Mechanism of MALAT1 in Regulating the Rab25/PI3K/Akt Pathway via miR-125 in a Mouse Model of Psoriasis | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Mechanism of MALAT1 in Regulating the Rab25/PI3K/Akt Pathway via miR-125 in a Mouse Model of Psoriasis Jianan Yao¹, Lisheng Ying², Chun Feng, Xiu Zhang, Xiaoxiang Chen, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-8413152/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 5 You are reading this latest preprint version Abstract Psoriasis, a prevalent and chronic inflammatory skin disorder, lacks a curative therapy largely due to the incomplete understanding of its complex and multifactorial pathogenesis. A growing body of evidence highlights lncRNAs as a focal point in psoriasis research, with specific transcripts driving critical aspects of its immunopathogenesis. The long non-coding RNA MALAT1, frequently dysregulated in psoriatic lesions, has been identified as a key contributor to the disease, with evidence linking its expression to promoting keratinocyte hyperproliferation and inflammatory responses. Consistent with its potential role in pathogenesis, LncRNA-MALAT1 was substantially elevated in psoriatic skin samples, while miR-125 expression was concurrently suppressed. To explore the functional role of LncRNA-MALAT1, we employed an IMQ-induced psoriasis-like mouse model, which recapitulated the dysregulated expression pattern (increased LncRNA-MALAT1, Rab25, PI3K/AKT activity; decreased miR-125). Strikingly, specific knockdown of LncRNA-MALAT1 in vivo markedly alleviated the inflammatory skin manifestations. This phenotypic improvement coincided with a reversal of the molecular signature, namely downregulation of Rab25 and PI3K/AKT signaling and restoration of miR-125 expression. In summary, these findings suggest that LncRNA-MALAT1 may participate in the pathogenesis and progression of psoriasis by activating the Rab25/PI3K/AKT signaling pathway via miR-125, thereby providing a novel therapeutic target for psoriasis treatment. Biological sciences/Cell biology Health sciences/Diseases Health sciences/Medical research Biological sciences/Molecular biology Health sciences/Molecular medicine Health sciences/Pathogenesis Psoriasis LncRNA-MALAT1 miR-125 Rab25 PI3K AKT Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Introduction Psoriasis, a chronic inflammatory skin disease, imposes a significant global health burden, affecting over 125 million individuals worldwide, with a reported prevalence of approximately 0.47% in China 1,2 . The hallmark cutaneous manifestation of psoriasis consists of well-demarcated, erythematous plaques with adherent silvery-white scale, which vary in size and are typically associated with pruritus of variable intensity. Psoriasis is a chronic, relapsing-remitting condition with no definitive cure and is frequently associated with comorbidities including obesity, diabetes, hypertension, and malignancies. This complex disease burden contributes to significant psychological distress, with depression reported in approximately 16.5% of patients 3,4 . While biologics have significantly expanded the therapeutic arsenal for psoriasis, the multifactorial and incompletely understood pathogenesis of the disease—encompassing genetic predisposition, immune dysregulation, and environmental triggers—means that current management remains primarily palliative, aimed at symptom control rather than offering a definitive cure. The lack of response or acquired resistance to certain biologics in some patients underscores the potential need for multi-targeted strategies to achieve optimal outcomes. However, the high cost and associated risks of these agents currently pose significant barriers to implementing such combination regimens. Despite the rationale for combination therapy, the considerable cost and potential adverse effects of biologics pose substantial barriers to its clinical translation 5 . Consequently, there is a pressing need to deepen our understanding of psoriatic pathogenesis to guide the discovery of novel therapeutic agents that are both multi-targeted and possess improved safety profiles. Long non-coding RNAs (lncRNAs) are a class of RNA molecules exceeding 200 nucleotides in length that are implicated in various diseases. They exert their effects by regulating gene expression via mechanisms such as chromatin remodeling and post-transcriptional RNA processing 6,7 . Metastasis-associated lung adenocarcinoma transcript 1 (MALAT1) is a well-characterized long non-coding RNA (lncRNA) located on chromosome 11q13.1, with a length of approximately 6.7 kb and no protein-coding potential. It was first discovered in the context of non-small cell lung cancer 7 . Subsequently, MALAT1 has been firmly established as a key oncogenic driver, with its dysregulation implicated in the pathogenesis of a wide range of human malignancies, including lung, endometrial, cervical, hepatocellular, and colorectal carcinomas. MALAT1 overexpression correlates inversely with patient survival rates and often portends a poorer prognosis across a spectrum of cancers 8–10 . Mounting clinical evidence, including recent domestic studies, indicates a marked upregulation of MALAT1 expression in psoriatic lesions relative to adjacent non-lesional or healthy skin, implicating its potential role in psoriatic pathogenesis. An independent line of evidence from oncology research demonstrates that MALAT1 promotes bladder cancer progression through the downregulation of miR-125, suggesting the potential generality of this interaction across different pathological contexts 11–13 . The pathology of psoriasis is driven by excessive keratinocyte proliferation and impaired terminal differentiation, fostering a microenvironment that parallels that of malignancies. Notably, shared features include cellular hyperproliferation and the development of localized hypoxia 14 . We thus postulate that psoriatic keratinocytes undergo a maladaptive transformation characterized by dysregulated proliferation and acquired resistance to apoptosis, mechanisms mirroring central hallmarks of cancer biology. MicroRNAs (miRNAs) are single-stranded, non-coding RNAs approximately 19–25 nucleotides in length. They function primarily as post-transcriptional regulators by fine-tuning mRNA stability and translation, and their altered expression can critically influence disease progression by serving as tumor suppressors or oncogenes 15 . The microRNA-125 (miR-125) family, predominantly consisting of miR-125a and miR-125b, have attracted considerable interest as key regulators in tumorigenesis and cancer progression. MiR-125a-5p is commonly downregulated in cancers such as those of the colon, ovary, and lung. Consistent with this dysregulation, gain-of-function experiments demonstrate that miR-125a and miR-125b overexpression significantly attenuates tumor cell proliferation and invasive capacity 16–19 . Recent studies have identified characteristic miRNA expression imbalances in both the skin lesions and circulation of psoriasis patients, which play a crucial pathogenic role by orchestrating dysregulated innate and adaptive immunity, cytokine networks, and keratinocyte proliferation and differentiation 20 . MiR-125b has been identified as a top downregulated miRNA in psoriatic skin. In situ hybridization localizes this decrease predominantly to the epidermal compartment, implicating keratinocytes as the major cellular reservoir of its loss. Functional studies in primary human keratinocytes demonstrate that miR-125b acts as a key regulator of epidermal homeostasis: its overexpression inhibits proliferation and promotes differentiation, whereas its antagonism produces the opposite effects, accelerating proliferation and impairing differentiation 21 . Su et al. demonstrated that miR-125a inhibits keratinocyte proliferation and enhances apoptosis. Concurrently, they observed an inverse relationship between its expression and psoriatic inflammation severity, supporting the notion that miR-125a acts as a disease-modifying factor 22,23 . Therefore, miR-125a and miR-125b emerge as key regulatory molecules in inflammatory conditions, as evidenced by their functional impact on keratinocytes and their inverse correlation with disease severity in psoriasis. Rab25 has been validated as a direct target of miR-125a-5p, with this interaction mediating translational inhibition and/or mRNA destabilization of Rab25 24 . The ~ 23 kDa small GTPase Rab25 is characterized by its ability to promote proliferation, inhibit apoptosis, and facilitate invasion, underpinning its oncogenic role across multiple cancer types 25,26 . In epithelial tissues, Rab25 serves as a critical regulator of epidermal development and barrier function, processes essential for skin homeostasis 27 . The PI3K/AKT pathway has been identified as a major downstream effector of Rab25 signaling. Consistent with this regulatory link, AKT is markedly upregulated in psoriatic lesions compared to normal skin, implicating this axis in the disease's pathogenesis 28,29 . In our prior work, analysis of clinical specimens from plaque psoriasis patients revealed a characteristic inverse expression pattern: downregulation of miR-125a-5p alongside Rab25 protein overexpression in progressive lesions 30 . This clinical correlation was substantiated at the cellular level, where we experimentally confirmed that miR-125a-5p directly targets and represses Rab25, providing mechanistic support for this regulatory relationship. Based on this evidence, we hypothesize that miR-125a-5p contributes to psoriasis pathogenesis by targeting Rab25, thereby exerting negative regulation on the downstream PI3K/AKT signaling pathway. Therefore, we propose a mechanistic hypothesis wherein LncRNA-MALAT1, by functioning as a molecular sponge for miR-125, relieves the miR-125-mediated suppression of its target Rab25. This leads to consequent activation of the PI3K/AKT pathway, ultimately contributing to the pathogenesis of psoriasis. To validate this hypothesis, we first confirmed a correlative dysregulation of the proposed axis: both psoriatic patient lesions and IMQ-induced mouse model skin exhibited significant upregulation of LncRNA-MALAT1 concomitant with downregulation of miR-125. Subsequently, in vivo functional studies in the IMQ model demonstrated that LncRNA-MALAT1 knockdown not only ameliorated psoriatic skin inflammation but also concomitantly suppressed the activation of the Rab25/PI3K/AKT signaling pathway. Taken together, our findings delineate a pathogenic role for LncRNA-MALAT1 in psoriasis. Mechanistically, it appears to function as a ceRNA for miR-125, thereby derepressing Rab25 and activating the downstream PI3K/AKT cascade, which collectively drives disease progression. This positions LncRNA-MALAT1 as a promising candidate for therapeutic targeting in psoriasis. Results Differential Expression of LncRNA-MALAT1, miR-125a-5p, and miR-125b-5p in Psoriatic Lesions vs. Normal Human Skin. We first collected skin lesion samples from 14 psoriasis patients and 14 normal skin samples in clinical settings. qRT-PCR analysis demonstrated a significant dysregulation in the expression of the investigated non-coding RNAs. Specifically, LncRNA-MALAT1 expression was significantly upregulated in psoriatic lesions compared to normal skin controls (Fig. 1 A). In contrast, the expression levels of both miR-125a-5p (Fig. 1 B) and miR-125b-5p (Fig. 1 C) were markedly downregulated in psoriatic lesions. Collectively, these findings indicate that altered expression of LncRNA-MALAT1, miR-125a-5p, and miR-125b-5p is associated with the pathological state of psoriasis, suggesting their potential involvement in disease pathogenesis. Establishment of a Psoriasis Mouse Model and Expression of Lnc RNA-MALAT1 Knockdown in Psoriasis Mouse Skin Building upon previous studies, we further aimed to determine the potential role of LncRNA-MALAT1 and miR-125 in the pathogenesis of psoriasis. Specifically, we sought to investigate whether LncRNA-MALAT1 contributes to disease progression by modulating the miR-125 axis, thereby promoting the activation of the Rab25/PI3K/AKT signaling pathway. We locally knocked down Lnc RNA-MALAT1 expression in mouse dorsal skin by injecting lentiviral particles carrying Lnc RNA-MALAT1 shRNA, and observed the effect of Lnc RNA-MALAT1 silencing on disease progression in an IMQ-induced psoriasis-like mouse model. We established four groups: Normal, IMQ, IMQ + shRNA-NC, and IMQ + Lnc RNA-MALAT1 shRNA. Three days before the initiation of the psoriasis-like dermatitis induction, mice in the IMQ + LncRNA-MALAT1 shRNA and IMQ + shRNA-NC groups received a single intradermal injection of 50 µL of the designated lentivirus suspension (titer: 1×10⁹ TU/mL) at the designated dorsal treatment site. Mice in the Normal and IMQ groups received an equal volume of sterile phosphate-buffered saline via the same route. Beginning four days after lentivirus injection, mice in the IMQ, IMQ + shRNA-NC, and IMQ + LncRNA-MALAT1 shRNA groups were subjected to daily topical application of 62.5 mg of 5% IMQ cream on the shaved dorsal area for 7 consecutive days. Mice in the Normal group received daily topical application of an equivalent amount of petroleum jelly (Vaseline®) on the same area. Daily clinical observation revealed distinct cutaneous manifestations among the four experimental groups (Fig. 2 A). The dorsal skin of mice in the Normal group remained unaffected, with no signs of erythema or scaling. In contrast, mice in both the IMQ and IMQ + shRNA-NC groups developed pronounced psoriasiform features, including marked erythema and conspicuous scaling, indicating successful induction of the disease model. Notably, mice in the IMQ + LncRNA-MALAT1 shRNA group exhibited significantly milder clinical presentations; the severity of erythema and scaling was markedly reduced compared to the IMQ and IMQ + shRNA-NC groups. This suggests that local knockdown of LncRNA-MALAT1 attenuates the development of IMQ-induced psoriasiform dermatitis. PASI scores for each group are shown in (Fig. 2 B). Histological analysis of H&E-stained dorsal skin sections revealed distinct morphological changes corresponding to the clinical phenotypes (Fig. 2 C). Skin sections from the Normal group showed normal epidermal structure without pathology. In contrast, skin from the IMQ and IMQ + shRNA-NC groups demonstrated classic histopathological features of psoriasiform dermatitis, including marked epidermal hyperplasia, parakeratosis, the presence of Munro's microabscesses (collections of neutrophils in the stratum corneum), and downward elongation of the rete ridges. The IMQ + LncRNA-MALAT1 shRNA group also exhibited mild epidermal hyperplasia; however, the typical psoriasiform features such as parakeratosis and Munro's microabscesses were significantly attenuated compared to the IMQ and IMQ + shRNA-NC groups. These findings confirm that knockdown of LncRNA-MALAT1 ameliorates the histopathological hallmarks of IMQ-induced psoriasis-like dermatitis. Statistical analysis of epidermal thickness across groups revealed that mice treated with IMQ or IMQ + shRNA‑NC exhibited a significant increase in epidermal thickness relative to the Normal control group (Fig. 2 D). Expression of LncRNA-MALAT1, miR-125, Rab25, and the PI3K/AKT Signaling Pathway in Psoriasis-like Mouse Models Following LncRNA-MALAT1 Knockdown The transcriptional activity of the LncRNA-MALAT1/miR‑125 axis and its downstream effectors was analyzed in skin lesions from all experimental groups. Using qRT‑PCR, we assessed the mRNA expression levels of LncRNA-MALAT1, miR‑125, Rab25, PI3K, and AKT. Compared to the Normal control, the IMQ mice exhibited a significant increase in mRNA levels of LncRNA-MALAT1, Rab25, PI3K, and AKT, accompanied by a marked downregulation of miR‑125. The IMQ + shRNA‑NC group showed a similar dysregulation pattern. Importantly, LncRNA-MALAT1 knockdown in the IMQ + LncRNA-MALAT1 shRNA group reversed this expression signature: the mRNA levels of LncRNA-MALAT1, Rab25, PI3K, and AKT were significantly decreased, while miR‑125 expression was restored, relative to the IMQ + shRNA‑NC control (Fig. 3 ). Western blotting was performed to analyze the expression levels of total PI3K, AKT, Rab25, and their phosphorylated forms (p-PI3K, p-AKT) in dorsal skin tissues from all experimental groups. Western blot analysis revealed that, compared to the Normal group, the IMQ group exhibited a significant upregulation in the protein expression of p-PI3K, p-AKT, and Rab25, whereas the levels of total PI3K and total AKT remained unchanged. In contrast, compared to the IMQ + shRNA-NC group, the IMQ + LncRNA-MALAT1 shRNA group showed a downregulation in p-PI3K and p-AKT protein expression, with no significant alterations in Rab25, total PI3K, or total AKT levels (Fig. 4 ). Notably, the epidermal thickening in the IMQ + LncRNA-MALAT1 shRNA group was significantly reduced compared to the IMQ and IMQ + shRNA‑NC groups, although it remained greater than in Normal controls. Immunohistochemical (IHC) staining was performed to assess the expression and localization of key proteins in the studied pathway (Fig. 5 ). PI3K expression was not detectable in any of the experimental groups under the applied staining conditions. AKT expression was strongly positive in the epidermis of both the IMQ and IMQ + shRNA-NC groups, with prominent staining observed in the cell membrane, cytoplasm, and nuclei. The expression intensity of AKT was markedly reduced to weakly positive levels in the epidermis of the IMQ + LncRNA-MALAT1 shRNA group. Similarly, Rab25 exhibited a robust positive expression pattern in the IMQ and IMQ + shRNA-NC groups, primarily localized to the cell membrane and cytoplasm of keratinocytes. In the IMQ + LncRNA-MALAT1 shRNA group, the intensity of Rab25 staining was substantially diminished, presenting as weakly positive. These results confirm our hypothesis that shRNA-mediated knockdown of LncRNA-MALAT1 attenuates the activity of the PI3K/AKT signaling pathway. The data further demonstrate the critical role of LncRNA-MALAT1 in the pathogenesis of psoriasis. Discussion Psoriasis is a clinically common chronic inflammatory skin disease characterized by persistent recurrence, whose pathogenesis is closely associated with immune system dysregulation. Current research indicates that the development of psoriasis results from the complex interplay of multiple genetic predispositions and various endogenous and exogenous stimuli, including genetic susceptibility, abnormal immune regulation, infections, and trauma 31,32 . The management of psoriasis remains challenging. First, its etiology and pathogenesis are not yet fully elucidated, and a definitive curative therapy is still lacking. Second, the chronic and recurring nature of the disease causes most patients to experience a cyclical pathological process, while a high prevalence of comorbid metabolic disorders (such as hypertension, diabetes, and obesity) further exacerbates physical impairment. The interaction between these biological factors and the uncertainty of therapeutic outcomes ultimately compromises patients' mental health, leading to a significantly increased incidence of anxiety, depression, and other emotional disorders. Therefore, research into the pathogenesis of psoriasis remains a major focus in dermatology. Studies have shown that dysregulated expression of LncRNAs is closely associated with autoimmune diseases 33,34 . Among them, MALAT1 is one of the most extensively studied LncRNAs, and it is ubiquitously expressed in human tissues and highly conserved across species 35,36 . Recent research has revealed that MALAT1 plays a crucial role in the onset and progression of psoriasis: analysis of clinical samples has confirmed that its expression is significantly upregulated in psoriatic lesion tissues, and it contributes to the disease process by influencing keratinocyte proliferation, inflammation, and apoptosis 37 . Previous studies have established that Rab25, a key downstream target of miR-125a-5p, is an intracellular transport protein highly expressed in epithelial tissues and plays a critical role in epidermal differentiation and barrier maintenance 27,38 . Rab25 expression is significantly upregulated in psoriatic lesions. Furthermore, it has been demonstrated that the Phosphatidylinositol 3-Kinase/Protein Kinase B (PI3K/AKT) signaling pathway is aberrantly activated in psoriasis. This pathway exerts a dual pathological effect: it directly drives hyperproliferation of keratinocytes and concurrently promotes pathological angiogenesis in the dermis, both of which jointly sustain and exacerbate lesion progression 39–41 . Based on the established regulatory relationship of miR-125a-5p on Rab25, combined with the known involvement of Rab25 in the PI3K/AKT pathway within psoriasis, we hypothesize that the "miR-125–Rab25–PI3K/AKT" axis constitutes a significant mechanism contributing to the pathogenesis of this disease. In the present study, we demonstrated through both clinical and animal experiments that LncRNA-MALAT1 is significantly upregulated, while miR-125 is markedly downregulated, in psoriatic lesions from patients and in an IMQ-induced psoriasis-like mouse model. Correspondingly, the mRNA expression of Rab25, PI3K, and AKT was significantly increased in the mouse model. Knockdown of LncRNA-MALAT1 in the IMQ-induced psoriasis-like mouse model led to a corresponding upregulation of miR-125 and a downregulation of Rab25, PI3K, and AKT mRNA expression. Although the protein levels of total PI3K and AKT did not show a clear trend of change, the increased expression of their phosphorylated, active forms (p-PI3K and p-AKT) indicates that the PI3K/AKT signaling pathway is aberrantly activated in psoriatic lesions. Following the knockdown of LncRNA-MALAT1, the PI3K/AKT signaling pathway was partially inhibited. Notably, previous studies have identified associations between LncRNA-MALAT1 and various malignant tumors. For instance, in colorectal cancer, LncRNA-MALAT1 acts as a competitive endogenous RNA (ceRNA), interacting with microRNAs to participate in the post-transcriptional regulation of tumorigenesis. Additionally, LncRNA-MALAT1 has been shown to be closely associated with the activation of multiple pro-oncogenic pathways, including the PI3K/AKT signaling pathway 9 . In lung cancer research, miR-125a-5p has been demonstrated to influence Rab25 and its downstream PI3K/AKT signaling pathway 24 . Integrating the experimental results of this study with existing literature, we propose that LncRNA-MALAT1 may competitively bind miR-125, thereby relieving its inhibitory effect on the target gene Rab25, and subsequently regulating the activity of the PI3K/AKT signaling pathway. This perspective is consistent with reported literature and supports the hypothesis that LncRNA-MALAT1 may participate in the pathogenesis of psoriasis by targeting the regulation of miR-125 to activate the Rab25/PI3K/AKT signaling pathway. Furthermore, the statistical analyses in the current study revealed partial asynchrony between transcriptional and protein expression data. This discrepancy may be attributed to the failure of some mRNAs to be successfully translated into their corresponding proteins during the translation process. Additionally, the limited sample size in this study may have contributed to the observed outcomes; increasing the sample size in future investigations could potentially yield more statistically significant results. Current studies indicate that the IMQ-induced psoriasis mouse model effectively recapitulates the core pathological phenotypes of human psoriasis 42 . The underlying mechanism primarily involves the binding of IMQ to Toll-like receptor 7 (TLR7) on epidermal plasmacytoid dendritic cells and macrophages. This interaction triggers the secretion of high levels of interferon-alpha (IFN-α), interleukin-23 (IL-23), IL-17, and IL-22, ultimately leading to psoriasiform pathological changes. These changes are characterized by epidermal hyperplasia, parakeratosis with hyperkeratosis, acanthosis, and inflammatory cell infiltration 43 . In this study, the IMQ-induced psoriasis mouse model exhibited characteristic psoriasiform pathological features. Following knockdown of LncRNA-MALAT1, we observed a significant attenuation of epidermal hyperproliferation and inflammatory cell infiltration. A limitation of the current study is that the measurement of key cytokines such as IL-23, IL-17, and IL-22 could provide further validation of successful model establishment. Assessing these cytokines would also more conclusively demonstrate that the psoriasiform phenotype was mitigated upon LncRNA-MALAT1 knockdown. Immunohistochemical analysis revealed that PI3K expression was negative in all groups. AKT protein was primarily expressed in the cell membrane, cytoplasm, and nucleus of epidermal cells. Its expression was stronger in psoriatic lesions of mice compared to normal skin tissue, and this expression weakened following knockdown of LncRNA-MALAT1. Rab25 protein was mainly expressed in the cell membrane and cytoplasm of epidermal cells. Its expression was also stronger in psoriatic lesions of mice compared to normal skin tissue and decreased after LncRNA-MALAT1 knockdown. These findings support the previously reported characteristics of high Rab25 and AKT protein expression in psoriatic lesions and further confirm our hypothesis. However, PI3K expression was negative in the skin tissues of all mouse groups. A literature search revealed that there are currently no systematic reports on PI3K expression detected by immunohistochemistry in skin tissues. This observation suggests that PI3K expression in skin tissue may have unique characteristics, which warrants further investigation in future studies. Collectively, these findings indicate that LncRNA-MALAT1 is upregulated in psoriasis and may participate in the pathogenesis of the disease in mice by activating the Rab25/PI3K/AKT signaling pathway via the regulation of miR-125. Furthermore, downregulation of LncRNA-MALAT1 ameliorated IMQ-induced psoriasis in mice. Therefore, LncRNA-MALAT1 plays a significant role in the pathogenesis of psoriasis and may represent a novel therapeutic target for the treatment of this condition. Materials and Methods Collection of Human Skin Specimens. After administering local anesthesia with lidocaine, punch biopsies were obtained from lesional skin of 14 patients diagnosed with plaque psoriasis and from comparable sites of 14 age- and sex-matched healthy volunteers at the Department of Dermatology, Affiliated Hospital of Zunyi Medical University. The collected tissue samples were immediately snap-frozen in liquid nitrogen and stored at -80°C until further analysis. This study was conducted in accordance with the declaration of Helsinki Principles and was approved by the Biomedical Research Ethics Committee of the Affiliated Hospital of Zunyi Medical University (Approval No.: KLLY-2021-057). Written informed consent was obtained from all participants. Quantitative Analysis of LncRNA-MALAT1, miR-125a-5p, and miR-125b-5p Expression via qRT‑PCR. Total RNA was isolated from both psoriatic lesional and adjacent normal skin tissues of patients with plaque psoriasis, in accordance with standard procedures for subsequent gene expression profiling. Following extraction according to the manufacturer’s protocol, RNA purity and concentration were assessed spectrophotometrically. cDNA synthesis was performed using a reverse transcription kit under recommended conditions. Amplification reaction mixtures were prepared with SYBR Green Master Mix, and real-time quantitative PCR was carried out on a QuantStudio instrument. Primer sequences used in the assay are listed in Table 1 . Relative expression of target genes was determined using the comparative 2^(-ΔΔCt) method. All samples were analyzed in triplicate to ensure reproducibility. Table 1 Primer sequences for quantitative real‑time PCR. Gene Name Primer Sequence (5′→3′) LncRNA-MALAT1 Forward: TTGCCACTTCTCAACCGTCC Reverse: ACGGGTCATCAAACACCTCAC miR-125a-5p Forward: ACACTCCAGCTGGGTCCCTGAGACCCTTTAAC Reverse: Universal Downstream Primer miR-125b-5p Forward: ACACTCCAGCTGGGTCCCTGAGACCCTAAC Reverse: Universal Downstream Primer GAPDH Forward: GGAAGCTTGTCATCAATGGAAATC Reverse: TGATGACCCTTTTGGCTCCC Animals. A total of 24 healthy, 6- to 8-week-old BALB/c mice (12 males and 12 females; body weight 18–22 g) were purchased from Guizhou Huiji Biotechnology Co., Ltd. (Animal License No. SYXK(Gui)2023-0001). Mice were group-housed under specific-pathogen-free conditions in the Animal Experiment Center of the Affiliated Hospital of Zunyi Medical University, with ambient temperature maintained at 22–27°C, a 12-h light/dark cycle, and ad libitum access to standard chow and water. This study was approved by the Laboratory Animal Ethics Committee of Zunyi Medical University (Approval No.: KLL-2022-270). All experiments involving mice were conducted in accordance with the ARRIVE guidelines. In Vivo Modeling of Imiquimod-Induced Psoriasis-like Dermatitis and LncRNA- MALAT1 shRNA Lentivirus Administration. BALB/c mice were randomly divided into four groups, with six mice per group. After one week of acclimation feeding, hair was removed from a 2 cm × 3 cm area on the dorsal side of each mouse. Following grouping, mice received intradermal injections in the prepared dorsal area according to the following protocol: Normal group: 50 µL of sterile normal saline. IMQ group: 50 µL of sterile normal saline. IMQ + shRNA-NC group: 50 µL of negative control lentivirus at a titer of 1×10⁹ TU/mL. IMQ + LncRNA-MALAT1 shRNA group: 50 µL of LncRNA-MALAT1-targeting shRNA lentivirus at a titer of 1×10⁹ TU/mL. Three days post-injection, model induction commenced. Mice in the IMQ, IMQ + shRNA-NC, and IMQ + LncRNA-MALAT1 shRNA groups received a daily topical application of 62.5 mg of 5% IMQ cream to the shaved dorsal skin. Mice in the Normal group received an equal amount of Vaseline daily as a control. This treatment regimen continued for seven consecutive days. Erythema, scaling, and skin thickening/infiltration on the dorsal skin were observed and recorded daily for all mice. The severity of psoriasiform lesions was quantified using a modified Psoriasis Area and Severity Index (PASI) scoring system. On day 8, all mice were euthanized by cervical dislocation. Full-thickness skin samples, comprising a circular area with a radius of approximately 1 cm centered on the lentivirus injection site, were collected. Each tissue sample was immediately divided into three portions for different downstream analyses: One portion was snap-frozen in liquid nitrogen and stored at -80°C for subsequent RNA extraction and quantitative real-time PCR (qRT-PCR) analysis. Another portion was similarly stored at -80°C for subsequent protein extraction and Western blot analysis. The remaining portion was gently spread flat and fixed in 10% neutral buffered formalin for subsequent paraffin embedding, sectioning, hematoxylin and eosin (H&E) staining, and immunohistochemical (IHC) staining. Analysis of LncRNA-MALAT1, miR-125, Rab25, PI3K, and AKT Expression in Mouse Skin Tissues via qRT-PCR. Total RNA was extracted from mouse dorsal skin tissues using the Total RNA Extraction Kit for Animal Tissues/Cells (Servicebio, Wuhan, China) following the manufacturer’s protocol. RNA concentration and purity were assessed by spectrophotometry (NanoDrop). First-strand cDNA synthesis was performed using the PrimeScript RT Reagent Kit (TaKaRa, RR047A). Quantitative real-time PCR (qRT-PCR) was subsequently carried out using ChamQ SYBR qPCR Master Mix (Vazyme, Q711) on a QuantStudio Real-Time PCR System (Applied Biosystems). The expression levels of the target genes (LncRNA-MALAT1, miR-125, Rab25, PI3K, and AKT) and the reference gene (GAPDH) were quantified. The relative gene expression was calculated using the 2^(-ΔΔCt) method. All reactions were performed in triplicate, and melting curve analysis was performed to verify the specificity of amplification. Primer sequences are listed in Table 2 . Table 2 Primer sequences for quantitative real‑time PCR. Gene Name Primer Sequence (5′→3′) LncRNA-MALAT1 Forward:GAAGAATGGTAGATGGCAAGTTGTC Reverse:AGGAGTGAGGCTTGTGGTAGG miR-125 Forward:TTTGTGGGCAGAGAGGAAACC Reverse:GCAGCAGCATCTTTGAAGGC Rab25 Forward:CCCGAGAGGTCCCTACTGAG Reverse:TGCTGTTCTGCTTCTGCTTGG PI3K Forward:CTATTGCGAGGGAAGCGAGAC Reverse:AGGGAGGTGTGTTGATAATGTAGC AKT Forward:CTACTTCCTCCTCAAGAACGATGG Reverse:AGCGGATGATAAAGGTGTTGGG GAPDH Forward:CTGCCAACGTGTCAGTGGTG Reverse:TCAGTGTAGCCCAGGATGCC Western blot. Frozen mouse skin tissues were homogenized in ice-cold RIPA lysis buffer supplemented with phosphatase and protease inhibitors. The lysates were centrifuged at 12,000 × g for 15 min at 4°C, and the supernatants were collected. Protein concentrations were determined using the BCA Protein Assay Kit. Equal amounts of protein were separated by 10% SDS‑PAGE and transferred onto PVDF membranes. After blocking in TBST for 1 h at room temperature, the membranes were incubated with primary antibodies (dilutions specified in Table 2 ) overnight at 4°C. Following three washes with TBST, the membranes were probed with horseradish peroxidase (HRP)-conjugated secondary antibodies for 1 h at room temperature. Protein bands were visualized using an enhanced chemiluminescence (ECL) substrate and imaged with a chemiluminescence detection system. Band intensities were quantified using ImageJ software. Table 3 Primary antibody information and dilutions used for Western blot analysis. Antibody (Name) Dilution Ratio P-PI3K 1∶1000 PI3K 1∶1000 P-AKT 1∶2000 AKT 1∶2000 Rab25 1∶500 β-actin 1∶50000 References for the specificity validation of all target gene antibodies by Western blot analysis 44–46 . Histopathological Examination via Hematoxylin and Eosin (H&E) Staining. Dorsal skin tissue specimens from mice were fixed in 10% neutral buffered formalin, dehydrated, embedded in paraffin, and sectioned at a thickness of 4–5 µm. The sections were subsequently deparaffinized, rehydrated, and stained with hematoxylin and eosin according to standard protocols. Histopathological evaluation was performed under a light microscope to assess morphological changes, including epidermal hyperplasia, inflammatory cell infiltration in the dermis, and other psoriasiform features. Epidermal thickness was quantified by measuring the vertical distance from the basal layer to the stratum corneum at three randomly selected sites per section using ImageJ software and the mean value was calculated for each sample. Immunohistochemistry (IHC) Staining and Analysis. IHC staining was performed according to standard protocols under the guidance of a qualified pathologist. PBS was used in place of the primary antibody as a negative control. The stained sections were observed under a light microscope. Immunopositivity for Rab25 and PI3K proteins was defined as the presence of pale yellow to brownish-yellow granular staining in the cytoplasm and/or cell membrane, with pale staining indicative of weak positivity and brown staining indicative of strong positivity. For AKT, nuclear, membranous, and/or cytoplasmic staining of pale yellow to brownish-yellow granules was considered indicative of protein expression, similarly graded as weak or strong based on intensity. Statistical Analysis. All experimental data were analyzed using SPSS software (version 29.0) and are presented as the mean ± standard deviation (mean ± SD). Statistical significance was set at p < 0.05. Comparisons between two independent groups were performed using Student’s t-test. For comparisons among more than two groups, one-way analysis of variance (ANOVA) was applied. When the ANOVA results indicated a statistically significant difference (p < 0.05), Tukey’s post hoc test was conducted for multiple comparisons to identify specific intergroup differences. All statistical graphs were generated using GraphPad Prism software (version 10.0). This work was supported by the Natural Science Foundation of Guizhou Province, China (Grant Number: ZK [2023] General 578). Declarations Additional Information Competing interests The authors declare no competing interests. Author Contribution W.Y. conceived and designed the study. Jn.Y. and Ls.Y. performed the experiments. X.Z. and Xx.C. assisted with data analysis. Jn.Y. drafted the manuscript. C.F. participated in its revision. All authors reviewed and approved the final manuscript. Acknowledgments. This work was supported by the Natural Science Foundation of Guizhou Province, China (Grant Number: ZK [2023] General 578). Data Availability The datasets generated during the current study are available from the corresponding author upon reasonable request. References Mahil, S. K. & Smith, C. H. Psoriasis biologics: a new era of choice. Lancet 394 , 807-808 (2019). https://doi.org:10.1016/S0140-6736(19)31772-6 Ding, X. et al. Prevalence of psoriasis in China: a population-based study in six cities. Eur J Dermatol 22 , 663-667 (2012). https://doi.org:10.1684/ejd.2012.1802 Kanda, N. Psoriasis: Pathogenesis, Comorbidities, and Therapy Updated. Int J Mol Sci 22 (2021). https://doi.org:10.3390/ijms22062979 Cohen, B. E., Martires, K. J. & Ho, R. S. Psoriasis and the Risk of Depression in the US Population: National Health and Nutrition Examination Survey 2009-2012. JAMA Dermatol 152 , 73-79 (2016). https://doi.org:10.1001/jamadermatol.2015.3605 Hawkes, J. E., Chan, T. C. & Krueger, J. G. Psoriasis pathogenesis and the development of novel targeted immune therapies. Journal of Allergy and Clinical Immunology 140 , 645-653 (2017). https://doi.org:10.1016/j.jaci.2017.07.004 Raaby, L. et al. Changes in mRNA expression precede changes in microRNA expression in lesional psoriatic skin during treatment with adalimumab. Br J Dermatol 173 , 436-447 (2015). https://doi.org:10.1111/bjd.13721 Goyal, B. et al. Diagnostic, prognostic, and therapeutic significance of long non-coding RNA MALAT1 in cancer. Biochim Biophys Acta Rev Cancer 1875 , 188502 (2021). https://doi.org:10.1016/j.bbcan.2021.188502 Li, Y. et al. Clinical prognostic value of metastasis-associated lung adenocarcinoma transcript 1 in various human cancers: an updated meta-analysis. Int J Biol Markers 31 , e173-182 (2016). https://doi.org:10.5301/jbm.5000185 Uthman, Y. A. et al. MALAT1: A Promising Therapeutic Target for the Treatment of Metastatic Colorectal Cancer. Biochem Pharmacol 190 , 114657 (2021). https://doi.org:10.1016/j.bcp.2021.114657 Wang, T., Zhang, W., Huang, W., Hua, Z. & Li, S. LncRNA MALAT1 was regulated by HPV16 E7 independently of pRB in cervical cancer cells. J Cancer 12 , 6344-6355 (2021). https://doi.org:10.7150/jca.61194 杜悦. 长链非编码RNA 与银屑病发病关系的研究 , 石河子大学, (2019). Han, Y. et al. Hsa-miR-125b suppresses bladder cancer development by down-regulating oncogene SIRT7 and oncogenic long non-coding RNA MALAT1. FEBS Lett 587 , 3875-3882 (2013). Xie, H. et al. LncRNA MALAT1 Inhibits Apoptosis and Promotes Invasion by Antagonizing miR-125b in Bladder Cancer Cells. J Cancer 8 , 3803-3811 (2017). https://doi.org:10.7150/jca.21228 Wu, X., Ma, Y., Wang, L. & Qin, X. A Route for Investigating Psoriasis: From the Perspective of the Pathological Mechanisms and Therapeutic Strategies of Cancer. International Journal of Molecular Sciences 24 (2023). https://doi.org:10.3390/ijms241814390 Domingo, S., Sole, C., Moline, T., Ferrer, B. & Cortes-Hernandez, J. MicroRNAs in Several Cutaneous Autoimmune Diseases: Psoriasis, Cutaneous Lupus Erythematosus and Atopic Dermatitis. Cells 9 (2020). https://doi.org:10.3390/cells9122656 Russo, A. & Potenza, N. Antiproliferative Activity of microRNA-125a and its Molecular Targets. Microrna 8 , 173-179 (2019). https://doi.org:10.2174/2211536608666181105114739 Wu, S. et al. Genetic variations in miR-125 family and the survival of non-small cell lung cancer in Chinese population. Cancer Med 8 , 2636-2645 (2019). https://doi.org:10.1002/cam4.2073 Zhao, Y. L. & Huang, Y. M. LncSNHG14 promotes ovarian cancer by targeting microRNA-125a-5p. Eur Rev Med Pharmacol Sci 23 , 3235-3242 (2019). https://doi.org:10.26355/eurrev_201904_17683 付乐凡, 田珂, 苗国英 & 冯爱平. 基于microRNA-125b靶向信号传导转录激活因子3调控皮肤鳞状细胞癌的增殖和侵袭. 中国热带医学 20 , 1082-1087 (2020). https://doi.org:10.13604/j.cnki.46-1064/r.2020.11.14 Hawkes, J. E. et al. microRNAs in Psoriasis. J Invest Dermatol 136 , 365-371 (2016). https://doi.org:10.1038/JID.2015.409 Jiang, X. et al. The role of microRNA in psoriasis: A review. Exp Dermatol 32 , 1598-1612 (2023). https://doi.org:10.1111/exd.14871 Su, F., Jin, L. & Liu, W. MicroRNA-125a Correlates with Decreased Psoriasis Severity and Inflammation and Represses Keratinocyte Proliferation. Dermatology 237 , 568-578 (2021). https://doi.org:10.1159/000510681 Alatas, E. T., Kara, M., Dogan, G. & Akin Belli, A. Blood microRNA expressions in patients with mild to moderate psoriasis and the relationship between microRNAs and psoriasis activity. An Bras Dermatol 95 , 702-707 (2020). https://doi.org:10.1016/j.abd.2020.07.001 周建国. Hsa-miR-125a-5p 调控Rab25-PI3K/AKT 通路在NSCLC-TKIs 耐药中的作用研究 , 遵义医学院, (2017). Mitra, S., Cheng, K. W. & Mills, G. B. Rab25 in cancer: a brief update. Biochem Soc Trans 40 , 1404-1408 (2012). https://doi.org:10.1042/BST20120249 Wang, S., Hu, C., Wu, F. & He, S. Rab25 GTPase: Functional roles in cancer. Oncotarget 8 , 64591-64599 (2017). https://doi.org:10.18632/oncotarget.19571 Jeong, H., Lim, K. M., Goldenring, J. R. & Nam, K. T. Rab25 Deficiency Perturbs Epidermal Differentiation and Skin Barrier Function in Mice. Biomol Ther (Seoul) 27 , 553-561 (2019). https://doi.org:10.4062/biomolther.2019.125 Fan, Y., Wang, L., Han, X., Liu, X. & Ma, H. Rab25 is responsible for phosphoinositide 3-kinase/AKT‑mediated cisplatin resistance in human epithelial ovarian cancer cells. Mol Med Rep 11 , 2173-2178 (2015). https://doi.org:10.3892/mmr.2014.2963 Varshney, P. & Saini, N. PI3K/AKT/mTOR activation and autophagy inhibition plays a key role in increased cholesterol during IL-17A mediated inflammatory response in psoriasis. Biochim Biophys Acta Mol Basis Dis 1864 , 1795-1803 (2018). https://doi.org:10.1016/j.bbadis.2018.02.003 张霖. MicroRNA-125a-5p 和Rab25 在寻常型银屑病中表达的研究 , 遵义医科大学, (2019). Bu, J., Ding, R., Zhou, L., Chen, X. & Shen, E. Epidemiology of Psoriasis and Comorbid Diseases: A Narrative Review. Front Immunol 13 , 880201 (2022). https://doi.org:10.3389/fimmu.2022.880201 Michalek, I. M., Loring, B. & John, S. M. A systematic review of worldwide epidemiology of psoriasis. J Eur Acad Dermatol Venereol 31 , 205-212 (2017). https://doi.org:10.1111/jdv.13854 Chen, Y. G., Satpathy, A. T. & Chang, H. Y. Gene regulation in the immune system by long noncoding RNAs. Nat Immunol 18 , 962-972 (2017). https://doi.org:10.1038/ni.3771 Hur, K., Kim, S. H. & Kim, J. M. Potential Implications of Long Noncoding RNAs in Autoimmune Diseases. Immune Netw 19 , e4 (2019). https://doi.org:10.4110/in.2019.19.e4 Ji, P. et al. MALAT-1, a novel noncoding RNA, and thymosin beta4 predict metastasis and survival in early-stage non-small cell lung cancer. Oncogene 22 , 8031-8041 (2003). https://doi.org:10.1038/sj.onc.1206928 Zhang, X., Hamblin, M. H. & Yin, K. J. The long noncoding RNA Malat1: Its physiological and pathophysiological functions. RNA Biol 14 , 1705-1714 (2017). https://doi.org:10.1080/15476286.2017.1358347 Elamir, A. M., Shaker, O. G., El-Komy, M. H., Mahmoud Sharabi, M. & Aboraia, N. M. The role of LncRNA MALAT-1 and MiRNA-9 in Psoriasis. Biochem Biophys Rep 26 , 101030 (2021). https://doi.org:10.1016/j.bbrep.2021.101030 Casanova, J. E. et al. Association of Rab25 and Rab11a with the apical recycling system of polarized Madin-Darby canine kidney cells. Mol Biol Cell 10 , 47-61 (1999). https://doi.org:10.1091/mbc.10.1.47 Chamcheu, J. C. et al. Upregulation of PI3K/AKT/mTOR, FABP5 and PPARbeta/delta in Human Psoriasis and Imiquimod-induced Murine Psoriasiform Dermatitis Model. Acta Derm Venereol 96 , 854-856 (2016). https://doi.org:10.2340/00015555-2359 王昊, 冉立伟, 惠珂, 王新阳 & 郑焱. Survivin和PI3K、AKT在寻常型银屑病皮损角质形成细胞中的表达及其相关性. 南方医科大学学报 37 , 1512-1516 (2017). https://doi.org:10.3969/j.issn.1673-4254.2017.11.14 Zhang, M. & Zhang, X. The role of PI3K/AKT/FOXO signaling in psoriasis. Arch Dermatol Res 311 , 83-91 (2019). https://doi.org:10.1007/s00403-018-1879-8 Swindell, W. R. et al. Genome-wide expression profiling of five mouse models identifies similarities and differences with human psoriasis. PLoS One 6 , e18266 (2011). https://doi.org:10.1371/journal.pone.0018266 Shah, N., Deol, G., McMullen, E., Maazi, M. & Vender, R. B. From treatment to trigger: a systematic review of imiquimod-induced psoriasis. Int J Dermatol 63 , e137-e139 (2024). https://doi.org:10.1111/ijd.17267 Chen, J. et al. Bifidobacterium longum subsp. longum B-53 Alleviated Abnormalities of Glycolipid Metabolism and Oxidative Stress in T2DM Mice Through Regulating Gut Microbiota and GLP-1 Secretion. Journal of Agricultural and Food Chemistry 73 , 24169-24186 (2025). https://doi.org:10.1021/acs.jafc.5c07346 Yang, L. et al. Neurons enhance blood–brain barrier function via upregulating claudin-5 and VE-cadherin expression due to glial cell line-derived neurotrophic factor secretion. eLife 13 , RP96161 (2024). https://doi.org:10.7554/eLife.96161 Xu, P. et al. MiR-140 inhibits classical swine fever virus replication by targeting Rab25 in swine umbilical vein endothelial cells. Virulence 11 , 260-269 (2020). https://doi.org:10.1080/21505594.2020.1735051 Additional Declarations No competing interests reported. Supplementary Files SupplementaryInfoFile.pdf Cite Share Download PDF Status: Under Review Version 1 posted Reviewers invited by journal 15 Jan, 2026 Editor assigned by journal 06 Jan, 2026 Editor invited by journal 31 Dec, 2025 Submission checks completed at journal 30 Dec, 2025 First submitted to journal 30 Dec, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-8413152","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":575232166,"identity":"082acbf5-90de-4db9-b244-8f899c066b08","order_by":0,"name":"Jianan Yao¹","email":"","orcid":"","institution":"Affiliated Hospital of Zunyi Medical College","correspondingAuthor":false,"prefix":"","firstName":"Jianan","middleName":"","lastName":"Yao¹","suffix":""},{"id":575232167,"identity":"0a311895-bd90-437e-ad0d-e865467dc7dc","order_by":1,"name":"Lisheng Ying²","email":"","orcid":"","institution":"The Second Affiliated Hospital of Zunyi Medical University","correspondingAuthor":false,"prefix":"","firstName":"Lisheng","middleName":"","lastName":"Ying²","suffix":""},{"id":575232170,"identity":"7a9e32b8-48b7-4c2f-9feb-33c63b2153b9","order_by":2,"name":"Chun Feng","email":"","orcid":"","institution":"Affiliated Hospital of Zunyi Medical College","correspondingAuthor":false,"prefix":"","firstName":"Chun","middleName":"","lastName":"Feng","suffix":""},{"id":575232173,"identity":"6abe291d-3a2f-4ca2-9392-d431d7b2562a","order_by":3,"name":"Xiu Zhang","email":"","orcid":"","institution":"Affiliated Hospital of Zunyi Medical College","correspondingAuthor":false,"prefix":"","firstName":"Xiu","middleName":"","lastName":"Zhang","suffix":""},{"id":575232178,"identity":"ddd7c808-6898-4017-809c-d5397bd8df2b","order_by":4,"name":"Xiaoxiang Chen","email":"","orcid":"","institution":"Affiliated Hospital of Zunyi Medical College","correspondingAuthor":false,"prefix":"","firstName":"Xiaoxiang","middleName":"","lastName":"Chen","suffix":""},{"id":575232180,"identity":"64e5fea4-8a35-4be9-8abf-c0e34a36197b","order_by":5,"name":"Wen Yan","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAwElEQVRIiWNgGAWjYDADfmbmww9I0yLZzpZmQJoWg/M8ChJEqZSfkWP4ubDNJs/4MA+DAUONTTRBLYwzcoylZ7alFZsd5j3wgOFYWm4DIS3MEjkG0rzbDiduO8yXYMDYcJiwFjaJHOPfvNv+J25u5jGQIEoLj0SOGdCWA4kbmInVIsHzrMya919y4ozDwEBOIMYv8u3Jm2/znLFL7O8/fPjBhxobwloYBDKQIjCBoHIQ4D/+gCh1o2AUjIJRMIIBAOALO+JGhEzmAAAAAElFTkSuQmCC","orcid":"","institution":"Affiliated Hospital of Zunyi Medical College","correspondingAuthor":true,"prefix":"","firstName":"Wen","middleName":"","lastName":"Yan","suffix":""}],"badges":[],"createdAt":"2025-12-20 15:38:28","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-8413152/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-8413152/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":100665491,"identity":"2f1e8233-ce8d-4abc-8d48-91d4798d3d52","added_by":"auto","created_at":"2026-01-20 09:27:36","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":989407,"visible":true,"origin":"","legend":"","description":"","filename":"MechanismofMALAT1inRegulatingtheRab25PI3KAktPathwayviamiR125inaMouseModelofPsoriasis.docx","url":"https://assets-eu.researchsquare.com/files/rs-8413152/v1/8ada9faa759218de6fa03bfe.docx"},{"id":100665525,"identity":"e02921f9-b761-4c67-89f6-da975c911ccd","added_by":"auto","created_at":"2026-01-20 09:28:03","extension":"json","order_by":1,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":7262,"visible":true,"origin":"","legend":"","description":"","filename":"79a40bc6c7874c73ba3b37093012fc38.json","url":"https://assets-eu.researchsquare.com/files/rs-8413152/v1/f5d770ccdaba86b81b3aa108.json"},{"id":100665609,"identity":"862ba3d0-a04b-46cf-be40-dd480df795d3","added_by":"auto","created_at":"2026-01-20 09:29:04","extension":"pdf","order_by":2,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":417374,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryInfoFile.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8413152/v1/f4c99be3ee02c953f67d224b.pdf"},{"id":100665531,"identity":"7f3222c6-4ecd-4dfc-95b4-f0cfb644a848","added_by":"auto","created_at":"2026-01-20 09:28:06","extension":"xml","order_by":3,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":77293,"visible":true,"origin":"","legend":"","description":"","filename":"79a40bc6c7874c73ba3b37093012fc381enriched.xml","url":"https://assets-eu.researchsquare.com/files/rs-8413152/v1/0d8faf90ba15c7f6987888bd.xml"},{"id":100665232,"identity":"439a8f6f-de42-48ce-ac18-b4cd57ec0c75","added_by":"auto","created_at":"2026-01-20 09:25:56","extension":"jpeg","order_by":4,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":46403,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage1.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8413152/v1/a2596192cc8a5b257910a52b.jpeg"},{"id":100665605,"identity":"c7aa47c1-7da1-49e4-ad87-66d4e342edde","added_by":"auto","created_at":"2026-01-20 09:29:03","extension":"jpeg","order_by":5,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1079728,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage2.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8413152/v1/8512f239fd0725447bd71f2a.jpeg"},{"id":100665592,"identity":"28ebdd36-a785-4570-b5d1-115f7d0be9c2","added_by":"auto","created_at":"2026-01-20 09:28:41","extension":"jpeg","order_by":6,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1489097,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage3.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8413152/v1/ee93772bccf98ad0c56ef9c6.jpeg"},{"id":100665539,"identity":"25b7227b-3ccf-4c70-989e-a81c54670dcc","added_by":"auto","created_at":"2026-01-20 09:28:08","extension":"jpeg","order_by":7,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":48619,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage4.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8413152/v1/04ad2e95eb34199f58c02229.jpeg"},{"id":100665535,"identity":"32d2c4df-7a91-4103-ad38-81d6d42b3544","added_by":"auto","created_at":"2026-01-20 09:28:07","extension":"jpeg","order_by":8,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":303953,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage5.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8413152/v1/76b0b6e7badb4aca15c1468d.jpeg"},{"id":100665612,"identity":"239b1330-a311-40cc-8b93-75c379ddbe2e","added_by":"auto","created_at":"2026-01-20 09:29:06","extension":"jpeg","order_by":9,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":379466,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage6.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8413152/v1/3cccec9edb3df61c91240e0a.jpeg"},{"id":100665571,"identity":"21212e11-3032-43f1-be4c-f4bc0d057e07","added_by":"auto","created_at":"2026-01-20 09:28:15","extension":"jpeg","order_by":10,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":110340,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage7.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8413152/v1/daa3960aab3ab3dcd741638b.jpeg"},{"id":100665617,"identity":"ac46bcf9-21f7-4345-a613-b928105de5f1","added_by":"auto","created_at":"2026-01-20 09:29:11","extension":"png","order_by":11,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":16422,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-8413152/v1/27f98d376741e21b12a26cd7.png"},{"id":100665590,"identity":"4225b8ee-e0cc-402c-aeae-e50e6644b0ec","added_by":"auto","created_at":"2026-01-20 09:28:34","extension":"png","order_by":12,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":429445,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-8413152/v1/50887a5e778875c78fe14fa2.png"},{"id":100665626,"identity":"ef14c5ab-5049-4c25-a081-dd3921478594","added_by":"auto","created_at":"2026-01-20 09:29:34","extension":"png","order_by":13,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":374618,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-8413152/v1/21823085665a22f096dc3642.png"},{"id":100665584,"identity":"eacce65b-c86b-47c7-80c4-8c4b991b2da7","added_by":"auto","created_at":"2026-01-20 09:28:26","extension":"png","order_by":14,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":25883,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-8413152/v1/f7972b615b7367d2dcf81a70.png"},{"id":100665511,"identity":"b2f1bec5-157a-4c8e-b6fe-3762e4c0ecb1","added_by":"auto","created_at":"2026-01-20 09:27:54","extension":"png","order_by":15,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":85527,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-8413152/v1/c9e296d1894b50895fac677d.png"},{"id":100665585,"identity":"cf3601e5-e26e-4e75-af96-c6f45dfa21a9","added_by":"auto","created_at":"2026-01-20 09:28:28","extension":"png","order_by":16,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":83336,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-8413152/v1/2b174c6275850059a4c9f36f.png"},{"id":100665464,"identity":"abdc78a3-aed6-4717-8993-65b2bcda7dc9","added_by":"auto","created_at":"2026-01-20 09:27:20","extension":"png","order_by":17,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":205082,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage7.png","url":"https://assets-eu.researchsquare.com/files/rs-8413152/v1/518d167323ed42941eb5e2a3.png"},{"id":100665481,"identity":"942f00ac-a470-4a1a-9dd6-0feea2703b3a","added_by":"auto","created_at":"2026-01-20 09:27:32","extension":"xml","order_by":18,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":75771,"visible":true,"origin":"","legend":"","description":"","filename":"79a40bc6c7874c73ba3b37093012fc381structuring.xml","url":"https://assets-eu.researchsquare.com/files/rs-8413152/v1/134c85293a5e3a0c0d6cc8cb.xml"},{"id":100665310,"identity":"5505b82a-f2c9-4926-b186-b66b90d17a26","added_by":"auto","created_at":"2026-01-20 09:26:26","extension":"html","order_by":19,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":84996,"visible":true,"origin":"","legend":"","description":"","filename":"earlyproof.html","url":"https://assets-eu.researchsquare.com/files/rs-8413152/v1/fa0e863ea6e8dea2f97c6adf.html"},{"id":100665575,"identity":"3a09ccc4-c203-4596-933d-88e766186a56","added_by":"auto","created_at":"2026-01-20 09:28:22","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":46281,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eA. Relative expression of LncRNA-MALAT1. Figure 1B. Relative expression of miR-125a-5p; Figure 1C. Relative expression of miR-125b-5p. (n=15).***\u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eP\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e \u0026lt; 0.001.\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8413152/v1/4260be4d12b7345d9b495dfb.jpg"},{"id":100665613,"identity":"8d4396b2-2cc8-4bd2-933c-b13e672bb51d","added_by":"auto","created_at":"2026-01-20 09:29:07","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":2374439,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eChanges in mouse skin tissues across groups before and after LncRNA-MALAT1 knockdown (n=6).\u003c/strong\u003e (A) Representative photographs of skin lesions following topical drug application in each group. (B) Psoriasis Area and Severity Index (PASI) scores of dorsal skin for each group. (C) Hematoxylin and eosin (H\u0026amp;E) staining of skin lesions. Scale bars: 100μm. (D) Comparison of skin epidermal thickness in back of mice in each group.***\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.001.\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-8413152/v1/0c3a1721c18759fe4c6e92e7.png"},{"id":100665570,"identity":"972040b3-ea7f-45f7-a2b1-e563ec97c7cc","added_by":"auto","created_at":"2026-01-20 09:28:14","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":63368,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eExpression levels of LncRNA-MALAT1, miR-125, and Rab25, PI3K, and AKT mRNAs in dorsal skin tissues of mice from each group. (*\u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eP\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e \u0026lt;0.05、**\u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eP\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e\u0026lt;0.01 )\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8413152/v1/4cbfc76bbd758f901afc8596.jpg"},{"id":100665696,"identity":"0b2e20dc-c30c-4158-a02b-d4cd3e7dd1ba","added_by":"auto","created_at":"2026-01-20 09:30:03","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":1586784,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eProtein expression of Rab25 and key components (total and phosphorylated forms) of the PI3K/AKT pathway in dorsal skin tissues across groups. Original blots/gels are presented in Supplementary Fig. 1.(*\u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eP\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e\u0026lt;0.05,**\u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eP\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e \u0026lt; 0.01,***\u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eP \u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e\u0026lt; 0.001)\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-8413152/v1/6ffa4bd447fc55fdfc5e72fd.png"},{"id":100665512,"identity":"e22c94cb-251e-4ba2-bbc8-a5eb746bf44b","added_by":"auto","created_at":"2026-01-20 09:27:55","extension":"jpg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":155135,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eImmunohistochemical (IHC) staining of skin lesions. Scale bars: 200μm.\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"5.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8413152/v1/15985de2a44df645dad7c305.jpg"},{"id":100669910,"identity":"661def29-3346-49df-b658-17477312b973","added_by":"auto","created_at":"2026-01-20 10:10:28","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":5140173,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8413152/v1/ad9ddc03-6bea-4caf-a110-e67b48c2ca7d.pdf"},{"id":100665636,"identity":"0ea44cec-0be1-4af9-a3f3-a3a90af2d732","added_by":"auto","created_at":"2026-01-20 09:29:51","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"supplement","size":417374,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryInfoFile.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8413152/v1/1440bd7f1b81335d1b4e5e88.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Mechanism of MALAT1 in Regulating the Rab25/PI3K/Akt Pathway via miR-125 in a Mouse Model of Psoriasis","fulltext":[{"header":"Introduction","content":"\u003cp\u003ePsoriasis, a chronic inflammatory skin disease, imposes a significant global health burden, affecting over 125\u0026nbsp;million individuals worldwide, with a reported prevalence of approximately 0.47% in China\u003csup\u003e1,2\u003c/sup\u003e. The hallmark cutaneous manifestation of psoriasis consists of well-demarcated, erythematous plaques with adherent silvery-white scale, which vary in size and are typically associated with pruritus of variable intensity. Psoriasis is a chronic, relapsing-remitting condition with no definitive cure and is frequently associated with comorbidities including obesity, diabetes, hypertension, and malignancies. This complex disease burden contributes to significant psychological distress, with depression reported in approximately 16.5% of patients\u003csup\u003e3,4\u003c/sup\u003e. While biologics have significantly expanded the therapeutic arsenal for psoriasis, the multifactorial and incompletely understood pathogenesis of the disease\u0026mdash;encompassing genetic predisposition, immune dysregulation, and environmental triggers\u0026mdash;means that current management remains primarily palliative, aimed at symptom control rather than offering a definitive cure. The lack of response or acquired resistance to certain biologics in some patients underscores the potential need for multi-targeted strategies to achieve optimal outcomes. However, the high cost and associated risks of these agents currently pose significant barriers to implementing such combination regimens. Despite the rationale for combination therapy, the considerable cost and potential adverse effects of biologics pose substantial barriers to its clinical translation\u003csup\u003e5\u003c/sup\u003e. Consequently, there is a pressing need to deepen our understanding of psoriatic pathogenesis to guide the discovery of novel therapeutic agents that are both multi-targeted and possess improved safety profiles.\u003c/p\u003e \u003cp\u003eLong non-coding RNAs (lncRNAs) are a class of RNA molecules exceeding 200 nucleotides in length that are implicated in various diseases. They exert their effects by regulating gene expression via mechanisms such as chromatin remodeling and post-transcriptional RNA processing\u003csup\u003e6,7\u003c/sup\u003e. Metastasis-associated lung adenocarcinoma transcript 1 (MALAT1) is a well-characterized long non-coding RNA (lncRNA) located on chromosome 11q13.1, with a length of approximately 6.7 kb and no protein-coding potential. It was first discovered in the context of non-small cell lung cancer\u003csup\u003e7\u003c/sup\u003e. Subsequently, MALAT1 has been firmly established as a key oncogenic driver, with its dysregulation implicated in the pathogenesis of a wide range of human malignancies, including lung, endometrial, cervical, hepatocellular, and colorectal carcinomas. MALAT1 overexpression correlates inversely with patient survival rates and often portends a poorer prognosis across a spectrum of cancers\u003csup\u003e8\u0026ndash;10\u003c/sup\u003e. Mounting clinical evidence, including recent domestic studies, indicates a marked upregulation of MALAT1 expression in psoriatic lesions relative to adjacent non-lesional or healthy skin, implicating its potential role in psoriatic pathogenesis. An independent line of evidence from oncology research demonstrates that MALAT1 promotes bladder cancer progression through the downregulation of miR-125, suggesting the potential generality of this interaction across different pathological contexts\u003csup\u003e11\u0026ndash;13\u003c/sup\u003e. The pathology of psoriasis is driven by excessive keratinocyte proliferation and impaired terminal differentiation, fostering a microenvironment that parallels that of malignancies. Notably, shared features include cellular hyperproliferation and the development of localized hypoxia\u003csup\u003e14\u003c/sup\u003e. We thus postulate that psoriatic keratinocytes undergo a maladaptive transformation characterized by dysregulated proliferation and acquired resistance to apoptosis, mechanisms mirroring central hallmarks of cancer biology.\u003c/p\u003e \u003cp\u003eMicroRNAs (miRNAs) are single-stranded, non-coding RNAs approximately 19\u0026ndash;25 nucleotides in length. They function primarily as post-transcriptional regulators by fine-tuning mRNA stability and translation, and their altered expression can critically influence disease progression by serving as tumor suppressors or oncogenes\u003csup\u003e15\u003c/sup\u003e. The microRNA-125 (miR-125) family, predominantly consisting of miR-125a and miR-125b, have attracted considerable interest as key regulators in tumorigenesis and cancer progression. MiR-125a-5p is commonly downregulated in cancers such as those of the colon, ovary, and lung. Consistent with this dysregulation, gain-of-function experiments demonstrate that miR-125a and miR-125b overexpression significantly attenuates tumor cell proliferation and invasive capacity\u003csup\u003e16\u0026ndash;19\u003c/sup\u003e. Recent studies have identified characteristic miRNA expression imbalances in both the skin lesions and circulation of psoriasis patients, which play a crucial pathogenic role by orchestrating dysregulated innate and adaptive immunity, cytokine networks, and keratinocyte proliferation and differentiation\u003csup\u003e20\u003c/sup\u003e. MiR-125b has been identified as a top downregulated miRNA in psoriatic skin. In situ hybridization localizes this decrease predominantly to the epidermal compartment, implicating keratinocytes as the major cellular reservoir of its loss. Functional studies in primary human keratinocytes demonstrate that miR-125b acts as a key regulator of epidermal homeostasis: its overexpression inhibits proliferation and promotes differentiation, whereas its antagonism produces the opposite effects, accelerating proliferation and impairing differentiation\u003csup\u003e21\u003c/sup\u003e. Su et al. demonstrated that miR-125a inhibits keratinocyte proliferation and enhances apoptosis. Concurrently, they observed an inverse relationship between its expression and psoriatic inflammation severity, supporting the notion that miR-125a acts as a disease-modifying factor\u003csup\u003e22,23\u003c/sup\u003e. Therefore, miR-125a and miR-125b emerge as key regulatory molecules in inflammatory conditions, as evidenced by their functional impact on keratinocytes and their inverse correlation with disease severity in psoriasis.\u003c/p\u003e \u003cp\u003eRab25 has been validated as a direct target of miR-125a-5p, with this interaction mediating translational inhibition and/or mRNA destabilization of Rab25\u003csup\u003e24\u003c/sup\u003e. The ~\u0026thinsp;23 kDa small GTPase Rab25 is characterized by its ability to promote proliferation, inhibit apoptosis, and facilitate invasion, underpinning its oncogenic role across multiple cancer types\u003csup\u003e25,26\u003c/sup\u003e. In epithelial tissues, Rab25 serves as a critical regulator of epidermal development and barrier function, processes essential for skin homeostasis\u003csup\u003e27\u003c/sup\u003e. The PI3K/AKT pathway has been identified as a major downstream effector of Rab25 signaling. Consistent with this regulatory link, AKT is markedly upregulated in psoriatic lesions compared to normal skin, implicating this axis in the disease's pathogenesis\u003csup\u003e28,29\u003c/sup\u003e. In our prior work, analysis of clinical specimens from plaque psoriasis patients revealed a characteristic inverse expression pattern: downregulation of miR-125a-5p alongside Rab25 protein overexpression in progressive lesions\u003csup\u003e30\u003c/sup\u003e. This clinical correlation was substantiated at the cellular level, where we experimentally confirmed that miR-125a-5p directly targets and represses Rab25, providing mechanistic support for this regulatory relationship. Based on this evidence, we hypothesize that miR-125a-5p contributes to psoriasis pathogenesis by targeting Rab25, thereby exerting negative regulation on the downstream PI3K/AKT signaling pathway.\u003c/p\u003e \u003cp\u003eTherefore, we propose a mechanistic hypothesis wherein LncRNA-MALAT1, by functioning as a molecular sponge for miR-125, relieves the miR-125-mediated suppression of its target Rab25. This leads to consequent activation of the PI3K/AKT pathway, ultimately contributing to the pathogenesis of psoriasis. To validate this hypothesis, we first confirmed a correlative dysregulation of the proposed axis: both psoriatic patient lesions and IMQ-induced mouse model skin exhibited significant upregulation of LncRNA-MALAT1 concomitant with downregulation of miR-125. Subsequently, in vivo functional studies in the IMQ model demonstrated that LncRNA-MALAT1 knockdown not only ameliorated psoriatic skin inflammation but also concomitantly suppressed the activation of the Rab25/PI3K/AKT signaling pathway. Taken together, our findings delineate a pathogenic role for LncRNA-MALAT1 in psoriasis. Mechanistically, it appears to function as a ceRNA for miR-125, thereby derepressing Rab25 and activating the downstream PI3K/AKT cascade, which collectively drives disease progression. This positions LncRNA-MALAT1 as a promising candidate for therapeutic targeting in psoriasis.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e \u003cb\u003eDifferential Expression of LncRNA-MALAT1, miR-125a-5p, and miR-125b-5p in Psoriatic Lesions vs. Normal Human Skin.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eWe first collected skin lesion samples from 14 psoriasis patients and 14 normal skin samples in clinical settings. qRT-PCR analysis demonstrated a significant dysregulation in the expression of the investigated non-coding RNAs. Specifically, LncRNA-MALAT1 expression was significantly upregulated in psoriatic lesions compared to normal skin controls (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). In contrast, the expression levels of both miR-125a-5p (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB) and miR-125b-5p (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC) were markedly downregulated in psoriatic lesions. Collectively, these findings indicate that altered expression of LncRNA-MALAT1, miR-125a-5p, and miR-125b-5p is associated with the pathological state of psoriasis, suggesting their potential involvement in disease pathogenesis.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eEstablishment of a Psoriasis Mouse Model and Expression of Lnc RNA-MALAT1 Knockdown in Psoriasis Mouse Skin\u003c/b\u003e \u003c/p\u003e \u003cp\u003eBuilding upon previous studies, we further aimed to determine the potential role of LncRNA-MALAT1 and miR-125 in the pathogenesis of psoriasis. Specifically, we sought to investigate whether LncRNA-MALAT1 contributes to disease progression by modulating the miR-125 axis, thereby promoting the activation of the Rab25/PI3K/AKT signaling pathway. We locally knocked down Lnc RNA-MALAT1 expression in mouse dorsal skin by injecting lentiviral particles carrying Lnc RNA-MALAT1 shRNA, and observed the effect of Lnc RNA-MALAT1 silencing on disease progression in an IMQ-induced psoriasis-like mouse model. We established four groups: Normal, IMQ, IMQ\u0026thinsp;+\u0026thinsp;shRNA-NC, and IMQ\u0026thinsp;+\u0026thinsp;Lnc RNA-MALAT1 shRNA. Three days before the initiation of the psoriasis-like dermatitis induction, mice in the IMQ\u0026thinsp;+\u0026thinsp;LncRNA-MALAT1 shRNA and IMQ\u0026thinsp;+\u0026thinsp;shRNA-NC groups received a single intradermal injection of 50 \u0026micro;L of the designated lentivirus suspension (titer: 1\u0026times;10⁹ TU/mL) at the designated dorsal treatment site. Mice in the Normal and IMQ groups received an equal volume of sterile phosphate-buffered saline via the same route. Beginning four days after lentivirus injection, mice in the IMQ, IMQ\u0026thinsp;+\u0026thinsp;shRNA-NC, and IMQ\u0026thinsp;+\u0026thinsp;LncRNA-MALAT1 shRNA groups were subjected to daily topical application of 62.5 mg of 5% IMQ cream on the shaved dorsal area for 7 consecutive days. Mice in the Normal group received daily topical application of an equivalent amount of petroleum jelly (Vaseline\u0026reg;) on the same area. Daily clinical observation revealed distinct cutaneous manifestations among the four experimental groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). The dorsal skin of mice in the Normal group remained unaffected, with no signs of erythema or scaling. In contrast, mice in both the IMQ and IMQ\u0026thinsp;+\u0026thinsp;shRNA-NC groups developed pronounced psoriasiform features, including marked erythema and conspicuous scaling, indicating successful induction of the disease model. Notably, mice in the IMQ\u0026thinsp;+\u0026thinsp;LncRNA-MALAT1 shRNA group exhibited significantly milder clinical presentations; the severity of erythema and scaling was markedly reduced compared to the IMQ and IMQ\u0026thinsp;+\u0026thinsp;shRNA-NC groups. This suggests that local knockdown of LncRNA-MALAT1 attenuates the development of IMQ-induced psoriasiform dermatitis. PASI scores for each group are shown in (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB). Histological analysis of H\u0026amp;E-stained dorsal skin sections revealed distinct morphological changes corresponding to the clinical phenotypes (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC). Skin sections from the Normal group showed normal epidermal structure without pathology. In contrast, skin from the IMQ and IMQ\u0026thinsp;+\u0026thinsp;shRNA-NC groups demonstrated classic histopathological features of psoriasiform dermatitis, including marked epidermal hyperplasia, parakeratosis, the presence of Munro's microabscesses (collections of neutrophils in the stratum corneum), and downward elongation of the rete ridges. The IMQ\u0026thinsp;+\u0026thinsp;LncRNA-MALAT1 shRNA group also exhibited mild epidermal hyperplasia; however, the typical psoriasiform features such as parakeratosis and Munro's microabscesses were significantly attenuated compared to the IMQ and IMQ\u0026thinsp;+\u0026thinsp;shRNA-NC groups. These findings confirm that knockdown of LncRNA-MALAT1 ameliorates the histopathological hallmarks of IMQ-induced psoriasis-like dermatitis. Statistical analysis of epidermal thickness across groups revealed that mice treated with IMQ or IMQ\u0026thinsp;+\u0026thinsp;shRNA‑NC exhibited a significant increase in epidermal thickness relative to the Normal control group (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eExpression of LncRNA-MALAT1, miR-125, Rab25, and the PI3K/AKT Signaling Pathway in Psoriasis-like Mouse Models Following LncRNA-MALAT1 Knockdown\u003c/b\u003e \u003c/p\u003e \u003cp\u003eThe transcriptional activity of the LncRNA-MALAT1/miR‑125 axis and its downstream effectors was analyzed in skin lesions from all experimental groups. Using qRT‑PCR, we assessed the mRNA expression levels of LncRNA-MALAT1, miR‑125, Rab25, PI3K, and AKT. Compared to the Normal control, the IMQ mice exhibited a significant increase in mRNA levels of LncRNA-MALAT1, Rab25, PI3K, and AKT, accompanied by a marked downregulation of miR‑125. The IMQ\u0026thinsp;+\u0026thinsp;shRNA‑NC group showed a similar dysregulation pattern. Importantly, LncRNA-MALAT1 knockdown in the IMQ\u0026thinsp;+\u0026thinsp;LncRNA-MALAT1 shRNA group reversed this expression signature: the mRNA levels of LncRNA-MALAT1, Rab25, PI3K, and AKT were significantly decreased, while miR‑125 expression was restored, relative to the IMQ\u0026thinsp;+\u0026thinsp;shRNA‑NC control (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). Western blotting was performed to analyze the expression levels of total PI3K, AKT, Rab25, and their phosphorylated forms (p-PI3K, p-AKT) in dorsal skin tissues from all experimental groups. Western blot analysis revealed that, compared to the Normal group, the IMQ group exhibited a significant upregulation in the protein expression of p-PI3K, p-AKT, and Rab25, whereas the levels of total PI3K and total AKT remained unchanged. In contrast, compared to the IMQ\u0026thinsp;+\u0026thinsp;shRNA-NC group, the IMQ\u0026thinsp;+\u0026thinsp;LncRNA-MALAT1 shRNA group showed a downregulation in p-PI3K and p-AKT protein expression, with no significant alterations in Rab25, total PI3K, or total AKT levels (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e). Notably, the epidermal thickening in the IMQ\u0026thinsp;+\u0026thinsp;LncRNA-MALAT1 shRNA group was significantly reduced compared to the IMQ and IMQ\u0026thinsp;+\u0026thinsp;shRNA‑NC groups, although it remained greater than in Normal controls. Immunohistochemical (IHC) staining was performed to assess the expression and localization of key proteins in the studied pathway (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e). PI3K expression was not detectable in any of the experimental groups under the applied staining conditions. AKT expression was strongly positive in the epidermis of both the IMQ and IMQ\u0026thinsp;+\u0026thinsp;shRNA-NC groups, with prominent staining observed in the cell membrane, cytoplasm, and nuclei. The expression intensity of AKT was markedly reduced to weakly positive levels in the epidermis of the IMQ\u0026thinsp;+\u0026thinsp;LncRNA-MALAT1 shRNA group. Similarly, Rab25 exhibited a robust positive expression pattern in the IMQ and IMQ\u0026thinsp;+\u0026thinsp;shRNA-NC groups, primarily localized to the cell membrane and cytoplasm of keratinocytes. In the IMQ\u0026thinsp;+\u0026thinsp;LncRNA-MALAT1 shRNA group, the intensity of Rab25 staining was substantially diminished, presenting as weakly positive. These results confirm our hypothesis that shRNA-mediated knockdown of LncRNA-MALAT1 attenuates the activity of the PI3K/AKT signaling pathway. The data further demonstrate the critical role of LncRNA-MALAT1 in the pathogenesis of psoriasis.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003ePsoriasis is a clinically common chronic inflammatory skin disease characterized by persistent recurrence, whose pathogenesis is closely associated with immune system dysregulation. Current research indicates that the development of psoriasis results from the complex interplay of multiple genetic predispositions and various endogenous and exogenous stimuli, including genetic susceptibility, abnormal immune regulation, infections, and trauma\u003csup\u003e31,32\u003c/sup\u003e. The management of psoriasis remains challenging. First, its etiology and pathogenesis are not yet fully elucidated, and a definitive curative therapy is still lacking. Second, the chronic and recurring nature of the disease causes most patients to experience a cyclical pathological process, while a high prevalence of comorbid metabolic disorders (such as hypertension, diabetes, and obesity) further exacerbates physical impairment. The interaction between these biological factors and the uncertainty of therapeutic outcomes ultimately compromises patients' mental health, leading to a significantly increased incidence of anxiety, depression, and other emotional disorders. Therefore, research into the pathogenesis of psoriasis remains a major focus in dermatology.\u003c/p\u003e \u003cp\u003eStudies have shown that dysregulated expression of LncRNAs is closely associated with autoimmune diseases\u003csup\u003e33,34\u003c/sup\u003e. Among them, MALAT1 is one of the most extensively studied LncRNAs, and it is ubiquitously expressed in human tissues and highly conserved across species\u003csup\u003e35,36\u003c/sup\u003e. Recent research has revealed that MALAT1 plays a crucial role in the onset and progression of psoriasis: analysis of clinical samples has confirmed that its expression is significantly upregulated in psoriatic lesion tissues, and it contributes to the disease process by influencing keratinocyte proliferation, inflammation, and apoptosis\u003csup\u003e37\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003ePrevious studies have established that Rab25, a key downstream target of miR-125a-5p, is an intracellular transport protein highly expressed in epithelial tissues and plays a critical role in epidermal differentiation and barrier maintenance\u003csup\u003e27,38\u003c/sup\u003e. Rab25 expression is significantly upregulated in psoriatic lesions. Furthermore, it has been demonstrated that the Phosphatidylinositol 3-Kinase/Protein Kinase B (PI3K/AKT) signaling pathway is aberrantly activated in psoriasis. This pathway exerts a dual pathological effect: it directly drives hyperproliferation of keratinocytes and concurrently promotes pathological angiogenesis in the dermis, both of which jointly sustain and exacerbate lesion progression\u003csup\u003e39\u0026ndash;41\u003c/sup\u003e. Based on the established regulatory relationship of miR-125a-5p on Rab25, combined with the known involvement of Rab25 in the PI3K/AKT pathway within psoriasis, we hypothesize that the \"miR-125\u0026ndash;Rab25\u0026ndash;PI3K/AKT\" axis constitutes a significant mechanism contributing to the pathogenesis of this disease.\u003c/p\u003e \u003cp\u003eIn the present study, we demonstrated through both clinical and animal experiments that LncRNA-MALAT1 is significantly upregulated, while miR-125 is markedly downregulated, in psoriatic lesions from patients and in an IMQ-induced psoriasis-like mouse model. Correspondingly, the mRNA expression of Rab25, PI3K, and AKT was significantly increased in the mouse model. Knockdown of LncRNA-MALAT1 in the IMQ-induced psoriasis-like mouse model led to a corresponding upregulation of miR-125 and a downregulation of Rab25, PI3K, and AKT mRNA expression. Although the protein levels of total PI3K and AKT did not show a clear trend of change, the increased expression of their phosphorylated, active forms (p-PI3K and p-AKT) indicates that the PI3K/AKT signaling pathway is aberrantly activated in psoriatic lesions. Following the knockdown of LncRNA-MALAT1, the PI3K/AKT signaling pathway was partially inhibited. Notably, previous studies have identified associations between LncRNA-MALAT1 and various malignant tumors. For instance, in colorectal cancer, LncRNA-MALAT1 acts as a competitive endogenous RNA (ceRNA), interacting with microRNAs to participate in the post-transcriptional regulation of tumorigenesis. Additionally, LncRNA-MALAT1 has been shown to be closely associated with the activation of multiple pro-oncogenic pathways, including the PI3K/AKT signaling pathway\u003csup\u003e9\u003c/sup\u003e. In lung cancer research, miR-125a-5p has been demonstrated to influence Rab25 and its downstream PI3K/AKT signaling pathway\u003csup\u003e24\u003c/sup\u003e. Integrating the experimental results of this study with existing literature, we propose that LncRNA-MALAT1 may competitively bind miR-125, thereby relieving its inhibitory effect on the target gene Rab25, and subsequently regulating the activity of the PI3K/AKT signaling pathway. This perspective is consistent with reported literature and supports the hypothesis that LncRNA-MALAT1 may participate in the pathogenesis of psoriasis by targeting the regulation of miR-125 to activate the Rab25/PI3K/AKT signaling pathway. Furthermore, the statistical analyses in the current study revealed partial asynchrony between transcriptional and protein expression data. This discrepancy may be attributed to the failure of some mRNAs to be successfully translated into their corresponding proteins during the translation process. Additionally, the limited sample size in this study may have contributed to the observed outcomes; increasing the sample size in future investigations could potentially yield more statistically significant results.\u003c/p\u003e \u003cp\u003eCurrent studies indicate that the IMQ-induced psoriasis mouse model effectively recapitulates the core pathological phenotypes of human psoriasis\u003csup\u003e42\u003c/sup\u003e. The underlying mechanism primarily involves the binding of IMQ to Toll-like receptor 7 (TLR7) on epidermal plasmacytoid dendritic cells and macrophages. This interaction triggers the secretion of high levels of interferon-alpha (IFN-α), interleukin-23 (IL-23), IL-17, and IL-22, ultimately leading to psoriasiform pathological changes. These changes are characterized by epidermal hyperplasia, parakeratosis with hyperkeratosis, acanthosis, and inflammatory cell infiltration\u003csup\u003e43\u003c/sup\u003e. In this study, the IMQ-induced psoriasis mouse model exhibited characteristic psoriasiform pathological features. Following knockdown of LncRNA-MALAT1, we observed a significant attenuation of epidermal hyperproliferation and inflammatory cell infiltration. A limitation of the current study is that the measurement of key cytokines such as IL-23, IL-17, and IL-22 could provide further validation of successful model establishment. Assessing these cytokines would also more conclusively demonstrate that the psoriasiform phenotype was mitigated upon LncRNA-MALAT1 knockdown.\u003c/p\u003e \u003cp\u003eImmunohistochemical analysis revealed that PI3K expression was negative in all groups. AKT protein was primarily expressed in the cell membrane, cytoplasm, and nucleus of epidermal cells. Its expression was stronger in psoriatic lesions of mice compared to normal skin tissue, and this expression weakened following knockdown of LncRNA-MALAT1. Rab25 protein was mainly expressed in the cell membrane and cytoplasm of epidermal cells. Its expression was also stronger in psoriatic lesions of mice compared to normal skin tissue and decreased after LncRNA-MALAT1 knockdown. These findings support the previously reported characteristics of high Rab25 and AKT protein expression in psoriatic lesions and further confirm our hypothesis. However, PI3K expression was negative in the skin tissues of all mouse groups. A literature search revealed that there are currently no systematic reports on PI3K expression detected by immunohistochemistry in skin tissues. This observation suggests that PI3K expression in skin tissue may have unique characteristics, which warrants further investigation in future studies.\u003c/p\u003e \u003cp\u003eCollectively, these findings indicate that LncRNA-MALAT1 is upregulated in psoriasis and may participate in the pathogenesis of the disease in mice by activating the Rab25/PI3K/AKT signaling pathway via the regulation of miR-125. Furthermore, downregulation of LncRNA-MALAT1 ameliorated IMQ-induced psoriasis in mice. Therefore, LncRNA-MALAT1 plays a significant role in the pathogenesis of psoriasis and may represent a novel therapeutic target for the treatment of this condition.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cp\u003e\u003cb\u003eCollection of Human Skin Specimens.\u003c/b\u003e After administering local anesthesia with lidocaine, punch biopsies were obtained from lesional skin of 14 patients diagnosed with plaque psoriasis and from comparable sites of 14 age- and sex-matched healthy volunteers at the Department of Dermatology, Affiliated Hospital of Zunyi Medical University. The collected tissue samples were immediately snap-frozen in liquid nitrogen and stored at -80\u0026deg;C until further analysis. This study was conducted in accordance with the declaration of Helsinki Principles and was approved by the Biomedical Research Ethics Committee of the Affiliated Hospital of Zunyi Medical University (Approval No.: KLLY-2021-057). Written informed consent was obtained from all participants.\u003c/p\u003e \u003cp\u003e \u003cb\u003eQuantitative Analysis of LncRNA-MALAT1, miR-125a-5p, and miR-125b-5p Expression via qRT‑PCR.\u003c/b\u003e Total RNA was isolated from both psoriatic lesional and adjacent normal skin tissues of patients with plaque psoriasis, in accordance with standard procedures for subsequent gene expression profiling. Following extraction according to the manufacturer\u0026rsquo;s protocol, RNA purity and concentration were assessed spectrophotometrically. cDNA synthesis was performed using a reverse transcription kit under recommended conditions. Amplification reaction mixtures were prepared with SYBR Green Master Mix, and real-time quantitative PCR was carried out on a QuantStudio instrument. Primer sequences used in the assay are listed in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. Relative expression of target genes was determined using the comparative 2^(-ΔΔCt) method. All samples were analyzed in triplicate to ensure reproducibility.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimer sequences for quantitative real‑time PCR.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"2\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene Name\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePrimer Sequence (5\u0026prime;\u0026rarr;3\u0026prime;)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eLncRNA-MALAT1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward: TTGCCACTTCTCAACCGTCC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse: ACGGGTCATCAAACACCTCAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003emiR-125a-5p\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward: ACACTCCAGCTGGGTCCCTGAGACCCTTTAAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse: Universal Downstream Primer\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003emiR-125b-5p\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward: ACACTCCAGCTGGGTCCCTGAGACCCTAAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse: Universal Downstream Primer\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eGAPDH\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward: GGAAGCTTGTCATCAATGGAAATC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse: TGATGACCCTTTTGGCTCCC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e\u003cb\u003eAnimals.\u003c/b\u003e A total of 24 healthy, 6- to 8-week-old BALB/c mice (12 males and 12 females; body weight 18\u0026ndash;22 g) were purchased from Guizhou Huiji Biotechnology Co., Ltd. (Animal License No. SYXK(Gui)2023-0001). Mice were group-housed under specific-pathogen-free conditions in the Animal Experiment Center of the Affiliated Hospital of Zunyi Medical University, with ambient temperature maintained at 22\u0026ndash;27\u0026deg;C, a 12-h light/dark cycle, and ad libitum access to standard chow and water. This study was approved by the Laboratory Animal Ethics Committee of Zunyi Medical University (Approval No.: KLL-2022-270). All experiments involving mice were conducted in accordance with the ARRIVE guidelines.\u003c/p\u003e \u003cp\u003e \u003cb\u003eIn Vivo Modeling of Imiquimod-Induced Psoriasis-like Dermatitis and LncRNA- MALAT1 shRNA Lentivirus Administration.\u003c/b\u003e BALB/c mice were randomly divided into four groups, with six mice per group. After one week of acclimation feeding, hair was removed from a 2 cm \u0026times; 3 cm area on the dorsal side of each mouse. Following grouping, mice received intradermal injections in the prepared dorsal area according to the following protocol: Normal group: 50 \u0026micro;L of sterile normal saline. IMQ group: 50 \u0026micro;L of sterile normal saline. IMQ\u0026thinsp;+\u0026thinsp;shRNA-NC group: 50 \u0026micro;L of negative control lentivirus at a titer of 1\u0026times;10⁹ TU/mL. IMQ\u0026thinsp;+\u0026thinsp;LncRNA-MALAT1 shRNA group: 50 \u0026micro;L of LncRNA-MALAT1-targeting shRNA lentivirus at a titer of 1\u0026times;10⁹ TU/mL. Three days post-injection, model induction commenced. Mice in the IMQ, IMQ\u0026thinsp;+\u0026thinsp;shRNA-NC, and IMQ\u0026thinsp;+\u0026thinsp;LncRNA-MALAT1 shRNA groups received a daily topical application of 62.5 mg of 5% IMQ cream to the shaved dorsal skin. Mice in the Normal group received an equal amount of Vaseline daily as a control. This treatment regimen continued for seven consecutive days. Erythema, scaling, and skin thickening/infiltration on the dorsal skin were observed and recorded daily for all mice. The severity of psoriasiform lesions was quantified using a modified Psoriasis Area and Severity Index (PASI) scoring system. On day 8, all mice were euthanized by cervical dislocation. Full-thickness skin samples, comprising a circular area with a radius of approximately 1 cm centered on the lentivirus injection site, were collected. Each tissue sample was immediately divided into three portions for different downstream analyses: One portion was snap-frozen in liquid nitrogen and stored at -80\u0026deg;C for subsequent RNA extraction and quantitative real-time PCR (qRT-PCR) analysis. Another portion was similarly stored at -80\u0026deg;C for subsequent protein extraction and Western blot analysis. The remaining portion was gently spread flat and fixed in 10% neutral buffered formalin for subsequent paraffin embedding, sectioning, hematoxylin and eosin (H\u0026amp;E) staining, and immunohistochemical (IHC) staining.\u003c/p\u003e \u003cp\u003e \u003cb\u003eAnalysis of LncRNA-MALAT1, miR-125, Rab25, PI3K, and AKT Expression in Mouse Skin Tissues via qRT-PCR.\u003c/b\u003e Total RNA was extracted from mouse dorsal skin tissues using the Total RNA Extraction Kit for Animal Tissues/Cells (Servicebio, Wuhan, China) following the manufacturer\u0026rsquo;s protocol. RNA concentration and purity were assessed by spectrophotometry (NanoDrop). First-strand cDNA synthesis was performed using the PrimeScript RT Reagent Kit (TaKaRa, RR047A). Quantitative real-time PCR (qRT-PCR) was subsequently carried out using ChamQ SYBR qPCR Master Mix (Vazyme, Q711) on a QuantStudio Real-Time PCR System (Applied Biosystems). The expression levels of the target genes (LncRNA-MALAT1, miR-125, Rab25, PI3K, and AKT) and the reference gene (GAPDH) were quantified. The relative gene expression was calculated using the 2^(-ΔΔCt) method. All reactions were performed in triplicate, and melting curve analysis was performed to verify the specificity of amplification. Primer sequences are listed in Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimer sequences for quantitative real‑time PCR.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"2\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene Name\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePrimer Sequence (5\u0026prime;\u0026rarr;3\u0026prime;)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eLncRNA-MALAT1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward:GAAGAATGGTAGATGGCAAGTTGTC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse:AGGAGTGAGGCTTGTGGTAGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003emiR-125\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward:TTTGTGGGCAGAGAGGAAACC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse:GCAGCAGCATCTTTGAAGGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eRab25\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward:CCCGAGAGGTCCCTACTGAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse:TGCTGTTCTGCTTCTGCTTGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003ePI3K\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward:CTATTGCGAGGGAAGCGAGAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse:AGGGAGGTGTGTTGATAATGTAGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eAKT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward:CTACTTCCTCCTCAAGAACGATGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse:AGCGGATGATAAAGGTGTTGGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eGAPDH\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward:CTGCCAACGTGTCAGTGGTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse:TCAGTGTAGCCCAGGATGCC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eWestern blot.\u003c/b\u003e Frozen mouse skin tissues were homogenized in ice-cold RIPA lysis buffer supplemented with phosphatase and protease inhibitors. The lysates were centrifuged at 12,000 \u0026times; g for 15 min at 4\u0026deg;C, and the supernatants were collected. Protein concentrations were determined using the BCA Protein Assay Kit. Equal amounts of protein were separated by 10% SDS‑PAGE and transferred onto PVDF membranes. After blocking in TBST for 1 h at room temperature, the membranes were incubated with primary antibodies (dilutions specified in Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e) overnight at 4\u0026deg;C. Following three washes with TBST, the membranes were probed with horseradish peroxidase (HRP)-conjugated secondary antibodies for 1 h at room temperature. Protein bands were visualized using an enhanced chemiluminescence (ECL) substrate and imaged with a chemiluminescence detection system. Band intensities were quantified using ImageJ software.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimary antibody information and dilutions used for Western blot analysis.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"2\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAntibody (Name)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eDilution Ratio\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eP-PI3K\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1∶1000\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePI3K\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1∶1000\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eP-AKT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1∶2000\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAKT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1∶2000\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRab25\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1∶500\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eβ-actin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1∶50000\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eReferences for the specificity validation of all target gene antibodies by Western blot analysis\u003csup\u003e44\u0026ndash;46\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003e \u003cb\u003eHistopathological Examination via Hematoxylin and Eosin (H\u0026amp;E) Staining.\u003c/b\u003e Dorsal skin tissue specimens from mice were fixed in 10% neutral buffered formalin, dehydrated, embedded in paraffin, and sectioned at a thickness of 4\u0026ndash;5 \u0026micro;m. The sections were subsequently deparaffinized, rehydrated, and stained with hematoxylin and eosin according to standard protocols. Histopathological evaluation was performed under a light microscope to assess morphological changes, including epidermal hyperplasia, inflammatory cell infiltration in the dermis, and other psoriasiform features. Epidermal thickness was quantified by measuring the vertical distance from the basal layer to the stratum corneum at three randomly selected sites per section using ImageJ software and the mean value was calculated for each sample.\u003c/p\u003e \u003cp\u003e \u003cb\u003eImmunohistochemistry (IHC) Staining and Analysis.\u003c/b\u003e IHC staining was performed according to standard protocols under the guidance of a qualified pathologist. PBS was used in place of the primary antibody as a negative control. The stained sections were observed under a light microscope. Immunopositivity for Rab25 and PI3K proteins was defined as the presence of pale yellow to brownish-yellow granular staining in the cytoplasm and/or cell membrane, with pale staining indicative of weak positivity and brown staining indicative of strong positivity. For AKT, nuclear, membranous, and/or cytoplasmic staining of pale yellow to brownish-yellow granules was considered indicative of protein expression, similarly graded as weak or strong based on intensity.\u003c/p\u003e \u003cp\u003e \u003cb\u003eStatistical Analysis.\u003c/b\u003e All experimental data were analyzed using SPSS software (version 29.0) and are presented as the mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation (mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD). Statistical significance was set at p\u0026thinsp;\u0026lt;\u0026thinsp;0.05. Comparisons between two independent groups were performed using Student\u0026rsquo;s t-test. For comparisons among more than two groups, one-way analysis of variance (ANOVA) was applied. When the ANOVA results indicated a statistically significant difference (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05), Tukey\u0026rsquo;s post hoc test was conducted for multiple comparisons to identify specific intergroup differences. All statistical graphs were generated using GraphPad Prism software (version 10.0).\u003c/p\u003e \u003cp\u003eThis work was supported by the Natural Science Foundation of Guizhou Province, China (Grant Number: ZK [2023] General 578).\u003c/p\u003e "},{"header":"Declarations","content":"\u003cp\u003e \u003ch2\u003eAdditional Information Competing interests\u003c/h2\u003e \u003cp\u003eThe authors declare no competing interests.\u003c/p\u003e \u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eW.Y. conceived and designed the study. Jn.Y. and Ls.Y. performed the experiments. X.Z. and Xx.C. assisted with data analysis. Jn.Y. drafted the manuscript. C.F. participated in its revision. All authors reviewed and approved the final manuscript.\u003c/p\u003e\u003ch2\u003eAcknowledgments.\u003c/h2\u003e \u003cp\u003eThis work was supported by the Natural Science Foundation of Guizhou Province, China (Grant Number: ZK [2023] General 578).\u003c/p\u003e\u003ch2\u003eData Availability\u003c/h2\u003e\u003cp\u003eThe datasets generated during the current study are available from the corresponding author upon reasonable request.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eMahil, S. K. \u0026amp; Smith, C. H. Psoriasis biologics: a new era of choice. \u003cem\u003eLancet\u003c/em\u003e\u003cstrong\u003e394\u003c/strong\u003e, 807-808 (2019). https://doi.org:10.1016/S0140-6736(19)31772-6\u003c/li\u003e\n\u003cli\u003eDing, X.\u003cem\u003e et al.\u003c/em\u003e Prevalence of psoriasis in China: a population-based study in six cities. \u003cem\u003eEur J Dermatol\u003c/em\u003e\u003cstrong\u003e22\u003c/strong\u003e, 663-667 (2012). https://doi.org:10.1684/ejd.2012.1802\u003c/li\u003e\n\u003cli\u003eKanda, N. Psoriasis: Pathogenesis, Comorbidities, and Therapy Updated. \u003cem\u003eInt J Mol Sci\u003c/em\u003e\u003cstrong\u003e22\u003c/strong\u003e (2021). https://doi.org:10.3390/ijms22062979\u003c/li\u003e\n\u003cli\u003eCohen, B. E., Martires, K. J. \u0026amp; Ho, R. S. Psoriasis and the Risk of Depression in the US Population: National Health and Nutrition Examination Survey 2009-2012. \u003cem\u003eJAMA Dermatol\u003c/em\u003e\u003cstrong\u003e152\u003c/strong\u003e, 73-79 (2016). https://doi.org:10.1001/jamadermatol.2015.3605\u003c/li\u003e\n\u003cli\u003eHawkes, J. E., Chan, T. C. \u0026amp; Krueger, J. G. Psoriasis pathogenesis and the development of novel targeted immune therapies. \u003cem\u003eJournal of Allergy and Clinical Immunology\u003c/em\u003e\u003cstrong\u003e140\u003c/strong\u003e, 645-653 (2017). https://doi.org:10.1016/j.jaci.2017.07.004\u003c/li\u003e\n\u003cli\u003eRaaby, L.\u003cem\u003e et al.\u003c/em\u003e Changes in mRNA expression precede changes in microRNA expression in lesional psoriatic skin during treatment with adalimumab. \u003cem\u003eBr J Dermatol\u003c/em\u003e\u003cstrong\u003e173\u003c/strong\u003e, 436-447 (2015). https://doi.org:10.1111/bjd.13721\u003c/li\u003e\n\u003cli\u003eGoyal, B.\u003cem\u003e et al.\u003c/em\u003e Diagnostic, prognostic, and therapeutic significance of long non-coding RNA MALAT1 in cancer. \u003cem\u003eBiochim Biophys Acta Rev Cancer\u003c/em\u003e\u003cstrong\u003e1875\u003c/strong\u003e, 188502 (2021). https://doi.org:10.1016/j.bbcan.2021.188502\u003c/li\u003e\n\u003cli\u003eLi, Y.\u003cem\u003e et al.\u003c/em\u003e Clinical prognostic value of metastasis-associated lung adenocarcinoma transcript 1 in various human cancers: an updated meta-analysis. \u003cem\u003eInt J Biol Markers\u003c/em\u003e\u003cstrong\u003e31\u003c/strong\u003e, e173-182 (2016). https://doi.org:10.5301/jbm.5000185\u003c/li\u003e\n\u003cli\u003eUthman, Y. A.\u003cem\u003e et al.\u003c/em\u003e MALAT1: A Promising Therapeutic Target for the Treatment of Metastatic Colorectal Cancer. \u003cem\u003eBiochem Pharmacol\u003c/em\u003e\u003cstrong\u003e190\u003c/strong\u003e, 114657 (2021). https://doi.org:10.1016/j.bcp.2021.114657\u003c/li\u003e\n\u003cli\u003e Wang, T., Zhang, W., Huang, W., Hua, Z. \u0026amp; Li, S. LncRNA MALAT1 was regulated by HPV16 E7 independently of pRB in cervical cancer cells. \u003cem\u003eJ Cancer\u003c/em\u003e\u003cstrong\u003e12\u003c/strong\u003e, 6344-6355 (2021). https://doi.org:10.7150/jca.61194\u003c/li\u003e\n\u003cli\u003e 杜悦. \u003cem\u003e长链非编码RNA\u003c/em\u003e\u003cem\u003e与银屑病发病关系的研究\u003c/em\u003e, 石河子大学, (2019).\u003c/li\u003e\n\u003cli\u003e Han, Y.\u003cem\u003e et al.\u003c/em\u003e Hsa-miR-125b suppresses bladder cancer development by down-regulating oncogene SIRT7 and oncogenic long non-coding RNA MALAT1. \u003cem\u003eFEBS Lett\u003c/em\u003e\u003cstrong\u003e587\u003c/strong\u003e, 3875-3882 (2013).\u003c/li\u003e\n\u003cli\u003e Xie, H.\u003cem\u003e et al.\u003c/em\u003e LncRNA MALAT1 Inhibits Apoptosis and Promotes Invasion by Antagonizing miR-125b in Bladder Cancer Cells. \u003cem\u003eJ Cancer\u003c/em\u003e\u003cstrong\u003e8\u003c/strong\u003e, 3803-3811 (2017). https://doi.org:10.7150/jca.21228\u003c/li\u003e\n\u003cli\u003e Wu, X., Ma, Y., Wang, L. \u0026amp; Qin, X. A Route for Investigating Psoriasis: From the Perspective of the Pathological Mechanisms and Therapeutic Strategies of Cancer. \u003cem\u003eInternational Journal of Molecular Sciences\u003c/em\u003e\u003cstrong\u003e24\u003c/strong\u003e (2023). https://doi.org:10.3390/ijms241814390\u003c/li\u003e\n\u003cli\u003e Domingo, S., Sole, C., Moline, T., Ferrer, B. \u0026amp; Cortes-Hernandez, J. MicroRNAs in Several Cutaneous Autoimmune Diseases: Psoriasis, Cutaneous Lupus Erythematosus and Atopic Dermatitis. \u003cem\u003eCells\u003c/em\u003e\u003cstrong\u003e9\u003c/strong\u003e (2020). https://doi.org:10.3390/cells9122656\u003c/li\u003e\n\u003cli\u003e Russo, A. \u0026amp; Potenza, N. Antiproliferative Activity of microRNA-125a and its Molecular Targets. \u003cem\u003eMicrorna\u003c/em\u003e\u003cstrong\u003e8\u003c/strong\u003e, 173-179 (2019). https://doi.org:10.2174/2211536608666181105114739\u003c/li\u003e\n\u003cli\u003e Wu, S.\u003cem\u003e et al.\u003c/em\u003e Genetic variations in miR-125 family and the survival of non-small cell lung cancer in Chinese population. \u003cem\u003eCancer Med\u003c/em\u003e\u003cstrong\u003e8\u003c/strong\u003e, 2636-2645 (2019). https://doi.org:10.1002/cam4.2073\u003c/li\u003e\n\u003cli\u003e Zhao, Y. L. \u0026amp; Huang, Y. M. LncSNHG14 promotes ovarian cancer by targeting microRNA-125a-5p. \u003cem\u003eEur Rev Med Pharmacol Sci\u003c/em\u003e\u003cstrong\u003e23\u003c/strong\u003e, 3235-3242 (2019). https://doi.org:10.26355/eurrev_201904_17683\u003c/li\u003e\n\u003cli\u003e 付乐凡, 田珂, 苗国英 \u0026amp; 冯爱平. 基于microRNA-125b靶向信号传导转录激活因子3调控皮肤鳞状细胞癌的增殖和侵袭. \u003cem\u003e中国热带医学\u003c/em\u003e\u003cstrong\u003e20\u003c/strong\u003e, 1082-1087 (2020). https://doi.org:10.13604/j.cnki.46-1064/r.2020.11.14\u003c/li\u003e\n\u003cli\u003e Hawkes, J. E.\u003cem\u003e et al.\u003c/em\u003e microRNAs in Psoriasis. \u003cem\u003eJ Invest Dermatol\u003c/em\u003e\u003cstrong\u003e136\u003c/strong\u003e, 365-371 (2016). https://doi.org:10.1038/JID.2015.409\u003c/li\u003e\n\u003cli\u003e Jiang, X.\u003cem\u003e et al.\u003c/em\u003e The role of microRNA in psoriasis: A review. \u003cem\u003eExp Dermatol\u003c/em\u003e\u003cstrong\u003e32\u003c/strong\u003e, 1598-1612 (2023). https://doi.org:10.1111/exd.14871\u003c/li\u003e\n\u003cli\u003e Su, F., Jin, L. \u0026amp; Liu, W. MicroRNA-125a Correlates with Decreased Psoriasis Severity and Inflammation and Represses Keratinocyte Proliferation. \u003cem\u003eDermatology\u003c/em\u003e\u003cstrong\u003e237\u003c/strong\u003e, 568-578 (2021). https://doi.org:10.1159/000510681\u003c/li\u003e\n\u003cli\u003e Alatas, E. T., Kara, M., Dogan, G. \u0026amp; Akin Belli, A. Blood microRNA expressions in patients with mild to moderate psoriasis and the relationship between microRNAs and psoriasis activity. \u003cem\u003eAn Bras Dermatol\u003c/em\u003e\u003cstrong\u003e95\u003c/strong\u003e, 702-707 (2020). https://doi.org:10.1016/j.abd.2020.07.001\u003c/li\u003e\n\u003cli\u003e 周建国. \u003cem\u003eHsa-miR-125a-5p\u003c/em\u003e\u003cem\u003e调控Rab25-PI3K/AKT\u003c/em\u003e\u003cem\u003e通路在NSCLC-TKIs\u003c/em\u003e\u003cem\u003e耐药中的作用研究\u003c/em\u003e, 遵义医学院, (2017).\u003c/li\u003e\n\u003cli\u003e Mitra, S., Cheng, K. W. \u0026amp; Mills, G. B. Rab25 in cancer: a brief update. \u003cem\u003eBiochem Soc Trans\u003c/em\u003e\u003cstrong\u003e40\u003c/strong\u003e, 1404-1408 (2012). https://doi.org:10.1042/BST20120249\u003c/li\u003e\n\u003cli\u003e Wang, S., Hu, C., Wu, F. \u0026amp; He, S. Rab25 GTPase: Functional roles in cancer. \u003cem\u003eOncotarget\u003c/em\u003e\u003cstrong\u003e8\u003c/strong\u003e, 64591-64599 (2017). https://doi.org:10.18632/oncotarget.19571\u003c/li\u003e\n\u003cli\u003e Jeong, H., Lim, K. M., Goldenring, J. R. \u0026amp; Nam, K. T. Rab25 Deficiency Perturbs Epidermal Differentiation and Skin Barrier Function in Mice. \u003cem\u003eBiomol Ther (Seoul)\u003c/em\u003e\u003cstrong\u003e27\u003c/strong\u003e, 553-561 (2019). https://doi.org:10.4062/biomolther.2019.125\u003c/li\u003e\n\u003cli\u003e Fan, Y., Wang, L., Han, X., Liu, X. \u0026amp; Ma, H. Rab25 is responsible for phosphoinositide 3-kinase/AKT‑mediated cisplatin resistance in human epithelial ovarian cancer cells. \u003cem\u003eMol Med Rep\u003c/em\u003e\u003cstrong\u003e11\u003c/strong\u003e, 2173-2178 (2015). https://doi.org:10.3892/mmr.2014.2963\u003c/li\u003e\n\u003cli\u003e Varshney, P. \u0026amp; Saini, N. PI3K/AKT/mTOR activation and autophagy inhibition plays a key role in increased cholesterol during IL-17A mediated inflammatory response in psoriasis. \u003cem\u003eBiochim Biophys Acta Mol Basis Dis\u003c/em\u003e\u003cstrong\u003e1864\u003c/strong\u003e, 1795-1803 (2018). https://doi.org:10.1016/j.bbadis.2018.02.003\u003c/li\u003e\n\u003cli\u003e 张霖. \u003cem\u003eMicroRNA-125a-5p\u003c/em\u003e\u003cem\u003e和Rab25\u003c/em\u003e\u003cem\u003e在寻常型银屑病中表达的研究\u003c/em\u003e, 遵义医科大学, (2019).\u003c/li\u003e\n\u003cli\u003e Bu, J., Ding, R., Zhou, L., Chen, X. \u0026amp; Shen, E. Epidemiology of Psoriasis and Comorbid Diseases: A Narrative Review. \u003cem\u003eFront Immunol\u003c/em\u003e\u003cstrong\u003e13\u003c/strong\u003e, 880201 (2022). https://doi.org:10.3389/fimmu.2022.880201\u003c/li\u003e\n\u003cli\u003e Michalek, I. M., Loring, B. \u0026amp; John, S. M. A systematic review of worldwide epidemiology of psoriasis. \u003cem\u003eJ Eur Acad Dermatol Venereol\u003c/em\u003e\u003cstrong\u003e31\u003c/strong\u003e, 205-212 (2017). https://doi.org:10.1111/jdv.13854\u003c/li\u003e\n\u003cli\u003e Chen, Y. G., Satpathy, A. T. \u0026amp; Chang, H. Y. Gene regulation in the immune system by long noncoding RNAs. \u003cem\u003eNat Immunol\u003c/em\u003e\u003cstrong\u003e18\u003c/strong\u003e, 962-972 (2017). https://doi.org:10.1038/ni.3771\u003c/li\u003e\n\u003cli\u003e Hur, K., Kim, S. H. \u0026amp; Kim, J. M. Potential Implications of Long Noncoding RNAs in Autoimmune Diseases. \u003cem\u003eImmune Netw\u003c/em\u003e\u003cstrong\u003e19\u003c/strong\u003e, e4 (2019). https://doi.org:10.4110/in.2019.19.e4\u003c/li\u003e\n\u003cli\u003e Ji, P.\u003cem\u003e et al.\u003c/em\u003e MALAT-1, a novel noncoding RNA, and thymosin beta4 predict metastasis and survival in early-stage non-small cell lung cancer. \u003cem\u003eOncogene\u003c/em\u003e\u003cstrong\u003e22\u003c/strong\u003e, 8031-8041 (2003). https://doi.org:10.1038/sj.onc.1206928\u003c/li\u003e\n\u003cli\u003e Zhang, X., Hamblin, M. H. \u0026amp; Yin, K. J. The long noncoding RNA Malat1: Its physiological and pathophysiological functions. \u003cem\u003eRNA Biol\u003c/em\u003e\u003cstrong\u003e14\u003c/strong\u003e, 1705-1714 (2017). https://doi.org:10.1080/15476286.2017.1358347\u003c/li\u003e\n\u003cli\u003e Elamir, A. M., Shaker, O. G., El-Komy, M. H., Mahmoud Sharabi, M. \u0026amp; Aboraia, N. M. The role of LncRNA MALAT-1 and MiRNA-9 in Psoriasis. \u003cem\u003eBiochem Biophys Rep\u003c/em\u003e\u003cstrong\u003e26\u003c/strong\u003e, 101030 (2021). https://doi.org:10.1016/j.bbrep.2021.101030\u003c/li\u003e\n\u003cli\u003e Casanova, J. E.\u003cem\u003e et al.\u003c/em\u003e Association of Rab25 and Rab11a with the apical recycling system of polarized Madin-Darby canine kidney cells. \u003cem\u003eMol Biol Cell\u003c/em\u003e\u003cstrong\u003e10\u003c/strong\u003e, 47-61 (1999). https://doi.org:10.1091/mbc.10.1.47\u003c/li\u003e\n\u003cli\u003e Chamcheu, J. C.\u003cem\u003e et al.\u003c/em\u003e Upregulation of PI3K/AKT/mTOR, FABP5 and PPARbeta/delta in Human Psoriasis and Imiquimod-induced Murine Psoriasiform Dermatitis Model. \u003cem\u003eActa Derm Venereol\u003c/em\u003e\u003cstrong\u003e96\u003c/strong\u003e, 854-856 (2016). https://doi.org:10.2340/00015555-2359\u003c/li\u003e\n\u003cli\u003e 王昊, 冉立伟, 惠珂, 王新阳 \u0026amp; 郑焱. Survivin和PI3K、AKT在寻常型银屑病皮损角质形成细胞中的表达及其相关性. \u003cem\u003e南方医科大学学报\u003c/em\u003e\u003cstrong\u003e37\u003c/strong\u003e, 1512-1516 (2017). https://doi.org:10.3969/j.issn.1673-4254.2017.11.14\u003c/li\u003e\n\u003cli\u003e Zhang, M. \u0026amp; Zhang, X. The role of PI3K/AKT/FOXO signaling in psoriasis. \u003cem\u003eArch Dermatol Res\u003c/em\u003e\u003cstrong\u003e311\u003c/strong\u003e, 83-91 (2019). https://doi.org:10.1007/s00403-018-1879-8\u003c/li\u003e\n\u003cli\u003e Swindell, W. R.\u003cem\u003e et al.\u003c/em\u003e Genome-wide expression profiling of five mouse models identifies similarities and differences with human psoriasis. \u003cem\u003ePLoS One\u003c/em\u003e\u003cstrong\u003e6\u003c/strong\u003e, e18266 (2011). https://doi.org:10.1371/journal.pone.0018266\u003c/li\u003e\n\u003cli\u003e Shah, N., Deol, G., McMullen, E., Maazi, M. \u0026amp; Vender, R. B. From treatment to trigger: a systematic review of imiquimod-induced psoriasis. \u003cem\u003eInt J Dermatol\u003c/em\u003e\u003cstrong\u003e63\u003c/strong\u003e, e137-e139 (2024). https://doi.org:10.1111/ijd.17267\u003c/li\u003e\n\u003cli\u003e Chen, J.\u003cem\u003e et al.\u003c/em\u003e Bifidobacterium longum subsp. longum B-53 Alleviated Abnormalities of Glycolipid Metabolism and Oxidative Stress in T2DM Mice Through Regulating Gut Microbiota and GLP-1 Secretion. \u003cem\u003eJournal of Agricultural and Food Chemistry\u003c/em\u003e\u003cstrong\u003e73\u003c/strong\u003e, 24169-24186 (2025). https://doi.org:10.1021/acs.jafc.5c07346\u003c/li\u003e\n\u003cli\u003e Yang, L.\u003cem\u003e et al.\u003c/em\u003e Neurons enhance blood\u0026ndash;brain barrier function via upregulating claudin-5 and VE-cadherin expression due to glial cell line-derived neurotrophic factor secretion. \u003cem\u003eeLife\u003c/em\u003e\u003cstrong\u003e13\u003c/strong\u003e, RP96161 (2024). https://doi.org:10.7554/eLife.96161\u003c/li\u003e\n\u003cli\u003e Xu, P.\u003cem\u003e et al.\u003c/em\u003e MiR-140 inhibits classical swine fever virus replication by targeting Rab25 in swine umbilical vein endothelial cells. \u003cem\u003eVirulence\u003c/em\u003e\u003cstrong\u003e11\u003c/strong\u003e, 260-269 (2020). https://doi.org:10.1080/21505594.2020.1735051\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Psoriasis, LncRNA-MALAT1, miR-125, Rab25, PI3K, AKT","lastPublishedDoi":"10.21203/rs.3.rs-8413152/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-8413152/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003ePsoriasis, a prevalent and chronic inflammatory skin disorder, lacks a curative therapy largely due to the incomplete understanding of its complex and multifactorial pathogenesis. A growing body of evidence highlights lncRNAs as a focal point in psoriasis research, with specific transcripts driving critical aspects of its immunopathogenesis. The long non-coding RNA MALAT1, frequently dysregulated in psoriatic lesions, has been identified as a key contributor to the disease, with evidence linking its expression to promoting keratinocyte hyperproliferation and inflammatory responses. Consistent with its potential role in pathogenesis, LncRNA-MALAT1 was substantially elevated in psoriatic skin samples, while miR-125 expression was concurrently suppressed. To explore the functional role of LncRNA-MALAT1, we employed an IMQ-induced psoriasis-like mouse model, which recapitulated the dysregulated expression pattern (increased LncRNA-MALAT1, Rab25, PI3K/AKT activity; decreased miR-125). Strikingly, specific knockdown of LncRNA-MALAT1 in vivo markedly alleviated the inflammatory skin manifestations. This phenotypic improvement coincided with a reversal of the molecular signature, namely downregulation of Rab25 and PI3K/AKT signaling and restoration of miR-125 expression. In summary, these findings suggest that LncRNA-MALAT1 may participate in the pathogenesis and progression of psoriasis by activating the Rab25/PI3K/AKT signaling pathway via miR-125, thereby providing a novel therapeutic target for psoriasis treatment.\u003c/p\u003e","manuscriptTitle":"Mechanism of MALAT1 in Regulating the Rab25/PI3K/Akt Pathway via miR-125 in a Mouse Model of Psoriasis","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2026-01-20 08:30:57","doi":"10.21203/rs.3.rs-8413152/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"reviewersInvited","content":"","date":"2026-01-15T19:02:55+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2026-01-07T02:07:39+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2025-12-31T13:56:54+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-12-30T16:29:23+00:00","index":"","fulltext":""},{"type":"submitted","content":"Scientific Reports","date":"2025-12-30T16:21:37+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"ee1af568-2c95-43f6-965b-3adf0f4467f5","owner":[],"postedDate":"January 20th, 2026","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[{"id":61207918,"name":"Biological sciences/Cell biology"},{"id":61207919,"name":"Health sciences/Diseases"},{"id":61207920,"name":"Health sciences/Medical research"},{"id":61207921,"name":"Biological sciences/Molecular biology"},{"id":61207922,"name":"Health sciences/Molecular medicine"},{"id":61207923,"name":"Health sciences/Pathogenesis"}],"tags":[],"updatedAt":"2026-01-20T08:30:57+00:00","versionOfRecord":[],"versionCreatedAt":"2026-01-20 08:30:57","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-8413152","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-8413152","identity":"rs-8413152","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.