The genetic driver of Acute Necrotizing Encephalopathy, RANBP2, regulates the inflammatory response to Influenza A virus infection

preprint OA: closed CC-BY-4.0
📄 Open PDF Full text JSON View at publisher
Full text 156,524 characters · extracted from preprint-html · click to expand
The genetic driver of Acute Necrotizing Encephalopathy, RANBP2, regulates the inflammatory response to Influenza A virus infection | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article The genetic driver of Acute Necrotizing Encephalopathy, RANBP2, regulates the inflammatory response to Influenza A virus infection Nathalie Arhel, Sophie Desgraupes, Suzon Perrin, Benoît Gouy, and 4 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6597157/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 06 Feb, 2026 Read the published version in Nature Communications → Version 1 posted You are reading this latest preprint version Abstract Influenza virus infections can cause severe complications such as Acute Necrotizing Encephalopathy (ANE), which is characterised by rapid onset pathological inflammation following febrile infection. Heterozygous dominant mutations in the nucleoporin RANBP2/Nup358 predispose to influenza-triggered ANE1. The aim of our study was to determine whether RANBP2 plays a role in IAV-triggered inflammatory responses. We found that the depletion of RANBP2 in a human airway epithelial cell line increased IAV genomic replication by favouring the import of the viral polymerase subunits, PB1, PB2 and PA, and promoted an abnormal accumulation of some viral segments in the cytoplasm. In human primary macrophages, this corroborated with an enhanced production of the pro-inflammatory chemokines CXCL8, CXCL10, CCL2, CCL3 and CCL4. Then, using CRISPR-Cas9 knock-in for the ANE1 disease variant RANBP2-T585M, we demonstrated that the point mutation is sufficient to drive CXCL10 expression following activation downstream of RIG-I and leads to a redistribution of RANBP2 away from the nuclear pore. Together, our results reveal that RANBP2 regulates influenza RNA replication and nuclear export, triggering hyper-inflammation, offering insight into ANE pathogenesis. Health sciences/Pathogenesis/Infection Health sciences/Pathogenesis/Inflammation Figures Figure 1 Figure 2 Figure 3 Figure 4 INTRODUCTION Influenza viral infections are responsible for seasonal epidemics with respiratory manifestations but can also lead to severe complications. Among these, Acute Necrotizing Encephalopathy (ANE), also called ANE of Childhood (ANEC), is a severe reaction to febrile infection that is characterized by rapid progression and very poor prognosis (Lee et al., 2023 ; Sakuma et al., 2025 ; Wu et al., 2015 ; Mizuguchi et al., 2007 ). Influenza viruses are thought to be responsible for ~ 50% of all ANE episodes and are associated with high morbidity and mortality (Bartolini et al., 2024 ; Jiang et al., 2022 ; Mizuguchi et al., 2007 ; Neilson et al., 2003 ; Chatur et al., 2022 ; Bashiri et al., 2020 ). Although the pathogenesis is unclear, a hyperinflammatory response triggered by the virus is proposed as the underlying mechanism (Levine et al., 2020 ; Mizuguchi et al., 2007 ; Sugaya, 2002 ), and early anti-inflammatory therapy may help mitigate the disease (Chatur et al., 2022 ; Koh et al., 2019 ; Okumura et al., 2009 ). Influenza viruses belong to the Orthomyxoviridae family and are classified into types, Influenza A and B being the most prevalent ones associated with seasonal flu cases. Influenza A is further divided into subtypes based on their surface glycoproteins, haemagglutinin (HA) and neuraminidase (NA). The H1N1 and H3N2 strains are responsible for major outbreaks and epidemics, and in the 2024–2025 winter season, there has been an unprecedented surge in H1N1 cases, leading to an unusual spike in hospitalizations and ANE in children (Bartolini et al., 2024 ). The Influenza A virus (IAV) is an enveloped particle containing 8 negative-sense single-stranded viral RNA (vRNA) gene segments, each packaged by nucleoprotein (NP) into a viral ribonucleoprotein (vRNP) complex, and associated with the viral polymerase complex (PB1, PB2, and PA). Unlike most RNA viruses, IAV replicates in the nucleus and hijacks the nuclear pore complex (NPC) machinery for four critical steps of its replication cycle. (i) After endocytosis and uncoating, vRNPs are trafficked to the nucleus where the viral polymerase transcribes the viral genome. (ii) Capped and polyadenylated mRNAs are exported into the cytoplasm for translation by cytoplasmic ribosomes. (iii) The newly translated viral proteins, including NP, PB1, PB2 and PA, are imported back into the nucleus, which allows the viral polymerase to replicate the viral genome into complementary RNAs (cRNA) and genomic vRNA. (iv) Lastly, new vRNPs, assembled with M1 and NS2/NEP, are exported back from the nucleus for incorporation into budding virions (Dou et al., 2018 ; Carter and Iqbal, 2024 ; Fodor and Te Velthuis, 2020 ; Zhu et al., 2023 ). Many viral and host factors are thought to contribute to severe influenza, and genetic susceptibility particularly in genes that regulate innate signalling and antiviral response, has been reported (Mettelman and Thomas, 2021 ; Clohisey and Baillie, 2019 ; Gounder and Boon, 2019 ). However, the mechanisms that drive severe influenza-triggered ANE in previously healthy children are not known. One clue to understanding the pathogenesis of influenza-associated ANE comes from genetic susceptibility in familial, recurrent cases, known as ANE1 (or ADANE) (Neilson et al., 2003 ). Patients with ANE1 present with autosomal dominant missense mutations in RANBP2 and have a significantly increased lifetime risk of developing ANE (Neilson et al., 2009). Mutations in RANBP2 increase the risk of relapse and recurrence (Levine et al., 2020 ; Chatur et al., 2022 ) and may associate with greater morbidity and mortality. RANBP2 (Nup358) is a cytoplasmic fibril (CF) nucleoporin that regulates nucleocytoplasmic transport by interacting with nuclear transport receptors such as Karyopherin α/β and CRM1/Exportin 1 (Yokoyama et al., 1995 ; Hutten et al., 2008 ). Additional functions have been attributed to RANBP2 at the NPC, many of which are linked to its C-terminal domain (CTD) E3 SUMO ligase activity, and away from the NPC, namely at annulate lamellae, mitochondria-endoplasmic reticulum junctions and in the nucleus (Desgraupes et al., 2023 ). Moreover, at least 4 protein isoforms have been identified for RANBP2, however, it is not known if these have distinct functions or subcellular localisations. The predominant ANE1-associated mutation (c.C1754T, p.T585M), and most other pathogenic mutations in RANBP2, all cluster in the N-terminal domain (NTD), which is responsible for anchoring to NPCs (Jiang et al., 2022 ; Joseph and Dasso, 2008 ). This suggests that the localization of RANBP2 to CF may be physiologically essential, although no changes in localisation could be demonstrated following the overexpression of disease variants (Shen et al., 2021 ; Bley et al., 2022 ). Previous work showed that RANBP2 can modulate viral infection of several viruses, such as Adenovirus (Carlon-Andres et al., 2020 ), Herpes simplex virus type 1 (HSV-1) (Copeland et al., 2009 ; Hofemeister and O’Hare, 2008 ) and Human immunodeficiency virus type 1 (HIV-1) (Bichel et al., 2013 ; Di Nunzio et al., 2012 ; Schaller et al., 2011 ; Zhang et al., 2010 ), however no work has uncovered a role for RANBP2 in Influenza virus infection. In fact, although some studies showed that NPC components can impact the replication and transcription of Influenza virus, such as Nup62, Nup98 and Nup153, RANBP2 was not identified as a host factor for Influenza virus (Khanna et al., 2024 ; Watanabe et al., 2010 ; Munier et al., 2013 ). Previous work also showed that RANBP2 can modulate innate immune signalling, however this activity was consistently attributed to its E3 SUMO ligase activity or Cyclophilin-homology motif in the CTD (Maarifi et al., 2018 ; Portilho et al., 2016 ; Shen et al., 2021 ; Li et al., 2023 ), and no work has yet demonstrated a role for the NTD where ANE1 mutations are clustered. The aim of our study was to determine how RANBP2 contributes to or regulates inflammatory responses to infection by Influenza virus. We show that RANBP2 impacts the replication of genomic vRNAs of IAV into cRNA by controlling the re-import of newly translated viral polymerase complex. Interestingly, RANBP2 also controls RNP export from the nucleus but in a segment-specific manner, only impacting the long segments encoding the PB1, PB2 and PA proteins, thus leading to their cytoplasmic accumulation and triggering hyper-inflammation, which could provide a first clue in understanding the pathogenesis of ANE. RESULTS Knockdown of RANBP2 stimulates non-productive Influenza vRNA replication in infected cells To investigate the role of RANBP2 in IAV infection, RANBP2-knockdown (RANBP2-KD) was induced in A549 human alveolar cells by lentiviral vector (LV) transduction before infection with A/WSN/1933(H1N1) virus at MOI 0.5. Supernatants were harvested at 10 h post-infection (hpi) to investigate the production of infectious viral particles by TCID50 titration. No differences were observed between the Control and RANBP2-KD cells, suggesting that RANBP2 had no effect on the production of infectious particles ( Fig. 1 A, Figure S1) . However, an unexpected phenotype was observed for viral RNA quantification in both A549 and the monocytic cell line THP-1. Infection kinetics were performed and viral RNA levels were determined at early (2 h) and late (6, 8, 16 and 24 h) time points using qPCR primers recognizing M1 on segment 7. In the monocytic cell line THP-1 ( Fig. 1 B ) and in A549 cells ( Fig. 1 C ) , a significant increase of M1 RNA was induced in RANBP2-KD cells. Although the change was most striking in THP-1 cells (40-fold), this led to considerable cell death and, therefore, A549 cells were preferred for further analysis. The increase in viral RNA was confirmed with another IAV segment, encoding the NP ( Fig. 1 D ) , and appeared to be specific since no increase was observed for any of the housekeeping genes that were measured ( Fig. 1 E ) . Together, these data suggested that RANBP2 is involved in controlling Influenza viral RNA synthesis but that this does not translate into increased productive infection. Because different types of viral RNAs are produced during the IAV life cycle, we investigated which RNAs are impacted by the depletion of RANBP2. Tagged RT primers were used to specifically recognize the negative-sense genomic vRNA sequence or the positive-sense cRNA sequence in order to specifically reverse transcribe (RT) each type of viral RNA (Figure S2A) . First, the specificity of each primer was validated by amplifying only vRNAs after vRNA-specific RT, or only cRNAs after cRNA-specific RT, while not amplifying any target in non-infected cells (Figure S2B) . In RANBP2-KD cells, we observed a significant increase of both vRNAs and cRNAs ( Fig. 1 F ) , thus showing that RANBP2 is involved in IAV RNA replication. Although this was unexpected given the absence of phenotype in terms of viral production, the marked increase in cRNA and vRNA levels suggested an enhancement in viral genome replication. Having observed an increase in genomic vRNAs, we tested if this correlated with more newly produced vRNPs. As previously, A549 cells were transduced with Control- or RANBP2-shRNAs then infected with IAV (MOI 0.5). At 8 hpi, the distribution of NP was investigated by immunofluorescence. Although export is ongoing in every condition, RANBP2-KD cells showed a striking increase in cytoplasmic NP ( Fig. 1 G and 1 H, Figure S3). In order to determine if signal corresponded to vRNPs or free NP in the cytoplasm, we performed co-stainings with other components of vRNPs (i.e. PB1 and PA). We observed a co-localisation of cytoplasmic NP with PB1 and with PA ( Fig. 1 I and 1 J, Figure S4) , showing that RANBP2-KD induces an increase in vRNPs exported to the cytoplasm. Increased IAV replication does not result from enhanced viral entry into cells or into the nucleus To determine how vRNA is increased in RANBP2-depleted cells, we first tested whether RANBP2 regulates IAV infection by modulating viral entry into cells and/or nuclei, thereby increasing the quantity of IAV RNA to be copied. To assess whether RANBP2 regulates cell or nuclear entry, Control or RANBP2-KD cells were infected with IAV (A/WSN/33) at MOI 4 in order to increase signal detection during early steps of the viral cycle, and NP localization was studied by immunofluorescence at 1 hpi to assess internalization, and at 2 h to monitor NP nuclear entry. Results indicate that depletion of RANBP2 from A549 cells affects neither internalization ( Fig. 1 K and 1 L ) nor nuclear import ( Fig. 1 M and 1 N ) . To further validate these findings, we adapted an Alpha-Centauri protein-complementation assay previously developed to monitor the nuclear import of HIV-1 (Fernandez et al., 2021 ). Briefly, the NanoLuc protein was expressed as two unequal non-luminescent fragments. The smaller fragment was fused to PB2 (called Alpha), while the larger fragment (Centauri) was fused to a NLS and expressed in A549 cells by lentiviral vector (LV) transduction ( Fig. 1 O, Figure S5A and S5B) . Upon vRNP nuclear import, the two fragments reconstitute a functional NanoLuc, generating a measurable signal upon addition of substrate (Figure S5C) . No significant differences in luminescence were detected between control and RANBP2-KD cells at 1 and 2 hpi, confirming that RANBP2 is not essential for vRNP nuclear import ( Fig. 1 P, Figure S5D) , thus demonstrating that RANBP2 does not regulate IAV vRNP nuclear import. RANBP2 Knockdown facilitates the nuclear import of the neo-synthesised viral polymerase complex proteins PB1, PB2 and PA Since RANBP2 does not impact the quantity of template available for replication, we investigated whether it modulates the quantity or transport of the polymerase complex subunits. First, the total levels of PB1, PB2, PA and NP were assessed by Western-Blot at 8 hpi, however, no differences were observed between RANBP2-KD cells and Control cells ( Fig. 2 A ) , suggesting that RANBP2 does not impact the translation of the viral polymerase complex. Being an NPC component, we hypothesised that RANBP2 may control the replication of vRNA by regulating the import of the viral polymerase. Therefore, we tested the impact of RANBP2 on the nuclear import of newly synthesised PB1, PB2, and PA subunits. To focus specifically on import, we inhibited vRNP export using a pharmacological inhibitor of CRM1, KPT-330/Selinexor. First, we confirmed that KPT-330 inhibits vRNP export in a dose-dependent manner (Figure S6A) , with negligible toxicity (Figure S6B) and that inhibition operates from 5 hpi onwards (Figure S6C) . Then we performed subcellular fractionation followed by Western blotting at 6 hpi to determine the localisation of the different polymerase subunits. Results revealed an increase in PB1, PB2 and PA protein levels in the nucleus, confirmed by the immunofluorescence detection of nuclear PB1, indicating that the import of the neo-synthesised polymerase is facilitated in the absence of RANBP2 ( Fig. 2 B and 2 C, Figure S7) . RANBP2 depletion disrupts the segment stoichiometry by selectively favouring the export of some vRNA segments to the cytoplasm Having determined that RANBP2 controls Influenza virus replication in the nucleus by regulating the import of the newly synthesised viral polymerase, we asked why the increase in vRNA and vRNP does not translate into an increased production of infectious particles ( Fig. 1 A ) . To address this, we performed strand-specific RT to distinguish vRNA and cRNA, as previously (Figure S2A) , then quantified the 8 IAV segments by qPCR to investigate segment stoichiometry ( Fig. 2 D, Figure S8A and S8B) . After sub-cellular fractionation, analysis of viral RNA localization revealed that, while cRNA levels increased for all influenza segments in the nucleus ( Fig. 2 E ) , segments 1, 2, 3, 7 and 8 exhibited increased vRNA export to the cytoplasm in the absence of RANBP2 compared to other segments ( Fig. 2 F ) . These findings indicate that, while the depletion of RANBP2 increases the replication of all vRNA segments, it disproportionately affects their export back to the cytoplasm. Taken together, our results indicated that the knockdown of RANBP2 greatly perturbs infection by IAV, first by facilitating the re-import of polymerase into the nucleus, which increases cRNA and vRNA, second by selectively favouring the export of some vRNA into the cytoplasm. The dysregulation of both these steps may cause an abnormal accumulation of some vRNA segments in the cytoplasm, thus constituting potential pathogen-associated molecular patterns (PAMPs) that may be sensed by the infected cell. RANBP2 knockdown exacerbates the inflammatory response to IAV infection in primary human macrophages In ANE1, it is thought that innate immune cells may contribute to the deleterious production of cytokines following IAV infection. To test this in relevant innate immune cells, primary monocytes were isolated from PBMCs from healthy donors and differentiated into pro-inflammatory M1-like macrophages. After 7 days of differentiation, primary monocyte-derived macrophages (MDM) were CD3- CD14 + CD16 + CD11b + HLA-DR + CD80- (Figure S9) . We first determined that IAV can infect MDMs (Figure S10A) , and stimulate an effective immune response without additional pre-stimulation, triggering the synthesis of pro-inflammatory cytokines such as IL-6 and IL-1β (Figure S10B) . MDM were then transduced with LVs coding for control or RANBP2 shRNA and infected with IAV (Figure S1) . The stimulation of innate immunity was initially assessed by qPCR detection of representative transcripts, namely CXCL10, IL-6, TNFα and IL-1β, comparing MDM with THP-1 and A549 cells. Although some cell-dependent changes were observed, the knockdown of RANBP2 led to a ~ 2-fold increase in IL-6, up to 6-fold increase in TNFα and IL-1β, and up to 50-fold increase in CXCL10 ( Fig. 3 A ) , suggesting that RANBP2 regulates the inflammatory response to IAV infection. To confirm this at the protein level, supernatants were collected at 24 hpi and the secretion of pro-inflammatory mediators was analysed by Multiplex Luminex assay. Strikingly, the knock-down of RANBP2 in primary macrophages led to an exacerbated inflammatory response to IAV infection, with a stronger induction of the pro-inflammatory chemokines CXCL8, CXCL10, CCL2, CCL3 and CCL4 ( Fig. 3 B ) . Together, these findings suggest that RANBP2 plays a critical role in modulating the inflammatory response to IAV infection by regulating vRNA replication, nucleocytoplasmic trafficking of viral polymerase subunits, and selective vRNA export. The abnormal accumulation of viral components in the cytoplasm amplifies inflammatory signalling, highlighting a potential mechanism underlying the pathogenesis of ANE. The RANBP2-T585M ANE1 variant drives hyper-inflammation following IAV infection Having identified the role of RANBP2 in controlling the IAV-triggered inflammation, we investigated if this function is compromised by the predominant ANE-associated mutation, c.C1754T, p.T585M. Heterozygous mutations in RANBP2 are associated with increased susceptibility to acute necrotizing encephalopathy, however it is not known how these affect protein function. In particular, previous work showed that ANE1 mutations do not alter the structure of RANBP2 (Bley et al., 2022 ), and that ectopically-expressed RANBP2-T585M still localises to the nuclear envelope (Bley et al., 2022 ; Shen et al., 2021 ). We introduced the predominant mutation (c.C1754T, p.T585M), by CRISPR-Cas9 knock-in of U2OS cells ( Fig. 4 A ) . A total of 47 clones were isolated after puromycin selection during 3 weeks. Mutations were confirmed by allelic qPCR ( Fig. 4 B, Figure S11A-S11C) , as previously described (Gouy et al., 2023 ), and by Sanger sequencing of the cDNA ( Fig. 4 C and 4 D ) . For many clones, we noted that CRISPR repair had occurred using the highly homologous RGPD sequences present on the same chromosome (Desgraupes et al., 2023 ), rather than the repair plasmid, therefore only clones that did not recombine with RGPD were selected (Figure S11B) . In total, two wild-type clones (C4 and C15, referred to as WT/WT), one heterozygously-mutated (C10, WT/C1754T) and three homozygously-mutated (C6, C9 and C14, C1754T/ C1754T) clones were isolated. CRISPR-knock-in clones were infected with IAV and activation of innate immune pathways was assessed by qPCR, normalised for house-keeping genes, as previously ( Fig. 3 A ) . IAV infection induced expression of CXCL10 and TNFα transcript expression in all clones. However, a striking phenotype emerged in cells homozygous for the RANBP2-T585M disease variant, where CXCL10 expression following IAV infection was exacerbated by a fold change of 1-2-log compared to WT or heterozygous clones ( Fig. 4 E ). A similar phenotype was observed upon transfection of the constitutively active caspase recruitment domain (2-CARD) of the retinoic acid-inducible gene I (RIG-I), which mimics viral RNA sensing (Maarifi et al., 2018 ), suggesting that the ANE1-associated variant amplifies innate immune responses to agonist stimulation. In CRISPR-Cas9 knock-in cells, RANBP2 mislocalises away from nuclear pores Although previous studies reported that ectopically expressed RANBP2-T585M localizes to the NPC (Bley et al., 2022 ; Shen et al., 2021 ), its localization has not been examined in genetically edited cell lines. We therefore examined the subcellular localisation of RANBP2 by immunofluorescence in the clones expressing RANBP2-T585M heterozygously and homozygously using a RANBP2-specific antibody recognising the CTD. As expected, RANBP2 localised to the nuclear envelope in WT clones. In contrast, all three clones homozygous for RANBP2-T585M lost the characteristic nuclear rim staining, indicating that the mutation disrupts RANBP2 retention at the nuclear envelope ( Fig. 4 F- 4 H ) . Despite this, nuclear pores appeared intact, since the labelling of FG-repeat Nups with the MAb414 antibody was comparable across all clones ( Fig. 4 F, Figure S12) . In conclusion, our findings suggest that RANBP2 localization at the nuclear envelope is critical to safeguard cells from the pathological inflammation following viral infection. In ANE1, mutations in the NTD of RANBP2 are specifically associated with hyperinflammation. DISCUSSION In this work, we show that the NPC component RANBP2 regulates the nucleocytoplasmic transport of Influenza A virus proteins and RNAs. Its absence from nuclear pores contributes to exacerbated viral replication in the nucleus, and a disproportionate increase in some viral RNAs. While previous work indicated that RANBP2 is a co-factor for the infection by some viruses (Bichel et al., 2013 ; Di Nunzio et al., 2012 ; Schaller et al., 2011 ; Zhang et al., 2010 ; Copeland et al., 2009 ; Hofemeister and O’Hare, 2008 ), this study reveals an opposite role in IAV infection, namely the restriction of key nuclear transport steps. RANBP2 can regulate the nucleocytoplasmic transport of macromolecules by two major mechanisms, first by regulating the cycle of Ran, second by interacting with nuclear transport receptors (Yokoyama et al., 1995 ; Hutten et al., 2008 ). The replication of IAV involves four distinct sequential NCT steps, namely the import of incoming vRNPs, the export of viral mRNAs, the import of translated viral proteins, and the export of vRNPs. RANBP2 was found to regulate only two of these steps, suggesting a specific mechanism. In particular, RANBP2 was not involved in the initial entry of incoming vRNPs into the nucleus, which involves the classical karyopherin α/β nuclear import pathway (Miyake et al., 2019 ; Nguyen et al., 2023 ; Dou et al., 2018 ), nor in the initial export of viral transcripts, which involves the general mRNA export pathway via NXF1:NXT1. Rather, RANBP2 acted on late nuclear transport steps of IAV, after translation of the viral proteins. First, RANBP2 was found to regulate the re-import of the polymerase complex subunits, which is known to involve different pathways, the best characterised being via the β-karyopherin RanBP5 (Huet et al., 2010 ; Hemerka et al., 2009 ; Cros et al., 2005 ). Second, results suggest that RANBP2 exerts a quality control checkpoint for vRNAs that are exported back to the cytoplasm, a step known to depend on the β-karyopherin CRM1 (Elton et al., 2001 ; Ma et al., 2001 ; Watanabe et al., 2001 ). Our results therefore suggest that RANBP2 may impact viral NCT by interacting with key β-karyopherins. Despite increased vRNA levels, infectious viral particle production did not increase. Our results indicated that the absence of RANBP2 disrupted the segment stoichiometry, leading to the disproportionate increase in the largest segments (1, 2, 3), and in segments that undergo splicing (7 and 8). Changes in segment stoichiometry could lead to packaging defects, however, the mechanism responsible for this imbalance in viral RNA export is not known. It is possible that the increase in vRNA corresponds to truncated RNA segments, especially since large deletions are frequent in the segments coding for PB1, PB2 and PA. After replication, Influenza viral genomic single stranded RNA molecules are sensed by RIG-I, which results in the production of pro-inflammatory cytokines downstream of NF-κB (Iwasaki and Pillai, 2014 ). In the absence of RANBP2, IAV infection led to a dramatic increase in the pro-inflammatory response, especially with the production of chemokines. We hypothesize that the disproportionate increase of some cRNA/vRNA segments in the cytoplasm could constitute PAMPs that exacerbate the inflammatory response. Influenza viruses are responsible for the majority of ANE1 cases in children. The high prevalence for Influenza over other respiratory infections (e.g., RSV, SARS-CoV-2) and childhood febrile illnesses (e.g., streptococcal infections) is puzzling and unexplained. Our work suggests that, by restraining key steps of IAV nucleocytoplasmic trafficking, RANBP2 is responsible for limiting the accumulation of viral PAMPs in the cytoplasm. Additionally, in CRISPR knock-in cells expressing the ANE1 disease variant, stimulation of innate immune signalling downstream of RIG-I led to a high expression of some pro-inflammatory transcripts, indicating that RANBP2 also regulates innate immune signalling. Although the prevalent phenotype was observed in homozygously edited cells, this is the first demonstration that ANE1 mutation is associated with exacerbated inflammation. This role of RANBP2 in controlling innate immunity is coherent with the symptoms observed in ANE1 patients as they express elevated levels of pro-inflammatory cytokines. It remains unclear how heterozygous dominant single point mutations in the NTD of RANBP2 contribute to disease. Previous work suggests that both wild-type and mutant alleles are expressed in patients (Gouy et al., 2023 ), suggesting that the mutant allele might have dominant negative activity. However, ANE1 mutations were shown not to affect protein structure, nor localisation at the NPC using ectopically-expressed RANBP2 (Bley et al., 2022 ; Shen et al., 2021 ). In CRISPR knock-in cells, we demonstrate that the T585M mutation in the NTD causes its redistribution away from the nuclear envelope. This change was only observed in homozygously-edited cells, suggesting that the mutation affects the ability of mutant-RANBP2 to anchor into the NPCs. Future work in patient samples will be essential to determine whether ANE1 mutations favour the accumulation of RANBP2 isoforms or truncated forms. MATERIALS & METHODS Viruses, lentiviral vectors and cells Infections with IAV were carried out with the H1N1/A/WSN/1933 strain in all experiments except for the Alpha-Centauri assay where this same strain was engineered to express a fragment of the NanoLuc (IAV-alpha) as described below. Lentiviral vectors (LV) were produced by transfecting HEK-293T cells in calcium phosphate with a pVSVg plasmid, an encapsidation Gag-Pol plasmid (p8.74) and the plasmid of interest (i.e. mCherry-shRNA-Control, mCherry-shRNA-RANBP2 or Centauri-NLuc-NLS) (see Table S1 for plasmid information). After 48 h, vectors were harvested and ultracentrifuged for 1 h at 22,000 rpm (Optima XE-90, Beckman Coulter) at 4°C. A549 cells (ATCC) and CRISPR U2OS clones (homemade) were cultured in Dulbecco's Modified Eagle Medium (DMEM, Gibco) containing 10% of Fetal bovine serum (FBS, Serana) and 1× penicillin/streptomycin (PS, Gibco) at 37°C with 5% CO2. THP-1 cells and monocyte-derived macrophages (MDM) were cultured in Roswell Park Memorial Institute (RPMI-1640, Gibco) medium containing 10% FBS and 1× of PS. IAV infections Cells were infected with IAV at MOI 0.5 in all experiments, except when monitory the early steps of the viral cycle (i.e. internalization, nuclear import), when MOI 4 was used to increase signal detection. Cells were exposed to IAV for 1 h in a small volume of 2% FBS culture medium to promote viral adsorption at the cell surface before replacing viral inoculum with warm culture medium and incubation at 37°C with 5% CO2. For experiments with NF-κB canonical pathway inhibition, cells were pre-treated with 2% FBS culture medium containing 20 µM of PS1145 (MedChemExpress) for 1 h at 37°C. RNA extractions and RTqPCR Intracellular RNAs were extracted using the RNeasy mini kit (Qiagen) according to the manufacturer’s protocol. RNA yields and purity were assessed by spectrophotometry (NanoDrop 2000c, Thermofisher Scientific). Unspecific reverse transcription (RT) was performed using the PrimeScript RT Reagent Kit (Perfect Real Time, Takara Bio Inc.) with random and polyT primers. IAV strand-specific RT was performed using tagged primers that bind either to the consensus 3’-end sequence of vRNAs (all 8 segments) or to the consensus 3’-end sequence of cRNAs (all 8 segments as well) with Superscript III (Invitrogen, Thermofisher Scientific) in the presence of DTT 0.1M (Invitrogen, Thermofisher Scientific), dNTP 10mM (Invitrogen, Thermofisher Scientific) and RNAsin (Promega). Distinction between segments was then made using specific qPCR primers ( Table S2 ). RANBP2-specific RT was performed using a primer (at 1µM) that binds to RANBP2 on a sequence absent from RGPDs, as published in (Gouy et al., 2023 ) PrimeScript RT Reagent Kit was used (Perfect Real Time, Takara Bio Inc.) ( Table S2 ). Real-time quantitative PCR was performed using the Power Up kit (Applied Biosystems, Thermofisher Scientific) on the ViiA7 thermocycler (Life technologies, Thermofisher Scientific). All qPCR primers are listed in Table S2 . Immunofluorescence Cells were washed with PBS and fixed with 4% paraformaldehyde (PFA, Thermofisher Scientific) for 10 min at room temperature (R/T). After 3 PBS washes, remaining PFA was neutralized with PBS containing 50mM of NH4Cl for 10 min at R/T. After 2 PBS washes, cells were permeabilized using PBS containing 0.5% of Triton-100X (Sigma-Aldrich) for 15 min at R/T. Cells were washed twice in PBS and saturated in PBS supplemented with 2% of Normal goat serum (NGS, Invitrogen, Thermofisher Scientific). Primary stainings were performed for 1h at R/T with antibodies listed in Table S3 . Cells were washed 5 times with PBS and secondary antibodies were added for 30 min at R/T ( Table S3 ). After 5 PBS washes, cells were stained with Hoechst (Thermofisher Scientific) diluted to the 1/10,000 in PBS for 5 min at R/T. Cells were washed 5 times with PBS and mounted in Prolong Diamond anti-fade mounting medium (Invitrogen, Thermofisher Scientific). Imaging was carried out using the Confocal Zeiss LSM880 Airyscan microscope of the Montpellier Ressources Imagerie (MRI) platform. Image processing and quantifications were done using the Fiji software (2.14.0): Alexafluor-488 staining of the NP was changed to the color « Orange Hot » for aesthetic purposes and brightness was increased uniformly in all conditions. Full panels of images are provided in supplementary data. Alpha-Centauri assay Cloning steps. A DNA fragment coding for αNluc (GVTGWRLCERILA) flanked by NotI and NheI overhangs was obtained by annealing two overlapping oligonucleotides: NotI-αNLuc-NheI-F GGCCGCAGGGGGAGTGACAGGGTGGAGACTATGCGAAAGAATACTTGCATAAG NotI-αNLuc-NheI-R CTAGCTTATGCAAGTATTCTTTCGCATAGTCTCCACCCTGTCACTCCCCCTGC The reverse genetics plasmid pPolI-SL-PB2-αNluc was obtained by subcloning this restriction fragment between the NotI and NheI sites of the pPolI-SL-PB2-Nanoluc described in Diot 2016. Particle production by reverse genetics. The eight pPolI-WSN-PB2-αNluc, -PB1, -PA, -HA, -NP, -NA, -NS, -M, and four pcDNA3.1-WSN-PB2, -PB1, -PA, -NP plasmids (0.5 µg of each) were co-transfected into a co-culture of 293T and MDCK cells (seeded in a 6-well plate at 4 × 10 5 and 3 × 10 5 cells, respectively) using 10 µL of FuGENE® HD transfection reagent (Promega). After 24 h of incubation at 35°C, cells were washed twice with DMEM and incubated in DMEM containing 1 µg/mL of TPCK-treated trypsin for 48 h. The reverse genetics supernatant was titrated on MDCK by plaque assay and the recombinant PB2-αNluc virus was amplified at an MOI of 10 − 4 on MDCK cells for 3 days at 35°C. The viral stock was titrated on MDCK by plaque assays and sequenced to verify the presence of the αNluc coding sequence. Cells were transduced with LV Centauri-NLuc-NLS for 3 days, then with LV shRNA-Control or LV shRNA-RANBP2 at MOI 15 for 4 days. Cells were then infected with IAV-α at MOI 4 for the indicated times. NanoGlo live cell substrate (Promega) was added and luminescence was measured with the Infinite M Plex spectrophotometer (Tecan). Nucleo-cytoplasmic fractionation Nuclear and cytoplasmic fractions were separated using the NE-PER Kit (Thermofisher Scientific) according to the manufacturer’s protocol. Briefly, 1–2 million cells were washed with PBS then lysed in cold CER I buffer, vortexed 15 seconds and incubated on ice for 10 min. Cold CER II buffer was then added and cells were vortexed 5 seconds then incubated on ice for 1 min. After 5 second vortex and full speed centrifugation, supernatants (cytoplasmic fraction) were harvested and stored at -80°C. Pellets (nuclei) were resuspended in cold NER buffer and 4 cycles of 15 second vortex then 10-min incubation on ice were performed. After full speed centrifugation, supernatants (nuclear fraction) were harvested and stored at -80°C. Western blot Cell lysates were sonicated for 20 cycles of 30 seconds ON, 30 seconds OFF (Bioruptor Pico, Diagenode) and 4X Laemmli (250 mM Tris-HCl pH 7, 8% sodium dodecyl sulphate (SDS), 40% glycerol, 10% β-mercaptoethanol and 0.005% bromophenol blue) was added. After denaturation at 95°C for 5 min, samples underwent SDS polyacrylamide gel electrophoresis (SureCast Gel Handcast System, Thermo Fisher Scientific) and were transferred on a 0.45 µm nitrocellulose membrane (Sigma Aldrich). Membranes were saturated in PBS containing 0.05% Tween 20 (Sigma) and 10% milk powder for 30 min. Primary antibodies were added and left overnight at 4°C ( Table S3 ). After 3 PBS washes, secondary antibodies were added for 1 h at R/T ( Table S3 ). Protein revelation was carried out by measuring HRP activity (Immobilon Forte Western HRP substrate, Merck) with a Chemidoc imager (Biorad). TCID50 assay MDCK cells were washed in FBS-free MEM medium (Gibco) and serially diluted cell supernatants were added in 2% FBS in octoplicates. After 3 days at 37°C and 5% CO2, cells were washed twice in PBS and fixed with 4% PFA for 10 min at R/T. Violet crystal was added, washed twice in water and cytopathic effect was observed. The TCID50 titer was determined using the formula: log10 (TCID50/mL) = x0 - (d/2) + (d*xi/n) + ν x0: decimal logarithm of initial dilution factor. d: decimal logarithm of serial dilution factor. xi: score of positive events. n: number of replicates. ν: decimal logarithm of the inoculum volume (mL). Peripheral blood mononuclear cell (PBMC) isolation Buffy coats from healthy donors were obtained from the Établissement Français du Sang (EFS). Whole blood was diluted by half with Phosphate buffered saline (PBS) and loaded on an equivalent volume of Lymphoprep (Stemcell technologies) at R/T. Tubes were centrifuged at 800g for 30 min at 20°C without brakes. The PBMC ring was collected using a 5 mL pipet and washed 3 times in a final volume of 50 mL of PBS (centrifugations at 1200 rpm for 5 min at 20°C with brakes on). The cell pellet was resuspended in 30 mL of 10% FBS RPMI-1640 medium. PBMCs were counted manually using counting chambers (Kova). Monocyte-derived macrophages differentiation After PBMC isolation, 20 million cells were seeded per well into 6-well plates and incubated for 45 min, at 37°C with 5% CO2. After monocyte adherence, cells were washed 3 times with 10% FBS RPMI-1640 medium directly on the cell layers to remove non-attached cells. For monocyte-derived macrophage (MDM) differentiation, monocytes were cultured in 10% FBS RPMI-1640 medium containing GM-CSF (50 ng/mL, Gentaur) for 8 days. Flow cytometry phenotyping After 8 days of MDM differentiation, phenotypic markers were analysed by flow cytometry on a Fortessa using the following antibodies: CD3-BV421 (clone UCHT1, Biolegend 300433), CD14-PerCP-Cy5.5 (clone HCD14, Biolegend 325621), CD16-Alexa700 (clone 3G8, Biolegend 302026), CD11b-APC-Cy7 (clone M1/70, Biolegend 101225), HLA-DR-FITC (REA805, Miltenyi 130-111-941), and CD80-BV650 (clone 2D10, Biolegend 305227). Multiplex LUMINEX assay The presence of mediators of inflammation was assessed in supernatants of stimulated cells using the ProcartaPlex Human inflammation Panel 20-plex kit (Invitrogen, ThermoFisher Scientific). A few samples were centrifuged and diluted to the 1/10 or to the 1/50 in order to determine optimal dilution for the experiment. Dilution to the 1/50 was chosen to detect the strongly induced mediators (e.g. IL-8) in the range of the standard curves supplied in the kit. Buffers and standards were prepared according to the manufacturer’s protocol. Briefly, Capture Bead mix was vortexed and added to the plate, washed in Wash buffer, then samples and standards were added. The plate was incubated 1 h at R/T on a shaker. After 2 washes, Biotinylated Detection Antibody mix was added for 30 min at R/T on a shaker. After 2 washes, Streptavidin-PE was added for 30 min at R/T on a shaker. After 2 more washes, the plate was read on the MAGPIX flow cytometer (LUMINEX). Establishment of U2OS clones expressing RANBP2 T585M by CRISPR knock-in The plasmid pUcIDT Amp (synthetized by Integrated DNA Technologies) containing the donor sequences (see below) and the plasmid pSpCas9(BB)-2A-Puro (PX459) (Addgene #62988) modified to contain the guide sequences (GGCAGAATGCCTTCAGAAAA) were co-transfected at equal quantity in the human osteosarcoma cell lines U2OS using Lipofectamine 3000 (Invitrogen, ThermoFisher Scientific) following the manufacturer’s instructions. Two days post-transfection, cells were selected using puromycin (Gibco) at 2µg/ml during four days. The different clones were established by limiting dilution. A total of 198 cells were split in 576 different wells containing 10% FBS DMEM medium. After 3 weeks, 47 clones were established and analyzed by RANBP2-specific RTqPCR as describe above and Sanger sequencing (Eurofins). Donor DNA sequence : (GCGGTTTGTACTCTGATTCACAGAAAAGCAGTgtaagtagtaaaacaaaaatattgctttcacttagtgcgtaggttttaccggggatttaatcctcatgtg aagatttaatttgtcatgtgacccattaacatatatgtatgtaagccctgaactgtgtatttagaaagcaattttagtaaattgaactattttttagACCTGGAAACGTAGCAAA ATTGAGACTTCTAGTTCAGCATGAAATAAACACTCTAAGAGCCCAGGAAAAACATGGCCTTCAACCTGCTCTGC TTGTACATTGGGCAGA g TG t CT g CAGAAAA t Ggtgagttttaaagtataagcatttttaaagaacattaccttaattttttaaaatcatgaactttttattgaaagtttt tttgttctgaaaacagcagcttggtcacattatgacagatgtgttttttattgctgcaaaatagttaatgtagttaaatataagcacttagaggagcaatgcctggcacacagtgaatgttacat attagctgagctgttactgttattccttaataattaagttctgataattattcagcctgaaaattaaaaaaa) Capital letters: exon lowercase: intron underlined: mutations Bold lowercase: C1754T mutation Generation of homozygous/heterozygous RANBP2-expressing control cells for allelic qPCR HEK-293T cells were transfected with plasmids encoding the mCherry-RanBP2-shRNA and either GFP-RANBP2-WT, GFP-RANBP2-T585M or both ( Table S1 ) in calcium phosphate. After 48 h of culture, cells were detached using trypsin (Gibco) and sorted on the ARIA IIu cytometer (Becton Dickinson) of the MRI platform to isolate the mCherry-positive cells. Sorted cells were lyzed and total RNAs were extracted using the RNeasy mini kit (Qiagen) according to the manufacturer’s protocol. Statistical analysis Statistical analysis was performed using the GraphPad Prism software (10.2.3). Declarations ACKNOWLEDGMENTS This work was financed by grants from the Agence Nationale de la Recherche (ANR-23-CE15-0005-01) and ANRS-MIE (ECTZ209411). We thank Marion Cannac (Université de Montpellier, France) for help with phenotyping primary macrophages, and Montpellier Ressources Imagerie (MRI) for support with flow cytometry, cell sorting and imaging. We thank Rick Wozniak (University of Alberta, Canada) for the kind gift of RANBP2-specific antibody, Jomon Joseph (National Center for Cell Science, Pune, India) for the GFP-RANBP2 construct, and Sébastien Nisole (INSERM) for the GFP-RANBP2-T585M construct. References Bartolini L, Ricci S, Azzari C, Moriondo M, Nieddu F, L’Erario M, Ricci Z, Simonini G, Mortilla M, Indolfi G, Montagnani C, Chiappini E, Galli L, Guerrini R (2024) Severe A(H1N1)pdm09 influenza acute encephalopathy outbreak in children in Tuscany, Italy, December 2023 to January 2024. Eurosurveillance 29. 10.2807/1560-7917.ES.2024.29.17.2400199 Bashiri FA, Al Johani S, Hamad MH, Kentab AY, Alwadei AH, Hundallah K, Hasan HH, Alshuaibi W, Jad L, Alrifai MT, Hudairi A, Al Sheikh R, Alenizi A, Alharthi NA, Abdelmagid TA, Ba-Armah D, Salih MA, Tabarki B (2020) Acute Necrotizing Encephalopathy of Childhood: A Multicenter Experience in Saudi Arabia. Front Pediatr 8:526. 10.3389/fped.2020.00526 Bichel K, Price AJ, Schaller T, Towers GJ, Freund SM, James LC (2013) HIV-1 capsid undergoes coupled binding and isomerization by the nuclear pore protein NUP358. Retrovirology . 10:81. 10.1186/1742-4690-10-81 Bley CJ, Nie S, Mobbs GW, Petrovic S, Gres AT, Liu X, Mukherjee S, Harvey S, Huber FM, Lin DH, Brown B, Tang AW, Rundlet EJ, Correia AR, Chen S, Regmi SG, Stevens TA, Jette CA, Dasso M, Patke A, Palazzo AF, Kossiakoff AA, Hoelz A (2022) Architecture of the cytoplasmic face of the nuclear pore. Science 376:eabm9129. 10.1126/science.abm9129 Carlon-Andres I, Lagadec F, Pied N, Rayne F, Lafon M-E, Kehlenbach RH, Wodrich H (2020) Nup358 and Transportin 1 Cooperate in Adenoviral Genome Import. J Virol 94:e00164–e00120. 10.1128/JVI.00164-20 Carter T, Iqbal M (2024) The Influenza A Virus Replication Cycle: A Comprehensive Review. Viruses 16:316. 10.3390/v16020316 Chatur N, Yea C, Ertl-Wagner B, Yeh EA (2022) Outcomes in influenza and RANBP2 mutation‐associated acute necrotizing encephalopathy of childhood. Dev Med Child Neurol 64:1008–1016. 10.1111/dmcn.15165 Clohisey S, Baillie JK (2019) Host susceptibility to severe influenza A virus infection. Crit Care 23:303. 10.1186/s13054-019-2566-7 Copeland AM, Newcomb WW, Brown JC (2009) Herpes Simplex Virus Replication: Roles of Viral Proteins and Nucleoporins in Capsid-Nucleus Attachment. J Virol 83:1660–1668. 10.1128/JVI.01139-08 Cros JF, García-Sastre A, Palese P (2005) An Unconventional NLS is Critical for the Nuclear Import of the Influenza A Virus Nucleoprotein and Ribonucleoprotein. Traffic 6:205–213. 10.1111/j.1600-0854.2005.00263.x Desgraupes S, Etienne L, Arhel NJ (2023) RANBP2 evolution and human disease. FEBS Lett 597:2519–2533. 10.1002/1873-3468.14749 Di Nunzio F, Danckaert A, Fricke T, Perez P, Fernandez J, Perret E, Roux P, Shorte S, Charneau P, Diaz-Griffero F, Arhel NJ (2012) Human Nucleoporins Promote HIV-1 Docking at the Nuclear Pore, Nuclear Import and Integration. PLoS ONE 7:e46037. 10.1371/journal.pone.0046037 Dou D, Revol R, Östbye H, Wang H, Daniels R (2018) Influenza A Virus Cell Entry, Replication, Virion Assembly and Movement. Front Immunol 9:1581. 10.3389/fimmu.2018.01581 Elton D, Simpson-Holley M, Archer K, Medcalf L, Hallam R, McCauley J, Digard P (2001) Interaction of the Influenza Virus Nucleoprotein with the Cellular CRM1-Mediated Nuclear Export Pathway. J Virol 75:408–419. 10.1128/JVI.75.1.408-419.2001 Fernandez J, Hassen-Khodja C, Georget V, Rose T, Jacob Y, Janin YL, Nisole S, Vidalain P-O, Arhel NJ (2021) Measuring the subcellular compartmentalization of viral infections by protein complementation assay. Proc. Natl. Acad. Sci. 118:e2010524118. 10.1073/pnas.2010524118 Fodor E, Te Velthuis AJW (2020) Structure and Function of the Influenza Virus Transcription and Replication Machinery. Cold Spring Harb Perspect Med 10:a038398. 10.1101/cshperspect.a038398 Gounder AP, Boon ACM (2019) Influenza Pathogenesis: The Effect of Host Factors on Severity of Disease. J Immunol Baltim Md 1950 202:341–350. 10.4049/jimmunol.1801010 Gouy B, Decorsière A, Desgraupes S, Duan W, Ouyang H, Wang YE, Yeh EA, Palazzo AF, Moraes TJ, Nisole S, Arhel NJ (2023) Rapid and inexpensive bedside diagnosis of RAN binding protein 2-associated acute necrotizing encephalopathy. Front Neurol 14:1282059. 10.3389/fneur.2023.1282059 Hemerka JN, Wang D, Weng Y, Lu W, Kaushik RS, Jin J, Harmon AF, Li F (2009) Detection and Characterization of Influenza A Virus PA-PB2 Interaction through a Bimolecular Fluorescence Complementation Assay. J Virol 83:3944–3955. 10.1128/JVI.02300-08 Hofemeister H, O’Hare P (2008) Nuclear pore composition and gating in herpes simplex virus-infected cells. J Virol 82:8392–8399. 10.1128/JVI.00951-08 Huet S, Avilov SV, Ferbitz L, Daigle N, Cusack S, Ellenberg J (2010) Nuclear Import and Assembly of Influenza A Virus RNA Polymerase Studied in Live Cells by Fluorescence Cross-Correlation Spectroscopy. J Virol 84:1254–1264. 10.1128/JVI.01533-09 Hutten S, Flotho A, Melchior F, Kehlenbach RH (2008) The Nup358-RanGAP Complex Is Required for Efficient Importin α/β-dependent Nuclear Import. Mol Biol Cell 19:2300–2310. 10.1091/mbc.e07-12-1279 Iwasaki A, Pillai PS (2014) Innate immunity to influenza virus infection. Nat Rev Immunol 14:315–328. 10.1038/nri3665 Jiang J, Wang YE, Palazzo AF, Shen Q (2022) Roles of Nucleoporin RanBP2/Nup358 in Acute Necrotizing Encephalopathy Type 1 (ANE1) and Viral Infection. Int J Mol Sci 23:3548. 10.3390/ijms23073548 Joseph J, Dasso M (2008) The nucleoporin Nup358 associates with and regulates interphase microtubules. FEBS Lett 582:190–196. 10.1016/j.febslet.2007.11.087 Khanna M, Sharma K, Saxena SK, Sharma JG, Rajput R, Kumar B (2024) Unravelling the interaction between Influenza virus and the nuclear pore complex: insights into viral replication and host immune response. VirusDisease 35:231–242. 10.1007/s13337-024-00879-6 Koh JC, Murugasu A, Krishnappa J, Thomas T (2019) Favorable Outcomes With Early Interleukin 6 Receptor Blockade in Severe Acute Necrotizing Encephalopathy of Childhood. Pediatr Neurol 98:80–84. 10.1016/j.pediatrneurol.2019.04.009 Lee VWM, Khoo TB, Teh CM, Heng HS, Li L, Yusof YLM, Yahaya NA, Dharshini S, Wong SW, Nickson T, ANE Malaysia Outcome Study Group (2023) Factors associated with outcomes of severe acute necrotizing encephalopathy: A multicentre experience in Malaysia. Dev Med Child Neurol 65:1256–1263. 10.1111/dmcn.15536 Levine JM, Ahsan N, Ho E, Santoro JD (2020) Genetic Acute Necrotizing Encephalopathy Associated with RANBP2: Clinical and Therapeutic Implications in Pediatrics. Mult Scler Relat Disord 43:102194. 10.1016/j.msard.2020.102194 Li J, Su L, Jiang J, Wang YE, Ling Y, Qiu Y, Yu H, Huang Y, Wu J, Jiang S, Zhang T, Palazzo AF, Shen Q (2023) RanBP2/Nup358 Mediates Sumoylation of STAT1 and Antagonizes Interferon-α-Mediated Antiviral Innate Immunity. Int J Mol Sci 25:299. 10.3390/ijms25010299 Ma K, Roy A-MM, Whittaker GR (2001) Nuclear Export of Influenza Virus Ribonucleoproteins: Identification of an Export Intermediate at the Nuclear Periphery. Virology 282:215–220. 10.1006/viro.2001.0833 Maarifi G, Fernandez J, Portilho DM, Boulay A, Dutrieux J, Oddos S, Butler-Browne G, Nisole S, Arhel NJ (2018) RanBP2 regulates the anti-retroviral activity of TRIM5α by SUMOylation at a predicted phosphorylated SUMOylation motif. Commun Biol 1:193. 10.1038/s42003-018-0198-0 Mettelman RC, Thomas PG (2021) Human Susceptibility to Influenza Infection and Severe Disease. Cold Spring Harb Perspect Med 11:a038711. 10.1101/cshperspect.a038711 Miyake Y, Keusch JJ, Decamps L, Ho-Xuan H, Iketani S, Gut H, Kutay U, Helenius A, Yamauchi Y (2019) Influenza virus uses transportin 1 for vRNP debundling during cell entry. Nat Microbiol 4:578–586. 10.1038/s41564-018-0332-2 Mizuguchi M, Yamanouchi H, Ichiyama T, Shiomi M (2007) Acute encephalopathy associated with influenza and other viral infections. Acta Neurol Scand 115:45–56. 10.1111/j.1600-0404.2007.00809.x Munier S, Rolland T, Diot C, Jacob Y, Naffakh N (2013) Exploration of Binary Virus–Host Interactions Using an Infectious Protein Complementation Assay. Mol Cell Proteom 12:2845–2855. 10.1074/mcp.M113.028688 Neilson DE, Eiben RM, Waniewski S, Hoppel CL, Varnes ME, Bangert BA, Wiznitzer M, Warman ML, Kerr DS (2003) Autosomal dominant acute necrotizing encephalopathy. Neurology 61:226–230. 10.1212/01.WNL.0000073544.28775.1A Nguyen NLT, Wu W, Panté N (2023) Contribution of the Nuclear Localization Sequences of Influenza A Nucleoprotein to the Nuclear Import of the Influenza Genome in Infected Cells. Viruses 15:1641. 10.3390/v15081641 Okumura A, Mizuguchi M, Kidokoro H, Tanaka M, Abe S, Hosoya M, Aiba H, Maegaki Y, Yamamoto H, Tanabe T, Noda E, Imataka G, Kurahashi H (2009) Outcome of acute necrotizing encephalopathy in relation to treatment with corticosteroids and gammaglobulin. Brain Dev 31:221–227. 10.1016/j.braindev.2008.03.005 Portilho DM, Fernandez J, Ringeard M, Machado AK, Boulay A, Mayer M, Müller-Trutwin M, Beignon A-S, Kirchhoff F, Nisole S, Arhel NJ (2016) Endogenous TRIM5α Function Is Regulated by SUMOylation and Nuclear Sequestration for Efficient Innate Sensing in Dendritic Cells. Cell Rep 14:355–369. 10.1016/j.celrep.2015.12.039 Sakuma H, Thomas T, Debinski C, Eyre M, Han VX, Jones HF, Kawano G, Lee VW, Malone S, Matsuishi T, Mohammad SS, Mori T, Nishida H, Nosadini M, Takanashi J-I, Mizuguchi M, Lim M, Dale RC (2025) International consensus definitions for infection-triggered encephalopathy syndromes. Dev Med Child Neurol 67:195–207. 10.1111/dmcn.16067 Schaller T, Ocwieja KE, Rasaiyaah J, Price AJ, Brady TL, Roth SL, Hué S, Fletcher AJ, Lee K, KewalRamani VN, Noursadeghi M, Jenner RG, James LC, Bushman FD, Towers GJ (2011) HIV-1 Capsid-Cyclophilin Interactions Determine Nuclear Import Pathway, Integration Targeting and Replication Efficiency. PLOS Pathog 7:e1002439. 10.1371/journal.ppat.1002439 Shen Q, Wang YE, Truong M, Mahadevan K, Wu JJ, Zhang H, Li J, Smith HW, Smibert CA, Palazzo AF (2021) RanBP2/Nup358 enhances miRNA activity by sumoylating Argonautes. PLOS Genet 17:e1009378. 10.1371/journal.pgen.1009378 Sugaya N (2002) Influenza-associated encephalopathy in Japan. Semin Pediatr Infect Dis 13:79–84. 10.1053/spid.2002.122993 Watanabe K, Takizawa N, Katoh M, Hoshida K, Kobayashi N, Nagata K (2001) Inhibition of nuclear export of ribonucleoprotein complexes of influenza virus by leptomycin B. Virus Res 77:31–42. 10.1016/S0168-1702(01)00263-5 Watanabe T, Watanabe S, Kawaoka Y (2010) Cellular Networks Involved in the Influenza Virus Life Cycle. Cell Host Microbe 7:427–439. 10.1016/j.chom.2010.05.008 Wu J, Matunis MJ, Kraemer D, Blobel G, Coutavas E (1995) Nup358, a Cytoplasmically Exposed Nucleoporin with Peptide Repeats, Ran-GTP Binding Sites, Zinc Fingers, a Cyclophilin A Homologous Domain, and a Leucine-rich Region. J Biol Chem 270:14209–14213. 10.1074/jbc.270.23.14209 Wu X, Wu W, Pan W, Wu L, Liu K, Zhang H-L (2015) Acute Necrotizing Encephalopathy: An Underrecognized Clinicoradiologic Disorder. Mediators Inflamm. 2015:792578. 10.1155/2015/792578 Yokoyama N, Hayashi N, Seki T, Panté N, Ohba T, Nishii K, Kuma K, Hayashida T, Miyata T, Aebi U, Fukui M, Nishimoto T (1995) A giant nucleopore protein that binds Ran/TC4. Nature 376:184–188. 10.1038/376184a0 Zhang R, Mehla R, Chauhan A (2010) Perturbation of Host Nuclear Membrane Component RanBP2 Impairs the Nuclear Import of Human Immunodeficiency Virus – 1 Preintegration Complex (DNA). PLoS ONE 5:e15620. 10.1371/journal.pone.0015620 Zhu Z, Fodor E, Keown JR (2023) A structural understanding of influenza virus genome replication. Trends Microbiol 31:308–319. 10.1016/j.tim.2022.09.015 Additional Declarations There is NO Competing Interest. Supplementary Files DesgraupesFiguresv4min.pdf DesgraupesTablesv4.pdf SUPPLEMENTARYLEGENDS.docx Cite Share Download PDF Status: Published Journal Publication published 06 Feb, 2026 Read the published version in Nature Communications → Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-6597157","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":456355562,"identity":"2935d6da-c259-401e-a7be-280545a7eb1a","order_by":0,"name":"Nathalie Arhel","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABDElEQVRIie3OMUvDQBTA8RcCL4MXbn0hwX6FFwSjIParXAjEVXDpZDPFJd39GHVzjBScrFkFQQKFTA6OLXTwFBIqTQQ3h/tP4S6/ew/AZPqfIcAltR9nAuz2wi4HhK3/5JZwukNQ/UbacbzYHd9PIqd6rNd8cgjOsqk/uAqimwMFm/u3MaBb95HTInHCgukIxEUU3vKrCBbu3Jo9XcUZOtxHuEyQBFOcQYq+0IRsd25buVIwynsX42qF3pZpmskG/S0/d0Qvhv3kJfl6nBSQnqKHdsTKBsnq2A+Ywpwa9ApOvsnDLFdxPkSquPHeJ9cjKVOk9eR8THJ5V2/0YnKAdP24LvdOTCaTyfSnPgFm4UkKbqMMRQAAAABJRU5ErkJggg==","orcid":"https://orcid.org/0000-0001-5309-1725","institution":"Institut de Recherche en Infectiologie de Montpellier","correspondingAuthor":true,"prefix":"","firstName":"Nathalie","middleName":"","lastName":"Arhel","suffix":""},{"id":456355563,"identity":"d79db2b2-13af-4bfa-91de-547a2dd04e7f","order_by":1,"name":"Sophie Desgraupes","email":"","orcid":"","institution":"Institut de Recherche en Infectiologie de Montpellier","correspondingAuthor":false,"prefix":"","firstName":"Sophie","middleName":"","lastName":"Desgraupes","suffix":""},{"id":456355564,"identity":"f11ec4bd-2bf4-4b95-8528-98f4cc6a52d3","order_by":2,"name":"Suzon Perrin","email":"","orcid":"","institution":"Institut de Recherche en Infectiologie de Montpellier","correspondingAuthor":false,"prefix":"","firstName":"Suzon","middleName":"","lastName":"Perrin","suffix":""},{"id":456355565,"identity":"f5ebb338-a4d9-4fff-bd8a-32de7c65e168","order_by":3,"name":"Benoît Gouy","email":"","orcid":"","institution":"Institut de Recherche en Infectiologie de Montpellier","correspondingAuthor":false,"prefix":"","firstName":"Benoît","middleName":"","lastName":"Gouy","suffix":""},{"id":456355566,"identity":"539dbff5-eeba-495f-bb96-f83cab1d73db","order_by":4,"name":"Adrien Decorsière","email":"","orcid":"","institution":"Institut de Recherche en Infectiologie de Montpellier","correspondingAuthor":false,"prefix":"","firstName":"Adrien","middleName":"","lastName":"Decorsière","suffix":""},{"id":456355567,"identity":"ebdaafd2-a557-4489-b0f6-efb377f00814","order_by":5,"name":"Yifan Wang","email":"","orcid":"","institution":"University of Toronto","correspondingAuthor":false,"prefix":"","firstName":"Yifan","middleName":"","lastName":"Wang","suffix":""},{"id":456355568,"identity":"abd1a0aa-02d8-4281-b0df-e314d2d51ff2","order_by":6,"name":"Alexander Palazzo","email":"","orcid":"https://orcid.org/0000-0002-9700-1995","institution":"University of Toronto","correspondingAuthor":false,"prefix":"","firstName":"Alexander","middleName":"","lastName":"Palazzo","suffix":""},{"id":456355569,"identity":"ebb21a44-3da1-40c9-ba09-061aaea81b38","order_by":7,"name":"Sandie Munier","email":"","orcid":"","institution":"Institut Pasteur","correspondingAuthor":false,"prefix":"","firstName":"Sandie","middleName":"","lastName":"Munier","suffix":""}],"badges":[],"createdAt":"2025-05-05 20:15:07","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-6597157/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-6597157/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1038/s41467-026-69288-1","type":"published","date":"2026-02-06T05:00:00+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":82805257,"identity":"7cddcf65-c91d-4200-97b1-8f01606e0744","added_by":"auto","created_at":"2025-05-15 12:19:41","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":2103961,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eKnockdown of RANBP2 stimulates non-productive Influenza vRNA replication in infected cells without altering the initial vRNP import into the nucleus.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(A) \u003c/strong\u003eA549 cells were transduced with LV shRNA-Control or shRANBP2, and infected with influenza A virus (IAV) (A/WSN/1933) at MOI 0.5. RANBP2 transcripts were quantified by RT-qPCR and normalized on RPL13a housekeeping gene and on the control condition. Supernatants were harvested at 10h post-infection and viral titers were determined by TCID50 assay on MDCK cells. Results represent mean values +/- SD. \u003cstrong\u003e(B) \u003c/strong\u003eA549 cells or \u003cstrong\u003e(C)\u003c/strong\u003e THP-1 cells were transduced with LV shRNA-Control or -RANBP2 or not transduced (NTD) then infected with influenza A virus (A/WSN/1933) at MOI 0.5. At the indicated time points, cells were lysed and total intracellular RNAs were extracted. Viral RNAs encoding the Matrix 1 (M1) protein were amplified by RTqPCR. \u003cstrong\u003e(D)\u003c/strong\u003eNucleoprotein-encoding (NP) viral RNAs were amplified by RTqPCR in the A549 infected cells. Results from B-C-D are normalized on a housekeeping gene and on the control condition. Results are presented as mean +/- SD.\u003cstrong\u003e (E) \u003c/strong\u003eHousekeeping gene expression was not affected by the knock down. \u003cstrong\u003e(F)\u003c/strong\u003e Transduced A549 cells were infected at MOI 0.5 and total intracellular RNAs were extracted at 6h post-infection. Strand-specific reverse transcription (RT) was performed with tagged-primers to amplify separately the genomic viral RNA (vRNA) and the complementary viral RNA (cRNA). M1-encoding viral RNAs were amplified by RTqPCR. Results are normalized on the control condition and presented as mean +/- SD. \u003cstrong\u003e(G)\u003c/strong\u003e Transduced A549 cells were infected at MOI 0.5 and stained for the NP at 8h post-infection. Scale bar: 20µm. \u003cstrong\u003e(H)\u003c/strong\u003e Cytoplasmic fluorescence was quantified using the Fiji software. Each dot represents the cytoplasmic fluorescence of a cell, normalized by its area. \u003cstrong\u003e(I)\u003c/strong\u003eTransduced A549 cells were infected at MOI 0.5 and co-stained for the NP and PB1 proteins at 8h post-infection. Scale bar: 20µm. B\u003cstrong\u003eJ) \u003c/strong\u003eColocalization\u003cstrong\u003e \u003c/strong\u003ewas quantified using the Fiji software. \u003cstrong\u003e(K)\u003c/strong\u003e Transduced A549 cells were infected at MOI 4 and stained for the NP at 1h post-infection. Scale bar: 20µm. \u003cstrong\u003e(L) \u003c/strong\u003eConfocal Airyscan image processing and quantifications were performed in the Fiji software. Each dot represents the cytoplasmic fluorescence of a cell, normalized by its area. \u003cstrong\u003e(M) \u003c/strong\u003eTransduced A549 cells were infected at MOI 4 and stained for the NP at 2h post-infection. Scale bar: 20µm.\u003cstrong\u003e (N) \u003c/strong\u003eNuclear fluorescence was quantified using the Fiji software. Each dot represents the nuclear fluorescence of a cell. \u003cstrong\u003e(O)\u003c/strong\u003eExperimental strategy of the Alpha-Centauri assay. IAV (A/WSN/1933) particles containing the PB2 protein fused to a fragment of the NanoLuc (α-Nluc) were produced by reverse genetics. A plasmid containing a nuclear localization signal (NLS) fused to the other fragment of the NanoLuc (Centauri-Nluc) was generated and transfected into A549 cells. Transfected cells were infected at MOI 4 and the luminescence was measured to assess the NanoLuc complementation upon nuclear import of the viral ribonucleoproteins. \u003cstrong\u003e(P) \u003c/strong\u003eNanoLuc complementation results are normalized on the last time point.\u003cstrong\u003e \u003c/strong\u003eTwo-tailed unpaired Student’s t test. *P \u0026lt; 0.05, **P \u0026lt; 0.002, ***P \u0026lt; 0.0002, ****P \u0026lt; 0.0001, ns: non-significant.\u003c/p\u003e","description":"","filename":"DesgraupesFiguresv4min1.png","url":"https://assets-eu.researchsquare.com/files/rs-6597157/v1/76240524ab3d129b0d86d5e6.png"},{"id":82805248,"identity":"1d04b439-126a-464d-9eae-21116fb65ba9","added_by":"auto","created_at":"2025-05-15 12:19:40","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":271406,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eRANBP2 Knockdown facilitates the Nuclear Reimport of the viral polymerase complex proteins PB1/PB2/PA and segment-selective vRNP over-export to the cytoplasm.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(A)\u003c/strong\u003e A549 cells were transduced with LV shRNA-Control or shRNA-RANBP2 and infected with influenza A virus (IAV) (A/WSN/1933) at MOI 4. At 6h post-infection, protein levels of PB1, PB2, PA and NP were determined by western blot. \u003cstrong\u003e(B)\u003c/strong\u003e Transduced A549 cells were treated with KPT-330 for 2h and infected with IAV at MOI 0.5. Nucleo-cytoplasmic fractionation was performed at 6h post-infection and PB1, PB2 and PA levels were determined by western blot (N: nucleus, C: cytoplasm). Lamin and tubulin protein levels were investigated to verify the efficacy of the fractionation. \u003cstrong\u003e(C)\u003c/strong\u003e Transduced A549 cells were infected with IAV at MOI 0.5 in the absence of KPT-330. The PB1 was stained at 6h post-infection and nuclear fluorescence \u003cstrong\u003e(Figure S7)\u003c/strong\u003e was quantified using the Fiji software. Each dot represents the nuclear fluorescence of a cell. \u003cstrong\u003e(D)\u003c/strong\u003e Strand- and segment-specific RTqPCR strategy. Strand-specific reverse transcription (RT) was performed with tagged-primers to amplify separately the genomic viral RNA (vRNA) and the complementary viral RNA (cRNA). Each of the 8 segments of IAV were then amplified by qPCR using specific primers. \u003cstrong\u003e(E)\u003c/strong\u003e Transduced A549 cells were infected with IAV at MOI 0.5. At 6h post-infection, nuclear (N) and cytoplasmic (C) fractions were separated and total intracellular RNAs were extracted. cRNAs were reverse transcribed by strand-specific RTqPCR and results were normalized on the nuclear fraction of the control condition. \u003cstrong\u003e(F)\u003c/strong\u003e vRNAs were reverse transcribed by strand-specific RTqPCR and results were normalized on the control condition of each fraction. Results are presented as mean +/- SD.\u003c/p\u003e","description":"","filename":"DesgraupesFiguresv4min2.png","url":"https://assets-eu.researchsquare.com/files/rs-6597157/v1/c3032a67f73268e0175129d2.png"},{"id":82805250,"identity":"e97ba953-a859-4dc7-b8b9-748e63e75560","added_by":"auto","created_at":"2025-05-15 12:19:41","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":69620,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eRANBP2 knockdown exacerbates the inflammatory response to IAV infection.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(A) \u003c/strong\u003eMonocyte-derived macrophages (MDM), THP-1 cells and A549 cells were transduced with LV shRNA-Control or shRNA-RANBP2 at MOI 30 and stimulated with influenza A virus (IAV) (A/WSN/1933) at MOI 0.1 overnight. Cytokine transcripts were assessed by RT-qPCR and results were normalized on RPL13a or b-actin and on the non-stimulated control condition. Results are presented as mean +/- SD. Two-tailed unpaired Student’s t test. *P \u0026lt; 0.05, **P \u0026lt; 0.002, ***P \u0026lt; 0.0002, ****P \u0026lt; 0.0001, ns: non-significant. \u003cstrong\u003e(B)\u003c/strong\u003e Supernatants from IAV-stimulated MDM were collected at 24h post-stimulation and pro-inflammatory mediators were quantified by multiplex LUMINEX assay on samples diluted 1:50. The mean fluorescence intensities (MFI) for RANBP2-KD samples were normalized on the Control samples. Results are represented as heat maps of fold values.\u003c/p\u003e","description":"","filename":"DesgraupesFiguresv4min3.png","url":"https://assets-eu.researchsquare.com/files/rs-6597157/v1/40977fa08a032abec10e1f89.png"},{"id":82806403,"identity":"80196973-1ae3-4a84-945a-521900265b91","added_by":"auto","created_at":"2025-05-15 12:27:41","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":1947544,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eMislocalisation of the ANE1-mutated N-terminal part of RANBP2 drives hyper-inflammation upon immune stimulation.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(A)\u003c/strong\u003e CRISPR editing strategy. A guide sgRNA hybridizing directly upstream the C1754 position was used to induce the cleavage by the Cas9 enzyme. A donor DNA sequence carrying the C1754T mutation (corresponding to T585M at the protein level) was supplied. After homology directed repair (HDR), three types of CRISPR clones were generated (box below): (top) WT homozygous clones (middle) WT/C1754T heterozygous clones and (bottom) C1754T/C1754T homozygous clones. \u003cstrong\u003e(B)\u003c/strong\u003e RNA expression of the WT or C1754T form of RANBP2 was assessed by RANBP2-specific RTqPCR. HEK-293T cells transfected with plasmids encoding the WT form, the T585M form or both forms of RANBP2 were used as control. \u003cstrong\u003e(C)\u003c/strong\u003e Illustration of the RANBP2 sequence from positions 1749 to 1757, carrying a C on the WT sequence at position 1754, replaced by a T on the T585M mutant. \u003cstrong\u003e(D) \u003c/strong\u003eSanger sequencing of the CRISPR clones showing either a C, a T or both at position 1754. \u003cstrong\u003e(E)\u003c/strong\u003e CRISPR clones were stimulated overnight either by IAV (A/WSN/1933) at MOI 0.5 or by transfection with the 2CARD module of RIG-I, and total intracellular RNAs were extracted. Pro-inflammatory cytokine expression was assessed by RTqPCR to detect CXCL10 and TNFα transcripts. Values were normalized on RPL13a and for the untransfected control condition. Results are presented as mean +/- SD. \u003cstrong\u003e(F)\u003c/strong\u003e CRISPR clones were fixed and stained for RANBP2 using either an antibody recognizing the NTD (amino acids 1 to 18) or the CTD (amino acids 2550 to 2837) parts of RANBP2. \u003cstrong\u003e(G)\u003c/strong\u003e Schematic representation of the RANBP2 protein sequence and the epitopes recognized by the antibodies. Nuclear fluorescence was quantified using the Fiji software for \u003cstrong\u003e(H)\u003c/strong\u003e RANBP2\u003csup\u003eNTD\u003c/sup\u003e and \u003cstrong\u003e(I) \u003c/strong\u003eRANBP2\u003csup\u003eCTD\u003c/sup\u003e.\u003c/p\u003e","description":"","filename":"DesgraupesFiguresv4min4.png","url":"https://assets-eu.researchsquare.com/files/rs-6597157/v1/27eaaf5cc83989f162959c09.png"},{"id":104615243,"identity":"4ff7a17b-fc70-48c0-b053-c78642a32caf","added_by":"auto","created_at":"2026-03-14 07:10:03","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":5785365,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6597157/v1/05a5c486-1980-4d89-8b68-84e130adbd5f.pdf"},{"id":82805258,"identity":"d032727f-759e-467a-a769-3bd39447524b","added_by":"auto","created_at":"2025-05-15 12:19:41","extension":"pdf","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":2312349,"visible":true,"origin":"","legend":"","description":"","filename":"DesgraupesFiguresv4min.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6597157/v1/6c7afb31244d802fcd8d4242.pdf"},{"id":82806402,"identity":"c78aff77-8ab2-4f02-aacb-04a5a1e6eacf","added_by":"auto","created_at":"2025-05-15 12:27:41","extension":"pdf","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":43660,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cbr\u003e\u003c/p\u003e","description":"","filename":"DesgraupesTablesv4.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6597157/v1/1345e9f7b401651b8de7f43c.pdf"},{"id":82805249,"identity":"3e618a19-ebb6-4fe5-8866-856541b84e96","added_by":"auto","created_at":"2025-05-15 12:19:41","extension":"docx","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":19577,"visible":true,"origin":"","legend":"","description":"","filename":"SUPPLEMENTARYLEGENDS.docx","url":"https://assets-eu.researchsquare.com/files/rs-6597157/v1/5fdecbf60bc425c5736beeb4.docx"}],"financialInterests":"There is \u003cb\u003eNO\u003c/b\u003e Competing Interest.","formattedTitle":"The genetic driver of Acute Necrotizing Encephalopathy, RANBP2, regulates the inflammatory response to Influenza A virus infection","fulltext":[{"header":"INTRODUCTION","content":"\u003cp\u003eInfluenza viral infections are responsible for seasonal epidemics with respiratory manifestations but can also lead to severe complications. Among these, Acute Necrotizing Encephalopathy (ANE), also called ANE of Childhood (ANEC), is a severe reaction to febrile infection that is characterized by rapid progression and very poor prognosis (Lee et al., \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2023\u003c/span\u003e; Sakuma et al., \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e2025\u003c/span\u003e; Wu et al., \u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e2015\u003c/span\u003e; Mizuguchi et al., \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2007\u003c/span\u003e). Influenza viruses are thought to be responsible for ~ 50% of all ANE episodes and are associated with high morbidity and mortality (Bartolini et al., \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2024\u003c/span\u003e; Jiang et al., \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2022\u003c/span\u003e; Mizuguchi et al., \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2007\u003c/span\u003e; Neilson et al., \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2003\u003c/span\u003e; Chatur et al., \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2022\u003c/span\u003e; Bashiri et al., \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Although the pathogenesis is unclear, a hyperinflammatory response triggered by the virus is proposed as the underlying mechanism (Levine et al., \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Mizuguchi et al., \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2007\u003c/span\u003e; Sugaya, \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e2002\u003c/span\u003e), and early anti-inflammatory therapy may help mitigate the disease (Chatur et al., \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2022\u003c/span\u003e; Koh et al., \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Okumura et al., \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e2009\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eInfluenza viruses belong to the \u003cem\u003eOrthomyxoviridae\u003c/em\u003e family and are classified into types, Influenza A and B being the most prevalent ones associated with seasonal flu cases. Influenza A is further divided into subtypes based on their surface glycoproteins, haemagglutinin (HA) and neuraminidase (NA). The H1N1 and H3N2 strains are responsible for major outbreaks and epidemics, and in the 2024–2025 winter season, there has been an unprecedented surge in H1N1 cases, leading to an unusual spike in hospitalizations and ANE in children (Bartolini et al., \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2024\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThe Influenza A virus (IAV) is an enveloped particle containing 8 negative-sense single-stranded viral RNA (vRNA) gene segments, each packaged by nucleoprotein (NP) into a viral ribonucleoprotein (vRNP) complex, and associated with the viral polymerase complex (PB1, PB2, and PA). Unlike most RNA viruses, IAV replicates in the nucleus and hijacks the nuclear pore complex (NPC) machinery for four critical steps of its replication cycle. (i) After endocytosis and uncoating, vRNPs are trafficked to the nucleus where the viral polymerase transcribes the viral genome. (ii) Capped and polyadenylated mRNAs are exported into the cytoplasm for translation by cytoplasmic ribosomes. (iii) The newly translated viral proteins, including NP, PB1, PB2 and PA, are imported back into the nucleus, which allows the viral polymerase to replicate the viral genome into complementary RNAs (cRNA) and genomic vRNA. (iv) Lastly, new vRNPs, assembled with M1 and NS2/NEP, are exported back from the nucleus for incorporation into budding virions (Dou et al., \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; Carter and Iqbal, \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2024\u003c/span\u003e; Fodor and Te Velthuis, \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Zhu et al., \u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e2023\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eMany viral and host factors are thought to contribute to severe influenza, and genetic susceptibility particularly in genes that regulate innate signalling and antiviral response, has been reported (Mettelman and Thomas, \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Clohisey and Baillie, \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Gounder and Boon, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). However, the mechanisms that drive severe influenza-triggered ANE in previously healthy children are not known. One clue to understanding the pathogenesis of influenza-associated ANE comes from genetic susceptibility in familial, recurrent cases, known as ANE1 (or ADANE) (Neilson et al., \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2003\u003c/span\u003e). Patients with ANE1 present with autosomal dominant missense mutations in \u003cem\u003eRANBP2\u003c/em\u003e and have a significantly increased lifetime risk of developing ANE (Neilson et al., 2009). Mutations in \u003cem\u003eRANBP2\u003c/em\u003e increase the risk of relapse and recurrence (Levine et al., \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Chatur et al., \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2022\u003c/span\u003e) and may associate with greater morbidity and mortality.\u003c/p\u003e \u003cp\u003eRANBP2 (Nup358) is a cytoplasmic fibril (CF) nucleoporin that regulates nucleocytoplasmic transport by interacting with nuclear transport receptors such as Karyopherin α/β and CRM1/Exportin 1 (Yokoyama et al., \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e1995\u003c/span\u003e; Hutten et al., \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2008\u003c/span\u003e). Additional functions have been attributed to RANBP2 at the NPC, many of which are linked to its C-terminal domain (CTD) E3 SUMO ligase activity, and away from the NPC, namely at annulate lamellae, mitochondria-endoplasmic reticulum junctions and in the nucleus (Desgraupes et al., \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). Moreover, at least 4 protein isoforms have been identified for RANBP2, however, it is not known if these have distinct functions or subcellular localisations. The predominant ANE1-associated mutation (c.C1754T, p.T585M), and most other pathogenic mutations in RANBP2, all cluster in the N-terminal domain (NTD), which is responsible for anchoring to NPCs (Jiang et al., \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2022\u003c/span\u003e; Joseph and Dasso, \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2008\u003c/span\u003e). This suggests that the localization of RANBP2 to CF may be physiologically essential, although no changes in localisation could be demonstrated following the overexpression of disease variants (Shen et al., \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Bley et al., \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2022\u003c/span\u003e).\u003c/p\u003e \u003cp\u003ePrevious work showed that RANBP2 can modulate viral infection of several viruses, such as Adenovirus (Carlon-Andres et al., \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2020\u003c/span\u003e), Herpes simplex virus type 1 (HSV-1) (Copeland et al., \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2009\u003c/span\u003e; Hofemeister and O’Hare, \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2008\u003c/span\u003e) and Human immunodeficiency virus type 1 (HIV-1) (Bichel et al., \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2013\u003c/span\u003e; Di Nunzio et al., \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2012\u003c/span\u003e; Schaller et al., \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e2011\u003c/span\u003e; Zhang et al., \u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e2010\u003c/span\u003e), however no work has uncovered a role for RANBP2 in Influenza virus infection. In fact, although some studies showed that NPC components can impact the replication and transcription of Influenza virus, such as Nup62, Nup98 and Nup153, RANBP2 was not identified as a host factor for Influenza virus (Khanna et al., \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2024\u003c/span\u003e; Watanabe et al., \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e2010\u003c/span\u003e; Munier et al., \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e2013\u003c/span\u003e).\u003c/p\u003e \u003cp\u003ePrevious work also showed that RANBP2 can modulate innate immune signalling, however this activity was consistently attributed to its E3 SUMO ligase activity or Cyclophilin-homology motif in the CTD (Maarifi et al., \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; Portilho et al., \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e2016\u003c/span\u003e; Shen et al., \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Li et al., \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2023\u003c/span\u003e), and no work has yet demonstrated a role for the NTD where ANE1 mutations are clustered.\u003c/p\u003e \u003cp\u003eThe aim of our study was to determine how RANBP2 contributes to or regulates inflammatory responses to infection by Influenza virus. We show that RANBP2 impacts the replication of genomic vRNAs of IAV into cRNA by controlling the re-import of newly translated viral polymerase complex. Interestingly, RANBP2 also controls RNP export from the nucleus but in a segment-specific manner, only impacting the long segments encoding the PB1, PB2 and PA proteins, thus leading to their cytoplasmic accumulation and triggering hyper-inflammation, which could provide a first clue in understanding the pathogenesis of ANE.\u003c/p\u003e"},{"header":"RESULTS","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eKnockdown of RANBP2 stimulates non-productive Influenza vRNA replication in infected cells\u003c/h2\u003e \u003cp\u003eTo investigate the role of RANBP2 in IAV infection, RANBP2-knockdown (RANBP2-KD) was induced in A549 human alveolar cells by lentiviral vector (LV) transduction before infection with A/WSN/1933(H1N1) virus at MOI 0.5. Supernatants were harvested at 10 h post-infection (hpi) to investigate the production of infectious viral particles by TCID50 titration. No differences were observed between the Control and RANBP2-KD cells, suggesting that RANBP2 had no effect on the production of infectious particles \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA, \u003cb\u003eFigure S1)\u003c/b\u003e.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eHowever, an unexpected phenotype was observed for viral RNA quantification in both A549 and the monocytic cell line THP-1. Infection kinetics were performed and viral RNA levels were determined at early (2 h) and late (6, 8, 16 and 24 h) time points using qPCR primers recognizing M1 on segment 7. In the monocytic cell line THP-1 \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB\u003cb\u003e)\u003c/b\u003e and in A549 cells \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC\u003cb\u003e)\u003c/b\u003e, a significant increase of M1 RNA was induced in RANBP2-KD cells. Although the change was most striking in THP-1 cells (40-fold), this led to considerable cell death and, therefore, A549 cells were preferred for further analysis. The increase in viral RNA was confirmed with another IAV segment, encoding the NP \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD\u003cb\u003e)\u003c/b\u003e, and appeared to be specific since no increase was observed for any of the housekeeping genes that were measured \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eE\u003cb\u003e)\u003c/b\u003e. Together, these data suggested that RANBP2 is involved in controlling Influenza viral RNA synthesis but that this does not translate into increased productive infection.\u003c/p\u003e \u003cp\u003eBecause different types of viral RNAs are produced during the IAV life cycle, we investigated which RNAs are impacted by the depletion of RANBP2. Tagged RT primers were used to specifically recognize the negative-sense genomic vRNA sequence or the positive-sense cRNA sequence in order to specifically reverse transcribe (RT) each type of viral RNA \u003cb\u003e(Figure S2A)\u003c/b\u003e. First, the specificity of each primer was validated by amplifying only vRNAs after vRNA-specific RT, or only cRNAs after cRNA-specific RT, while not amplifying any target in non-infected cells \u003cb\u003e(Figure S2B)\u003c/b\u003e. In RANBP2-KD cells, we observed a significant increase of both vRNAs and cRNAs \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eF\u003cb\u003e)\u003c/b\u003e, thus showing that RANBP2 is involved in IAV RNA replication. Although this was unexpected given the absence of phenotype in terms of viral production, the marked increase in cRNA and vRNA levels suggested an enhancement in viral genome replication.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eHaving observed an increase in genomic vRNAs, we tested if this correlated with more newly produced vRNPs. As previously, A549 cells were transduced with Control- or RANBP2-shRNAs then infected with IAV (MOI 0.5). At 8 hpi, the distribution of NP was investigated by immunofluorescence. Although export is ongoing in every condition, RANBP2-KD cells showed a striking increase in cytoplasmic NP \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eG and \u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eH, \u003cb\u003eFigure S3).\u003c/b\u003e In order to determine if signal corresponded to vRNPs or free NP in the cytoplasm, we performed co-stainings with other components of vRNPs (i.e. PB1 and PA). We observed a co-localisation of cytoplasmic NP with PB1 and with PA \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eI and \u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eJ, \u003cb\u003eFigure S4)\u003c/b\u003e, showing that RANBP2-KD induces an increase in vRNPs exported to the cytoplasm.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eIncreased IAV replication does not result from enhanced viral entry into cells or into the nucleus\u003c/b\u003e \u003c/p\u003e \u003cp\u003eTo determine how vRNA is increased in RANBP2-depleted cells, we first tested whether RANBP2 regulates IAV infection by modulating viral entry into cells and/or nuclei, thereby increasing the quantity of IAV RNA to be copied.\u003c/p\u003e \u003cp\u003eTo assess whether RANBP2 regulates cell or nuclear entry, Control or RANBP2-KD cells were infected with IAV (A/WSN/33) at MOI 4 in order to increase signal detection during early steps of the viral cycle, and NP localization was studied by immunofluorescence at 1 hpi to assess internalization, and at 2 h to monitor NP nuclear entry. Results indicate that depletion of RANBP2 from A549 cells affects neither internalization \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eK and \u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eL\u003cb\u003e)\u003c/b\u003e nor nuclear import \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eM and \u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eN\u003cb\u003e)\u003c/b\u003e.\u003c/p\u003e \u003cp\u003eTo further validate these findings, we adapted an Alpha-Centauri protein-complementation assay previously developed to monitor the nuclear import of HIV-1 (Fernandez et al., \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Briefly, the NanoLuc protein was expressed as two unequal non-luminescent fragments. The smaller fragment was fused to PB2 (called Alpha), while the larger fragment (Centauri) was fused to a NLS and expressed in A549 cells by lentiviral vector (LV) transduction \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eO, \u003cb\u003eFigure S5A and S5B)\u003c/b\u003e. Upon vRNP nuclear import, the two fragments reconstitute a functional NanoLuc, generating a measurable signal upon addition of substrate \u003cb\u003e(Figure S5C)\u003c/b\u003e. No significant differences in luminescence were detected between control and RANBP2-KD cells at 1 and 2 hpi, confirming that RANBP2 is not essential for vRNP nuclear import \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eP, \u003cb\u003eFigure S5D)\u003c/b\u003e, thus demonstrating that RANBP2 does not regulate IAV vRNP nuclear import.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eRANBP2 Knockdown facilitates the nuclear import of the neo-synthesised viral polymerase complex proteins PB1, PB2 and PA\u003c/b\u003e \u003c/p\u003e \u003cp\u003eSince RANBP2 does not impact the quantity of template available for replication, we investigated whether it modulates the quantity or transport of the polymerase complex subunits. First, the total levels of PB1, PB2, PA and NP were assessed by Western-Blot at 8 hpi, however, no differences were observed between RANBP2-KD cells and Control cells \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e2\u003c/span\u003eA\u003cb\u003e)\u003c/b\u003e, suggesting that RANBP2 does not impact the translation of the viral polymerase complex.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eBeing an NPC component, we hypothesised that RANBP2 may control the replication of vRNA by regulating the import of the viral polymerase. Therefore, we tested the impact of RANBP2 on the nuclear import of newly synthesised PB1, PB2, and PA subunits. To focus specifically on import, we inhibited vRNP export using a pharmacological inhibitor of CRM1, KPT-330/Selinexor. First, we confirmed that KPT-330 inhibits vRNP export in a dose-dependent manner \u003cb\u003e(Figure S6A)\u003c/b\u003e, with negligible toxicity \u003cb\u003e(Figure S6B)\u003c/b\u003e and that inhibition operates from 5 hpi onwards \u003cb\u003e(Figure S6C)\u003c/b\u003e. Then we performed subcellular fractionation followed by Western blotting at 6 hpi to determine the localisation of the different polymerase subunits. Results revealed an increase in PB1, PB2 and PA protein levels in the nucleus, confirmed by the immunofluorescence detection of nuclear PB1, indicating that the import of the neo-synthesised polymerase is facilitated in the absence of RANBP2 \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e2\u003c/span\u003eB and \u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e2\u003c/span\u003eC, \u003cb\u003eFigure S7)\u003c/b\u003e.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eRANBP2 depletion disrupts the segment stoichiometry by selectively favouring the export of some vRNA segments to the cytoplasm\u003c/b\u003e \u003c/p\u003e \u003cp\u003eHaving determined that RANBP2 controls Influenza virus replication in the nucleus by regulating the import of the newly synthesised viral polymerase, we asked why the increase in vRNA and vRNP does not translate into an increased production of infectious particles \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA\u003cb\u003e)\u003c/b\u003e. To address this, we performed strand-specific RT to distinguish vRNA and cRNA, as previously \u003cb\u003e(Figure S2A)\u003c/b\u003e, then quantified the 8 IAV segments by qPCR to investigate segment stoichiometry \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e2\u003c/span\u003eD, \u003cb\u003eFigure S8A and S8B)\u003c/b\u003e. After sub-cellular fractionation, analysis of viral RNA localization revealed that, while cRNA levels increased for all influenza segments in the nucleus \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e2\u003c/span\u003eE\u003cb\u003e)\u003c/b\u003e, segments 1, 2, 3, 7 and 8 exhibited increased vRNA export to the cytoplasm in the absence of RANBP2 compared to other segments \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e2\u003c/span\u003eF\u003cb\u003e)\u003c/b\u003e. These findings indicate that, while the depletion of RANBP2 increases the replication of all vRNA segments, it disproportionately affects their export back to the cytoplasm.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eTaken together, our results indicated that the knockdown of RANBP2 greatly perturbs infection by IAV, first by facilitating the re-import of polymerase into the nucleus, which increases cRNA and vRNA, second by selectively favouring the export of some vRNA into the cytoplasm. The dysregulation of both these steps may cause an abnormal accumulation of some vRNA segments in the cytoplasm, thus constituting potential pathogen-associated molecular patterns (PAMPs) that may be sensed by the infected cell.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eRANBP2 knockdown exacerbates the inflammatory response to IAV infection in primary human macrophages\u003c/h3\u003e\n\u003cp\u003eIn ANE1, it is thought that innate immune cells may contribute to the deleterious production of cytokines following IAV infection. To test this in relevant innate immune cells, primary monocytes were isolated from PBMCs from healthy donors and differentiated into pro-inflammatory M1-like macrophages. After 7 days of differentiation, primary monocyte-derived macrophages (MDM) were CD3- CD14\u0026thinsp;+\u0026thinsp;CD16\u0026thinsp;+\u0026thinsp;CD11b\u0026thinsp;+\u0026thinsp;HLA-DR\u0026thinsp;+\u0026thinsp;CD80- \u003cb\u003e(Figure S9)\u003c/b\u003e. We first determined that IAV can infect MDMs \u003cb\u003e(Figure S10A)\u003c/b\u003e, and stimulate an effective immune response without additional pre-stimulation, triggering the synthesis of pro-inflammatory cytokines such as IL-6 and IL-1β \u003cb\u003e(Figure S10B)\u003c/b\u003e. MDM were then transduced with LVs coding for control or RANBP2 shRNA and infected with IAV \u003cb\u003e(Figure S1)\u003c/b\u003e. The stimulation of innate immunity was initially assessed by qPCR detection of representative transcripts, namely CXCL10, IL-6, TNFα and IL-1β, comparing MDM with THP-1 and A549 cells. Although some cell-dependent changes were observed, the knockdown of RANBP2 led to a\u0026thinsp;~\u0026thinsp;2-fold increase in IL-6, up to 6-fold increase in TNFα and IL-1β, and up to 50-fold increase in CXCL10 \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig11\" class=\"InternalRef\"\u003e3\u003c/span\u003eA\u003cb\u003e)\u003c/b\u003e, suggesting that RANBP2 regulates the inflammatory response to IAV infection.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eTo confirm this at the protein level, supernatants were collected at 24 hpi and the secretion of pro-inflammatory mediators was analysed by Multiplex Luminex assay. Strikingly, the knock-down of RANBP2 in primary macrophages led to an exacerbated inflammatory response to IAV infection, with a stronger induction of the pro-inflammatory chemokines CXCL8, CXCL10, CCL2, CCL3 and CCL4 \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig11\" class=\"InternalRef\"\u003e3\u003c/span\u003eB\u003cb\u003e)\u003c/b\u003e.\u003c/p\u003e \u003cp\u003eTogether, these findings suggest that RANBP2 plays a critical role in modulating the inflammatory response to IAV infection by regulating vRNA replication, nucleocytoplasmic trafficking of viral polymerase subunits, and selective vRNA export. The abnormal accumulation of viral components in the cytoplasm amplifies inflammatory signalling, highlighting a potential mechanism underlying the pathogenesis of ANE.\u003c/p\u003e\n\u003ch3\u003eThe RANBP2-T585M ANE1 variant drives hyper-inflammation following IAV infection\u003c/h3\u003e\n\u003cp\u003eHaving identified the role of RANBP2 in controlling the IAV-triggered inflammation, we investigated if this function is compromised by the predominant ANE-associated mutation, c.C1754T, p.T585M. Heterozygous mutations in \u003cem\u003eRANBP2\u003c/em\u003e are associated with increased susceptibility to acute necrotizing encephalopathy, however it is not known how these affect protein function. In particular, previous work showed that ANE1 mutations do not alter the structure of RANBP2 (Bley et al., \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2022\u003c/span\u003e), and that ectopically-expressed RANBP2-T585M still localises to the nuclear envelope (Bley et al., \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2022\u003c/span\u003e; Shen et al., \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e2021\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eWe introduced the predominant mutation (c.C1754T, p.T585M), by CRISPR-Cas9 knock-in of U2OS cells \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig14\" class=\"InternalRef\"\u003e4\u003c/span\u003eA\u003cb\u003e)\u003c/b\u003e. A total of 47 clones were isolated after puromycin selection during 3 weeks. Mutations were confirmed by allelic qPCR \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig14\" class=\"InternalRef\"\u003e4\u003c/span\u003eB, \u003cb\u003eFigure S11A-S11C)\u003c/b\u003e, as previously described (Gouy et al., \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2023\u003c/span\u003e), and by Sanger sequencing of the cDNA \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig14\" class=\"InternalRef\"\u003e4\u003c/span\u003eC and \u003cspan refid=\"Fig14\" class=\"InternalRef\"\u003e4\u003c/span\u003eD\u003cb\u003e)\u003c/b\u003e. For many clones, we noted that CRISPR repair had occurred using the highly homologous RGPD sequences present on the same chromosome (Desgraupes et al., \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2023\u003c/span\u003e), rather than the repair plasmid, therefore only clones that did not recombine with RGPD were selected \u003cb\u003e(Figure S11B)\u003c/b\u003e. In total, two wild-type clones (C4 and C15, referred to as WT/WT), one heterozygously-mutated (C10, WT/C1754T) and three homozygously-mutated (C6, C9 and C14, C1754T/ C1754T) clones were isolated.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eCRISPR-knock-in clones were infected with IAV and activation of innate immune pathways was assessed by qPCR, normalised for house-keeping genes, as previously \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig11\" class=\"InternalRef\"\u003e3\u003c/span\u003eA\u003cb\u003e)\u003c/b\u003e. IAV infection induced expression of CXCL10 and TNFα transcript expression in all clones. However, a striking phenotype emerged in cells homozygous for the RANBP2-T585M disease variant, where CXCL10 expression following IAV infection was exacerbated by a fold change of 1-2-log compared to WT or heterozygous clones \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig14\" class=\"InternalRef\"\u003e4\u003c/span\u003eE\u003cb\u003e).\u003c/b\u003e A similar phenotype was observed upon transfection of the constitutively active caspase recruitment domain (2-CARD) of the retinoic acid-inducible gene I (RIG-I), which mimics viral RNA sensing (Maarifi et al., \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2018\u003c/span\u003e), suggesting that the ANE1-associated variant amplifies innate immune responses to agonist stimulation.\u003c/p\u003e\n\u003ch3\u003eIn CRISPR-Cas9 knock-in cells, RANBP2 mislocalises away from nuclear pores\u003c/h3\u003e\n\u003cp\u003eAlthough previous studies reported that ectopically expressed RANBP2-T585M localizes to the NPC (Bley et al., \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2022\u003c/span\u003e; Shen et al., \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e2021\u003c/span\u003e), its localization has not been examined in genetically edited cell lines. We therefore examined the subcellular localisation of RANBP2 by immunofluorescence in the clones expressing RANBP2-T585M heterozygously and homozygously using a RANBP2-specific antibody recognising the CTD. As expected, RANBP2 localised to the nuclear envelope in WT clones. In contrast, all three clones homozygous for RANBP2-T585M lost the characteristic nuclear rim staining, indicating that the mutation disrupts RANBP2 retention at the nuclear envelope \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig14\" class=\"InternalRef\"\u003e4\u003c/span\u003eF-\u003cspan refid=\"Fig14\" class=\"InternalRef\"\u003e4\u003c/span\u003eH\u003cb\u003e)\u003c/b\u003e. Despite this, nuclear pores appeared intact, since the labelling of FG-repeat Nups with the MAb414 antibody was comparable across all clones \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig14\" class=\"InternalRef\"\u003e4\u003c/span\u003eF, \u003cb\u003eFigure S12)\u003c/b\u003e.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eIn conclusion, our findings suggest that RANBP2 localization at the nuclear envelope is critical to safeguard cells from the pathological inflammation following viral infection. In ANE1, mutations in the NTD of RANBP2 are specifically associated with hyperinflammation.\u003c/p\u003e"},{"header":"DISCUSSION","content":"\u003cp\u003eIn this work, we show that the NPC component RANBP2 regulates the nucleocytoplasmic transport of Influenza A virus proteins and RNAs. Its absence from nuclear pores contributes to exacerbated viral replication in the nucleus, and a disproportionate increase in some viral RNAs. While previous work indicated that RANBP2 is a co-factor for the infection by some viruses (Bichel et al., \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2013\u003c/span\u003e; Di Nunzio et al., \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2012\u003c/span\u003e; Schaller et al., \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e2011\u003c/span\u003e; Zhang et al., \u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e2010\u003c/span\u003e; Copeland et al., \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2009\u003c/span\u003e; Hofemeister and O’Hare, \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2008\u003c/span\u003e), this study reveals an opposite role in IAV infection, namely the restriction of key nuclear transport steps.\u003c/p\u003e \u003cp\u003eRANBP2 can regulate the nucleocytoplasmic transport of macromolecules by two major mechanisms, first by regulating the cycle of Ran, second by interacting with nuclear transport receptors (Yokoyama et al., \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e1995\u003c/span\u003e; Hutten et al., \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2008\u003c/span\u003e). The replication of IAV involves four distinct sequential NCT steps, namely the import of incoming vRNPs, the export of viral mRNAs, the import of translated viral proteins, and the export of vRNPs. RANBP2 was found to regulate only two of these steps, suggesting a specific mechanism. In particular, RANBP2 was not involved in the initial entry of incoming vRNPs into the nucleus, which involves the classical karyopherin α/β nuclear import pathway (Miyake et al., \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Nguyen et al., \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e2023\u003c/span\u003e; Dou et al., \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2018\u003c/span\u003e), nor in the initial export of viral transcripts, which involves the general mRNA export pathway via NXF1:NXT1. Rather, RANBP2 acted on late nuclear transport steps of IAV, after translation of the viral proteins. First, RANBP2 was found to regulate the re-import of the polymerase complex subunits, which is known to involve different pathways, the best characterised being via the β-karyopherin RanBP5 (Huet et al., \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2010\u003c/span\u003e; Hemerka et al., \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2009\u003c/span\u003e; Cros et al., \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2005\u003c/span\u003e). Second, results suggest that RANBP2 exerts a quality control checkpoint for vRNAs that are exported back to the cytoplasm, a step known to depend on the β-karyopherin CRM1 (Elton et al., \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2001\u003c/span\u003e; Ma et al., \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2001\u003c/span\u003e; Watanabe et al., \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e2001\u003c/span\u003e). Our results therefore suggest that RANBP2 may impact viral NCT by interacting with key β-karyopherins.\u003c/p\u003e \u003cp\u003eDespite increased vRNA levels, infectious viral particle production did not increase. Our results indicated that the absence of RANBP2 disrupted the segment stoichiometry, leading to the disproportionate increase in the largest segments (1, 2, 3), and in segments that undergo splicing (7 and 8). Changes in segment stoichiometry could lead to packaging defects, however, the mechanism responsible for this imbalance in viral RNA export is not known. It is possible that the increase in vRNA corresponds to truncated RNA segments, especially since large deletions are frequent in the segments coding for PB1, PB2 and PA.\u003c/p\u003e \u003cp\u003eAfter replication, Influenza viral genomic single stranded RNA molecules are sensed by RIG-I, which results in the production of pro-inflammatory cytokines downstream of NF-κB (Iwasaki and Pillai, \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). In the absence of RANBP2, IAV infection led to a dramatic increase in the pro-inflammatory response, especially with the production of chemokines. We hypothesize that the disproportionate increase of some cRNA/vRNA segments in the cytoplasm could constitute PAMPs that exacerbate the inflammatory response.\u003c/p\u003e \u003cp\u003eInfluenza viruses are responsible for the majority of ANE1 cases in children. The high prevalence for Influenza over other respiratory infections (e.g., RSV, SARS-CoV-2) and childhood febrile illnesses (e.g., streptococcal infections) is puzzling and unexplained. Our work suggests that, by restraining key steps of IAV nucleocytoplasmic trafficking, RANBP2 is responsible for limiting the accumulation of viral PAMPs in the cytoplasm. Additionally, in CRISPR knock-in cells expressing the ANE1 disease variant, stimulation of innate immune signalling downstream of RIG-I led to a high expression of some pro-inflammatory transcripts, indicating that RANBP2 also regulates innate immune signalling. Although the prevalent phenotype was observed in homozygously edited cells, this is the first demonstration that ANE1 mutation is associated with exacerbated inflammation. This role of RANBP2 in controlling innate immunity is coherent with the symptoms observed in ANE1 patients as they express elevated levels of pro-inflammatory cytokines.\u003c/p\u003e \u003cp\u003eIt remains unclear how heterozygous dominant single point mutations in the NTD of RANBP2 contribute to disease. Previous work suggests that both wild-type and mutant alleles are expressed in patients (Gouy et al., \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2023\u003c/span\u003e), suggesting that the mutant allele might have dominant negative activity. However, ANE1 mutations were shown not to affect protein structure, nor localisation at the NPC using ectopically-expressed RANBP2 (Bley et al., \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2022\u003c/span\u003e; Shen et al., \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). In CRISPR knock-in cells, we demonstrate that the T585M mutation in the NTD causes its redistribution away from the nuclear envelope. This change was only observed in homozygously-edited cells, suggesting that the mutation affects the ability of mutant-RANBP2 to anchor into the NPCs. Future work in patient samples will be essential to determine whether ANE1 mutations favour the accumulation of RANBP2 isoforms or truncated forms.\u003c/p\u003e"},{"header":"MATERIALS \u0026 METHODS","content":"\u003ch2\u003eViruses, lentiviral vectors and cells\u003c/h2\u003e\u003cp\u003eInfections with IAV were carried out with the H1N1/A/WSN/1933 strain in all experiments except for the Alpha-Centauri assay where this same strain was engineered to express a fragment of the NanoLuc (IAV-alpha) as described below. Lentiviral vectors (LV) were produced by transfecting HEK-293T cells in calcium phosphate with a pVSVg plasmid, an encapsidation Gag-Pol plasmid (p8.74) and the plasmid of interest (i.e. mCherry-shRNA-Control, mCherry-shRNA-RANBP2 or Centauri-NLuc-NLS) (see \u003cb\u003eTable S1\u003c/b\u003e for plasmid information). After 48 h, vectors were harvested and ultracentrifuged for 1 h at 22,000 rpm (Optima XE-90, Beckman Coulter) at 4°C. A549 cells (ATCC) and CRISPR U2OS clones (homemade) were cultured in Dulbecco's Modified Eagle Medium (DMEM, Gibco) containing 10% of Fetal bovine serum (FBS, Serana) and 1× penicillin/streptomycin (PS, Gibco) at 37°C with 5% CO2. THP-1 cells and monocyte-derived macrophages (MDM) were cultured in Roswell Park Memorial Institute (RPMI-1640, Gibco) medium containing 10% FBS and 1× of PS.\u003c/p\u003e\u003ch3\u003eIAV infections\u003c/h3\u003e\u003cp\u003eCells were infected with IAV at MOI 0.5 in all experiments, except when monitory the early steps of the viral cycle (i.e. internalization, nuclear import), when MOI 4 was used to increase signal detection. Cells were exposed to IAV for 1 h in a small volume of 2% FBS culture medium to promote viral adsorption at the cell surface before replacing viral inoculum with warm culture medium and incubation at 37°C with 5% CO2. For experiments with NF-κB canonical pathway inhibition, cells were pre-treated with 2% FBS culture medium containing 20 µM of PS1145 (MedChemExpress) for 1 h at 37°C.\u003c/p\u003e\u003ch2\u003eRNA extractions and RTqPCR\u003c/h2\u003e\u003cp\u003eIntracellular RNAs were extracted using the RNeasy mini kit (Qiagen) according to the manufacturer’s protocol. RNA yields and purity were assessed by spectrophotometry (NanoDrop 2000c, Thermofisher Scientific). Unspecific reverse transcription (RT) was performed using the PrimeScript RT Reagent Kit (Perfect Real Time, Takara Bio Inc.) with random and polyT primers. IAV strand-specific RT was performed using tagged primers that bind either to the consensus 3’-end sequence of vRNAs (all 8 segments) or to the consensus 3’-end sequence of cRNAs (all 8 segments as well) with Superscript III (Invitrogen, Thermofisher Scientific) in the presence of DTT 0.1M (Invitrogen, Thermofisher Scientific), dNTP 10mM (Invitrogen, Thermofisher Scientific) and RNAsin (Promega). Distinction between segments was then made using specific qPCR primers (\u003cb\u003eTable S2\u003c/b\u003e). RANBP2-specific RT was performed using a primer (at 1µM) that binds to RANBP2 on a sequence absent from RGPDs, as published in (Gouy et al., \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2023\u003c/span\u003e) PrimeScript RT Reagent Kit was used (Perfect Real Time, Takara Bio Inc.) (\u003cb\u003eTable S2\u003c/b\u003e). Real-time quantitative PCR was performed using the Power Up kit (Applied Biosystems, Thermofisher Scientific) on the ViiA7 thermocycler (Life technologies, Thermofisher Scientific). All qPCR primers are listed in \u003cb\u003eTable S2\u003c/b\u003e.\u003c/p\u003e\u003ch2\u003eImmunofluorescence\u003c/h2\u003e\u003cp\u003eCells were washed with PBS and fixed with 4% paraformaldehyde (PFA, Thermofisher Scientific) for 10 min at room temperature (R/T). After 3 PBS washes, remaining PFA was neutralized with PBS containing 50mM of NH4Cl for 10 min at R/T. After 2 PBS washes, cells were permeabilized using PBS containing 0.5% of Triton-100X (Sigma-Aldrich) for 15 min at R/T. Cells were washed twice in PBS and saturated in PBS supplemented with 2% of Normal goat serum (NGS, Invitrogen, Thermofisher Scientific). Primary stainings were performed for 1h at R/T with antibodies listed in \u003cb\u003eTable S3\u003c/b\u003e. Cells were washed 5 times with PBS and secondary antibodies were added for 30 min at R/T (\u003cb\u003eTable S3\u003c/b\u003e). After 5 PBS washes, cells were stained with Hoechst (Thermofisher Scientific) diluted to the 1/10,000 in PBS for 5 min at R/T. Cells were washed 5 times with PBS and mounted in Prolong Diamond anti-fade mounting medium (Invitrogen, Thermofisher Scientific). Imaging was carried out using the Confocal Zeiss LSM880 Airyscan microscope of the Montpellier Ressources Imagerie (MRI) platform. Image processing and quantifications were done using the Fiji software (2.14.0): Alexafluor-488 staining of the NP was changed to the color « Orange Hot » for aesthetic purposes and brightness was increased uniformly in all conditions. Full panels of images are provided in supplementary data.\u003c/p\u003e\u003ch2\u003eAlpha-Centauri assay\u003c/h2\u003e\u003cp\u003eCloning steps. A DNA fragment coding for αNluc (GVTGWRLCERILA) flanked by NotI and NheI overhangs was obtained by annealing two overlapping oligonucleotides:\u003c/p\u003e\u003cdiv class=\"gridtable\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003ctable float=\"No\" id=\"Taba\" border=\"1\"\u003e\u003ccolgroup cols=\"1\"\u003e\u003c/colgroup\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eNotI-αNLuc-NheI-F\u003c/b\u003e GGCCGCAGGGGGAGTGACAGGGTGGAGACTATGCGAAAGAATACTTGCATAAG\u003c/p\u003e \u003cp\u003e\u003cb\u003eNotI-αNLuc-NheI-R\u003c/b\u003e CTAGCTTATGCAAGTATTCTTTCGCATAGTCTCCACCCTGTCACTCCCCCTGC\u003c/p\u003e \u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/table\u003e\u003c/div\u003e\u003cp\u003eThe reverse genetics plasmid pPolI-SL-PB2-αNluc was obtained by subcloning this restriction fragment between the NotI and NheI sites of the pPolI-SL-PB2-Nanoluc described in Diot 2016.\u003c/p\u003e\u003cp\u003eParticle production by reverse genetics. The eight pPolI-WSN-PB2-αNluc, -PB1, -PA, -HA, -NP, -NA, -NS, -M, and four pcDNA3.1-WSN-PB2, -PB1, -PA, -NP plasmids (0.5 µg of each) were co-transfected into a co-culture of 293T and MDCK cells (seeded in a 6-well plate at 4 × 10\u003csup\u003e5\u003c/sup\u003e and 3 × 10\u003csup\u003e5\u003c/sup\u003e cells, respectively) using 10 µL of FuGENE® HD transfection reagent (Promega). After 24 h of incubation at 35°C, cells were washed twice with DMEM and incubated in DMEM containing 1 µg/mL of TPCK-treated trypsin for 48 h. The reverse genetics supernatant was titrated on MDCK by plaque assay and the recombinant PB2-αNluc virus was amplified at an MOI of 10\u003csup\u003e− 4\u003c/sup\u003e on MDCK cells for 3 days at 35°C. The viral stock was titrated on MDCK by plaque assays and sequenced to verify the presence of the αNluc coding sequence.\u003c/p\u003e\u003cp\u003eCells were transduced with LV Centauri-NLuc-NLS for 3 days, then with LV shRNA-Control or LV shRNA-RANBP2 at MOI 15 for 4 days. Cells were then infected with IAV-α at MOI 4 for the indicated times. NanoGlo live cell substrate (Promega) was added and luminescence was measured with the Infinite M Plex spectrophotometer (Tecan).\u003c/p\u003e\u003ch2\u003eNucleo-cytoplasmic fractionation\u003c/h2\u003e\u003cp\u003eNuclear and cytoplasmic fractions were separated using the NE-PER Kit (Thermofisher Scientific) according to the manufacturer’s protocol. Briefly, 1–2\u0026nbsp;million cells were washed with PBS then lysed in cold CER I buffer, vortexed 15 seconds and incubated on ice for 10 min. Cold CER II buffer was then added and cells were vortexed 5 seconds then incubated on ice for 1 min. After 5 second vortex and full speed centrifugation, supernatants (cytoplasmic fraction) were harvested and stored at -80°C. Pellets (nuclei) were resuspended in cold NER buffer and 4 cycles of 15 second vortex then 10-min incubation on ice were performed. After full speed centrifugation, supernatants (nuclear fraction) were harvested and stored at -80°C.\u003c/p\u003e\u003ch2\u003eWestern blot\u003c/h2\u003e\u003cp\u003eCell lysates were sonicated for 20 cycles of 30 seconds ON, 30 seconds OFF (Bioruptor Pico, Diagenode) and 4X Laemmli (250 mM Tris-HCl pH 7, 8% sodium dodecyl sulphate (SDS), 40% glycerol, 10% β-mercaptoethanol and 0.005% bromophenol blue) was added. After denaturation at 95°C for 5 min, samples underwent SDS polyacrylamide gel electrophoresis (SureCast Gel Handcast System, Thermo Fisher Scientific) and were transferred on a 0.45 µm nitrocellulose membrane (Sigma Aldrich). Membranes were saturated in PBS containing 0.05% Tween 20 (Sigma) and 10% milk powder for 30 min. Primary antibodies were added and left overnight at 4°C (\u003cb\u003eTable S3\u003c/b\u003e). After 3 PBS washes, secondary antibodies were added for 1 h at R/T (\u003cb\u003eTable S3\u003c/b\u003e). Protein revelation was carried out by measuring HRP activity (Immobilon Forte Western HRP substrate, Merck) with a Chemidoc imager (Biorad).\u003c/p\u003e\u003ch2\u003eTCID50 assay\u003c/h2\u003e\u003cp\u003eMDCK cells were washed in FBS-free MEM medium (Gibco) and serially diluted cell supernatants were added in 2% FBS in octoplicates. After 3 days at 37°C and 5% CO2, cells were washed twice in PBS and fixed with 4% PFA for 10 min at R/T. Violet crystal was added, washed twice in water and cytopathic effect was observed. The TCID50 titer was determined using the formula:\u003c/p\u003e\u003cp\u003elog10 (TCID50/mL) = x0 - (d/2) + (d*xi/n) + ν\u003c/p\u003e\u003cp\u003ex0: decimal logarithm of initial dilution factor.\u003c/p\u003e\u003cp\u003ed: decimal logarithm of serial dilution factor.\u003c/p\u003e\u003cp\u003exi: score of positive events.\u003c/p\u003e\u003cp\u003en: number of replicates.\u003c/p\u003e\u003cp\u003eν: decimal logarithm of the inoculum volume (mL).\u003c/p\u003e\u003ch2\u003ePeripheral blood mononuclear cell (PBMC) isolation\u003c/h2\u003e\u003cp\u003eBuffy coats from healthy donors were obtained from the Établissement Français du Sang (EFS). Whole blood was diluted by half with Phosphate buffered saline (PBS) and loaded on an equivalent volume of Lymphoprep (Stemcell technologies) at R/T. Tubes were centrifuged at 800g for 30 min at 20°C without brakes. The PBMC ring was collected using a 5 mL pipet and washed 3 times in a final volume of 50 mL of PBS (centrifugations at 1200 rpm for 5 min at 20°C with brakes on). The cell pellet was resuspended in 30 mL of 10% FBS RPMI-1640 medium. PBMCs were counted manually using counting chambers (Kova).\u003c/p\u003e\u003ch2\u003eMonocyte-derived macrophages differentiation\u003c/h2\u003e\u003cp\u003eAfter PBMC isolation, 20\u0026nbsp;million cells were seeded per well into 6-well plates and incubated for 45 min, at 37°C with 5% CO2. After monocyte adherence, cells were washed 3 times with 10% FBS RPMI-1640 medium directly on the cell layers to remove non-attached cells. For monocyte-derived macrophage (MDM) differentiation, monocytes were cultured in 10% FBS RPMI-1640 medium containing GM-CSF (50 ng/mL, Gentaur) for 8 days.\u003c/p\u003e\u003ch2\u003eFlow cytometry phenotyping\u003c/h2\u003e\u003cp\u003eAfter 8 days of MDM differentiation, phenotypic markers were analysed by flow cytometry on a Fortessa using the following antibodies: CD3-BV421 (clone UCHT1, Biolegend 300433), CD14-PerCP-Cy5.5 (clone HCD14, Biolegend 325621), CD16-Alexa700 (clone 3G8, Biolegend 302026), CD11b-APC-Cy7 (clone M1/70, Biolegend 101225), HLA-DR-FITC (REA805, Miltenyi 130-111-941), and CD80-BV650 (clone 2D10, Biolegend 305227).\u003c/p\u003e\u003ch2\u003eMultiplex LUMINEX assay\u003c/h2\u003e\u003cp\u003eThe presence of mediators of inflammation was assessed in supernatants of stimulated cells using the ProcartaPlex Human inflammation Panel 20-plex kit (Invitrogen, ThermoFisher Scientific). A few samples were centrifuged and diluted to the 1/10 or to the 1/50 in order to determine optimal dilution for the experiment. Dilution to the 1/50 was chosen to detect the strongly induced mediators (e.g. IL-8) in the range of the standard curves supplied in the kit. Buffers and standards were prepared according to the manufacturer’s protocol. Briefly, Capture Bead mix was vortexed and added to the plate, washed in Wash buffer, then samples and standards were added. The plate was incubated 1 h at R/T on a shaker. After 2 washes, Biotinylated Detection Antibody mix was added for 30 min at R/T on a shaker. After 2 washes, Streptavidin-PE was added for 30 min at R/T on a shaker. After 2 more washes, the plate was read on the MAGPIX flow cytometer (LUMINEX).\u003c/p\u003e\u003ch2\u003eEstablishment of U2OS clones expressing RANBP2 T585M by CRISPR knock-in\u003c/h2\u003e\u003cp\u003eThe plasmid pUcIDT Amp (synthetized by Integrated DNA Technologies) containing the donor sequences (see below) and the plasmid pSpCas9(BB)-2A-Puro (PX459) (Addgene #62988) modified to contain the guide sequences (GGCAGAATGCCTTCAGAAAA) were co-transfected at equal quantity in the human osteosarcoma cell lines U2OS using Lipofectamine 3000 (Invitrogen, ThermoFisher Scientific) following the manufacturer’s instructions. Two days post-transfection, cells were selected using puromycin (Gibco) at 2µg/ml during four days. The different clones were established by limiting dilution. A total of 198 cells were split in 576 different wells containing 10% FBS DMEM medium. After 3 weeks, 47 clones were established and analyzed by RANBP2-specific RTqPCR as describe above and Sanger sequencing (Eurofins).\u003c/p\u003e\u003ch2\u003e\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eDonor DNA sequence\u003c/span\u003e:\u003c/h2\u003e\u003cp\u003e(GCGGTTTGTACTCTGATTCACAGAAAAGCAGTgtaagtagtaaaacaaaaatattgctttcacttagtgcgtaggttttaccggggatttaatcctcatgtg aagatttaatttgtcatgtgacccattaacatatatgtatgtaagccctgaactgtgtatttagaaagcaattttagtaaattgaactattttttagACCTGGAAACGTAGCAAA ATTGAGACTTCTAGTTCAGCATGAAATAAACACTCTAAGAGCCCAGGAAAAACATGGCCTTCAACCTGCTCTGC TTGTACATTGGGCAGA\u003cu\u003eg\u003c/u\u003eTG\u003cu\u003et\u003c/u\u003eCT\u003cu\u003eg\u003c/u\u003eCAGAAAA\u003cstrong\u003e\u003cu\u003et\u003c/u\u003e\u003c/strong\u003eGgtgagttttaaagtataagcatttttaaagaacattaccttaattttttaaaatcatgaactttttattgaaagtttt tttgttctgaaaacagcagcttggtcacattatgacagatgtgttttttattgctgcaaaatagttaatgtagttaaatataagcacttagaggagcaatgcctggcacacagtgaatgttacat attagctgagctgttactgttattccttaataattaagttctgataattattcagcctgaaaattaaaaaaa)\u003c/p\u003e\u003cp\u003eCapital letters: exon\u003c/p\u003e\u003cp\u003elowercase: intron\u003c/p\u003e\u003cp\u003eunderlined: mutations\u003c/p\u003e\u003cp\u003eBold lowercase: C1754T mutation\u003c/p\u003e\u003ch2\u003eGeneration of homozygous/heterozygous RANBP2-expressing control cells for allelic qPCR\u003c/h2\u003e\u003cp\u003eHEK-293T cells were transfected with plasmids encoding the mCherry-RanBP2-shRNA and either GFP-RANBP2-WT, GFP-RANBP2-T585M or both (\u003cb\u003eTable S1\u003c/b\u003e) in calcium phosphate. After 48 h of culture, cells were detached using trypsin (Gibco) and sorted on the ARIA IIu cytometer (Becton Dickinson) of the MRI platform to isolate the mCherry-positive cells. Sorted cells were lyzed and total RNAs were extracted using the RNeasy mini kit (Qiagen) according to the manufacturer’s protocol.\u003c/p\u003e\u003ch2\u003eStatistical analysis\u003c/h2\u003e\u003cp\u003eStatistical analysis was performed using the GraphPad Prism software (10.2.3).\u003c/p\u003e"},{"header":"Declarations","content":"\u003ch2\u003eACKNOWLEDGMENTS\u003c/h2\u003e \u003cp\u003eThis work was financed by grants from the Agence Nationale de la Recherche (ANR-23-CE15-0005-01) and ANRS-MIE (ECTZ209411). We thank Marion Cannac (Universit\u0026eacute; de Montpellier, France) for help with phenotyping primary macrophages, and Montpellier Ressources Imagerie (MRI) for support with flow cytometry, cell sorting and imaging. We thank Rick Wozniak (University of Alberta, Canada) for the kind gift of RANBP2-specific antibody, Jomon Joseph (National Center for Cell Science, Pune, India) for the GFP-RANBP2 construct, and S\u0026eacute;bastien Nisole (INSERM) for the GFP-RANBP2-T585M construct.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eBartolini L, Ricci S, Azzari C, Moriondo M, Nieddu F, L\u0026rsquo;Erario M, Ricci Z, Simonini G, Mortilla M, Indolfi G, Montagnani C, Chiappini E, Galli L, Guerrini R (2024) Severe A(H1N1)pdm09 influenza acute encephalopathy outbreak in children in Tuscany, Italy, December 2023 to January 2024. Eurosurveillance 29. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.2807/1560-7917.ES.2024.29.17.2400199\u003c/span\u003e\u003cspan address=\"10.2807/1560-7917.ES.2024.29.17.2400199\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBashiri FA, Al Johani S, Hamad MH, Kentab AY, Alwadei AH, Hundallah K, Hasan HH, Alshuaibi W, Jad L, Alrifai MT, Hudairi A, Al Sheikh R, Alenizi A, Alharthi NA, Abdelmagid TA, Ba-Armah D, Salih MA, Tabarki B (2020) Acute Necrotizing Encephalopathy of Childhood: A Multicenter Experience in Saudi Arabia. Front Pediatr 8:526. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/fped.2020.00526\u003c/span\u003e\u003cspan address=\"10.3389/fped.2020.00526\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBichel K, Price AJ, Schaller T, Towers GJ, Freund SM, James LC (2013) HIV-1 capsid undergoes coupled binding and isomerization by the nuclear pore protein NUP358. \u003cem\u003eRetrovirology\u003c/em\u003e. 10:81. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/1742-4690-10-81\u003c/span\u003e\u003cspan address=\"10.1186/1742-4690-10-81\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBley CJ, Nie S, Mobbs GW, Petrovic S, Gres AT, Liu X, Mukherjee S, Harvey S, Huber FM, Lin DH, Brown B, Tang AW, Rundlet EJ, Correia AR, Chen S, Regmi SG, Stevens TA, Jette CA, Dasso M, Patke A, Palazzo AF, Kossiakoff AA, Hoelz A (2022) Architecture of the cytoplasmic face of the nuclear pore. Science 376:eabm9129. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1126/science.abm9129\u003c/span\u003e\u003cspan address=\"10.1126/science.abm9129\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCarlon-Andres I, Lagadec F, Pied N, Rayne F, Lafon M-E, Kehlenbach RH, Wodrich H (2020) Nup358 and Transportin 1 Cooperate in Adenoviral Genome Import. J Virol 94:e00164\u0026ndash;e00120. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1128/JVI.00164-20\u003c/span\u003e\u003cspan address=\"10.1128/JVI.00164-20\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCarter T, Iqbal M (2024) The Influenza A Virus Replication Cycle: A Comprehensive Review. Viruses 16:316. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/v16020316\u003c/span\u003e\u003cspan address=\"10.3390/v16020316\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChatur N, Yea C, Ertl-Wagner B, Yeh EA (2022) Outcomes in influenza and \u003cem\u003eRANBP2\u003c/em\u003e mutation‐associated acute necrotizing encephalopathy of childhood. Dev Med Child Neurol 64:1008\u0026ndash;1016. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/dmcn.15165\u003c/span\u003e\u003cspan address=\"10.1111/dmcn.15165\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eClohisey S, Baillie JK (2019) Host susceptibility to severe influenza A virus infection. Crit Care 23:303. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/s13054-019-2566-7\u003c/span\u003e\u003cspan address=\"10.1186/s13054-019-2566-7\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCopeland AM, Newcomb WW, Brown JC (2009) Herpes Simplex Virus Replication: Roles of Viral Proteins and Nucleoporins in Capsid-Nucleus Attachment. J Virol 83:1660\u0026ndash;1668. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1128/JVI.01139-08\u003c/span\u003e\u003cspan address=\"10.1128/JVI.01139-08\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCros JF, Garc\u0026iacute;a-Sastre A, Palese P (2005) An Unconventional NLS is Critical for the Nuclear Import of the Influenza A Virus Nucleoprotein and Ribonucleoprotein. Traffic 6:205\u0026ndash;213. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/j.1600-0854.2005.00263.x\u003c/span\u003e\u003cspan address=\"10.1111/j.1600-0854.2005.00263.x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDesgraupes S, Etienne L, Arhel NJ (2023) RANBP2 evolution and human disease. FEBS Lett 597:2519\u0026ndash;2533. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1002/1873-3468.14749\u003c/span\u003e\u003cspan address=\"10.1002/1873-3468.14749\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDi Nunzio F, Danckaert A, Fricke T, Perez P, Fernandez J, Perret E, Roux P, Shorte S, Charneau P, Diaz-Griffero F, Arhel NJ (2012) Human Nucleoporins Promote HIV-1 Docking at the Nuclear Pore, Nuclear Import and Integration. PLoS ONE 7:e46037. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1371/journal.pone.0046037\u003c/span\u003e\u003cspan address=\"10.1371/journal.pone.0046037\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDou D, Revol R, \u0026Ouml;stbye H, Wang H, Daniels R (2018) Influenza A Virus Cell Entry, Replication, Virion Assembly and Movement. Front Immunol 9:1581. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/fimmu.2018.01581\u003c/span\u003e\u003cspan address=\"10.3389/fimmu.2018.01581\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eElton D, Simpson-Holley M, Archer K, Medcalf L, Hallam R, McCauley J, Digard P (2001) Interaction of the Influenza Virus Nucleoprotein with the Cellular CRM1-Mediated Nuclear Export Pathway. J Virol 75:408\u0026ndash;419. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1128/JVI.75.1.408-419.2001\u003c/span\u003e\u003cspan address=\"10.1128/JVI.75.1.408-419.2001\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFernandez J, Hassen-Khodja C, Georget V, Rose T, Jacob Y, Janin YL, Nisole S, Vidalain P-O, Arhel NJ (2021) Measuring the subcellular compartmentalization of viral infections by protein complementation assay. \u003cem\u003eProc. Natl. Acad. Sci.\u003c/em\u003e 118:e2010524118. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1073/pnas.2010524118\u003c/span\u003e\u003cspan address=\"10.1073/pnas.2010524118\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFodor E, Te Velthuis AJW (2020) Structure and Function of the Influenza Virus Transcription and Replication Machinery. Cold Spring Harb Perspect Med 10:a038398. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1101/cshperspect.a038398\u003c/span\u003e\u003cspan address=\"10.1101/cshperspect.a038398\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGounder AP, Boon ACM (2019) Influenza Pathogenesis: The Effect of Host Factors on Severity of Disease. J Immunol Baltim Md 1950 202:341\u0026ndash;350. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.4049/jimmunol.1801010\u003c/span\u003e\u003cspan address=\"10.4049/jimmunol.1801010\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGouy B, Decorsi\u0026egrave;re A, Desgraupes S, Duan W, Ouyang H, Wang YE, Yeh EA, Palazzo AF, Moraes TJ, Nisole S, Arhel NJ (2023) Rapid and inexpensive bedside diagnosis of RAN binding protein 2-associated acute necrotizing encephalopathy. Front Neurol 14:1282059. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/fneur.2023.1282059\u003c/span\u003e\u003cspan address=\"10.3389/fneur.2023.1282059\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHemerka JN, Wang D, Weng Y, Lu W, Kaushik RS, Jin J, Harmon AF, Li F (2009) Detection and Characterization of Influenza A Virus PA-PB2 Interaction through a Bimolecular Fluorescence Complementation Assay. J Virol 83:3944\u0026ndash;3955. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1128/JVI.02300-08\u003c/span\u003e\u003cspan address=\"10.1128/JVI.02300-08\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHofemeister H, O\u0026rsquo;Hare P (2008) Nuclear pore composition and gating in herpes simplex virus-infected cells. J Virol 82:8392\u0026ndash;8399. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1128/JVI.00951-08\u003c/span\u003e\u003cspan address=\"10.1128/JVI.00951-08\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHuet S, Avilov SV, Ferbitz L, Daigle N, Cusack S, Ellenberg J (2010) Nuclear Import and Assembly of Influenza A Virus RNA Polymerase Studied in Live Cells by Fluorescence Cross-Correlation Spectroscopy. J Virol 84:1254\u0026ndash;1264. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1128/JVI.01533-09\u003c/span\u003e\u003cspan address=\"10.1128/JVI.01533-09\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHutten S, Flotho A, Melchior F, Kehlenbach RH (2008) The Nup358-RanGAP Complex Is Required for Efficient Importin α/β-dependent Nuclear Import. Mol Biol Cell 19:2300\u0026ndash;2310. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1091/mbc.e07-12-1279\u003c/span\u003e\u003cspan address=\"10.1091/mbc.e07-12-1279\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eIwasaki A, Pillai PS (2014) Innate immunity to influenza virus infection. Nat Rev Immunol 14:315\u0026ndash;328. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/nri3665\u003c/span\u003e\u003cspan address=\"10.1038/nri3665\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJiang J, Wang YE, Palazzo AF, Shen Q (2022) Roles of Nucleoporin RanBP2/Nup358 in Acute Necrotizing Encephalopathy Type 1 (ANE1) and Viral Infection. Int J Mol Sci 23:3548. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/ijms23073548\u003c/span\u003e\u003cspan address=\"10.3390/ijms23073548\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJoseph J, Dasso M (2008) The nucleoporin Nup358 associates with and regulates interphase microtubules. FEBS Lett 582:190\u0026ndash;196. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.febslet.2007.11.087\u003c/span\u003e\u003cspan address=\"10.1016/j.febslet.2007.11.087\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKhanna M, Sharma K, Saxena SK, Sharma JG, Rajput R, Kumar B (2024) Unravelling the interaction between Influenza virus and the nuclear pore complex: insights into viral replication and host immune response. VirusDisease 35:231\u0026ndash;242. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s13337-024-00879-6\u003c/span\u003e\u003cspan address=\"10.1007/s13337-024-00879-6\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKoh JC, Murugasu A, Krishnappa J, Thomas T (2019) Favorable Outcomes With Early Interleukin 6 Receptor Blockade in Severe Acute Necrotizing Encephalopathy of Childhood. Pediatr Neurol 98:80\u0026ndash;84. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.pediatrneurol.2019.04.009\u003c/span\u003e\u003cspan address=\"10.1016/j.pediatrneurol.2019.04.009\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLee VWM, Khoo TB, Teh CM, Heng HS, Li L, Yusof YLM, Yahaya NA, Dharshini S, Wong SW, Nickson T, ANE Malaysia Outcome Study Group (2023) Factors associated with outcomes of severe acute necrotizing encephalopathy: A multicentre experience in Malaysia. Dev Med Child Neurol 65:1256\u0026ndash;1263. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/dmcn.15536\u003c/span\u003e\u003cspan address=\"10.1111/dmcn.15536\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLevine JM, Ahsan N, Ho E, Santoro JD (2020) Genetic Acute Necrotizing Encephalopathy Associated with RANBP2: Clinical and Therapeutic Implications in Pediatrics. Mult Scler Relat Disord 43:102194. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.msard.2020.102194\u003c/span\u003e\u003cspan address=\"10.1016/j.msard.2020.102194\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi J, Su L, Jiang J, Wang YE, Ling Y, Qiu Y, Yu H, Huang Y, Wu J, Jiang S, Zhang T, Palazzo AF, Shen Q (2023) RanBP2/Nup358 Mediates Sumoylation of STAT1 and Antagonizes Interferon-α-Mediated Antiviral Innate Immunity. Int J Mol Sci 25:299. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/ijms25010299\u003c/span\u003e\u003cspan address=\"10.3390/ijms25010299\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMa K, Roy A-MM, Whittaker GR (2001) Nuclear Export of Influenza Virus Ribonucleoproteins: Identification of an Export Intermediate at the Nuclear Periphery. Virology 282:215\u0026ndash;220. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1006/viro.2001.0833\u003c/span\u003e\u003cspan address=\"10.1006/viro.2001.0833\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMaarifi G, Fernandez J, Portilho DM, Boulay A, Dutrieux J, Oddos S, Butler-Browne G, Nisole S, Arhel NJ (2018) RanBP2 regulates the anti-retroviral activity of TRIM5α by SUMOylation at a predicted phosphorylated SUMOylation motif. Commun Biol 1:193. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s42003-018-0198-0\u003c/span\u003e\u003cspan address=\"10.1038/s42003-018-0198-0\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMettelman RC, Thomas PG (2021) Human Susceptibility to Influenza Infection and Severe Disease. Cold Spring Harb Perspect Med 11:a038711. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1101/cshperspect.a038711\u003c/span\u003e\u003cspan address=\"10.1101/cshperspect.a038711\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMiyake Y, Keusch JJ, Decamps L, Ho-Xuan H, Iketani S, Gut H, Kutay U, Helenius A, Yamauchi Y (2019) Influenza virus uses transportin 1 for vRNP debundling during cell entry. Nat Microbiol 4:578\u0026ndash;586. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41564-018-0332-2\u003c/span\u003e\u003cspan address=\"10.1038/s41564-018-0332-2\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMizuguchi M, Yamanouchi H, Ichiyama T, Shiomi M (2007) Acute encephalopathy associated with influenza and other viral infections. Acta Neurol Scand 115:45\u0026ndash;56. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/j.1600-0404.2007.00809.x\u003c/span\u003e\u003cspan address=\"10.1111/j.1600-0404.2007.00809.x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMunier S, Rolland T, Diot C, Jacob Y, Naffakh N (2013) Exploration of Binary Virus\u0026ndash;Host Interactions Using an Infectious Protein Complementation Assay. Mol Cell Proteom 12:2845\u0026ndash;2855. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1074/mcp.M113.028688\u003c/span\u003e\u003cspan address=\"10.1074/mcp.M113.028688\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNeilson DE, Eiben RM, Waniewski S, Hoppel CL, Varnes ME, Bangert BA, Wiznitzer M, Warman ML, Kerr DS (2003) Autosomal dominant acute necrotizing encephalopathy. Neurology 61:226\u0026ndash;230. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1212/01.WNL.0000073544.28775.1A\u003c/span\u003e\u003cspan address=\"10.1212/01.WNL.0000073544.28775.1A\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNguyen NLT, Wu W, Pant\u0026eacute; N (2023) Contribution of the Nuclear Localization Sequences of Influenza A Nucleoprotein to the Nuclear Import of the Influenza Genome in Infected Cells. Viruses 15:1641. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/v15081641\u003c/span\u003e\u003cspan address=\"10.3390/v15081641\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOkumura A, Mizuguchi M, Kidokoro H, Tanaka M, Abe S, Hosoya M, Aiba H, Maegaki Y, Yamamoto H, Tanabe T, Noda E, Imataka G, Kurahashi H (2009) Outcome of acute necrotizing encephalopathy in relation to treatment with corticosteroids and gammaglobulin. Brain Dev 31:221\u0026ndash;227. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.braindev.2008.03.005\u003c/span\u003e\u003cspan address=\"10.1016/j.braindev.2008.03.005\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePortilho DM, Fernandez J, Ringeard M, Machado AK, Boulay A, Mayer M, M\u0026uuml;ller-Trutwin M, Beignon A-S, Kirchhoff F, Nisole S, Arhel NJ (2016) Endogenous TRIM5α Function Is Regulated by SUMOylation and Nuclear Sequestration for Efficient Innate Sensing in Dendritic Cells. Cell Rep 14:355\u0026ndash;369. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.celrep.2015.12.039\u003c/span\u003e\u003cspan address=\"10.1016/j.celrep.2015.12.039\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSakuma H, Thomas T, Debinski C, Eyre M, Han VX, Jones HF, Kawano G, Lee VW, Malone S, Matsuishi T, Mohammad SS, Mori T, Nishida H, Nosadini M, Takanashi J-I, Mizuguchi M, Lim M, Dale RC (2025) International consensus definitions for infection-triggered encephalopathy syndromes. Dev Med Child Neurol 67:195\u0026ndash;207. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/dmcn.16067\u003c/span\u003e\u003cspan address=\"10.1111/dmcn.16067\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSchaller T, Ocwieja KE, Rasaiyaah J, Price AJ, Brady TL, Roth SL, Hu\u0026eacute; S, Fletcher AJ, Lee K, KewalRamani VN, Noursadeghi M, Jenner RG, James LC, Bushman FD, Towers GJ (2011) HIV-1 Capsid-Cyclophilin Interactions Determine Nuclear Import Pathway, Integration Targeting and Replication Efficiency. PLOS Pathog 7:e1002439. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1371/journal.ppat.1002439\u003c/span\u003e\u003cspan address=\"10.1371/journal.ppat.1002439\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShen Q, Wang YE, Truong M, Mahadevan K, Wu JJ, Zhang H, Li J, Smith HW, Smibert CA, Palazzo AF (2021) RanBP2/Nup358 enhances miRNA activity by sumoylating Argonautes. PLOS Genet 17:e1009378. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1371/journal.pgen.1009378\u003c/span\u003e\u003cspan address=\"10.1371/journal.pgen.1009378\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSugaya N (2002) Influenza-associated encephalopathy in Japan. Semin Pediatr Infect Dis 13:79\u0026ndash;84. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1053/spid.2002.122993\u003c/span\u003e\u003cspan address=\"10.1053/spid.2002.122993\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWatanabe K, Takizawa N, Katoh M, Hoshida K, Kobayashi N, Nagata K (2001) Inhibition of nuclear export of ribonucleoprotein complexes of influenza virus by leptomycin B. Virus Res 77:31\u0026ndash;42. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/S0168-1702(01)00263-5\u003c/span\u003e\u003cspan address=\"10.1016/S0168-1702(01)00263-5\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWatanabe T, Watanabe S, Kawaoka Y (2010) Cellular Networks Involved in the Influenza Virus Life Cycle. Cell Host Microbe 7:427\u0026ndash;439. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.chom.2010.05.008\u003c/span\u003e\u003cspan address=\"10.1016/j.chom.2010.05.008\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWu J, Matunis MJ, Kraemer D, Blobel G, Coutavas E (1995) Nup358, a Cytoplasmically Exposed Nucleoporin with Peptide Repeats, Ran-GTP Binding Sites, Zinc Fingers, a Cyclophilin A Homologous Domain, and a Leucine-rich Region. J Biol Chem 270:14209\u0026ndash;14213. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1074/jbc.270.23.14209\u003c/span\u003e\u003cspan address=\"10.1074/jbc.270.23.14209\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWu X, Wu W, Pan W, Wu L, Liu K, Zhang H-L (2015) Acute Necrotizing Encephalopathy: An Underrecognized Clinicoradiologic Disorder. \u003cem\u003eMediators Inflamm.\u003c/em\u003e 2015:792578. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1155/2015/792578\u003c/span\u003e\u003cspan address=\"10.1155/2015/792578\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYokoyama N, Hayashi N, Seki T, Pant\u0026eacute; N, Ohba T, Nishii K, Kuma K, Hayashida T, Miyata T, Aebi U, Fukui M, Nishimoto T (1995) A giant nucleopore protein that binds Ran/TC4. Nature 376:184\u0026ndash;188. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/376184a0\u003c/span\u003e\u003cspan address=\"10.1038/376184a0\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang R, Mehla R, Chauhan A (2010) Perturbation of Host Nuclear Membrane Component RanBP2 Impairs the Nuclear Import of Human Immunodeficiency Virus \u0026ndash;\u0026thinsp;1 Preintegration Complex (DNA). PLoS ONE 5:e15620. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1371/journal.pone.0015620\u003c/span\u003e\u003cspan address=\"10.1371/journal.pone.0015620\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhu Z, Fodor E, Keown JR (2023) A structural understanding of influenza virus genome replication. Trends Microbiol 31:308\u0026ndash;319. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.tim.2022.09.015\u003c/span\u003e\u003cspan address=\"10.1016/j.tim.2022.09.015\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":true,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"nature-portfolio","isNatureJournal":true,"hasQc":false,"allowDirectSubmit":false,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"","title":"Nature Portfolio","twitterHandle":"","acdcEnabled":false,"dfaEnabled":false,"editorialSystem":"ejp","reportingPortfolio":"","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"","lastPublishedDoi":"10.21203/rs.3.rs-6597157/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-6597157/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eInfluenza virus infections can cause severe complications such as Acute Necrotizing Encephalopathy (ANE), which is characterised by rapid onset pathological inflammation following febrile infection. Heterozygous dominant mutations in the nucleoporin RANBP2/Nup358 predispose to influenza-triggered ANE1. The aim of our study was to determine whether RANBP2 plays a role in IAV-triggered inflammatory responses. We found that the depletion of RANBP2 in a human airway epithelial cell line increased IAV genomic replication by favouring the import of the viral polymerase subunits, PB1, PB2 and PA, and promoted an abnormal accumulation of some viral segments in the cytoplasm. In human primary macrophages, this corroborated with an enhanced production of the pro-inflammatory chemokines CXCL8, CXCL10, CCL2, CCL3 and CCL4. Then, using CRISPR-Cas9 knock-in for the ANE1 disease variant RANBP2-T585M, we demonstrated that the point mutation is sufficient to drive CXCL10 expression following activation downstream of RIG-I and leads to a redistribution of RANBP2 away from the nuclear pore. Together, our results reveal that RANBP2 regulates influenza RNA replication and nuclear export, triggering hyper-inflammation, offering insight into ANE pathogenesis.\u003c/p\u003e","manuscriptTitle":"The genetic driver of Acute Necrotizing Encephalopathy, RANBP2, regulates the inflammatory response to Influenza A virus infection","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-05-15 12:19:36","doi":"10.21203/rs.3.rs-6597157/v1","editorialEvents":[],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"nature-communications","isNatureJournal":true,"hasQc":false,"allowDirectSubmit":false,"externalIdentity":"NCOMMS","sideBox":"Learn more about [Nature Communications](http://www.nature.com/ncomms/)","snPcode":"","submissionUrl":"https://mts-ncomms.nature.com/","title":"Nature Communications","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"ejp","reportingPortfolio":"Nature Communications","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"5e258145-bd12-44a3-92dd-5920e11569b8","owner":[],"postedDate":"May 15th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[{"id":48505574,"name":"Health sciences/Pathogenesis/Infection"},{"id":48505575,"name":"Health sciences/Pathogenesis/Inflammation"}],"tags":[],"updatedAt":"2026-03-14T07:09:29+00:00","versionOfRecord":{"articleIdentity":"rs-6597157","link":"https://doi.org/10.1038/s41467-026-69288-1","journal":{"identity":"nature-communications","isVorOnly":false,"title":"Nature Communications"},"publishedOn":"2026-02-06 05:00:00","publishedOnDateReadable":"February 6th, 2026"},"versionCreatedAt":"2025-05-15 12:19:36","video":"","vorDoi":"10.1038/s41467-026-69288-1","vorDoiUrl":"https://doi.org/10.1038/s41467-026-69288-1","workflowStages":[]},"version":"v1","identity":"rs-6597157","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-6597157","identity":"rs-6597157","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2025) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00
unpaywall
last seen: 2026-05-23T02:00:01.238055+00:00
License: CC-BY-4.0