Molecular detection of Wolbachia sp. and cytoplasmic incompatibility factors (CifA/B) in wild caught mosquitoes in Côte d'Ivoire

preprint OA: gold CC-BY-4.0
📄 Open PDF Full text JSON View at publisher
Full text 117,393 characters · extracted from preprint-html · click to expand
Molecular detection of Wolbachia sp. and cytoplasmic incompatibility factors (CifA/B) in wild caught mosquitoes in Côte d'Ivoire | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Molecular detection of Wolbachia sp. and cytoplasmic incompatibility factors (CifA/B) in wild caught mosquitoes in Côte d'Ivoire Raymond Karlhis YAO, Michel Kiréopori GOMGNIMBOU, Ibrahima Zanakoungo COULIBALY, and 6 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-5377992/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 31 Jan, 2025 Read the published version in Molecular Biology Reports → Version 1 posted 8 You are reading this latest preprint version Abstract Background: Wolbachia is an endosymbiont bacterium known to stimulate host immunity against arboviruses and protozoa. Côte d'Ivoire is in a malaria-endemic region, and has experienced several dengue epidemics in recent decades as well. In order to help reduce the transmission of pathogens by mosquito vectors, we studied the prevalence of Wolbachia and the distribution of Cif genes in different mosquito species caught in the wild in Cote d’Ivoire. Methods and Results: Mosquitoes of the genera Anophele, Aedes, Culex and Mansonia were captured in five cities. Mosquitoes were collected at larval stage in breeding sites and adults were captured using BG sentinel traps. The mosquitoes were identified morphologically and Wolbachia and cytoplasmic incompatibility factors were screened using qPCR targeting the 16s rRNA gene and the Cif A,B genes. A total of 518 mosquito samples belonging to 15 species and 4 genera were examined. Sixty percent of the species were infected with Wolbachia. The three medically important mosquito species Aedes aegypti, Anopheles gambiae s.l. and Culex quinquefasciatus had a prevalence of 12.84%, 13.46% and 72.64% respectively. The Wolbachia strains infecting the different mosquito species of the genus Culex encoded 98.46% for the Cif A gene and 88.46 % for the Cif B gene. Conclusion: The presence of Wolbachia and Cif A,B genes in mosquitoes of different species in Côte d'Ivoire offer a promising opportunity to reduce the competence of mosquito vectors. Characterization of Wolbachia strains and cytoplasmic incompatibility factors will provide a better understanding of these endosymbionts, enabling the development of vector control strategies. Wolbachia prevalence mosquitos CifA CifB Côte d’Ivoire Figures Figure 1 Figure 2 Introduction Wolbachia is an intracellular α-proteobacterium belonging to the genus Rickettsale. It is considered to be the most abundant endosymbiont on earth due to its wide distribution in at least 40 % of arthropod species [1]. The discovery of this bacterium dates back to 1924, in the reproductive tissues of Culex pepens . It resulted from the work of Hertig Marshall and Wolbach Burt during their study of Rickettsial microorganisms in insects [2]. Numerous studies around the world have subsequently identified Wolbachia infections in several insects, including different species of mosquito [3,4]. Wolbachia is a symbiotic bacterium that has an antagonistic relationship with arboviruses [5], but also with protozoa [6]. It also has parasitic relationships with these arthropod hosts and a symbiotic relationship with nematodes [7–9]. It is a bacterium that is transmitted through successive generations by maternal heredity [10] although lateral transfer between species has been documented [11]. Vertical transmission of Wolbachia through natural populations in arthropods is mediated by reproductive parasitism. This parasitism is mediated by several mechanisms, namely the feminization of males, which is characterized by the transformation of genetic males into physiologically functional females [12] meiotic drive, which prevents the production of Z oocytes by females, resulting in female offspring with a Z0 [13] the killing of males [14] parthenogenesis [3]. These mechanisms all result in the production of exclusively female offspring. In addition to these mechanisms for distorting the sex ratio, there is cytoplasmic incompatibility (CI), which favors the proliferation of host specimens infected with Wolbachia [15,16]. Cytoplasmic incompatibility is the mechanism exploited in several vector control strategies [17,18]. It occurs when a male infected with Wolbachia mates with an uninfected female or a female infected with strains phylogenetically distant from that of the male. CI results in the reduction of embryos from incompatible crosses. The search for genetic factors responsible for CI led to the identification of two genes encoded in a prophage region inserted into the w Mel genome, a Wolbachia strain infecting Drosophila melanogaster [19]. Similar results were obtained with the w Pip strain infecting Culex pipins [20]. These genes were given the general name "cytoplasmic incompatibility factors" ( Cif ) , and then the letters A and B were attached to mark the difference in the naming of these two genes ( Cif A and Cif B) [19]. Depending on the functional domains involved in the manifestation of CI, these genes are coded Cid in reference to the enzyme Deubiquitylase (DUB) or Cin in reference to a putative nuclease; these functional domains are coded in the sequence of the Cif B gene [20]. On the basis of their protein sequences, Cif are grouped into four distinct phylogenetic groups designated "type I-IV [19,21]. Cif are both encoded in the same operon and are always co-transcribed [21]. However, they are regulated differently depending on the stage of embryonic development of the host [21]. Expression of Cif B in the testes is associated with the manifestation of CI in incompatible crosses; as for the Cif A gene, its expression in the ovaries of females is responsible for the rescue of CI [22]. The Wolbachia based vector control strategy is based on the prevalence of this bacterium and the polymorphism of the Cif proteins. Data on the prevalence of Wolbachia and a better understanding of the functional and molecular aspects of the Cif genes are indicators for choosing the appropriate Wolbachia strain for implementing a vector control strategy. Wolbachia is known to inhibit the development of parasites and arboviruses. However, the number of malaria infections remains high in Côte d'Ivoire. We have also seen a rise in dengue epidemics over the years. This raises questions about the presence of Wolbachia in wild mosquito populations. If the presence of Wolbachia is confirmed, the existence of Cif genes responsible for its propagation within mosquito populations remains to be seen. In this study, we examined the level of natural Wolbachia infection in different mosquito populations from five cities in Côte d'Ivoire and determined the distribution of Cif genes within Wolbachia -infected populations using polymerase chain reaction for analysis. Materials and Methods Study sites and period The mosquitoes were sampled in five cities in Côte d'Ivoire. These were the cities of Abidjan and Bingerville in the south of the country, the city of Bouaké in the center and the cities of Korhogo and Boundiali in the north of the country. These cities are located in different climatic environments [23]. In the north, the wooded savannah is subject to a tropical climate (Sudanese climate), with a rainy season extending from April-May to the end of October. Rainfall peaks in August, followed by a dry season. In the south, we have a humid equatorial climate (Atrean climate) , with two rainy seasons, the main one running from May to July and a short one from October to November, and two dry seasons. In the center, we have an intermediate climate (Baouleen climate). Mosquito sampling Mosquitoes were sampled using two different techniques: larval collection and capture using sentinel BG traps. The larvae were surveyed on vegetable farms and/or in rice fields in baffles, then at breeding sites (abandoned tires, used containers, and in watering holes) in the vicinity of mixed animal farms. To capture adults, BG sentinel traps were placed about one meter outside homes between 4pm and 6am. The BG sentinel trap contained an attractant (carbon dioxide) consisting of a mixture of water (1L), sugar (500g) and baker's yeast (16g) in the proportions indicated to attract mosquitoes. After each larval survey, the larvae were maintained in the laboratory under a 12h:12h photoperiod at 28°C. After the emergence of the adults, the mosquito species were identified morphologically using a binocular magnifying glass according to the identification keys for Culicidae [24,25] and the Anophelinae [26] . All species of mosquitoes sampled and identified were then preserved in silica gel until further use. Extraction of DNA from mosquito species Total DNA was extracted from each mosquito using the method previously described by Cornel and Collins, (1996) with some modification . This involved first soaking the whole mosquitoes in 2% cetyl trimethyl ammonium bromide (CTAB). They were then individually crushed in 200 μl of CTAB and incubated at 65°C for 5 min. A total of 200 μl of chloroform was then added and the resulting mixture centrifuged for 5 min at 12,000 rpm. The supernatant was pipetted into a new 1.5 ml tube to which 200 μl of isopropanol was added; the mixture was centrifuged for 15 min at 12,000 rpm to precipitate the DNA. The supernatant was then discarded and the DNA pellet formed at the bottom of the tubes was purified with 70 % ethanol. After a further centrifugation step at 12,000 rpm for 5 min, the ethanol was removed and the pellet dried overnight. The extracted DNA was dissolved in 20 μl of biomol water (Solis Biodyne) before storage at -20°C. Detection of Wolbachia and distribution Cif genes by qPCR The presence of Wolbachia in mosquitoes was investigated by quantitative PCR (qPCR) using the primer pair sense 5' CATACCTATTCGAAGGGATAG 3' and anti-sense 5'TTGCGGGACTTAACCCAACA 3' specific for Wolbachia 16s rRNA (Gomes et al., 2017). Samples testing positive for the presence of Wolbachia were examined for the presence of the Cif A and Cif B genes by qPCR, respectively with primer pairs CifAF: 5'ATAAAGGCGTTTCAGCAGGA 3', CifAR: 5' AGCAAACGTTCACATTTCC 3' and CifBF: 5' TACGGGAAGTTTCATGCACA 3' , CifBR: 5' TTGCCAGCCATCATTCATAA 3' [21] . PCR was performed on the CFX96 system (Bio-Rad) using the 5x HOT FREPol EvaGreen qPCR Mix Plus (ROX) kit (Solis BioDyne) with the sense and antisense primers concentrated at 250 mM. PCR conditions were as follows: initial denaturation at 95°C for 12 minutes, followed by 40 cycles of 15s denaturation at 95°C, 20s hybridization at 58°C, 20s elongation at 72°C. Samples are considered positive when Cycles threshold (Ct) value was under or equal to 38. The specificity of reaction was checked through the melting curve during Wolbachia’s detection by varying the temperature from 65°C to 95°C. The melting temperature equal to 84°C ± 2°C was determined from positive control. For Cif genes, samples are considered positive when the Cq ≤ 35. Data analysis For the comparison of Wolbachia prevalence according to sex and according to capture zones, the parametric Chi 2 test and the non-parametric Fisher's exact test were carried out respectively for species with a large sample size and those with a small sample size. Differences were considered statistically significant when P < 0.05. These analyses and the production of the maps and barplots were carried out using R software version 4.2.3. Results Inventory of mosquito species caught A total of 812 mosquito specimens were captured in the four cities of Côte d'Ivoire. These mosquitoes were divided into 15 species belonging to 4 genera. The species identified are: Aedes aegypti, Aedes vittatus, Anopheles gambiae, Anopheles paludis, Culex poicilipes, Culex theilleri, Culex (Lutzia) tigripes, Culex quinquefasciatus, Culex quinquevitatus, Culex neubulosus, Culex barraudius , Culex decens, Culex univitatus, Culex rubinotus and Mansonia Uniformis . Mosquitoes known for their high vectorial capacity in the transmission of infectious agents to humans, namely Aedes aegypti , Anophele gambiae and Culex quequefasciatus [29,30], were present at most of the capture sites (Fig.1). These three species were the most abundant at our various capture sites. The geographical distribution of these mosquito species will enable us to determine their relative prevalence according to the different climatic zones . Wolbachia screening by qPCR A subset of 518 mosquitoes from the five cities was analyzed for Wolbachia in different mosquito populations. Wolbachia was screened from both female and male specimens. For each city, 30 to 60 samples were selected for females of each species caught. For males, 30 to 60 specimens were selected per species for all five cities. For less abundant species, all samples were analyzed. Wolbachia was detected in 43.60% of all mosquitoes analyzed (Tableau 1). For the mosquito populations of the five cities, all three medically important species were found to be infected with Wolbachia . The prevalence of Wolbachia infection varie depending on the species and sex. For all the samples bewildered, the prevalence of Wolbachia was statistically different according to sex. It was higher in females compared in males. There was no statistical difference in the prevalence of Aedes aegypti , Anophele gambiae , Culex tigripès and Culex theilleri ; however, females had higher infection rates. In Culex quinquefasciatus, prevalence was significantly different according to sex (p=0.01013). Tableau 1 Prevalence of Wolbachia in adults of different mosquito species Species 16s rRNA Comparison by gender Population Femele Male Chi 2 df p-value Aedes aegypti 12.84 % (14/109) 13.43 % (9/67) 11,90 % (5/42) 0.05385 1 0.8165 Aedes vittatus 0.00 % (0/1) 0.00 % (0/1) - - - - Anophele gambiae s.l. 13.46 % (14/104) 15,79 % (9/57) 10,64 % (5/47) 0.58674 1 0.4437 Anophele paludis 0.00 % (0/2) 0.00 % (0/2) - Culex quinquefasciatus 72.64 % (146/201) 76.02 % (130/171) 53,33 % (16/30) 6.611 1 0.01013* Culex (Lutzia) tigripes 52.14 % (12/23) 50.00 % (7/14) 44,44 % (4/9) - - 1 Culex barraudius 0.00 % (0/1) 0.00 % (0/1) - - - - Culex decens 29.63 % (8/27) 29.63 % (8/27) - - - - Culex neubulosus 50.00 % (1/2) 50.00 % (1/2) - - - - Culex poicilipes 0.00 % (0/20) 0.00 % (0/9) 0.00 % (0/11) - - - Culex quinquevitatus 0.00 % (0/2) 0.00 % (0/2) - - - - Culex rubinotus 100.00 % (5/5) 100.00 % (5/5) - - - - Culex theilleri 88.89 % (16/18) 90.00 % (9/10) 87.50 % (7/8) - - 1 Culex univitatus 100.00 % (1/1) 100.00 % (1/1) - - - - Mansonia uniformis 100.00 % (2/2) 100.00 % (2/2) - - - - Total 43,60 % (218/518) 48,79 % (181/371) 25,17 % (37/147) 24.093 1 9.179e- 07 * The frequency of Wolbachia infection according to sex for each species of mosquito was compared by Chi 2 test, with degree of freedom (df) equal to 1. For species which had low effectiveness, the frequency of Wolbachia infection according to sex was compared using Fisher's exact test. The presence of * mean a statistical difference. The comparison of the prevalence among females of three medically important mosquito species in different climatic zones namely Ae. Aegypti (p=0.459), An. gambiae sl (p=0.459), Cx. quinquefasciatus (p=0.1289) reveals no statistical difference (Fig.2; Online Resource 1). For Aedes aegypti females, the prevalence was 14.61 % in the south and 5 % in the north. For Anophele gambiae females, the prevalence was 16.67 % in the south and 13.04 % in the north. For Culex quiquefasciatus females, the prevalence was 67.12 % in the south, 66.67 % in the center and 79.78 % in the north (Online Resource 1). Determination of cif A and cif B genes in captured mosquito species The cif A and cif B genes were determined by qPCR. On the basis of the results obtained, all the mosquito species of genus Culex infected with Wolbachia possessed the cif A and cif B genes (Table 2). These two genes had high prevalences ranging from 96.63% to 100% for the cif A gene and from 70.97 % to 100% for the cif B gene. The cif A gene had a higher average prevalence than the cif B gene. These data show that cif genes distribution within wild populations of mosquito of genus Culx . Tableau 2 Distribution of cif A and cif B genes in Wolbachia-infected mosquito species Species Amplification qPCR cif A cif B Culex (Lutzia) tigripes 100.00 % (11 / 11) 90.91 % (10/11) Culex decens 100.00 % (6/6) 100.00 % (6/6) Culex neubulosus 100.00 % (1/1) 100.00 % (1/1) Culex quinquefasciatus 96.63 % (91/93) 70.97 % (66/93) Culex rubinotus 100.00 % (5/5) 100.00 % (5/5) Culex theilleri 100.00 % (13/13) 92.30 % (12/13) Culex univitatus 100.00 % (1/1) 100.00 % (1/1) Total 98.46 % (128/130) 88.46 % (115/130) Discussion Vector control strategies based on Wolbachia require a preliminary study of Wolbachia prevalence in target vector populations. It also requires characterization of the Wolbachia strains circulating in these populations when they are naturally infected. The phylogeny of the cytoplasmic incompatibility proteins Cif A and Cif B is one of the main features of the phenotype manifestation. In the case of this study, the aim was to determine the prevalence of Wolbachia in the wild population of mosquitoes caught in Côte d’Ivoire. Also, the distribution of the cytoplasmic incompatibility factors Cif A and Cif B in different species was determined. This is in order to consider the search for it from these mosquito species, active prophage capable of carrying these cif genes in a vector control perspective. To this end, 15 mosquito species belonging to four genera were analyzed for Wolbachia . Nine species, namely Aedes aegypti , Anopheles gambiae s.l ., Culex theilleri , Culex (Lutzia) tigripes , Culex rubinitus , Culex univitatus , Culex quinquefasciatus , Culex neubulosus and Mansonia Uniformis , tested positive. Detection of Wolbachia in wild mosquitoes caught in Côte d'Ivoire by qPCR resulted in a prevalence of 43.60% across all mosquito species. Different genetic markers and screening methods for Wolbachia have been used in several studies worldwide [3,31,32]. The results of this study show that Wolbachia is widespread in mosquitoes in Côte d'Ivoire compared with countries such as Cameroon (1.87%) [4] California (18.23%) [31]. The prevalence obtained in this study is comparable to that reported in Singapore (43.9%) [50] and is relatively high compared to that reported in China (36.1%) [34]. In addition to the screening method, the observed difference in reported prevalences could result from the interaction of several factors, including the specific composition of mosquito populations, the sex of specimens, ecology and climatic variations. Our results show that 60.00% of the mosquito species captured were infected with Wolbachia . This percentage is relatively high compared with those reported in several other studies carried out in Sri Lanka (18.2%) [35], Madagascar (46.7%) [11], Taiwan (51.4%) [36] Singapore (1.2%) [33]. According to the literature, Wolbachia appears to be ubiquitous in certain mosquito species, such as Aedes albopictus and the Culex pipens complex. However, in other species such as Aedes aegypti , Wolbachia appears to be naturally absent [37]. The results showed a statistically significant difference (p=9.179e-07 <0.05) in the infection rate of female mosquitoes (48.66%) versus males (25.17%). For each mosquito species tested, Wolbachia prevalence was higher in females. The effect of sex on Wolbachia infection rates has been demonstrated in several studies. This observation has been reported in Malaysia [38] and Singapore [33]. This difference in prevalence could be the result of female feeding, as demonstrated by Balaji et al . [39], who showed that this difference was more pronounced when females benefited from the blood meal. The ecology of the different vectors is an important parameter in determining the Wolbachia infection status of vectors. Numerous studies carried out on the Asian, European and American continents have failed to determine Wolbachia infection in Anopheles mosquitoes. However, several studies conducted throughout Africa have demonstrated Wolbachia infection in species of this genus [40,41]. In Central Africa alone, Wolbachia infection has been detected in 16 different Anopheles species [42]. Exceptionally, mosquitoes of the Culex pipens complex caught in Madagascar were free from Wolbachia [33]. However, the results of studies carried out throughout the world converge on the ubiquitous presence of Wolbachia within this vector complex; in particular, in the Culex pipens and Culex quinquefasciatus species, with high prevalences [31,33,43]. This study shows a difference in prevalence of Wolbachia in females of the three species depending on the capture area. However, this difference is not statistically significant. This work reports for the first time in Côte d'Ivoire the natural infection by Wolbachia in Ae. aegypti , An. gambiae s.l . and Culex quinquefasciatus , three vector species of the main human pathogens in Africa [44–46]. The results of this study show that all Wolbachia strains infecting the different mosquito species of the genera Culex analyzed possess cytoplasmic incompatibility factors. This result corroborates those of numerous other studies demonstrating the induction of cytoplasmic incompatibility by Wolbachia strains naturally present in mosquitoes [47]. In five of the species of the genera Culex studied , Culex theilleri , Cules decens , Culex rubinotus, Culex univitatus and Culex neubulosus , there was no difference in the prevalence of the cif A and cif B genes. This may be explained by the fact that these two genes are encoded in a bi-cistronic operon [21]. However, Culex (Lutzia) tigripes had a 100% prevalence of the cif A gene and a cif B prevalence was 90.91 %. Also in Culex quinquefasciatus , cif A had a prevalence of 96.63%, relatively higher than that of cif B, which was 70.97 %. These results suggest that the cif A gene is better conserved than the cif B gene. According to their function, the Cif B protein present in the spermatozoon constitutes the toxin which will complex the paternal genetic heritage and lead to a mitotic defect after fertilization of the ovum [48]. The presence of a compatible Cif A protein in the egg is necessary for embryogenesis to proceed smoothly, neutralizing Cif B [49]. As a result, Cif B leads to the selection of Cif A for a compatible cross; thus, denaturation of the cif A gene in a viable embryo would be preceded by denaturation of the cif B gene. [50] show that these genes very often acquire loss-of-function mutations and become pseudogenes. Therefore, the mere presence of the cif genes in the Wolbachia genome is not sufficient to infer the ability of the bacterial strain to induce or rescue CI. Conclusion Our investigation of natural Wolbachia infection within populations of mosquito species in Côte d'Ivoire and and distribution of Cif genes several species of Culex provided preliminary data for the development of Wolbachia-based vector control strategies. We were able to determine the presence of Wolbachia in the three medically important mosquito species. We need sequencing to determine the Wolbachia line and their phylogeny with other Wolbachia strains. Declarations Acknowledgment The authors would like to thank Centre d'Excellence Africain en Innovations Biotechnologiques pour l'Elimination des Maladies à Transmission Vectorielle (CEA/ITECH-MTV) of the Université Nazi Boni, Bobo-Dioulasso, Burkina Faso and Wellcome Trust for supporting this work. Also, we thank the Institut Pasteur de Côte d'Ivoire for making its mosquito capture equipment and entomology platform available to us; the Centre MURAZ and the Institut de Recherche en Sciences de la Santé for the Molecular Biology Platform. Our thanks to the entomology team for their active contribution. We appreciate the active contribution of local volunteers to this study. Author contributions Raymond Karlhis YAO, Michel Kiréopori GOMGNIMBOU, Abdoulaye DIABATE and Etienne BILGO conceived of the study. Raymond Karlhis YAO, Ibrahima Zanakoungo COULIBALY, Christiane You ESSOH, Issouf Traoré, Miriam Félicité AMARA and Berenger Aristide AKO, conducted the experiments. Raymond Karlhis YAO, Michel Kiréopori GOMGNIMBOU and Etienne BILGO analysed the data. All authors drafted the manuscript. All authors read and approved the final manuscript. Funding The field activities and RKY PhD scholarship were funded by the Centre d'Excellence Africain en Innovations Biotechnologiques pour l'Elimination des Maladies à Transmission Vectorielle (CEA/ITECH-MTV) of the Université Nazi Boni, Bobo-Dioulasso, Burkina Faso, grant ref/letter acceptation CEA/ITECH-MTV du 04/02/2021 à YAO R. Karlhis. Additional field activities were supported by CEA/ITECH-MTV, grant ref/letter acceptation CEA/ITECH-MTV du 04/02/2021 à AMARA Miriam Félicité and lab activities were supported by Wellcome Trust grant ref 218771/Z/19/Z. Competing interests No competing interests were disclosed. Consent for publication Not applicable Ethics approval and consent to participate Not applicable References Zug R, Hammerstein P (2012) Still a Host of Hosts for Wolbachia: Analysis of Recent Data Suggests That 40% of Terrestrial Arthropod Species Are Infected. PLoS ONE 7:e38544. https://doi.org/10.1371/journal.pone.0038544. Hertig M, Wolbach SB (1924) Studies on Rickettsia-Like Micro-Organisms in Insects. J Med Res 44:329-374.7. Weeks AR, Breeuwer JAJ (2001) Wolbachia –induced parthenogenesis in a genus of phytophagous mites. Proc R Soc Lond B Biol Sci 268:2245–51. https://doi.org/10.1098/rspb.2001.1797. Bamou R, Diarra AZ, Mayi MPA, Djiappi-Tchamen B, Antonio-Nkondjio C, Parola P (2021) Wolbachia Detection in Field-Collected Mosquitoes from Cameroon. Insects 12:1133. https://doi.org/10.3390/insects12121133. Hugo LE, Rašić G, Maynard AJ, Ambrose L, Liddington C, Thomas CJE, et al (2022) Wolbachia wAlbB inhibit dengue and Zika infection in the mosquito Aedes aegypti with an Australian background. PLoS Negl Trop Dis 16. https://doi.org/10.1371/journal.pntd.0010786. Kambris Z, Blagborough AM, Pinto SB, Blagrove MSC, Godfray HCJ, Sinden RE, et al (2010) Wolbachia Stimulates Immune Gene Expression and Inhibits Plasmodium Development in Anopheles gambiae. PLOS Pathog 6:e1001143. https://doi.org/10.1371/journal.ppat.1001143. McMeniman CJ, O’Neill SL (2010) A virulent Wolbachia infection decreases the viability of the dengue vector Aedes aegypti during periods of embryonic quiescence. PLoS Negl Trop Dis 4:e748. https://doi.org/10.1371/journal.pntd.0000748. Comandatore F, Cordaux R, Bandi C, Blaxter M, Darby A, Makepeace BL, et al (2015) Supergroup C Wolbachia , mutualist symbionts of filarial nematodes, have a distinct genome structure. Open Biol 5:150099. https://doi.org/10.1098/rsob.150099. Fraser JE, Bruyne JTD, Iturbe-Ormaetxe I, Stepnell J, Burns RL, Flores HA, et al (2017) Novel Wolbachia-transinfected Aedes aegypti mosquitoes possess diverse fitness and vector competence phenotypes. PLOS Pathog 13:e1006751. https://doi.org/10.1371/journal.ppat.1006751. Baldini F, Segata N, Pompon J, Marcenac P, Robert Shaw W, Dabiré RK, et al (2014) Evidence of natural Wolbachia infections in field populations of Anopheles gambiae. Nat Commun 5:3985. https://doi.org/10.1038/ncomms4985. Jeffries CL, Tantely LM, Raharimalala FN, Hurn E, Boyer S, Walker T (2018) Diverse novel resident Wolbachia strains in Culicine mosquitoes from Madagascar. Sci Rep 8:17456. https://doi.org/10.1038/s41598-018-35658-z. Badawi M, Grève P, Cordaux R (2015) Feminization of the Isopod Cylisticus convexus after Transinfection of the wVulC Wolbachia Strain of Armadillidium vulgare. PLOS ONE 10:e0128660. https://doi.org/10.1371/journal.pone.0128660. Miyata M, Konagaya T, Yukuhiro K, Nomura M, Kageyama D (2017) Wolbachia -induced meiotic drive and feminization is associated with an independent occurrence of selective mitochondrial sweep in a butterfly. Biol Lett 13:20170153. https://doi.org/10.1098/rsbl.2017.0153. Arai H, Lin SR, Nakai M, Kunimi Y, Inoue MN (2020) Closely Related Male-Killing and Nonmale-Killing Wolbachia Strains in the Oriental Tea Tortrix Homona magnanima. Microb Ecol 79:1011–20. https://doi.org/10.1007/s00248-019-01469-6. Ant TH, Herd C, Louis F, Failloux AB, Sinkins SP (2020) Wolbachia transinfections in Culex quinquefasciatus generate cytoplasmic incompatibility. Insect Mol Biol 29:1–8. https://doi.org/10.1111/imb.12604. Shi H, Yu X, Cheng G (2023) Impact of the microbiome on mosquito-borne diseases. Protein Cell :pwad021. https://doi.org/10.1093/procel/pwad021. Hoffmann AA, Montgomery BL, Popovici J, Iturbe-Ormaetxe I, Johnson PH, Muzzi F, et al (2011) Successful establishment of Wolbachia in Aedes populations to suppress dengue transmission. Nature 476:454–7. https://doi.org/10.1038/nature10356. Caputo B, Moretti R, Manica M, Serini P, Lampazzi E, Bonanni M, et al (2020) A bacterium against the tiger: preliminary evidence of fertility reduction after release of Aedes albopictus males with manipulated Wolbachia infection in an Italian urban area. Pest Manag Sci 76:1324–32. https://doi.org/10.1002/ps.5643. LePage DP, Metcalf JA, Bordenstein SR, On J, Perlmutter JI, Shropshire JD, et al (2017) Prophage WO genes recapitulate and enhance Wolbachia-induced cytoplasmic incompatibility. Nature 543:243–7. https://doi.org/10.1038/nature21391. Beckmann JF, Ronau JA, Hochstrasser M. A (2017) Wolbachia deubiquitylating enzyme induces cytoplasmic incompatibility. Nat Microbiol 2:17007. https://doi.org/10.1038/nmicrobiol.2017.7. Lindsey ARI, Rice DW, Bordenstein SR, Brooks AW, Bordenstein SR, Newton ILG (2018) Evolutionary Genetics of Cytoplasmic Incompatibility Genes cifA and cifB in Prophage WO of Wolbachia. Genome Biol Evol 10:434–51. https://doi.org/10.1093/gbe/evy012. Shropshire JD, Rosenberg R, Bordenstein SR (2021) The impacts of cytoplasmic incompatibility factor ( cifA and cifB ) genetic variation on phenotypes. Genetics 217:iyaa007. https://doi.org/10.1093/genetics/iyaa007. Kouassi AM, Kouao J-M, Kouakou KE (2022) Caractérisation intra-annuelle de la variabilité climatique en Côte d’Ivoire. Bull L’association Géographes Fr Géographies 99:289–306. https://doi.org/10.4000/bagf.9534. Huang Y-M (2004) The subgenus Stegomyia of Aedes in the Afrotropical Region with keys to the species (Diptera: Culicidae). Zootaxa 700:1. https://doi.org/10.11646/zootaxa.700.1.1. Robert V, Ndiaye EH, Rahola N, Le Goff G, Bousses P, Diallo D, et al (2022) Clés dichotomiques illustrées d’identification des femelles et des larves de moustiques (Diptera : Culicidae) du Burkina Faso, Cap-Vert, Gambie, Mali, Mauritanie, Niger, Sénégal et Tchad. Montpellier: Institut de Recherche pour le Développement (IRD); https://doi.org/10.23708/fdi :010084866. Clé d’identification des moustiques anophèles femelles de la région afrotropicale (Diptera : Culicidae) n.d. https://www.who.int/fr/publications-detail/WHO-UCN-GMP-2021.04 (accessed June 29, 2023). Cornel AJ, Collins FH (1996) PCR of the Ribosomal DNA Intergenic Spacer Regions as a Method for Identifying Mosquitoes in the Anopheles gambiae Complex. In: Clapp JP, editor. Species Diagn. Protoc. PCR Nucleic Acid Methods, Totowa, NJ: Humana Press; p. 321–32. https://doi.org/10.1385/0-89603-323-6:321. Gomes FM, Hixson BL, Tyner MDW, Ramirez JL, Canepa GE, Alves E Silva TL, et al (2017) Effect of naturally occurring Wolbachia in Anopheles gambiae s.l. mosquitoes from Mali on Plasmodium falciparum malaria transmission. Proc Natl Acad Sci 114:12566–71. https://doi.org/10.1073/pnas.1716181114. Corbel V, Fonseca DM, Weetman D, Pinto J, Achee NL, Chandre F, et al (2017) International workshop on insecticide resistance in vectors of arboviruses, December 2016, Rio de Janeiro, Brazil. Parasit Vectors 10:278. https://doi.org/10.1186/s13071-017-2224-3. Simard F (2018) La lutte contre les vecteurs : quel avenir ? Biol Aujourdhui 212:137–45. https://doi.org/10.1051/jbio/2019006. Torres R, Hernandez E, Flores V, Ramirez JL, Joyce AL (2020) Wolbachia in mosquitoes from the Central Valley of California, USA. Parasit Vectors 13:558. https://doi.org/10.1186/s13071-020-04429-z. Yang Y, He Y, Zhu G, Zhang J, Gong Z, Huang S, et al (2021) Prevalence and molecular characterization of Wolbachia in field-collected Aedes albopictus, Anopheles sinensis, Armigeres subalbatus, Culex pipiens and Cx. tritaeniorhynchus in China. PLoS Negl Trop Dis 15:e0009911. https://doi.org/10.1371/journal.pntd.0009911. Ding H, Yeo H, Puniamoorthy N (2020) Wolbachia infection in wild mosquitoes (Diptera: Culicidae): implications for transmission modes and host-endosymbiont associations in Singapore. Parasit Vectors 13:612. https://doi.org/10.1186/s13071-020-04466-8. Li Y, Sun Y, Zou J, Zhong D, Liu R, Zhu C, et al (2023) Characterizing the Wolbachia infection in field-collected Culicidae mosquitoes from Hainan Province, China. Parasit Vectors 16:128. https://doi.org/10.1186/s13071-023-05719-y. Nugapola NWNP, De Silva WAPP, Karunaratne SHPP (2017) Distribution and phylogeny of Wolbachia strains in wild mosquito populations in Sri Lanka. Parasit Vectors 10:230. https://doi.org/10.1186/s13071-017-2174-9. Tsai K-H, Lien J-C, Huang C-G, Wu W-J, Chen W-J (2004) Molecular (sub) grouping of endosymbiont Wolbachia infection among mosquitoes of Taiwan. J Med Entomol 41:677–83. https://doi.org/10.1603/0022-2585-41.4.677. Gloria-Soria A, Chiodo TG, Powell JR (2018) Lack of Evidence for Natural Wolbachia Infections in Aedes aegypti (Diptera: Culicidae). J Med Entomol 55:1354–6. https://doi.org/10.1093/jme/tjy084. Noor SHMM, Emelia O, Mohd FMY, Aishah HA (2022) Super- or single infection: Wolbachia supergrouping of wild mosquito populations from varied location types in Peninsular Malaysia. Sains Malays 51:27–38. Balaji S, Jayachandran S, Prabagaran SR (2019) Evidence for the natural occurrence of Wolbachia in Aedes aegypti mosquitoes. FEMS Microbiol Lett 366:fnz055. https://doi.org/10.1093/femsle/fnz055. Shaw WR, Marcenac P, Childs LM, Buckee CO, Baldini F, Sawadogo SP, et al (2016) Wolbachia infections in natural Anopheles populations affect egg laying and negatively correlate with Plasmodium development. Nat Commun 7:11772. https://doi.org/10.1038/ncomms11772. Jeffries CL, Lawrence GG, Golovko G, Kristan M, Orsborne J, Spence K, et al (2018) Novel Wolbachia strains in Anopheles malaria vectors from Sub-Saharan Africa. Wellcome Open Res 3:113. https://doi.org/10.12688/wellcomeopenres.14765.2. Ayala D, Akone‐Ella O, Rahola N, Kengne P, Ngangue MF, Mezeme F, et al (2019) Natural Wolbachia infections are common in the major malaria vectors in Central Africa. Evol Appl 12:1583–94. https://doi.org/10.1111/eva.12804. Bergman A, Hesson JC (2021) Wolbachia prevalence in the vector species Culex pipiens and Culex torrentium in a Sindbis virus-endemic region of Sweden. Parasit Vectors 14:428. https://doi.org/10.1186/s13071-021-04937-6. Konan YL, Coulibaly ZI, Koné AB, Ekra KD, Doannio JM-C, Dosso M, et al (2013) Species composition and population dynamics of Aedes mosquitoes, potential vectors of arboviruses, at the container terminal of the autonomous port of Abidjan, Côte d’Ivoire. Parasite 20:13. https://doi.org/10.1051/parasite/2013013. Yokoly FN, Zahouli JBZ, Méite A, Opoku M, Kouassi BL, de Souza DK, et al (2020) Low transmission of Wuchereria bancrofti in cross-border districts of Côte d’Ivoire: A great step towards lymphatic filariasis elimination in West Africa. PLoS ONE 15:e0231541. https://doi.org/10.1371/journal.pone.0231541. Zahouli JZB, Edi CAV, Yao LA, Lisro EG, Adou M, Koné I, et al (2023) Small-scale field evaluation of PermaNet® Dual (a long-lasting net coated with a mixture of chlorfenapyr and deltamethrin) against pyrethroid-resistant Anopheles gambiae mosquitoes from Tiassalé, Côte d’Ivoire. Malar J 22:36. https://doi.org/10.1186/s12936-023-04455-z. Sicard M, Bonneau M, Weill M (2019) Wolbachia prevalence, diversity, and ability to induce cytoplasmic incompatibility in mosquitoes. Curr Opin Insect Sci 34:12–20. https://doi.org/10.1016/j.cois.2019.02.005. Kaur R, Leigh BA, Ritchie IT, Bordenstein SR (2022) The Cif proteins from Wolbachia prophage WO modify sperm genome integrity to establish cytoplasmic incompatibility. PLoS Biol 20. https://doi.org/10.1371/journal.pbio.3001584. Wang W, Cui W, Yang H (2022) Toward an accurate mechanistic understanding of Wolbachia-induced cytoplasmic incompatibility. Environ Microbiol 24:4519–32. https://doi.org/10.1111/1462-2920.16125. Martinez J, Klasson L, Welch JJ, Jiggins FM (2021) Life and Death of Selfish Genes: Comparative Genomics Reveals the Dynamic Evolution of Cytoplasmic Incompatibility. Mol Biol Evol 38:2–15. https://doi.org/10.1093/molbev/msaa209. Additional Declarations No competing interests reported. Supplementary Files OnlineResource1.docx Cite Share Download PDF Status: Published Journal Publication published 31 Jan, 2025 Read the published version in Molecular Biology Reports → Version 1 posted Editorial decision: Revision requested 09 Dec, 2024 Reviews received at journal 05 Dec, 2024 Reviewers agreed at journal 18 Nov, 2024 Reviewers agreed at journal 18 Nov, 2024 Reviewers invited by journal 04 Nov, 2024 Editor assigned by journal 02 Nov, 2024 Submission checks completed at journal 02 Nov, 2024 First submitted to journal 02 Nov, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-5377992","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":374789440,"identity":"b1080d8b-7bc0-4a6d-ac13-ba9be4ad44c2","order_by":0,"name":"Raymond Karlhis YAO","email":"","orcid":"","institution":"Ecole Doctorale Sciences Naturelles et Agronomiques, Université Nazi Boni","correspondingAuthor":false,"prefix":"","firstName":"Raymond","middleName":"Karlhis","lastName":"YAO","suffix":""},{"id":374789442,"identity":"a53d8a16-7ce4-409b-bae4-bfc618fb3d82","order_by":1,"name":"Michel Kiréopori GOMGNIMBOU","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAv0lEQVRIiWNgGAWjYJCCgw0GDHIMDDwgthzxWoyhWoyJ08LYwMCQ2EC0Fnn37sSDMwrupW84fvbggw8MBvkEtRieObvh4AaD4twNZ/KSDWcwGFg2ENQyI3fDwQcGCbkbDuSYSfMw/DEgbAtUS7rB+TcgLQaEtchL5IIclpBgcCOHSC0GPEC/zDBIMJx5442x4QwDYmxp7938sedPgjzf+RzDBx8qiLHlAJShAGYQ1gC0pQGdMQpGwSgYBaMAHQAAxN1A+7uZwTgAAAAASUVORK5CYII=","orcid":"","institution":"Institut Supérieur des Sciences de la Santé (IN.S.SA), Université Nazi BONI","correspondingAuthor":true,"prefix":"","firstName":"Michel","middleName":"Kiréopori","lastName":"GOMGNIMBOU","suffix":""},{"id":374789443,"identity":"216b0260-4f12-4f1a-a5d4-540915130086","order_by":2,"name":"Ibrahima Zanakoungo COULIBALY","email":"","orcid":"","institution":"Unité d’Entomologie et Herpetologie, Pasteur Institute de Côte d’Ivoire","correspondingAuthor":false,"prefix":"","firstName":"Ibrahima","middleName":"Zanakoungo","lastName":"COULIBALY","suffix":""},{"id":374789445,"identity":"ab0d9625-58a8-4140-974b-209b79a856a9","order_by":3,"name":"Christiane You ESSOH","email":"","orcid":"","institution":"Département de Biochemie-Genetique, UFR Sciences Biologique, Université Péléforo Gon Coulibaly","correspondingAuthor":false,"prefix":"","firstName":"Christiane","middleName":"You","lastName":"ESSOH","suffix":""},{"id":374789447,"identity":"82bb5fbf-268c-4cb1-96b5-292168e7ef77","order_by":4,"name":"Issouf Traoré","email":"","orcid":"","institution":"Unité d’Entomologie et Herpetologie, Pasteur Institute de Côte d’Ivoire","correspondingAuthor":false,"prefix":"","firstName":"Issouf","middleName":"","lastName":"Traoré","suffix":""},{"id":374789450,"identity":"8befd4d4-95ad-4ad1-bc70-30c71cbba9c6","order_by":5,"name":"Miriam Félicité AMARA","email":"","orcid":"","institution":"Ecole Doctorale Sciences Naturelles et Agronomiques, Université Nazi Boni","correspondingAuthor":false,"prefix":"","firstName":"Miriam","middleName":"Félicité","lastName":"AMARA","suffix":""},{"id":374789451,"identity":"7b8d5c4e-0174-44c4-8ef6-ce845771be5e","order_by":6,"name":"Berenger Aristide AKO","email":"","orcid":"","institution":"Département de paludisme, Institut Pasteur de Côte-d’Ivoire","correspondingAuthor":false,"prefix":"","firstName":"Berenger","middleName":"Aristide","lastName":"AKO","suffix":""},{"id":374789452,"identity":"627c931b-0a40-4480-9fdf-2b8eeed7e282","order_by":7,"name":"Abdoulaye DIABATE","email":"","orcid":"","institution":"Institut de Recherche en Sciences de la Santé (IRSS), Direction Régionale de l’Ouest","correspondingAuthor":false,"prefix":"","firstName":"Abdoulaye","middleName":"","lastName":"DIABATE","suffix":""},{"id":374789453,"identity":"0f4398ef-a3b1-4c48-b22b-48486d43206f","order_by":8,"name":"Etienne BILGO","email":"","orcid":"","institution":"Institut de Recherche en Sciences de la Santé (IRSS), Direction Régionale de l’Ouest","correspondingAuthor":false,"prefix":"","firstName":"Etienne","middleName":"","lastName":"BILGO","suffix":""}],"badges":[],"createdAt":"2024-11-02 11:38:11","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-5377992/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-5377992/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1007/s11033-025-10280-1","type":"published","date":"2025-01-31T15:57:12+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":68970564,"identity":"5ca2f799-b5c4-4977-82c3-c8d65903a19e","added_by":"auto","created_at":"2024-11-14 05:41:58","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":38812,"visible":true,"origin":"","legend":"\u003cp\u003eDistribution of mosquito species collected by study sites in Côte d'Ivoire\u003c/p\u003e\n\u003cp\u003eCapture site: ♦ Farm \u003ca href=\"https://www.alt-codes.net/triangle-symbols\"\u003e▲ \u003c/a\u003eHome \u0026nbsp;■ Shallows\u003c/p\u003e","description":"","filename":"Fig.1DistributionofmosquitospeciescollectedbystudysitesinCtedIvoire.jpg","url":"https://assets-eu.researchsquare.com/files/rs-5377992/v1/1258b90a077bbf066ad0b697.jpg"},{"id":68970565,"identity":"d567472c-8d98-4136-9067-91967b20a2c2","added_by":"auto","created_at":"2024-11-14 05:41:58","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":37339,"visible":true,"origin":"","legend":"\u003cp\u003ePrevalence of \u003cem\u003eWolbachia\u003c/em\u003e infection in female mosquitoes according to geographical locations in Côte d'Ivoire\u003c/p\u003e\n\u003cp\u003eThe bar plots represent the frequencies of \u003cem\u003eWolbachia\u003c/em\u003einfection in females of each species. The bars in the charts represent error bars\u003c/p\u003e","description":"","filename":"Fig.2PrevalenceofWolbachiainfectioninfemalemosquitoesaccordingtogeographicallocationsinCtedIvoire.jpg","url":"https://assets-eu.researchsquare.com/files/rs-5377992/v1/161503782d80c98d8b20c482.jpg"},{"id":75351471,"identity":"b033ff8d-d8ae-4fe3-93f2-fbee87e0c618","added_by":"auto","created_at":"2025-02-03 16:11:46","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":947482,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-5377992/v1/3a57cdae-f78b-46a0-9a0f-fab58299ae62.pdf"},{"id":68971600,"identity":"0e705a42-9722-44fa-bfbe-710af62985d6","added_by":"auto","created_at":"2024-11-14 05:57:58","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":18156,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineResource1.docx","url":"https://assets-eu.researchsquare.com/files/rs-5377992/v1/1cca0044ecf7098bcbf4dff2.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Molecular detection of Wolbachia sp. and cytoplasmic incompatibility factors (CifA/B) in wild caught mosquitoes in Côte d'Ivoire","fulltext":[{"header":"Introduction","content":"\u003cp\u003e\u003cem\u003eWolbachia is an\u0026nbsp;\u003c/em\u003eintracellular\u0026nbsp;\u0026alpha;-proteobacterium belonging to the genus Rickettsale. It is considered to be the most abundant endosymbiont on earth due to its wide distribution in at least 40 % of arthropod species\u0026nbsp;[1]. The\u0026nbsp;discovery of this bacterium dates back to 1924, in the reproductive tissues of \u003cem\u003eCulex pepens\u003c/em\u003e.\u0026nbsp;It resulted from the work of Hertig Marshall and Wolbach Burt during their study of Rickettsial microorganisms in insects\u0026nbsp;[2].\u0026nbsp;Numerous studies around the world have subsequently identified \u003cem\u003eWolbachia\u003c/em\u003e infections in several insects, including different species of mosquito\u0026nbsp;[3,4].\u0026nbsp;\u003cem\u003eWolbachia\u0026nbsp;\u003c/em\u003eis a symbiotic bacterium that has an antagonistic relationship with arboviruses\u0026nbsp;[5],\u0026nbsp;but also with protozoa\u0026nbsp;[6]. It also has parasitic relationships with these arthropod hosts and a symbiotic relationship with nematodes\u0026nbsp;[7\u0026ndash;9].\u0026nbsp;It is a bacterium that is transmitted through successive generations by maternal heredity\u0026nbsp;[10]\u0026nbsp;although lateral transfer between species has been documented\u0026nbsp;[11].\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003eVertical transmission of \u003cem\u003eWolbachia\u0026nbsp;\u003c/em\u003ethrough natural populations in arthropods is mediated by reproductive parasitism. This parasitism is mediated by several mechanisms, namely the feminization of males, which is characterized by the transformation of genetic males into physiologically functional females\u0026nbsp;[12]\u0026nbsp;meiotic drive, which prevents the production of Z oocytes by females, resulting in female offspring with a Z0\u0026nbsp;[13]\u0026nbsp;the killing of males\u0026nbsp;[14]\u0026nbsp;parthenogenesis\u0026nbsp;[3].\u0026nbsp;These mechanisms all result in the production of exclusively female offspring. In addition to these mechanisms for distorting the sex ratio, there is cytoplasmic incompatibility (CI), which favors the proliferation of host specimens infected with \u003cem\u003eWolbachia\u003c/em\u003e [15,16].\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eCytoplasmic incompatibility is the mechanism exploited in several vector control strategies\u0026nbsp;[17,18].\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003eIt occurs when a male infected with \u003cem\u003eWolbachia\u0026nbsp;\u003c/em\u003emates with an uninfected female or a female infected with strains phylogenetically distant from that of the male. CI results in the reduction of embryos from incompatible crosses. The search for genetic factors responsible for CI led to the identification of two genes encoded in a prophage region inserted into the \u003cem\u003ew\u003c/em\u003eMel genome, a \u003cem\u003eWolbachia\u0026nbsp;\u003c/em\u003estrain infecting \u003cem\u003eDrosophila melanogaster\u0026nbsp;\u003c/em\u003e[19].\u0026nbsp;Similar results were obtained with the \u003cem\u003ew\u003c/em\u003ePip strain infecting \u003cem\u003eCulex\u0026nbsp;\u003c/em\u003e\u003cem\u003epipins\u0026nbsp;\u003c/em\u003e[20].\u0026nbsp;These genes were given the general name \u0026quot;cytoplasmic incompatibility factors\u0026quot; (\u003cem\u003eCif\u003c/em\u003e)\u003cem\u003e,\u0026nbsp;\u003c/em\u003eand then the letters A and B were attached to mark the difference in the naming of these two genes (\u003cem\u003eCif\u003c/em\u003eA and \u003cem\u003eCif\u003c/em\u003eB)\u0026nbsp;[19].\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003eDepending on the functional domains involved in the manifestation of CI, these genes are coded \u003cem\u003eCid in\u0026nbsp;\u003c/em\u003ereference to the enzyme Deubiquitylase (DUB) or \u003cem\u003eCin\u0026nbsp;\u003c/em\u003ein reference to a putative nuclease; these functional domains are coded in the sequence of the \u003cem\u003eCif\u003c/em\u003eB gene\u0026nbsp;[20].\u0026nbsp;On the\u0026nbsp;basis of their protein sequences, \u003cem\u003eCif\u0026nbsp;\u003c/em\u003eare\u003cem\u003e\u0026nbsp;\u003c/em\u003egrouped into four\u0026nbsp;distinct\u0026nbsp;phylogenetic groups\u0026nbsp;designated \u0026quot;type I-IV\u0026nbsp;[19,21].\u0026nbsp;\u003cem\u003eCif\u0026nbsp;\u003c/em\u003eare both encoded in the same operon and are always\u0026nbsp;co-transcribed\u0026nbsp;[21]. However, they are regulated differently depending on the stage of embryonic development of the host\u0026nbsp;[21]. Expression of \u003cem\u003eCif\u003c/em\u003eB in the testes is associated with the manifestation of CI in incompatible crosses; as for the \u003cem\u003eCif\u003c/em\u003eA gene, its expression in the ovaries of females is responsible for the rescue of CI\u0026nbsp;[22].\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe \u003cem\u003eWolbachia\u0026nbsp;\u003c/em\u003ebased\u003cem\u003e\u0026nbsp;\u003c/em\u003evector control strategy is based on the prevalence of this bacterium and the polymorphism of the \u003cem\u003eCif\u003c/em\u003e proteins. Data on the prevalence of \u003cem\u003eWolbachia\u0026nbsp;\u003c/em\u003eand a better understanding of the functional and molecular aspects of the \u003cem\u003eCif\u0026nbsp;\u003c/em\u003egenes are indicators for choosing the appropriate \u003cem\u003eWolbachia\u0026nbsp;\u003c/em\u003estrain for implementing a vector control strategy.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eWolbachia\u003c/em\u003e is known to inhibit the development of parasites and arboviruses. However, the number of malaria infections remains high in C\u0026ocirc;te d\u0026apos;Ivoire. We have also seen a rise in dengue epidemics over the years. \u0026nbsp; This raises questions about the presence of \u003cem\u003eWolbachia\u003c/em\u003e in wild mosquito populations. If the presence of \u003cem\u003eWolbachia\u003c/em\u003e is confirmed, the existence of \u003cem\u003eCif\u003c/em\u003e genes responsible for its propagation within mosquito populations remains to be seen. In this study, we examined the level of natural \u003cem\u003eWolbachia\u003c/em\u003e infection in different mosquito populations from five cities in C\u0026ocirc;te d\u0026apos;Ivoire and determined the distribution of \u003cem\u003eCif\u003c/em\u003e genes within \u003cem\u003eWolbachia\u003c/em\u003e-infected populations using polymerase chain reaction for analysis.\u0026nbsp;\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cp\u003eStudy sites and period\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe mosquitoes were sampled in five cities in C\u0026ocirc;te d\u0026apos;Ivoire. These were the cities of Abidjan and Bingerville in the south of the country, the city of Bouak\u0026eacute; in the center and the cities of Korhogo and Boundiali in the north of the country. These cities are located in different\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003eclimatic environments\u0026nbsp;[23]. In the north, the wooded savannah is subject to a tropical climate (Sudanese climate), with\u0026nbsp;a rainy season extending from April-May to the end of October. Rainfall peaks in August, followed by a dry season.\u0026nbsp;In the south, we have\u0026nbsp;a humid equatorial climate (Atrean climate)\u003cstrong\u003e,\u0026nbsp;\u003c/strong\u003ewith two rainy seasons, the main one running from May to July and a short one from October to November, and two dry seasons. In the center, we have an intermediate climate (Baouleen climate).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eMosquito sampling\u003c/p\u003e\n\u003cp\u003eMosquitoes were sampled using two different techniques: larval collection and capture using sentinel BG traps. The larvae were surveyed on vegetable farms and/or in rice fields in baffles, then\u0026nbsp;at breeding sites (abandoned tires, used containers, and in watering holes) in the\u0026nbsp;vicinity of mixed animal farms. To capture adults, BG sentinel traps were placed about one meter outside homes between 4pm and 6am. The BG sentinel trap contained an attractant (carbon dioxide) consisting of a mixture of water (1L), sugar (500g) and baker\u0026apos;s yeast (16g) in the proportions indicated to attract mosquitoes. After each larval survey, the larvae were maintained in the laboratory under a 12h:12h photoperiod at 28\u0026deg;C. After the emergence of the adults, the mosquito species were identified morphologically using a binocular magnifying glass according to the identification keys for Culicidae\u0026nbsp;[24,25]\u0026nbsp;and the Anophelinae\u0026nbsp;[26]\u003cstrong\u003e.\u0026nbsp;\u003c/strong\u003eAll species of\u0026nbsp;mosquitoes sampled and identified were then preserved in silica gel until further use.\u003c/p\u003e\n\u003cp\u003eExtraction of DNA from mosquito species\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eTotal DNA was extracted from each mosquito using the method previously described by\u0026nbsp;Cornel and Collins, (1996)\u0026nbsp;with some modification\u003cstrong\u003e.\u0026nbsp;\u003c/strong\u003eThis involved first soaking the whole mosquitoes in 2% cetyl trimethyl ammonium bromide (CTAB). They were then individually crushed in 200\u0026nbsp;\u0026mu;l of CTAB and incubated at 65\u0026deg;C for 5 min. A total of 200\u0026nbsp;\u0026mu;l of chloroform was then added and the resulting mixture centrifuged for 5 min at 12,000 rpm. The supernatant was pipetted into a new 1.5 ml tube to which 200\u0026nbsp;\u0026mu;l of isopropanol was added; the mixture was centrifuged for 15 min at 12,000 rpm to precipitate the DNA. The supernatant was then discarded and the DNA pellet formed at the bottom of the tubes was purified with 70 % ethanol. After a further centrifugation step at 12,000 rpm for 5 min, the ethanol was removed and the pellet dried overnight. The extracted DNA was dissolved in 20\u0026nbsp;\u0026mu;l of biomol water (Solis Biodyne) before storage at -20\u0026deg;C.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eDetection of Wolbachia\u0026nbsp;and distribution Cif\u0026nbsp;genes by qPCR\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe presence of \u003cem\u003eWolbachia\u0026nbsp;\u003c/em\u003ein mosquitoes was investigated by quantitative PCR (qPCR) using the primer pair sense 5\u0026apos;\u0026nbsp;CATACCTATTCGAAGGGATAG 3\u0026apos; and anti-sense 5\u0026apos;TTGCGGGACTTAACCCAACA 3\u0026apos; specific for \u003cem\u003eWolbachia\u003c/em\u003e 16s rRNA\u0026nbsp;(Gomes et al., 2017).\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003eSamples testing positive for the presence of \u003cem\u003eWolbachia\u0026nbsp;\u003c/em\u003ewere examined for the presence of the \u003cem\u003eCif\u003c/em\u003eA and \u003cem\u003eCif\u003c/em\u003eB genes by qPCR, respectively with primer pairs CifAF: 5\u0026apos;ATAAAGGCGTTTCAGCAGGA 3\u0026apos;, CifAR: 5\u0026apos; AGCAAACGTTCACATTTCC 3\u0026apos; and CifBF: 5\u0026apos; TACGGGAAGTTTCATGCACA 3\u0026apos; , CifBR: 5\u0026apos; TTGCCAGCCATCATTCATAA 3\u0026apos;\u0026nbsp;[21]\u003cstrong\u003e.\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003ePCR was performed on the CFX96 system (Bio-Rad) using the 5x HOT FREPol EvaGreen qPCR Mix Plus (ROX) kit (Solis BioDyne) with the sense and antisense primers concentrated at 250 mM. PCR conditions were as follows: initial denaturation at 95\u0026deg;C for 12 minutes, followed by 40 cycles of 15s denaturation at 95\u0026deg;C, 20s hybridization at 58\u0026deg;C, 20s elongation at 72\u0026deg;C. Samples are considered positive when\u0026nbsp;Cycles threshold (Ct) value was under or equal to 38. The specificity of reaction was checked through\u0026nbsp;the melting curve during \u003cem\u003eWolbachia\u0026rsquo;s\u0026nbsp;\u003c/em\u003edetection by varying the temperature from 65\u0026deg;C to 95\u0026deg;C. The melting temperature equal to 84\u0026deg;C \u0026plusmn; 2\u0026deg;C was determined from positive control. For \u003cem\u003eCif\u003c/em\u003e genes, samples are considered positive when the Cq \u0026le; 35.\u003c/p\u003e\n\u003cp\u003eData analysis\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eFor the comparison of \u003cem\u003eWolbachia\u0026nbsp;\u003c/em\u003eprevalence according to sex and according to capture zones, the parametric Chi 2 test and the non-parametric Fisher\u0026apos;s exact test were carried out respectively for species with a large sample size and those with a small sample size.\u0026nbsp;Differences were considered statistically significant when \u003cem\u003eP\u0026nbsp;\u003c/em\u003e\u0026lt; 0.05. These analyses and the production of the maps and barplots were carried out using R software version 4.2.3.\u0026nbsp;\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003eInventory of mosquito species caught\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eA total of 812 mosquito specimens were captured in the four cities of C\u0026ocirc;te d\u0026apos;Ivoire. These mosquitoes were divided into 15 species belonging to 4 genera. The species identified are: \u003cem\u003eAedes aegypti, Aedes vittatus, Anopheles gambiae, Anopheles paludis, Culex poicilipes, Culex theilleri, Culex\u0026nbsp;\u003c/em\u003e\u003cem\u003e(Lutzia)\u0026nbsp;\u003c/em\u003e\u003cem\u003etigripes, Culex quinquefasciatus, Culex quinquevitatus, Culex neubulosus, Culex barraudius\u003c/em\u003e, \u003cem\u003eCulex decens, Culex univitatus, Culex rubinotus\u0026nbsp;\u003c/em\u003eand \u003cem\u003eMansonia Uniformis\u003c/em\u003e. Mosquitoes known for their high vectorial capacity in the transmission of infectious agents to humans, namely \u003cem\u003eAedes aegypti\u003c/em\u003e, \u003cem\u003eAnophele gambiae\u0026nbsp;\u003c/em\u003eand \u003cem\u003eCulex\u0026nbsp;\u003c/em\u003e\u003cem\u003equequefasciatus\u003c/em\u003e [29,30], were present at most of the capture sites \u003cem\u003e\u0026nbsp;\u003c/em\u003e(Fig.1). These three species were the most abundant at our various capture sites. The geographical distribution of these mosquito species will enable us to determine their relative prevalence according to the different climatic zones\u003cem\u003e.\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eWolbachia screening by qPCR\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eA subset of 518 mosquitoes from the five cities was analyzed for \u003cem\u003eWolbachia\u0026nbsp;\u003c/em\u003ein different mosquito populations. \u003cem\u003eWolbachia\u0026nbsp;\u003c/em\u003ewas\u003cem\u003e\u0026nbsp;\u003c/em\u003escreened from both female and male specimens. For each city, 30 to 60 samples were selected for females of each species caught. For males, 30 to 60 specimens were selected per species for all five cities. For less abundant species, all samples were analyzed. \u003cem\u003eWolbachia\u0026nbsp;\u003c/em\u003ewas detected in 43.60% of all mosquitoes analyzed (Tableau 1). For the mosquito populations of the five cities, all three medically important species were found to be infected with \u003cem\u003eWolbachia\u003c/em\u003e. The prevalence of \u003cem\u003eWolbachia\u003c/em\u003e infection varie depending on the species and sex. For all the samples bewildered, the prevalence of \u003cem\u003eWolbachia\u0026nbsp;\u003c/em\u003ewas statistically different according to sex. It was higher in females compared in males. There was no statistical difference in the prevalence of \u003cem\u003eAedes aegypti\u003c/em\u003e, \u003cem\u003eAnophele gambiae\u003c/em\u003e, \u003cem\u003eCulex tigrip\u0026egrave;s\u0026nbsp;\u003c/em\u003eand \u003cem\u003eCulex theilleri\u003c/em\u003e; however, females had higher infection rates. In \u003cem\u003eCulex quinquefasciatus,\u0026nbsp;\u003c/em\u003eprevalence was significantly different according to sex (p=0.01013).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTableau 1\u0026nbsp;\u003c/strong\u003ePrevalence of \u003cem\u003eWolbachia\u0026nbsp;\u003c/em\u003ein adults of different mosquito species\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"614\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" style=\"width: 135px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eSpecies\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"3\" style=\"width: 311px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e16s rRNA\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"3\" valign=\"top\" style=\"width: 169px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eComparison by gender\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 106px;\"\u003e\n \u003cp\u003ePopulation\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 105px;\"\u003e\n \u003cp\u003eFemele\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 99px;\"\u003e\n \u003cp\u003eMale\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 66px;\"\u003e\n \u003cp\u003eChi 2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 24px;\"\u003e\n \u003cp\u003edf\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 78px;\"\u003e\n \u003cp\u003ep-value\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 135px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003eAedes aegypti\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 106px;\"\u003e\n \u003cp\u003e12.84 % (14/109)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 105px;\"\u003e\n \u003cp\u003e13.43 % (9/67)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 99px;\"\u003e\n \u003cp\u003e11,90 % (5/42)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 66px;\"\u003e\n \u003cp\u003e0.05385\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 24px;\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 78px;\"\u003e\n \u003cp\u003e0.8165\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 135px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003eAedes vittatus\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 106px;\"\u003e\n \u003cp\u003e0.00 % (0/1)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 105px;\"\u003e\n \u003cp\u003e0.00 % (0/1)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 99px;\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 66px;\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 24px;\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 78px;\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 135px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003eAnophele gambiae s.l.\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 106px;\"\u003e\n \u003cp\u003e13.46 % (14/104)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 105px;\"\u003e\n \u003cp\u003e15,79 % (9/57)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 99px;\"\u003e\n \u003cp\u003e10,64 % (5/47)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 66px;\"\u003e\n \u003cp\u003e0.58674\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 24px;\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 78px;\"\u003e\n \u003cp\u003e0.4437\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 135px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003eAnophele paludis\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 106px;\"\u003e\n \u003cp\u003e0.00 % (0/2)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 105px;\"\u003e\n \u003cp\u003e0.00 % (0/2)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 99px;\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 66px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 24px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 78px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 135px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003eCulex \u0026nbsp; \u0026nbsp; quinquefasciatus\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 106px;\"\u003e\n \u003cp\u003e72.64 % (146/201)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 105px;\"\u003e\n \u003cp\u003e76.02 % (130/171)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 99px;\"\u003e\n \u003cp\u003e53,33 % (16/30)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 66px;\"\u003e\n \u003cp\u003e6.611\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 24px;\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 78px;\"\u003e\n \u003cp\u003e0.01013*\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 135px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003eCulex\u0026nbsp;\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003e\u003cem\u003e(Lutzia) tigripes\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 106px;\"\u003e\n \u003cp\u003e52.14 % (12/23)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 105px;\"\u003e\n \u003cp\u003e50.00 % (7/14)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 99px;\"\u003e\n \u003cp\u003e44,44 % (4/9)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 66px;\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 24px;\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 78px;\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 135px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003eCulex barraudius\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 106px;\"\u003e\n \u003cp\u003e0.00 % (0/1)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 105px;\"\u003e\n \u003cp\u003e0.00 % (0/1)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 99px;\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 66px;\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 24px;\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 78px;\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 135px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003eCulex decens\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 106px;\"\u003e\n \u003cp\u003e29.63 % (8/27)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 105px;\"\u003e\n \u003cp\u003e29.63 % (8/27)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 99px;\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 66px;\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 24px;\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 78px;\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 135px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003eCulex neubulosus\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 106px;\"\u003e\n \u003cp\u003e50.00 % (1/2)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 105px;\"\u003e\n \u003cp\u003e50.00 % (1/2)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 99px;\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 66px;\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 24px;\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 78px;\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 135px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003eCulex poicilipes\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 106px;\"\u003e\n \u003cp\u003e0.00 % (0/20)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 105px;\"\u003e\n \u003cp\u003e0.00 % (0/9)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 99px;\"\u003e\n \u003cp\u003e0.00 % (0/11)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 66px;\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 24px;\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 78px;\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 135px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003eCulex quinquevitatus\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 106px;\"\u003e\n \u003cp\u003e0.00 % (0/2)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 105px;\"\u003e\n \u003cp\u003e0.00 % (0/2)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 99px;\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 66px;\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 24px;\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 78px;\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 135px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003eCulex rubinotus\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 106px;\"\u003e\n \u003cp\u003e100.00 % (5/5)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 105px;\"\u003e\n \u003cp\u003e100.00 % (5/5)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 99px;\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 66px;\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 24px;\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 78px;\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 135px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003eCulex theilleri\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 106px;\"\u003e\n \u003cp\u003e88.89 % (16/18)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 105px;\"\u003e\n \u003cp\u003e90.00 % (9/10)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 99px;\"\u003e\n \u003cp\u003e87.50 % (7/8)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 66px;\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 24px;\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 78px;\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 135px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003eCulex univitatus\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 106px;\"\u003e\n \u003cp\u003e100.00 % (1/1)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 105px;\"\u003e\n \u003cp\u003e100.00 % (1/1)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 99px;\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 66px;\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 24px;\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 78px;\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 135px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003eMansonia uniformis\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 106px;\"\u003e\n \u003cp\u003e100.00 % (2/2)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 105px;\"\u003e\n \u003cp\u003e100.00 % (2/2)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 99px;\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 66px;\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 24px;\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 78px;\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 135px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eTotal\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 106px;\"\u003e\n \u003cp\u003e43,60 % (218/518)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 105px;\"\u003e\n \u003cp\u003e48,79 % (181/371)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 99px;\"\u003e\n \u003cp\u003e25,17 % (37/147)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 66px;\"\u003e\n \u003cp\u003e24.093\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 24px;\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 78px;\"\u003e\n \u003cp\u003e9.179e-\u003csup\u003e07\u003c/sup\u003e*\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003eThe frequency of \u003cem\u003eWolbachia\u003c/em\u003e infection according to sex for each species of mosquito was compared by Chi 2 test, with degree of freedom (df) equal to 1. For species which had low effectiveness, the frequency of \u003cem\u003eWolbachia\u003c/em\u003e infection according to sex was compared using Fisher\u0026apos;s exact test. The presence of * mean a statistical difference.\u003c/p\u003e\n\u003cp\u003eThe comparison of the prevalence among females of three medically important mosquito species in different climatic zones namely \u003cem\u003eAe. Aegypti\u003c/em\u003e (p=0.459), \u003cem\u003eAn. gambiae sl\u003c/em\u003e (p=0.459), \u003cem\u003eCx. quinquefasciatus\u003c/em\u003e (p=0.1289) reveals no statistical difference (Fig.2; Online Resource 1). For \u003cem\u003eAedes aegypti\u003c/em\u003e females, the prevalence was 14.61 % in the south and 5 % in the north. For \u003cem\u003eAnophele gambiae\u003c/em\u003e females, the prevalence was 16.67 % in the south and 13.04 % in the north. For \u003cem\u003eCulex quiquefasciatus\u003c/em\u003e females, the prevalence was 67.12 % in the south, 66.67 % in the center and 79.78 % in the north (Online Resource 1).\u003c/p\u003e\n\u003cp\u003eDetermination of \u003cem\u003ecif\u003c/em\u003eA and \u003cem\u003ecif\u003c/em\u003eB genes in captured mosquito species\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe \u003cem\u003ecif\u003c/em\u003eA and \u003cem\u003ecif\u003c/em\u003eB genes were determined by qPCR. On the basis of the results obtained, all the mosquito species of genus \u003cem\u003eCulex\u003c/em\u003e infected with \u003cem\u003eWolbachia\u0026nbsp;\u003c/em\u003epossessed the \u003cem\u003ecif\u003c/em\u003eA and \u003cem\u003ecif\u003c/em\u003eB genes (Table 2). These two genes had high prevalences ranging from 96.63% to 100% for the \u003cem\u003ecif\u003c/em\u003eA gene and from 70.97 % to 100% for the \u003cem\u003ecif\u003c/em\u003eB gene. The \u003cem\u003ecif\u003c/em\u003eA gene had a higher average prevalence than the \u003cem\u003ecif\u003c/em\u003eB gene. These data show that \u003cem\u003ecif\u0026nbsp;\u003c/em\u003egenes distribution within wild populations of mosquito of genus \u003cem\u003eCulx\u003c/em\u003e.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTableau 2\u0026nbsp;\u003c/strong\u003eDistribution of \u003cem\u003ecif\u003c/em\u003eA and \u003cem\u003ecif\u003c/em\u003eB genes in \u003cem\u003eWolbachia-infected\u0026nbsp;\u003c/em\u003emosquito species\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"512\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" style=\"width: 145px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eSpecies\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" style=\"width: 367px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eAmplification qPCR\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 192px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003ecif\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003eA\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 175px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003ecif\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003eB\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 145px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003eCulex\u0026nbsp;\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003e\u003cem\u003e(Lutzia) tigripes\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 192px;\"\u003e\n \u003cp\u003e100.00 % (11 /\u0026nbsp;11)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 175px;\"\u003e\n \u003cp\u003e90.91 % (10/11)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 145px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003eCulex decens\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 192px;\"\u003e\n \u003cp\u003e100.00 % (6/6)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 175px;\"\u003e\n \u003cp\u003e100.00 % (6/6)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 145px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003eCulex neubulosus\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 192px;\"\u003e\n \u003cp\u003e100.00 % (1/1)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 175px;\"\u003e\n \u003cp\u003e100.00 % (1/1)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 145px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003eCulex quinquefasciatus\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 192px;\"\u003e\n \u003cp\u003e96.63 % (91/93)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 175px;\"\u003e\n \u003cp\u003e70.97 % (66/93)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 145px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003eCulex rubinotus\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 192px;\"\u003e\n \u003cp\u003e100.00 % (5/5)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 175px;\"\u003e\n \u003cp\u003e100.00 % (5/5)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 145px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003eCulex theilleri\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 192px;\"\u003e\n \u003cp\u003e100.00 % (13/13)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 175px;\"\u003e\n \u003cp\u003e92.30 % (12/13)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 145px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003eCulex univitatus\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 192px;\"\u003e\n \u003cp\u003e100.00 % (1/1)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 175px;\"\u003e\n \u003cp\u003e100.00 % (1/1)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 145px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eTotal\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 192px;\"\u003e\n \u003cp\u003e98.46 % (128/130)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 175px;\"\u003e\n \u003cp\u003e88.46 % (115/130)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e"},{"header":"Discussion","content":"\u003cp\u003eVector control strategies based on \u003cem\u003eWolbachia\u003c/em\u003e require a preliminary study of \u003cem\u003eWolbachia\u003c/em\u003e prevalence in target vector populations. It also requires characterization of the \u003cem\u003eWolbachia\u003c/em\u003e strains circulating in these populations when they are naturally infected. The phylogeny of the cytoplasmic incompatibility proteins \u003cem\u003eCif\u003c/em\u003eA and \u003cem\u003eCif\u003c/em\u003eB is one of the main features of the phenotype manifestation. In the case of this study, the aim was to determine the prevalence of \u003cem\u003eWolbachia\u003c/em\u003e in the wild population of mosquitoes\u0026nbsp;caught\u0026nbsp;in C\u0026ocirc;te d\u0026rsquo;Ivoire. Also, the distribution of the cytoplasmic incompatibility factors \u003cem\u003eCif\u003c/em\u003eA and \u003cem\u003eCif\u003c/em\u003eB in different species was determined. This is in order to consider the search for it from these mosquito species, active prophage capable of carrying these \u003cem\u003ecif\u003c/em\u003e genes in a vector control perspective. To this end, 15 mosquito species belonging to four genera were analyzed for \u003cem\u003eWolbachia\u003c/em\u003e. Nine species, namely \u003cem\u003eAedes aegypti\u003c/em\u003e, \u003cem\u003eAnopheles gambiae s.l\u003c/em\u003e., \u003cem\u003eCulex theilleri\u003c/em\u003e, \u003cem\u003eCulex (Lutzia) tigripes\u003c/em\u003e, \u003cem\u003eCulex rubinitus\u003c/em\u003e, \u003cem\u003eCulex univitatus\u003c/em\u003e, \u003cem\u003eCulex quinquefasciatus\u003c/em\u003e, \u003cem\u003eCulex neubulosus\u003c/em\u003e and \u003cem\u003eMansonia Uniformis\u003c/em\u003e, tested positive.\u003c/p\u003e\n\u003cp\u003eDetection of \u003cem\u003eWolbachia\u003c/em\u003e in wild mosquitoes caught in C\u0026ocirc;te d\u0026apos;Ivoire by qPCR resulted in a prevalence of 43.60% across all mosquito species. Different genetic markers and screening methods for \u003cem\u003eWolbachia\u003c/em\u003e have been used in several studies worldwide\u0026nbsp;[3,31,32]. The results of this study show that \u003cem\u003eWolbachia\u0026nbsp;\u003c/em\u003eis widespread in mosquitoes in C\u0026ocirc;te d\u0026apos;Ivoire compared with countries such as\u0026nbsp;Cameroon (1.87%)\u0026nbsp;[4]\u0026nbsp;California (18.23%)\u0026nbsp;[31]. The prevalence obtained in this study is comparable to that reported in Singapore (43.9%)\u0026nbsp;[50]\u0026nbsp;and is relatively high compared to that reported in China (36.1%)\u0026nbsp;[34]. In addition to the screening method, the observed difference in reported prevalences could result from the interaction of several factors, including the specific composition of mosquito populations, the sex of specimens, ecology and climatic variations.\u003c/p\u003e\n\u003cp\u003eOur results show that 60.00% of the mosquito species captured were infected with \u003cem\u003eWolbachia\u003c/em\u003e. This percentage is relatively high compared with those reported in several other studies carried out in Sri Lanka (18.2%)\u0026nbsp;[35], Madagascar (46.7%)\u0026nbsp;[11], Taiwan (51.4%)\u0026nbsp;[36]\u0026nbsp;Singapore (1.2%)\u0026nbsp;[33].\u0026nbsp;According to the literature, \u003cem\u003eWolbachia\u003c/em\u003e appears to be ubiquitous in certain mosquito species, such as \u003cem\u003eAedes albopictus\u003c/em\u003e and the \u003cem\u003eCulex pipens\u003c/em\u003e complex. However, in other species such as \u003cem\u003eAedes aegypti\u003c/em\u003e, \u003cem\u003eWolbachia\u003c/em\u003e appears to be naturally absent\u0026nbsp;[37]. The results showed a statistically significant difference (p=9.179e-07 \u0026lt;0.05) in the infection rate of female mosquitoes (48.66%) versus males (25.17%). For each mosquito species tested, \u003cem\u003eWolbachia\u003c/em\u003e prevalence was higher in females. The effect of sex on \u003cem\u003eWolbachia\u003c/em\u003e infection rates has been demonstrated in several studies. This observation has been reported in Malaysia\u0026nbsp;[38]\u0026nbsp;and Singapore\u0026nbsp;[33]. This difference in prevalence could be the result of female feeding, as demonstrated by Balaji \u003cem\u003eet al\u003c/em\u003e.\u0026nbsp;[39], who showed that this difference was more pronounced when females benefited from the blood meal.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe ecology of the different vectors is an important parameter in determining the \u003cem\u003eWolbachia\u003c/em\u003e infection status of vectors. Numerous studies carried out on the Asian, European and American continents have failed to determine \u003cem\u003eWolbachia\u003c/em\u003e infection in Anopheles mosquitoes. However, several studies conducted throughout Africa have demonstrated \u003cem\u003eWolbachia\u003c/em\u003e infection in species of this genus\u0026nbsp;[40,41]. In Central Africa alone, \u003cem\u003eWolbachia\u0026nbsp;\u003c/em\u003einfection has been detected in 16 different Anopheles species\u0026nbsp;[42].\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eExceptionally, mosquitoes of the \u003cem\u003eCulex pipens\u003c/em\u003e complex caught in Madagascar were free from \u003cem\u003eWolbachia\u0026nbsp;\u003c/em\u003e[33]. However, the results of studies carried out throughout the world converge on the ubiquitous presence of \u003cem\u003eWolbachia\u0026nbsp;\u003c/em\u003ewithin this vector complex; in particular, in the \u003cem\u003eCulex pipens\u003c/em\u003e and \u003cem\u003eCulex quinquefasciatus\u003c/em\u003e species, with high prevalences\u0026nbsp;[31,33,43]. This study shows a difference in prevalence of \u003cem\u003eWolbachia\u003c/em\u003e in females of the three species depending on the capture area. However, this difference is not statistically significant. This work reports for the first time in C\u0026ocirc;te d\u0026apos;Ivoire the natural infection by \u003cem\u003eWolbachia\u003c/em\u003e in \u003cem\u003eAe. aegypti\u003c/em\u003e, \u003cem\u003eAn. gambiae s.l\u003c/em\u003e. and \u003cem\u003eCulex quinquefasciatus\u003c/em\u003e, three vector species of the main human pathogens in Africa\u0026nbsp;[44\u0026ndash;46].\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe results of this study show that all \u003cem\u003eWolbachia\u003c/em\u003e strains infecting the different mosquito species of the genera \u003cem\u003eCulex\u003c/em\u003e analyzed possess cytoplasmic incompatibility factors. This result corroborates those of numerous other studies demonstrating the induction of cytoplasmic incompatibility by \u003cem\u003eWolbachia\u003c/em\u003e strains naturally present in mosquitoes\u0026nbsp;[47]. In five of the species\u0026nbsp;of\u0026nbsp;the genera \u003cem\u003eCulex\u003c/em\u003e studied\u003cem\u003e,\u003c/em\u003e \u003cem\u003eCulex theilleri\u003c/em\u003e, \u003cem\u003eCules decens\u003c/em\u003e, \u003cem\u003eCulex rubinotus, Culex univitatus\u003c/em\u003e and \u003cem\u003eCulex neubulosus\u003c/em\u003e, there was no difference in the prevalence of the \u003cem\u003ecif\u003c/em\u003eA and \u003cem\u003ecif\u003c/em\u003eB genes. This may be explained by the fact that these two genes are encoded in a bi-cistronic operon\u0026nbsp;[21]. However, \u003cem\u003eCulex (Lutzia) tigripes\u003c/em\u003e had a 100% prevalence of the \u003cem\u003ecif\u003c/em\u003eA gene and a \u003cem\u003ecif\u003c/em\u003eB prevalence was 90.91 %. Also in \u003cem\u003eCulex quinquefasciatus\u003c/em\u003e, \u003cem\u003ecif\u003c/em\u003eA had a prevalence of 96.63%, relatively higher than that of \u003cem\u003ecif\u003c/em\u003eB, which was 70.97 %. These results suggest that the \u003cem\u003ecif\u003c/em\u003eA gene is better conserved than the \u003cem\u003ecif\u003c/em\u003eB gene. According to their function, the \u003cem\u003eCif\u003c/em\u003eB protein present in the spermatozoon constitutes the toxin which will complex the paternal genetic heritage and lead to a mitotic defect after fertilization of the ovum\u0026nbsp;[48]. The presence of a compatible \u003cem\u003eCif\u003c/em\u003eA protein in the egg is necessary for embryogenesis to proceed smoothly, neutralizing \u003cem\u003eCif\u003c/em\u003eB\u0026nbsp;[49]. As a result, \u003cem\u003eCif\u003c/em\u003eB leads to the selection of \u003cem\u003eCif\u003c/em\u003eA for a compatible cross; thus, denaturation of the \u003cem\u003ecif\u003c/em\u003eA gene in a viable embryo would be preceded by denaturation of the \u003cem\u003ecif\u003c/em\u003eB gene.\u0026nbsp;[50]\u0026nbsp;show that these genes very often acquire loss-of-function mutations and become pseudogenes. Therefore, the mere presence of the \u003cem\u003ecif\u003c/em\u003e genes in the \u003cem\u003eWolbachia\u003c/em\u003e genome is not sufficient to infer the ability of the bacterial strain to induce or rescue CI.\u0026nbsp;\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eOur investigation of natural Wolbachia infection within populations of mosquito species in Côte d'Ivoire and and distribution of Cif genes several species of Culex provided preliminary data for the development of Wolbachia-based vector control strategies. We were able to determine the presence of Wolbachia in the three medically important mosquito species. We need sequencing to determine the Wolbachia line and their phylogeny with other Wolbachia strains.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgment\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors would like to thank Centre d\u0026apos;Excellence Africain en Innovations Biotechnologiques pour l\u0026apos;Elimination des Maladies \u0026agrave; Transmission Vectorielle (CEA/ITECH-MTV) of the Universit\u0026eacute; Nazi Boni, Bobo-Dioulasso, Burkina Faso and Wellcome Trust for supporting this work. Also, we thank the Institut Pasteur de C\u0026ocirc;te d\u0026apos;Ivoire for making its mosquito capture equipment and entomology platform available to us; the Centre MURAZ and the Institut de Recherche en Sciences de la Sant\u0026eacute; for the Molecular Biology Platform. Our thanks to the entomology team for their active contribution. We appreciate the active contribution of local volunteers to this study.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eRaymond Karlhis YAO, Michel Kir\u0026eacute;opori GOMGNIMBOU, Abdoulaye DIABATE and Etienne BILGO conceived of the study. Raymond Karlhis YAO, Ibrahima Zanakoungo COULIBALY, Christiane You ESSOH, Issouf Traor\u0026eacute;, Miriam F\u0026eacute;licit\u0026eacute; AMARA and Berenger Aristide AKO, conducted the experiments. Raymond Karlhis YAO, Michel Kir\u0026eacute;opori GOMGNIMBOU and Etienne BILGO analysed the data. All authors drafted the manuscript. All authors read and approved the final manuscript.\u003c/p\u003e\n\u003cp\u003eFunding\u003c/p\u003e\n\u003cp\u003eThe field activities and RKY PhD scholarship were funded by the Centre d\u0026apos;Excellence Africain en Innovations Biotechnologiques pour l\u0026apos;Elimination des Maladies \u0026agrave; Transmission Vectorielle (CEA/ITECH-MTV) of the Universit\u0026eacute; Nazi Boni, Bobo-Dioulasso, Burkina Faso, grant ref/letter acceptation CEA/ITECH-MTV du 04/02/2021 \u0026agrave; YAO R. Karlhis. Additional field activities were supported by CEA/ITECH-MTV, grant ref/letter acceptation CEA/ITECH-MTV du 04/02/2021 \u0026agrave; AMARA Miriam F\u0026eacute;licit\u0026eacute; and lab activities were supported by Wellcome Trust grant ref 218771/Z/19/Z.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eNo competing interests were disclosed.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n \u003cli\u003eZug R, Hammerstein P (2012) Still a Host of Hosts for Wolbachia: Analysis of Recent Data Suggests That 40% of Terrestrial Arthropod Species Are Infected. PLoS ONE 7:e38544. https://doi.org/10.1371/journal.pone.0038544.\u003c/li\u003e\n \u003cli\u003eHertig M, Wolbach SB (1924) Studies on Rickettsia-Like Micro-Organisms in Insects. J Med Res 44:329-374.7.\u003c/li\u003e\n \u003cli\u003eWeeks AR, Breeuwer JAJ (2001) \u003cem\u003eWolbachia\u003c/em\u003e \u0026ndash;induced parthenogenesis in a genus of phytophagous mites. Proc R Soc Lond B Biol Sci 268:2245\u0026ndash;51. https://doi.org/10.1098/rspb.2001.1797.\u003c/li\u003e\n \u003cli\u003eBamou R, Diarra AZ, Mayi MPA, Djiappi-Tchamen B, Antonio-Nkondjio C, Parola P (2021) Wolbachia Detection in Field-Collected Mosquitoes from Cameroon. Insects 12:1133. https://doi.org/10.3390/insects12121133.\u003c/li\u003e\n \u003cli\u003eHugo LE, Ra\u0026scaron;ić G, Maynard AJ, Ambrose L, Liddington C, Thomas CJE, et al (2022) Wolbachia wAlbB inhibit dengue and Zika infection in the mosquito Aedes aegypti with an Australian background. PLoS Negl Trop Dis 16. https://doi.org/10.1371/journal.pntd.0010786.\u003c/li\u003e\n \u003cli\u003eKambris Z, Blagborough AM, Pinto SB, Blagrove MSC, Godfray HCJ, Sinden RE, et al (2010) Wolbachia Stimulates Immune Gene Expression and Inhibits Plasmodium Development in Anopheles gambiae. PLOS Pathog 6:e1001143. https://doi.org/10.1371/journal.ppat.1001143.\u003c/li\u003e\n \u003cli\u003eMcMeniman CJ, O\u0026rsquo;Neill SL (2010) A virulent Wolbachia infection decreases the viability of the dengue vector Aedes aegypti during periods of embryonic quiescence.\u0026nbsp;PLoS Negl Trop Dis 4:e748. https://doi.org/10.1371/journal.pntd.0000748.\u003c/li\u003e\n \u003cli\u003eComandatore F, Cordaux R, Bandi C, Blaxter M, Darby A, Makepeace BL, et al (2015) Supergroup C \u003cem\u003eWolbachia\u003c/em\u003e , mutualist symbionts of filarial nematodes, have a distinct genome structure. Open Biol 5:150099. https://doi.org/10.1098/rsob.150099.\u003c/li\u003e\n \u003cli\u003eFraser JE, Bruyne JTD, Iturbe-Ormaetxe I, Stepnell J, Burns RL, Flores HA, et al (2017) Novel Wolbachia-transinfected Aedes aegypti mosquitoes possess diverse fitness and vector competence phenotypes. PLOS Pathog 13:e1006751. https://doi.org/10.1371/journal.ppat.1006751.\u003c/li\u003e\n \u003cli\u003eBaldini F, Segata N, Pompon J, Marcenac P, Robert Shaw W, Dabir\u0026eacute; RK, et al (2014) Evidence of natural Wolbachia infections in field populations of Anopheles gambiae. Nat Commun 5:3985. https://doi.org/10.1038/ncomms4985.\u003c/li\u003e\n \u003cli\u003eJeffries CL, Tantely LM, Raharimalala FN, Hurn E, Boyer S, Walker T (2018) Diverse novel resident Wolbachia strains in Culicine mosquitoes from Madagascar. Sci Rep 8:17456. https://doi.org/10.1038/s41598-018-35658-z.\u003c/li\u003e\n \u003cli\u003eBadawi M, Gr\u0026egrave;ve P, Cordaux R (2015) Feminization of the Isopod Cylisticus convexus after Transinfection of the wVulC Wolbachia Strain of Armadillidium vulgare. PLOS ONE 10:e0128660. https://doi.org/10.1371/journal.pone.0128660.\u003c/li\u003e\n \u003cli\u003eMiyata M, Konagaya T, Yukuhiro K, Nomura M, Kageyama D (2017) \u003cem\u003eWolbachia\u003c/em\u003e -induced meiotic drive and feminization is associated with an independent occurrence of selective mitochondrial sweep in a butterfly. Biol Lett 13:20170153. https://doi.org/10.1098/rsbl.2017.0153.\u003c/li\u003e\n \u003cli\u003eArai H, Lin SR, Nakai M, Kunimi Y, Inoue MN (2020) Closely Related Male-Killing and Nonmale-Killing Wolbachia Strains in the Oriental Tea Tortrix Homona magnanima. Microb Ecol 79:1011\u0026ndash;20. https://doi.org/10.1007/s00248-019-01469-6.\u003c/li\u003e\n \u003cli\u003eAnt TH, Herd C, Louis F, Failloux AB, Sinkins SP (2020) \u003cem\u003eWolbachia\u003c/em\u003e transinfections in \u003cem\u003eCulex quinquefasciatus\u003c/em\u003e generate cytoplasmic incompatibility. Insect Mol Biol 29:1\u0026ndash;8. https://doi.org/10.1111/imb.12604.\u003c/li\u003e\n \u003cli\u003eShi H, Yu X, Cheng G (2023) Impact of the microbiome on mosquito-borne diseases. Protein Cell :pwad021. https://doi.org/10.1093/procel/pwad021.\u003c/li\u003e\n \u003cli\u003eHoffmann AA, Montgomery BL, Popovici J, Iturbe-Ormaetxe I, Johnson PH, Muzzi F, et al (2011) Successful establishment of Wolbachia in Aedes populations to suppress dengue transmission. Nature 476:454\u0026ndash;7. https://doi.org/10.1038/nature10356.\u003c/li\u003e\n \u003cli\u003eCaputo B, Moretti R, Manica M, Serini P, Lampazzi E, Bonanni M, et al (2020) A bacterium against the tiger: preliminary evidence of fertility reduction after release of \u003cem\u003eAedes albopictus\u003c/em\u003e males with manipulated \u003cem\u003eWolbachia\u003c/em\u003e infection in an Italian urban area. Pest Manag Sci 76:1324\u0026ndash;32. https://doi.org/10.1002/ps.5643.\u003c/li\u003e\n \u003cli\u003eLePage DP, Metcalf JA, Bordenstein SR, On J, Perlmutter JI, Shropshire JD, et al (2017) Prophage WO genes recapitulate and enhance Wolbachia-induced cytoplasmic incompatibility. Nature 543:243\u0026ndash;7. https://doi.org/10.1038/nature21391.\u003c/li\u003e\n \u003cli\u003eBeckmann JF, Ronau JA, Hochstrasser M. A (2017) Wolbachia deubiquitylating enzyme induces cytoplasmic incompatibility. Nat Microbiol 2:17007. https://doi.org/10.1038/nmicrobiol.2017.7.\u003c/li\u003e\n \u003cli\u003eLindsey ARI, Rice DW, Bordenstein SR, Brooks AW, Bordenstein SR, Newton ILG (2018) Evolutionary Genetics of Cytoplasmic Incompatibility Genes cifA and cifB in Prophage WO of Wolbachia. Genome Biol Evol 10:434\u0026ndash;51. https://doi.org/10.1093/gbe/evy012.\u003c/li\u003e\n \u003cli\u003eShropshire JD, Rosenberg R, Bordenstein SR (2021) The impacts of cytoplasmic incompatibility factor (\u003cem\u003ecifA\u003c/em\u003e and \u003cem\u003ecifB\u003c/em\u003e) genetic variation on phenotypes.\u0026nbsp;Genetics 217:iyaa007. https://doi.org/10.1093/genetics/iyaa007.\u003c/li\u003e\n \u003cli\u003eKouassi AM, Kouao J-M, Kouakou KE (2022) Caract\u0026eacute;risation intra-annuelle de la variabilit\u0026eacute; climatique en C\u0026ocirc;te d\u0026rsquo;Ivoire.\u0026nbsp;Bull L\u0026rsquo;association G\u0026eacute;ographes Fr G\u0026eacute;ographies 99:289\u0026ndash;306. https://doi.org/10.4000/bagf.9534.\u003c/li\u003e\n \u003cli\u003eHuang Y-M (2004) The subgenus Stegomyia of Aedes in the Afrotropical Region with keys to the species (Diptera: Culicidae).\u0026nbsp;Zootaxa 700:1. https://doi.org/10.11646/zootaxa.700.1.1.\u003c/li\u003e\n \u003cli\u003eRobert V, Ndiaye EH, Rahola N, Le Goff G, Bousses P, Diallo D, et al (2022) Cl\u0026eacute;s dichotomiques illustr\u0026eacute;es d\u0026rsquo;identification des femelles et des larves de moustiques (Diptera : Culicidae) du Burkina Faso, Cap-Vert, Gambie, Mali, Mauritanie, Niger, S\u0026eacute;n\u0026eacute;gal et Tchad. Montpellier: Institut de Recherche pour le D\u0026eacute;veloppement (IRD); https://doi.org/10.23708/fdi :010084866.\u003c/li\u003e\n \u003cli\u003eCl\u0026eacute; d\u0026rsquo;identification des moustiques anoph\u0026egrave;les femelles de la r\u0026eacute;gion afrotropicale (Diptera : Culicidae) n.d. https://www.who.int/fr/publications-detail/WHO-UCN-GMP-2021.04 (accessed June 29, 2023).\u003c/li\u003e\n \u003cli\u003eCornel AJ, Collins FH (1996) PCR of the Ribosomal DNA Intergenic Spacer Regions as a Method for Identifying Mosquitoes in the Anopheles gambiae Complex. In: Clapp JP, editor. Species Diagn. Protoc. PCR Nucleic Acid Methods, Totowa, NJ: Humana Press; p. 321\u0026ndash;32. https://doi.org/10.1385/0-89603-323-6:321.\u003c/li\u003e\n \u003cli\u003eGomes FM, Hixson BL, Tyner MDW, Ramirez JL, Canepa GE, Alves E Silva TL, et al (2017) Effect of naturally occurring \u003cem\u003eWolbachia\u003c/em\u003e in \u003cem\u003eAnopheles gambiae s.l.\u003c/em\u003e mosquitoes from Mali on \u003cem\u003ePlasmodium falciparum\u003c/em\u003e malaria transmission. Proc Natl Acad Sci 114:12566\u0026ndash;71. https://doi.org/10.1073/pnas.1716181114.\u003c/li\u003e\n \u003cli\u003eCorbel V, Fonseca DM, Weetman D, Pinto J, Achee NL, Chandre F, et al (2017) International workshop on insecticide resistance in vectors of arboviruses, December 2016, Rio de Janeiro, Brazil.\u0026nbsp;Parasit Vectors 10:278. https://doi.org/10.1186/s13071-017-2224-3.\u003c/li\u003e\n \u003cli\u003eSimard F (2018) La lutte contre les vecteurs : quel avenir ?\u0026nbsp;Biol Aujourdhui 212:137\u0026ndash;45. https://doi.org/10.1051/jbio/2019006.\u003c/li\u003e\n \u003cli\u003eTorres R, Hernandez E, Flores V, Ramirez JL, Joyce AL (2020) Wolbachia in mosquitoes from the Central Valley of California, USA. Parasit Vectors 13:558. https://doi.org/10.1186/s13071-020-04429-z.\u003c/li\u003e\n \u003cli\u003eYang Y, He Y, Zhu G, Zhang J, Gong Z, Huang S, et al (2021) Prevalence and molecular characterization of Wolbachia in field-collected Aedes albopictus, Anopheles sinensis, Armigeres subalbatus, Culex pipiens and Cx. tritaeniorhynchus in China.\u0026nbsp;PLoS Negl Trop Dis 15:e0009911. https://doi.org/10.1371/journal.pntd.0009911.\u003c/li\u003e\n \u003cli\u003eDing H, Yeo H, Puniamoorthy N (2020) Wolbachia infection in wild mosquitoes (Diptera: Culicidae): implications for transmission modes and host-endosymbiont associations in Singapore. Parasit Vectors 13:612. https://doi.org/10.1186/s13071-020-04466-8.\u003c/li\u003e\n \u003cli\u003eLi Y, Sun Y, Zou J, Zhong D, Liu R, Zhu C, et al (2023) Characterizing the Wolbachia infection in field-collected Culicidae mosquitoes from Hainan Province, China. Parasit Vectors 16:128. https://doi.org/10.1186/s13071-023-05719-y.\u003c/li\u003e\n \u003cli\u003eNugapola NWNP, De Silva WAPP, Karunaratne SHPP (2017) Distribution and phylogeny of Wolbachia strains in wild mosquito populations in Sri Lanka. Parasit Vectors 10:230. https://doi.org/10.1186/s13071-017-2174-9.\u003c/li\u003e\n \u003cli\u003eTsai K-H, Lien J-C, Huang C-G, Wu W-J, Chen W-J (2004) Molecular (sub) grouping of endosymbiont Wolbachia infection among mosquitoes of Taiwan. J Med Entomol 41:677\u0026ndash;83. https://doi.org/10.1603/0022-2585-41.4.677.\u003c/li\u003e\n \u003cli\u003eGloria-Soria A, Chiodo TG, Powell JR (2018) Lack of Evidence for Natural Wolbachia Infections in Aedes aegypti (Diptera: Culicidae). J Med Entomol 55:1354\u0026ndash;6. https://doi.org/10.1093/jme/tjy084.\u003c/li\u003e\n \u003cli\u003eNoor SHMM, Emelia O, Mohd FMY, Aishah HA (2022) Super- or single infection: Wolbachia supergrouping of wild mosquito populations from varied location types in Peninsular Malaysia. Sains Malays 51:27\u0026ndash;38.\u003c/li\u003e\n \u003cli\u003eBalaji S, Jayachandran S, Prabagaran SR (2019) Evidence for the natural occurrence of Wolbachia in Aedes aegypti mosquitoes. FEMS Microbiol Lett 366:fnz055. https://doi.org/10.1093/femsle/fnz055.\u003c/li\u003e\n \u003cli\u003eShaw WR, Marcenac P, Childs LM, Buckee CO, Baldini F, Sawadogo SP, et al (2016) Wolbachia infections in natural Anopheles populations affect egg laying and negatively correlate with Plasmodium development. Nat Commun 7:11772. https://doi.org/10.1038/ncomms11772.\u003c/li\u003e\n \u003cli\u003eJeffries CL, Lawrence GG, Golovko G, Kristan M, Orsborne J, Spence K, et al (2018) Novel Wolbachia strains in Anopheles malaria vectors from Sub-Saharan Africa. Wellcome Open Res 3:113. https://doi.org/10.12688/wellcomeopenres.14765.2.\u003c/li\u003e\n \u003cli\u003eAyala D, Akone‐Ella O, Rahola N, Kengne P, Ngangue MF, Mezeme F, et al (2019) Natural \u003cem\u003eWolbachia\u003c/em\u003e infections are common in the major malaria vectors in Central Africa. Evol Appl 12:1583\u0026ndash;94. https://doi.org/10.1111/eva.12804.\u003c/li\u003e\n \u003cli\u003eBergman A, Hesson JC (2021) Wolbachia prevalence in the vector species Culex pipiens and Culex torrentium in a Sindbis virus-endemic region of Sweden. Parasit Vectors 14:428. https://doi.org/10.1186/s13071-021-04937-6.\u003c/li\u003e\n \u003cli\u003eKonan YL, Coulibaly ZI, Kon\u0026eacute; AB, Ekra KD, Doannio JM-C, Dosso M, et al (2013) Species composition and population dynamics of Aedes mosquitoes, potential vectors of arboviruses, at the container terminal of the autonomous port of Abidjan, C\u0026ocirc;te d\u0026rsquo;Ivoire. Parasite 20:13. https://doi.org/10.1051/parasite/2013013.\u003c/li\u003e\n \u003cli\u003eYokoly FN, Zahouli JBZ, M\u0026eacute;ite A, Opoku M, Kouassi BL, de Souza DK, et al (2020) Low transmission of Wuchereria bancrofti in cross-border districts of C\u0026ocirc;te d\u0026rsquo;Ivoire: A great step towards lymphatic filariasis elimination in West Africa. PLoS ONE 15:e0231541. https://doi.org/10.1371/journal.pone.0231541.\u003c/li\u003e\n \u003cli\u003eZahouli JZB, Edi CAV, Yao LA, Lisro EG, Adou M, Kon\u0026eacute; I, et al (2023) Small-scale field evaluation of PermaNet\u0026reg; Dual (a long-lasting net coated with a mixture of chlorfenapyr and deltamethrin) against pyrethroid-resistant Anopheles gambiae mosquitoes from Tiassal\u0026eacute;, C\u0026ocirc;te d\u0026rsquo;Ivoire. Malar J 22:36. https://doi.org/10.1186/s12936-023-04455-z.\u003c/li\u003e\n \u003cli\u003eSicard M, Bonneau M, Weill M (2019) Wolbachia prevalence, diversity, and ability to induce cytoplasmic incompatibility in mosquitoes. Curr Opin Insect Sci 34:12\u0026ndash;20. https://doi.org/10.1016/j.cois.2019.02.005.\u003c/li\u003e\n \u003cli\u003eKaur R, Leigh BA, Ritchie IT, Bordenstein SR (2022) The Cif proteins from Wolbachia prophage WO modify sperm genome integrity to establish cytoplasmic incompatibility. PLoS Biol 20. https://doi.org/10.1371/journal.pbio.3001584.\u003c/li\u003e\n \u003cli\u003eWang W, Cui W, Yang H (2022) Toward an accurate mechanistic understanding of Wolbachia-induced cytoplasmic incompatibility. Environ Microbiol 24:4519\u0026ndash;32. https://doi.org/10.1111/1462-2920.16125.\u003c/li\u003e\n \u003cli\u003eMartinez J, Klasson L, Welch JJ, Jiggins FM (2021) Life and Death of Selfish Genes: Comparative Genomics Reveals the Dynamic Evolution of Cytoplasmic Incompatibility. Mol Biol Evol 38:2\u0026ndash;15. https://doi.org/10.1093/molbev/msaa209.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"molecular-biology-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"mole","sideBox":"Learn more about [Molecular Biology Reports](https://www.springer.com/journal/11033)","snPcode":"11033","submissionUrl":"https://submission.nature.com/new-submission/11033/3","title":"Molecular Biology Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"Wolbachia, prevalence, mosquitos, CifA, CifB, Côte d’Ivoire","lastPublishedDoi":"10.21203/rs.3.rs-5377992/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-5377992/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003eBackground:\u003c/strong\u003e\u003cem\u003e Wolbachia is \u003c/em\u003ean endosymbiont bacterium known to stimulate host immunity against arboviruses and protozoa. Côte d'Ivoire is in a malaria-endemic region, and has experienced several dengue epidemics in recent decades as well. In order to help reduce the transmission of pathogens by mosquito vectors, we studied the prevalence of \u003cem\u003eWolbachia \u003c/em\u003eand the distribution of \u003cem\u003eCif \u003c/em\u003egenes in different mosquito species caught in the wild in Cote d’Ivoire.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMethods and Results:\u003c/strong\u003eMosquitoes of the genera \u003cem\u003eAnophele, Aedes, Culex \u003c/em\u003eand \u003cem\u003eMansonia \u003c/em\u003ewere captured in five cities. Mosquitoes were collected at larval stage in breeding sites and adults were captured using BG sentinel traps. The mosquitoes were identified morphologically and \u003cem\u003eWolbachia \u003c/em\u003eand cytoplasmic incompatibility factors were screened using qPCR targeting the 16s rRNA gene and the \u003cem\u003eCif\u003c/em\u003eA,B genes. A total of 518 mosquito samples belonging to 15 species and 4 genera were examined. Sixty percent of the species were infected with \u003cem\u003eWolbachia. \u003c/em\u003eThe three medically important mosquito species \u003cem\u003eAedes aegypti, Anopheles gambiae s.l. \u003c/em\u003eand \u003cem\u003eCulex quinquefasciatus \u003c/em\u003ehad a prevalence of 12.84%, 13.46% and 72.64% respectively. The \u003cem\u003eWolbachia \u003c/em\u003estrains infecting the different mosquito species of the genus \u003cem\u003eCulex\u003c/em\u003eencoded 98.46% for the \u003cem\u003eCif\u003c/em\u003eA gene and 88.46 % for the \u003cem\u003eCif\u003c/em\u003eB gene.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConclusion: \u003c/strong\u003eThe presence of \u003cem\u003eWolbachia \u003c/em\u003eand \u003cem\u003eCif\u003c/em\u003eA,B genes in mosquitoes of different species in Côte d'Ivoire offer a promising opportunity to reduce the competence of mosquito vectors. Characterization of \u003cem\u003eWolbachia\u003c/em\u003e strains and cytoplasmic incompatibility factors will provide a better understanding of these endosymbionts, enabling the development of vector control strategies.\u003c/p\u003e","manuscriptTitle":"Molecular detection of Wolbachia sp. and cytoplasmic incompatibility factors (CifA/B) in wild caught mosquitoes in Côte d'Ivoire","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-11-14 05:41:53","doi":"10.21203/rs.3.rs-5377992/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2024-12-09T10:20:12+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-12-05T19:48:57+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"249319971283238217295497711906926015506","date":"2024-11-19T03:07:07+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"58818401192698411890761871412021992300","date":"2024-11-18T16:39:43+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2024-11-04T12:15:13+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-11-02T12:59:53+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2024-11-02T12:59:22+00:00","index":"","fulltext":""},{"type":"submitted","content":"Molecular Biology Reports","date":"2024-11-02T11:25:39+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"molecular-biology-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"mole","sideBox":"Learn more about [Molecular Biology Reports](https://www.springer.com/journal/11033)","snPcode":"11033","submissionUrl":"https://submission.nature.com/new-submission/11033/3","title":"Molecular Biology Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"686ce899-7323-4727-819a-108d04938aa6","owner":[],"postedDate":"November 14th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2025-02-03T16:07:43+00:00","versionOfRecord":{"articleIdentity":"rs-5377992","link":"https://doi.org/10.1007/s11033-025-10280-1","journal":{"identity":"molecular-biology-reports","isVorOnly":false,"title":"Molecular Biology Reports"},"publishedOn":"2025-01-31 15:57:12","publishedOnDateReadable":"January 31st, 2025"},"versionCreatedAt":"2024-11-14 05:41:53","video":"","vorDoi":"10.1007/s11033-025-10280-1","vorDoiUrl":"https://doi.org/10.1007/s11033-025-10280-1","workflowStages":[]},"version":"v1","identity":"rs-5377992","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-5377992","identity":"rs-5377992","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2024) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-19T01:45:01.086888+00:00
unpaywall
last seen: 2026-05-21T05:10:58.409756+00:00
License: CC-BY-4.0