Overexpression of the BRC repeat 8 of BRCA2 hyperstabilizes RAD51 and alters DNA repair dynamics

Overexpression of the BRC repeat 8 of BRCA2 hyperstabilizes RAD51 and alters DNA repair dynamics | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Short Report Overexpression of the BRC repeat 8 of BRCA2 hyperstabilizes RAD51 and alters DNA repair dynamics Zida Zhu, Taisuke Kitano, Masami Morimatsu, Koichi Orino, Yasunaga Yoshikawa This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-8590288/v1 This work is licensed under a CC BY 4.0 License Status: Under Revision Version 1 posted 4 You are reading this latest preprint version Abstract Background RAD51 plays an essential role in maintaining genomic stability via homologous recombination (HR). Aberrant RAD51 expression compromises genomic integrity and influences cellular responses to DNA-damaging agents. RAD51 expression is tightly regulated in normal cells, and its increased expression is associated with therapeutic resistance and poor prognosis in various cancers. BRCA2, a tumor suppressor gene product, promotes HR by directly interacting with RAD51 through eight evolutionarily conserved BRC repeats (BRC1–8). Individual BRC repeats in BRCA2 share a relatively low sequence similarity and possess distinct biochemical properties. We previously reported that the expression of certain BRC repeats alters RAD51 protein levels, suggesting that individual BRC repeats distinctly affect RAD51 expression. Methods and Results We aimed to determine the specific BRC repeat regions that affect RAD51 protein levels. Notably, BRC8 expression significantly elevated protein levels and foci formation, possibly due to the inhibition of ubiquitin-mediated RAD51 degradation. Paradoxically, despite increased RAD51 foci formation, BRC8 expression significantly reduced HR repair efficiency and sensitivity to DNA-damaging agents. Conclusion Our findings suggest that BRC8 overexpression stabilizes RAD51 by inhibiting ubiquitin-dependent degradation of RAD51, leading to increased persistence in RAD51 foci, indicating impaired timely removal of RAD51 from DNA damage sites and reduced HR efficiency. Additionally, altered cell cycle distribution may contribute to reduced non-homologous end-joining (NHEJ) efficiency, thereby further enhancing cellular sensitivity to DNA-damaging agents. These findings provide a basis for exploring the potential of BRC8-based peptides as tools for modulating RAD51 stability and sensitizing cells to DNA damage. BRCA2 RAD51 Homologous Recombination Ubiquitination DNA Damage Genome Stability Figures Figure 1 Figure 2 Figure 3 Introduction Cancer therapies, such as X-ray irradiation and chemotherapy, induce DNA double-stranded breaks (DSBs). DSBs are repaired by two major DNA repair mechanisms, homologous recombination (HR) and non-homologous end-joining (NHEJ)—both of which maintain genomic DNA integrity. Unlike NHEJ, which is error-prone, HR is a high-fidelity template-dependent mechanism that uses sister chromatids as templates and operates primarily during the S and G2 phases of the cell cycle [ 1 ]. During HR, the tumor suppressor BRCA2 gene product recruits the recombinase RAD51 to DNA double-strand breaks via eight domains known as BRC repeats (BRC1–8) [ 2 , 3 ]. RAD51 forms a single-stranded DNA complex called the nucleofilament, which is essential for initiating strand invasion into homologous sequences [ 4 ]. Appropriate RAD51 expression is essential for efficient HR repair. Insufficient RAD51 compromises HR efficiency; conversely, RAD51 overexpression can increase homologous recombination efficiency. Precise regulation of RAD51 protein levels occurs at both the transcriptional and post-translational levels [ 4 ] and involves multiple pathways, among which BRCA2 plays a key role in maintaining RAD51 protein levels. RAD51 protein levels are significantly decreased upon BRCA2 loss or downregulation but restored following the rescue of wild-type BRCA2 [ 5 – 7 ]. We previously reported that expression of individual BRC repeats alters RAD51 protein levels, with BRC1 significantly increasing and BRC2 decreasing RAD51 protein levels [ 8 ]. Although each BRC repeat is highly evolutionarily conserved, individual repeats share relatively low sequence similarity and exhibit distinct interactions with RAD51 [ 3 ]. These sequence differences confer distinct structural and biochemical properties to the repeats [ 9 ], potentially influencing how individual BRC repeats regulate RAD51 protein levels. Therefore, we investigated whether specific BRC repeats influence RAD51 protein levels and determined whether these effects occur at the transcriptional or post-translational regulation. Understanding these mechanisms will clarify how specific BRC repeats modulate RAD51 levels and provide insights into their potential impact on HR repair dynamics. In this study, we systematically examined the effects of overexpressing each BRC repeat on RAD51 protein levels. Notably, BRC8-overexpressing cells exhibited significantly increased RAD51 protein levels without changes in RAD51 transcript levels. BRC8-expressing cells also showed increased sensitivity to X-ray irradiation and DNA-damaging agents, possibly due to inhibition of ubiquitin-mediated proteasomal degradation of RAD51. These findings provide an experimental foundation for modulating RAD51 protein turnover through BRC8 overexpression by interfering with its ubiquitin-mediated degradation, thus providing new insights into therapeutic strategies targeting the post-translational regulation of RAD51. Materials and methods Cell line and antibodies HeLa cells were obtained from the RIKEN Cell Bank and cultured as previously described [8]. The following antibodies were used for western blotting and immunostaining: Anti-RAD51 (1:4000; 70-001; Bio Academia, Osaka, Japan), anti-BRCA2 (1:250; OP-95; Merck, Darmstadt, Germany), anti-Lamin B1 (1:2000; PM064; MBL, Tokyo, Japan), anti-FLAG (1:1000; M2; Merck), anti-β-actin (1:10000; M177-3, MBL), anti-α-tubulin (1:4000; M175-3; MBL), anti-cyclin A (1:1000; B8; Santa Cruz Biotechnology, Dallas, TX, USA), and anti-ubiquitin (1:100; P4D1; Santa Cruz Biotechnology) antibodies. Stable cell line generation HeLa cells stably expressing FLAG-HA nuclear localization signal-fused canine BRCA2 BRC repeats or an empty vector as a control were generated as previously described [8]. Protein extraction and western blotting Protein extraction and western blot analyses were performed as previously described [8]. Proteins were detected using a C-DiGit Blot Scanner (Li-COR, Lincoln, Nebraska, USA), and band intensities were quantified using Image Studio 6.0 software (Li-COR). Quantitative reverse transcription-polymerase chain reaction (qRT-PCR) RNA was extracted using the CellAmp Direct RNA Prep Kit (Takara Bio Inc., Shiga, Japan) following the manufacturer's instructions. qRT-PCR was performed to measure RAD51 mRNA levels using the following primers targeting RAD51: CTGATGAGTTTGGTGTAGCAG (forward) and GGAAGACAGGGAGAGTCGTAGA (reverse). RPS18 was used as an internal reference for normalization and was run as previously described [10]. Cycloheximide (CHX) and MG132 treatments BRC8-expressing cells or control cells were harvested at 3 and 6 h after treatment with 100 μg/mL CHX (MedChemExpress, Monmouth Junction, NJ, USA) or 10 μM MG132 (MedChemExpress). Co-immunoprecipitation assay BRC8-expressing cells or control cells were treated with 10 μM MG132 (MedChemExpress) or dimethyl sulfoxide for 1 h. Cells were lysed using a lysis buffer (20 mM Tris-HCl [pH 8.0], 50 mM KCl, 2 mM MgCl 2 , 0.5% Triton X-100, and 10% glycerol) supplemented with protease inhibitor cocktail (P8340; Merck). The lysates were incubated with the anti-RAD51 antibodies overnight at 4 °C with gentle rotation, followed by incubation with Dynabeads Protein G (Veritas, Santa Clara, CA, USA) for 3 h at 4 °C. The immunoprecipitates were washed three times with wash buffer (20 mM Tris-HCl [pH 8.0], 500 mM KCl, 2 mM MgCl 2 , 0.5% Triton X-100, and 10% glycerol) and eluted with 1× lithium dodecyl sulfate buffer (Thermo Fisher Scientific, Waltham, MA, USA) for western blot analysis. Clonogenic survival assay The cells were irradiated with MX-80Labo (MediXtec, Chiba, Japan) at doses of 1-5 Gy. Subsequently, 200–2000 cells/well were seeded in 6-well plates. For mitomycin C (MMC) treatment, 200–2000 cells/well were seeded in a 6-well plate and treated with 0.25–4 ng/mL MMC the following day. After 10–14 days, colony formation was assessed as previously described [11]. HR and NHEJ reporter assays Plasmids used in the reporter assays included pDRGFP (Addgene plasmid #26475; http://n2t.net/addgene:26475; RRID: Addgene_26475), which was a gift from Maria Jasin [12]. pimEJ5GFP (Addgene plasmid #44026; http://n2t.net/addgene:44026; RRID: Addgene_44026) was a gift from Jeremy Stark [13]. pUC CBA-SpCas9.EF1a-BFP.sgLMNA (Addgene plasmid #98971; http://n2t.net/addgene:98971; RRID: Addgene_98971) and pCAGGS Donor mClover-LMNA (Addgene plasmid #98970; http://n2t.net/addgene:98970) were gifts from Jan Karlseder [14] and were also obtained from Addgene. The pDRGFP and pimEJ5GFP plasmids were linearized with I-SceI (New England Biolabs, Ipswich, MA, USA) and co-transfected with an mCherry for normalization using the FuGENE HD transfection reagent (Promega Corporation, Madison, WI, USA). The Cas9-based HR assay was performed as previously described [11]. The cells were analyzed using flow cytometry (SH800; Sony, Tokyo, Japan) with at least 20,000 cells per sample. Immunostaining Immunostaining for RAD51 and cyclin A was performed as previously described [11]. RAD51 foci were visualized using confocal microscopy (LSM710; Carl Zeiss AG, Jena, Germany) and quantified using CellProfiler software [15]. Statistical analyses Statistical significance was set at p < 0.05. Student’s t -test was used for two-group comparisons. For multiple-group comparisons, data were analyzed using the Kruskal–Wallis test, followed by Dunn’s multiple-comparison test. Analyses and graphs were generated using GraphPad Software (GraphPad Software, Boston, MA, USA). Results BRC8 overexpression increases the RAD51 protein levels We stably expressed FLAG-HA-tagged canine peptides containing individual BRC repeats (BRC1–8) to identify specific BRC repeats that affect RAD51 protein levels (Fig. 1a). Although several repeats (BRC1, BRC2, BRC4, and BRC7) moderately affected RAD51 protein levels, only BRC8 significantly increased RAD51 levels (approximately 4.83-fold relative to the control; Fig. 1 b and c). Consistently, transient transfection-mediated BRC8 overexpression increased RAD51 protein levels (Online Resource 1; Supplementary Material Fig. s1). BRC8 overexpression stabilizes RAD51 by suppressing its ubiquitin-mediated proteasomal degradation To determine the mechanism underlying the increase in RAD51 protein levels upon BRC8 expression, we assessed RAD51 mRNA levels using qRT-PCR. No significant differences in RAD51 transcript levels were observed between BRC8-expressing and empty vector-transfected cells (Fig. 2a). Next, we evaluated RAD51 stability using CHX and MG132 assays. CHX inhibited protein synthesis, whereas MG132 blocked proteasomal degradation (Fig. 2b). Treatment effectiveness was confirmed using p53, a short-lived protein. p53 levels decreased rapidly after CHX treatment and increased following MG132 treatment. In control cells, blocking protein synthesis with CHX significantly reduced RAD51 protein levels (0.57-fold) within 6 h. In contrast, RAD51 degradation was markedly attenuated in BRC8-expressing cells, with 0.85-fold of the protein remaining (Fig. 2b and c, CHX-chase assay). In control cells, MG132 treatment led to significant accumulation of RAD51 protein (1.66-fold), confirming that RAD51 is a substrate for proteasomal degradation. However, MG132 did not significantly affect RAD51 protein levels in BRC8-expressing cells, suggesting that BRC8 inhibited proteasomal degradation of RAD51 (Fig. 2b and c, MG132-chase assay). Similarly, co-treatment with CHX and MG132 increased RAD51 protein levels (1.36-fold) within 6 h in control cells. In contrast, BRC8-expressing cells did not respond to this treatment, further confirming that BRC8 protected RAD51 from proteasomal degradation (Fig. 2b and c; CHX combined with the MG132-chase assay). To confirm that BRC8 expression stabilizes RAD51 by reducing its ubiquitination, we examined whether this stabilization occurs through inhibition of the ubiquitin–proteasome pathway. RAD51 immunoprecipitation assays were performed under stringent washing conditions to detect ubiquitin binding to RAD51. Compared with control cells, RAD51 polyubiquitination levels were significantly reduced in BRC8-expressing cells, both in the presence and absence of MG132 treatment. These findings indicate that BRC8 expression protects RAD51 from ubiquitin-mediated degradation (Fig. 2d). BRC8 overexpression increases the cellular sensitivity to DNA-damaging agents and reduces the DNA repair efficiency Next, we examined whether BRC8 expression influenced cellular sensitivity to DNA-damaging agents and DNA repair efficiency. Clonogenic survival assays were performed using X-ray irradiation and MMC. MMC induces DNA interstrand cross-links, which primarily require HR for effective repair. BRC8-expressing cells exhibited significantly greater sensitivity to X-ray and MMC treatments than control cells (Fig. 3a). To evaluate the effects of BRC8 on specific DNA repair pathways, we measured HR and NHEJ efficiencies (Fig. 3b and c). Both DR-GFP and Cas9-mClover HR assays revealed significantly reduced HR efficiency in BRC8-expressing cells (Fig. 3b and c). Moreover, the EJ5-GFP assay demonstrated a significant reduction in NHEJ efficiency in BRC8-expressing cells (Fig. 3d). Typically, these two pathways operate competitively, with one often being suppressed when the other is active [16]. The unexpected simultaneous reduction in the HR and NHEJ efficiencies suggests the involvement of another factor. Because the cell cycle influences the DNA repair pathway (HR or NHEJ), we analyzed whether cell cycle distribution changed in the examined cell types. Notably, BRC8-expressing cells exhibited a lower proportion of cells in the G1 phase and higher proportions in the S and G2/M phases than control cells (Fig. 3e). BRC8-expressing cells also showed higher percentages of cyclin A-positive cells in the S and G2 phases than control cells (Online Resource 1, Supplementary Material Fig. s2). To further clarify the mechanism underlying decreased HR efficiency, we assessed RAD51 foci formation with and without X-ray irradiation. RAD51 foci are formed in the nucleus in response to DSBs. Under non-irradiated conditions, BRC8-expressing cells exhibited a higher number of RAD51 foci than control cells. After irradiation, the number of RAD51 foci increased significantly in both groups. However, BRC8-expressing cells consistently showed significantly higher RAD51 foci formation than control cells at all post-irradiation time points. Notably, compared with untreated cells, BRC8-expressing cells exhibited significantly increased RAD51 foci at 8, 16, 24, 32, and 40 h, with a peak trend maintained for 40 h. In contrast, control cells showed significant increases relative to their basal levels only at 8, 16, 24, and 32 h, with a peak trend maintained until 16 h (Fig. 3f). Discussion In this study, BRC8 overexpression significantly increased RAD51 protein levels without altering transcript levels and reduced RAD51 polyubiquitination and prolonged RAD51 half-life. BRC8-expressing cells showed increased basal RAD51 foci and more RAD51 foci formation after X-ray irradiation compared to control cells. Previous in vitro studies have demonstrated that BRC8 preferentially binds to RAD51 already loaded onto single-stranded DNA (ssDNA) and enhances and stabilizes the formation of RAD51 nucleoprotein filaments, but does not influence DNA strand exchange activity in vitro [ 3 , 17 ]. Based on these findings, overexpression of BRC8 in cells may promote stabilization of RAD51 nucleoprotein filaments and their retention at DNA damage sites. When normalized to their respective basal conditions (without treatment), both control and BRC8-expressing cells exhibited a comparable ratio of increase in RAD51 foci after irradiation. However, the foci persisted longer in BRC8-expressing cells, indicating delayed disassembly of RAD51 from DNA damage sites. Although RAD51 protein levels were significantly elevated in BRC8-expressing cells, overall homologous recombination (HR) efficiency was notably reduced. The formation of RAD51 foci generally reflects the recruitment of RAD51 to DNA damage sites and serves as an indicator of an effective HR response. However, successful HR progression requires RAD51 filament formation and timely disassembly. Specifically, the progression of HR into later stages requires the timely removal of RAD51 from DNA damage sites, a process mediated by the E3 ligase RFWD3 [ 18 ]. Disruption of ubiquitin-mediated removal results in the abnormal persistence of RAD51 foci, impaired loading of downstream repair factors, and decreased HR efficiency. Therefore, we hypothesized that BRC8 overexpression promotes RAD51 recruitment to DNA damage sites, inhibits RAD51 ubiquitination, and leads to excessive stabilization of RAD51 at these sites, thereby interfering with RAD51 removal and impairing HR completion. Furthermore, we observed that their formation was significantly increased in BRC8-expressing cells even in the absence of exogenous DNA damage. Cell cycle analysis revealed an increased proportion of cells in the S and G2/M phases and a corresponding decrease in the G1 phase. These findings suggest that impaired RAD51 dissociation causes incomplete DNA repair, leading to activation of the S/G2 DNA damage checkpoint [ 2 ] and a consequent delay in cell cycle progression, resulting in the accumulation of cells in the S and G2/M phases. Although HR and NHEJ typically act as competing repair pathways, with increased NHEJ often accompanied by reduced HR [ 13 ], our results revealed an unexpected decrease in both HR and NHEJ efficiencies in BRC8-expressing cells. Because NHEJ functions actively across the cell cycle, whereas HR is primarily restricted to the S and G2 phases, NHEJ serves as the predominant repair pathway in the G1 phase. The markedly reduced G1 cell population may therefore have contributed to the observed reduction in NHEJ repair efficiency, explaining why both pathways were impaired. Although our study focused primarily on BRC8, it should be noted that among the eight BRC repeat peptides expressed, only BRC8 showed extremely high expression levels. Therefore, we cannot rule out the possibility that other BRC repeats similarly influence RAD51 ubiquitination and DNA repair dynamics if expressed at comparable levels. Future studies should investigate the effects of other BRC on RAD51 ubiquitination and DNA repair efficiency. In summary, our findings suggest that BRC8 stabilizes RAD51 by inhibiting its ubiquitin-mediated degradation, consequently impairing both HR and NHEJ efficiency and increasing cellular sensitivity to DNA-damaging agents. Our results provide an experimental foundation for using BRC8 overexpression to modulate RAD51 protein turnover by interfering with its ubiquitin-mediated degradation and offer new insights into therapeutic strategies for regulating RAD51 stability mediated by the BRC repeats of BRCA2. Abbreviations CHX, cycloheximide; DSB, double-strand break; HR, homologous recombination; MMC, mitomycin C; NHEJ, non-homologous end joining; qRT-PCR, quantitative reverse transcription-polymerase chain reaction Declarations Competing Interests The authors declare that they have no competing interests. Consent for publication All authors have read and approved the final manuscript. Ethics approval The author has confirmed that no ethical approval is required for this study. Consent to participate Informed consent was obtained from all participants included in the study. Consent to publish This study did not contain any identifiable personal data. Therefore, consent for publication of this manuscript was not required. Funding This work was supported by a Grant-in-Aid for Scientific Research (C) (grant number 23K05575) and a Grant-in-Aid for JSPS Fellows (grant number 24KJ1924) from the Japan Society for the Promotion of Science. Author Contribution Conceptualization Z.Z., T.K., M.M., and Y.Y.; Data curation Z.Z., T.K., and Y.Y.; Formal analysis Z.Z. and Y.Y.; Funding acquisition Z.Z. and Y.Y.; Investigation Z.Z., T.K., and Y.Y.; Methodology M.M. and Y.Y.; Project administration Y.Y.; Resources M.M. and Y.Y.; Software Z.Z. and Y.Y.; Supervision M.M., T.K., K.O., and Y.Y.; Validation Z.Z. and Y.Y.; Visualization Z.Z., T.K., and Y.Y.; Writing – original draft Z.Z. and Y.Y.; Writing – review and editing M.M., Y.Y., and K.O. . Acknowledgement This work was supported in part by Grant-in-Aid for JSPS Fellows (No. 24KJ1924) and Grants-in-Aid for Young Scientists (B) (No. 23K05575) from the Japan Society for the Promotion of Science. We thank Editage (www.editage.jp (accessed on 10th January 2026)) for English language editing. Data Availability The datasets used and analyzed in this study are available from the corresponding author upon reasonable request. References Li X, Heyer W-D. Homologous recombination in DNA repair and DNA damage tolerance. Cell Res 2008;18:99–113. https://doi.org/10.1038/cr.2008.1. Prakash R, Zhang Y, Feng W, Jasin M. Homologous Recombination and Human Health: The Roles of BRCA1, BRCA2, and Associated Proteins. Cold Spring Harb Perspect Biol 2015;7:a016600. https://doi.org/10.1101/cshperspect.a016600. Carreira A, Kowalczykowski SC. Two classes of BRC repeats in BRCA2 promote RAD51 nucleoprotein filament function by distinct mechanisms. Proc Natl Acad Sci 2011;108:10448–53. https://doi.org/10.1073/pnas.1106971108. Orhan E, Velazquez C, Tabet I, Sardet C, Theillet C. Regulation of RAD51 at the Transcriptional and Functional Levels: What Prospects for Cancer Therapy? Cancers 2021;13:2930. https://doi.org/10.3390/cancers13122930. Brown ET, Holt JT. Rad51 overexpression rescues radiation resistance in BRCA2-defective cancer cells. Mol Carcinog 2009;48:105–9. https://doi.org/10.1002/mc.20463. Lee SA, Roques C, Magwood AC, Masson J-Y, Baker MD. Recovery of deficient homologous recombination in Brca2-depleted mouse cells by wild-type Rad51 expression. DNA Repair 2009;8:170–81. https://doi.org/10.1016/j.dnarep.2008.10.002. Tripathi K, Mani C, Clark DW, Palle K. Rad18 is required for functional interactions between FANCD2, BRCA2, and Rad51 to repair DNA topoisomerase 1-poisons induced lesions and promote fork recovery. Oncotarget 2016;7:12537–53. https://doi.org/10.18632/oncotarget.7247. Zhu Z, Kitano T, Morimatsu M, Ochiai K, Ishiguro-Oonuma T, Oosumi K, et al. A Highly Conserved Region in BRCA2 Suppresses the RAD51-Interaction Activity of BRC Repeats. Vet Sci 2023;10:145. https://doi.org/10.3390/vetsci10020145. Lindenburg LH, Pantelejevs T, Gielen F, Zuazua-Villar P, Butz M, Rees E, et al. Improved RAD51 binders through motif shuffling based on the modularity of BRC repeats. Proc Natl Acad Sci 2021;118:e2017708118. https://doi.org/10.1073/pnas.2017708118. Yoshikawa Y, Morimatsu M, Ochiai K, Ishiguro-Oonuma T, Wada S, Orino K, et al. Reduced canine BRCA2 expression levels in mammary gland tumors. BMC Vet Res 2015;11:159. https://doi.org/10.1186/s12917-015-0483-9. Zhu Z, Kitano T, Morimatsu M, Tanaka A, Morioka R, Lin X, et al. BRCA2 C-Terminal RAD51-Binding Domain Confers Resistance to DNA-Damaging Agents. Int J Mol Sci 2022;23:4060. https://doi.org/10.3390/ijms23074060. Pierce AJ, Johnson RD, Thompson LH, Jasin M. XRCC3 promotes homology-directed repair of DNA damage in mammalian cells. Genes Dev 1999;13:2633–8. Bennardo N, Cheng A, Huang N, Stark JM. Alternative-NHEJ Is a Mechanistically Distinct Pathway of Mammalian Chromosome Break Repair. PLoS Genet 2008;4:e1000110. https://doi.org/10.1371/journal.pgen.1000110. Arnoult N, Correia A, Ma J, Merlo A, Garcia-Gomez S, Maric M, et al. Regulation of DNA repair pathway choice in S and G2 phases by the NHEJ inhibitor CYREN. Nature 2017;549:548–52. https://doi.org/10.1038/nature24023. Stirling DR, Swain-Bowden MJ, Lucas AM, Carpenter AE, Cimini BA, Goodman A. CellProfiler 4: improvements in speed, utility and usability. BMC Bioinformatics 2021;22:433. https://doi.org/10.1186/s12859-021-04344-9. Shrivastav M, De Haro LP, Nickoloff JA. Regulation of DNA double-strand break repair pathway choice. Cell Res 2008;18:134–47. https://doi.org/10.1038/cr.2007.111. Chatterjee G, Jimenez-Sainz J, Presti T, Nguyen T, Jensen RB. Distinct binding of BRCA2 BRC repeats to RAD51 generates differential DNA damage sensitivity. Nucleic Acids Res 2016;44:5256--5270. https://doi.org/10.1093/nar/gkw242. Inano S, Sato K, Katsuki Y, Kobayashi W, Tanaka H, Nakajima K, et al. RFWD3-Mediated Ubiquitination Promotes Timely Removal of Both RPA and RAD51 from DNA Damage Sites to Facilitate Homologous Recombination. Mol Cell 2017;66:622-634.e8. https://doi.org/10.1016/j.molcel.2017.04.022. Additional Declarations No competing interests reported. Supplementary Files SupplementaryMaterial.docx Cite Share Download PDF Status: Under Revision Version 1 posted Editorial decision: Revision requested 16 Jan, 2026 Editor assigned by journal 15 Jan, 2026 Submission checks completed at journal 15 Jan, 2026 First submitted to journal 13 Jan, 2026 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-8590288","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Short Report","associatedPublications":[],"authors":[{"id":575789862,"identity":"7317800d-d2db-4247-bc8c-170f3c4930c3","order_by":0,"name":"Zida Zhu","email":"","orcid":"","institution":"Kitasato University","correspondingAuthor":false,"prefix":"","firstName":"Zida","middleName":"","lastName":"Zhu","suffix":""},{"id":575789866,"identity":"2433602e-6a16-40b9-8c86-3e3c2ef432ff","order_by":1,"name":"Taisuke Kitano","email":"","orcid":"","institution":"Kitasato University","correspondingAuthor":false,"prefix":"","firstName":"Taisuke","middleName":"","lastName":"Kitano","suffix":""},{"id":575789869,"identity":"9aa6760f-7503-4b14-a7a7-f8a19f0005aa","order_by":2,"name":"Masami Morimatsu","email":"","orcid":"","institution":"Hokkaido University","correspondingAuthor":false,"prefix":"","firstName":"Masami","middleName":"","lastName":"Morimatsu","suffix":""},{"id":575789874,"identity":"781c5f64-6201-423e-a909-178d827b72c3","order_by":3,"name":"Koichi Orino","email":"","orcid":"","institution":"Kitasato University","correspondingAuthor":false,"prefix":"","firstName":"Koichi","middleName":"","lastName":"Orino","suffix":""},{"id":575789877,"identity":"dbb79706-9954-4629-8922-54c6dde10fe3","order_by":4,"name":"Yasunaga Yoshikawa","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABMUlEQVRIie2RMUvDQBTHXymY5TTrhSj1I5wEiiKSr3IhcA6e0DFjQMhkydqPUQgEx5QMWa7gGDdLoC4dLFkiCHqmHRISdRW8Hxz8ubsf7707AIXijzIEQkHfZYraZ/gHxfD3Su0kvypAgexuUWgrPZDcTcvJhI2s/MbZVsCObS1bla8eOL6WPsPFQ4/CmDkj/CzObyMTAUcIcQsnQiqIETBEj8LHQ0S8QSyWcxPAk7NwwIvgw/FlACPoU6xSKnZ0v4zeqi9FfymqRSCr6JvvFGIiwp25No1x3RimY1wruL+KIdZMKsydZdP4UgaE8s34XAiwArwmSc8sR5l8MfTuXoV3h9FT5bm2Fl4XuefBSai7q8LovtjpI2312cgHcqX7H24yCpPOXoPBtqsoFArFv+MTWuJqXlYk4+YAAAAASUVORK5CYII=","orcid":"","institution":"Kitasato University","correspondingAuthor":true,"prefix":"","firstName":"Yasunaga","middleName":"","lastName":"Yoshikawa","suffix":""}],"badges":[],"createdAt":"2026-01-13 09:53:56","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-8590288/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-8590288/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":103252990,"identity":"6762c53f-9867-4557-957e-546e138b3f57","added_by":"auto","created_at":"2026-02-23 16:16:54","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":151349,"visible":true,"origin":"","legend":"\u003cp\u003eImpacts of individual BRC repeats on the RAD51 protein levels\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ea\u003c/strong\u003e Diagram of the canine BRCA2 protein (NP_001006654; 3446 amino acids). The amino acid positions of each peptide with BRC repeats are indicated\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eb\u003c/strong\u003e Western blot analysis of RAD51 protein levels in HeLa cells expressing FLAG-tagged BRC repeats. RAD51 levels were normalized to lamin B1 levels, with fold changes relative to the control cells indicated above each lane. The positions of FLAG-tagged BRC repeats (BRC1–8) are indicated by arrowheads. Nonspecific bands are indicated by asterisks (*)\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ec\u003c/strong\u003e Quantitative analysis of RAD51 protein levels (n = 5). Data are presented as the mean ± standard deviation (SD) of fold-change relative to control cells. Statistical significance compared to that of the control (Dunn’s multiple comparison test; \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05) is indicated by an asterisk\u003c/p\u003e","description":"","filename":"FIG1.png","url":"https://assets-eu.researchsquare.com/files/rs-8590288/v1/8fc16f47a465572db602f43d.png"},{"id":103252842,"identity":"1165a209-c680-4bcf-8570-bcfbfa455ba3","added_by":"auto","created_at":"2026-02-23 16:16:20","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":259791,"visible":true,"origin":"","legend":"\u003cp\u003eBRC8 stabilizes RAD51 by preventing its ubiquitin-mediated proteasomal degradation\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ea\u003c/strong\u003e Quantitative reverse transcription polymerase chain reaction (qRT-PCR) analysis of \u003cem\u003eRAD51\u003c/em\u003e mRNA levels in control and BRC8-expressing cells. \u003cem\u003eRAD51\u003c/em\u003emRNA levels were normalized to those of \u003cem\u003eRPS18\u003c/em\u003e mRNA. Data are presented as mean ± SD (n = 8); ns, not significant (Student’s \u003cem\u003et\u003c/em\u003e-test)\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eb\u003c/strong\u003e HeLa cells transfected with the empty vector or BRC8-expressing plasmid were treated with dimethyl sulfoxide (DMSO), cycloheximide (CHX; 100 µg/mL), MG132 (10 µM), or a combination of CHX and MG132. Western blotting for RAD51, p53, and β-actin is shown. RAD51 protein levels were normalized to β-actin protein levels, and the fold-change relative to each untreated control is indicated above each lane\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ec\u003c/strong\u003e Quantification of RAD51 protein stability using CHX-chase, MG132-chase, and combined CHX and MG132-chase assays. Data are presented as mean ± SD (n = 4), including the western blots shown in Fig. 3b. *\u003cem\u003ep \u003c/em\u003e\u0026lt; 0.05 and **\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01 vs. control cells (Student's \u003cem\u003et\u003c/em\u003e-test)\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ed\u003c/strong\u003e Immunoprecipitation assay to detect RAD51 ubiquitination. HeLa cells transfected with the empty vector or BRC8-expressing plasmid were treated with or without 10 μM MG132 for 1 h. Then, cell lysates were immunoprecipitated using the anti-RAD51 antibody, and ubiquitinated RAD51 was detected using the anti-ubiquitin antibody\u003c/p\u003e","description":"","filename":"FIG2.png","url":"https://assets-eu.researchsquare.com/files/rs-8590288/v1/e35f78e3dd022e670dab36d8.png"},{"id":103252839,"identity":"d4cadbab-2846-446a-ad72-ee2cf8f1f55f","added_by":"auto","created_at":"2026-02-23 16:16:19","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":217840,"visible":true,"origin":"","legend":"\u003cp\u003eBRC8 overexpression increased the cellular sensitivity to DNA-damaging agents and reduced the DNA repair efficiency\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ea\u003c/strong\u003e Cell survival after X-ray irradiation (left) and mitomycin C (MMC) treatment (right) of HeLa cells transfected with an empty vector or BRC8-expressing plasmid. Statistical significance compared to the control cells. Data are presented as mean ± SD (n = 3). *\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05, **\u003cem\u003ep\u003c/em\u003e\u0026lt; 0.01, and ***\u003cem\u003ep \u003c/em\u003e\u0026lt; 0.001 (Student’s \u003cem\u003et\u003c/em\u003e-test)\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eb\u003c/strong\u003e Schematic illustration of direct repeat green fluorescent protein (DR-GFP) homologous recombination (HR) reporter assay. GFP expression indicated successful HR-mediated repair. Data are presented as mean ± SD (n = 3). **\u003cem\u003ep\u003c/em\u003e\u0026lt; 0.01, (Student’s \u003cem\u003et\u003c/em\u003e-test)\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ec\u003c/strong\u003e Schematic illustration of Cas9-induced HR reporter assay. Successful HR repair enables mClover expression. Data are presented as mean ± SD (n = 3). **\u003cem\u003ep\u003c/em\u003e\u0026lt; 0.01 (Student’s \u003cem\u003et\u003c/em\u003e-test)\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ed\u003c/strong\u003e Schematic illustration of end-joining 5 (EJ5)-GFP non-homologous end joining (NHEJ) reporter system. GFP expression indicated successful NHEJ repair. Data are presented as mean ± SD (n = 3). **\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01 (Student’s \u003cem\u003et\u003c/em\u003e-test)\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ee\u003c/strong\u003e Cell cycle analysis of HeLa cells transfected with empty vector or BRC8-expressing plasmid using flow cytometry. The proportions of cells in the G1, S, and G2/M phases of the cell cycle are indicated on the right-hand side of each panel\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ef\u003c/strong\u003e Scatter plot of RAD51 foci per cell in untreated and X-ray-irradiated (5 Gy) HeLa cells transfected with the empty vector (blue) or BRC8-expressing plasmid (red) at 8, 16, 24, 32, 40, and 48 h post-treatment. Individual data points and medians were presented. Statistical significance was determined using Dunn's multiple comparison test. The \u003cem\u003ep\u003c/em\u003e-values are shown for each comparison. Asterisks and sharps indicate significant differences between basal empty vector-transfected control cells (# \u003cem\u003ep \u003c/em\u003e\u0026lt; 0.05) and basal BRC8-expressing cells (* \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05)\u003c/p\u003e","description":"","filename":"FIG3.png","url":"https://assets-eu.researchsquare.com/files/rs-8590288/v1/66c2653c56b082819d4151b9.png"},{"id":103253010,"identity":"8e1ed242-c7ac-4c3f-90b6-7dee5f06f88f","added_by":"auto","created_at":"2026-02-23 16:17:04","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1314951,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8590288/v1/b2b0b99d-5ec0-4367-bad1-99c04b0c4542.pdf"},{"id":103252972,"identity":"d428fd28-6025-4d81-8da5-2354cf9ebb88","added_by":"auto","created_at":"2026-02-23 16:16:52","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"supplement","size":367120,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryMaterial.docx","url":"https://assets-eu.researchsquare.com/files/rs-8590288/v1/6a22b556141c6b06fc89dbbf.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Overexpression of the BRC repeat 8 of BRCA2 hyperstabilizes RAD51 and alters DNA repair dynamics","fulltext":[{"header":"Introduction","content":"\u003cp\u003eCancer therapies, such as X-ray irradiation and chemotherapy, induce DNA double-stranded breaks (DSBs). DSBs are repaired by two major DNA repair mechanisms, homologous recombination (HR) and non-homologous end-joining (NHEJ)\u0026mdash;both of which maintain genomic DNA integrity. Unlike NHEJ, which is error-prone, HR is a high-fidelity template-dependent mechanism that uses sister chromatids as templates and operates primarily during the S and G2 phases of the cell cycle [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. During HR, the tumor suppressor \u003cem\u003eBRCA2\u003c/em\u003e gene product recruits the recombinase RAD51 to DNA double-strand breaks via eight domains known as BRC repeats (BRC1\u0026ndash;8) [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e, \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. RAD51 forms a single-stranded DNA complex called the nucleofilament, which is essential for initiating strand invasion into homologous sequences [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eAppropriate RAD51 expression is essential for efficient HR repair. Insufficient RAD51 compromises HR efficiency; conversely, RAD51 overexpression can increase homologous recombination efficiency. Precise regulation of RAD51 protein levels occurs at both the transcriptional and post-translational levels [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e] and involves multiple pathways, among which BRCA2 plays a key role in maintaining RAD51 protein levels. RAD51 protein levels are significantly decreased upon BRCA2 loss or downregulation but restored following the rescue of wild-type BRCA2 [\u003cspan additionalcitationids=\"CR6\" citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. We previously reported that expression of individual BRC repeats alters RAD51 protein levels, with BRC1 significantly increasing and BRC2 decreasing RAD51 protein levels [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. Although each BRC repeat is highly evolutionarily conserved, individual repeats share relatively low sequence similarity and exhibit distinct interactions with RAD51 [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. These sequence differences confer distinct structural and biochemical properties to the repeats [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e], potentially influencing how individual BRC repeats regulate RAD51 protein levels. Therefore, we investigated whether specific BRC repeats influence RAD51 protein levels and determined whether these effects occur at the transcriptional or post-translational regulation. Understanding these mechanisms will clarify how specific BRC repeats modulate RAD51 levels and provide insights into their potential impact on HR repair dynamics.\u003c/p\u003e \u003cp\u003eIn this study, we systematically examined the effects of overexpressing each BRC repeat on RAD51 protein levels. Notably, BRC8-overexpressing cells exhibited significantly increased RAD51 protein levels without changes in \u003cem\u003eRAD51\u003c/em\u003e transcript levels. BRC8-expressing cells also showed increased sensitivity to X-ray irradiation and DNA-damaging agents, possibly due to inhibition of ubiquitin-mediated proteasomal degradation of RAD51. These findings provide an experimental foundation for modulating RAD51 protein turnover through BRC8 overexpression by interfering with its ubiquitin-mediated degradation, thus providing new insights into therapeutic strategies targeting the post-translational regulation of RAD51.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003ch2\u003eCell\u0026nbsp;line and\u0026nbsp;antibodies\u003c/h2\u003e\n\u003cp\u003eHeLa cells were obtained from the RIKEN Cell Bank and cultured as previously described [8]. The following antibodies were used for western blotting and immunostaining: Anti-RAD51 (1:4000; 70-001; Bio Academia, Osaka, Japan), anti-BRCA2 (1:250; OP-95; Merck, Darmstadt, Germany), anti-Lamin B1 (1:2000; PM064; MBL, Tokyo, Japan), anti-FLAG (1:1000; M2; Merck), anti-\u0026beta;-actin (1:10000; M177-3, MBL), anti-\u0026alpha;-tubulin (1:4000; M175-3; MBL), anti-cyclin A (1:1000; B8; Santa Cruz Biotechnology, Dallas, TX, USA), and anti-ubiquitin (1:100; P4D1; Santa Cruz Biotechnology) antibodies.\u003c/p\u003e\n\u003ch2\u003eStable cell line generation\u003c/h2\u003e\n\u003cp\u003eHeLa cells stably expressing FLAG-HA nuclear localization signal-fused canine BRCA2 BRC repeats or an empty vector as a control were generated as previously described [8].\u003c/p\u003e\n\u003ch2\u003eProtein extraction and western blotting\u003c/h2\u003e\n\u003cp\u003eProtein extraction and western blot analyses were performed as previously described [8]. Proteins were detected using a C-DiGit Blot Scanner (Li-COR, Lincoln, Nebraska, USA), and band intensities were quantified using Image Studio 6.0 software (Li-COR).\u003c/p\u003e\n\u003ch2\u003eQuantitative reverse transcription-polymerase chain reaction (qRT-PCR)\u003c/h2\u003e\n\u003cp\u003eRNA was extracted using the CellAmp Direct RNA Prep Kit (Takara Bio Inc., Shiga, Japan) following the manufacturer\u0026apos;s instructions. qRT-PCR was performed to measure \u003cem\u003eRAD51\u003c/em\u003e mRNA levels using the following primers targeting RAD51: CTGATGAGTTTGGTGTAGCAG (forward) and GGAAGACAGGGAGAGTCGTAGA (reverse). \u003cem\u003eRPS18\u003c/em\u003e was used as an internal reference for normalization and was run as previously described [10].\u003c/p\u003e\n\u003ch2\u003eCycloheximide (CHX) and MG132 treatments\u003c/h2\u003e\n\u003cp\u003eBRC8-expressing cells or control cells were harvested at 3 and 6 h after treatment with 100 \u0026mu;g/mL CHX (MedChemExpress, Monmouth Junction, NJ, USA) or 10 \u0026mu;M MG132 (MedChemExpress).\u0026nbsp;\u003c/p\u003e\n\u003ch2\u003eCo-immunoprecipitation assay\u003c/h2\u003e\n\u003cp\u003eBRC8-expressing cells\u0026nbsp;or control cells were treated with 10 \u0026mu;M MG132 (MedChemExpress) or dimethyl sulfoxide for 1 h. Cells were lysed using a lysis buffer (20 mM Tris-HCl [pH 8.0], 50 mM KCl, 2 mM MgCl\u003csub\u003e2\u003c/sub\u003e, 0.5% Triton X-100, and 10% glycerol) supplemented with protease inhibitor cocktail (P8340; Merck). The lysates were incubated with the anti-RAD51 antibodies overnight at 4 \u0026deg;C with gentle rotation, followed by incubation with Dynabeads Protein G (Veritas, Santa Clara, CA, USA) for 3 h at 4 \u0026deg;C. The immunoprecipitates were washed three times with wash buffer (20 mM Tris-HCl [pH 8.0], 500 mM KCl, 2 mM MgCl\u003csub\u003e2\u003c/sub\u003e, 0.5% Triton X-100, and 10% glycerol) and eluted with 1\u0026times; lithium dodecyl sulfate buffer (Thermo Fisher Scientific, Waltham, MA, USA) for western blot analysis.\u003c/p\u003e\n\u003ch2\u003eClonogenic survival assay\u003c/h2\u003e\n\u003cp\u003eThe cells were irradiated with MX-80Labo (MediXtec, Chiba, Japan) at doses of 1-5 Gy. Subsequently, 200\u0026ndash;2000 cells/well were seeded in 6-well plates. For mitomycin C (MMC) treatment, 200\u0026ndash;2000 cells/well were seeded in a 6-well plate and treated with 0.25\u0026ndash;4 ng/mL MMC the following day. After 10\u0026ndash;14 days, colony formation was assessed as previously described [11].\u003c/p\u003e\n\u003ch2\u003eHR and NHEJ reporter assays\u003c/h2\u003e\n\u003cp\u003ePlasmids used in\u0026nbsp;the\u0026nbsp;reporter assays included pDRGFP (Addgene plasmid #26475; http://n2t.net/addgene:26475; RRID: Addgene_26475), which was a gift from Maria Jasin\u0026nbsp;[12]. pimEJ5GFP (Addgene plasmid #44026; http://n2t.net/addgene:44026; RRID: Addgene_44026) was a gift from Jeremy Stark\u0026nbsp;[13]. pUC CBA-SpCas9.EF1a-BFP.sgLMNA (Addgene plasmid #98971; http://n2t.net/addgene:98971; RRID: Addgene_98971) and pCAGGS Donor mClover-LMNA (Addgene plasmid #98970; http://n2t.net/addgene:98970) were gifts from Jan Karlseder\u0026nbsp;[14]\u0026nbsp;and were also obtained from Addgene.\u003c/p\u003e\n\u003cp\u003eThe pDRGFP and pimEJ5GFP plasmids were linearized with I-SceI (New England Biolabs, Ipswich, MA, USA) and co-transfected with an mCherry for normalization using the FuGENE HD transfection reagent (Promega Corporation, Madison, WI, USA). The Cas9-based HR assay was performed as previously described [11]. The cells were analyzed using flow cytometry (SH800; Sony, Tokyo, Japan) with at least 20,000 cells per sample.\u003c/p\u003e\n\u003ch2\u003eImmunostaining\u003c/h2\u003e\n\u003cp\u003eImmunostaining for RAD51 and cyclin A was performed as previously described [11]. RAD51 foci were visualized using confocal microscopy (LSM710; Carl Zeiss AG, Jena, Germany) and quantified using CellProfiler software [15].\u0026nbsp;\u003c/p\u003e\n\u003ch2\u003eStatistical analyses\u003c/h2\u003e\n\u003cp\u003eStatistical significance was set at \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05. Student\u0026rsquo;s\u003cem\u003e\u0026nbsp;t\u003c/em\u003e-test was used for two-group comparisons. For multiple-group comparisons, data were analyzed using the Kruskal\u0026ndash;Wallis test, followed by Dunn\u0026rsquo;s multiple-comparison test. Analyses and graphs were generated using GraphPad Software (GraphPad Software, Boston, MA, USA).\u003c/p\u003e"},{"header":"Results","content":"\u003ch2\u003eBRC8 overexpression increases the RAD51 protein levels\u003c/h2\u003e\n\u003cp\u003eWe stably expressed FLAG-HA-tagged canine peptides containing individual BRC repeats (BRC1\u0026ndash;8) to identify specific BRC repeats that affect RAD51 protein levels (Fig. 1a). Although several repeats (BRC1, BRC2, BRC4, and BRC7) moderately affected RAD51 protein levels, only BRC8 significantly increased RAD51 levels (approximately 4.83-fold relative to the control; Fig. 1 b and c). Consistently, transient transfection-mediated BRC8 overexpression increased RAD51 protein levels (Online Resource 1; Supplementary Material Fig. s1).\u003c/p\u003e\n\u003ch2\u003eBRC8 overexpression stabilizes RAD51 by suppressing its ubiquitin-mediated proteasomal degradation\u003c/h2\u003e\n\u003cp\u003eTo determine the mechanism underlying the increase in RAD51 protein levels upon BRC8 expression, we assessed\u0026nbsp;\u003cem\u003eRAD51\u003c/em\u003e mRNA levels using qRT-PCR. No significant differences in\u0026nbsp;\u003cem\u003eRAD51\u003c/em\u003e transcript\u0026nbsp;levels were observed between BRC8-expressing and\u0026nbsp;empty vector-transfected\u0026nbsp;cells (Fig. 2a).\u003c/p\u003e\n\u003cp\u003eNext, we evaluated RAD51 stability using CHX and MG132\u0026nbsp;assays. CHX inhibited protein synthesis, whereas MG132 blocked proteasomal degradation (Fig. 2b). Treatment effectiveness was confirmed using p53, a short-lived protein. p53 levels decreased rapidly after CHX treatment and increased following MG132 treatment. In control cells, blocking protein synthesis with CHX significantly reduced RAD51 protein levels (0.57-fold) within 6 h. In contrast, RAD51 degradation was markedly attenuated in BRC8-expressing cells, with 0.85-fold of the\u0026nbsp;protein remaining\u0026nbsp;(Fig. 2b and c, CHX-chase assay). In control cells, MG132 treatment led to significant accumulation of RAD51 protein (1.66-fold), confirming\u0026nbsp;that RAD51\u0026nbsp;is a substrate for proteasomal degradation. However, MG132 did not significantly affect RAD51 protein levels in BRC8-expressing cells, suggesting that BRC8 inhibited proteasomal degradation of RAD51 (Fig. 2b and c, MG132-chase assay). Similarly,\u0026nbsp;co-treatment with CHX and MG132 increased RAD51 protein levels (1.36-fold) within 6 h in control cells. In contrast, BRC8-expressing cells did not respond to this treatment, further confirming that BRC8 protected RAD51 from proteasomal degradation (Fig. 2b and c; CHX combined\u0026nbsp;with\u0026nbsp;the\u0026nbsp;MG132-chase assay).\u003c/p\u003e\n\u003cp\u003eTo confirm that BRC8 expression stabilizes RAD51 by reducing its ubiquitination, we examined whether this stabilization occurs through inhibition of the ubiquitin\u0026ndash;proteasome pathway. RAD51 immunoprecipitation assays were performed under stringent washing conditions to detect ubiquitin binding to RAD51. Compared with control cells, RAD51 polyubiquitination levels were significantly reduced in BRC8-expressing cells, both in the presence and absence of MG132 treatment. These findings indicate that BRC8 expression protects RAD51 from ubiquitin-mediated degradation (Fig. 2d).\u003c/p\u003e\n\u003ch2\u003eBRC8 overexpression increases the cellular sensitivity to DNA-damaging agents and reduces the DNA repair efficiency\u003c/h2\u003e\n\u003cp\u003eNext, we examined whether BRC8 expression influenced cellular sensitivity to DNA-damaging agents and DNA repair efficiency. Clonogenic survival assays were performed using X-ray\u0026nbsp;irradiation\u0026nbsp;and MMC. MMC induces DNA interstrand cross-links, which primarily require HR for effective repair. BRC8-expressing cells exhibited significantly greater sensitivity to X-ray and MMC treatments than control cells (Fig. 3a).\u003c/p\u003e\n\u003cp\u003eTo evaluate the effects of BRC8 on specific DNA repair pathways, we measured\u0026nbsp;HR and NHEJ efficiencies (Fig. 3b and c). Both DR-GFP and Cas9-mClover HR assays revealed significantly reduced HR efficiency in BRC8-expressing cells (Fig. 3b and c). Moreover, the EJ5-GFP assay demonstrated a significant reduction in NHEJ efficiency in BRC8-expressing cells (Fig. 3d). Typically, these two pathways operate competitively, with one often being suppressed when the other is active [16]. The unexpected simultaneous reduction in the HR and NHEJ efficiencies suggests the involvement of another factor. Because the cell cycle influences the DNA repair pathway (HR or NHEJ), we analyzed whether cell cycle distribution changed in the examined cell types. Notably, BRC8-expressing cells exhibited a lower proportion of cells in the G1 phase and higher proportions in the S and G2/M phases than control cells (Fig. 3e). BRC8-expressing cells also showed higher percentages of cyclin A-positive cells in the S and G2 phases than control cells (Online Resource 1, Supplementary Material Fig. s2).\u003c/p\u003e\n\u003cp\u003eTo further clarify the mechanism underlying decreased HR efficiency, we assessed RAD51 foci formation with and without X-ray irradiation. RAD51 foci are formed in the nucleus in response to DSBs. Under non-irradiated conditions, BRC8-expressing cells exhibited a higher number of RAD51 foci than control cells. After irradiation, the number of RAD51 foci increased significantly in both groups. However, BRC8-expressing cells consistently showed significantly higher RAD51 foci formation than control cells at all post-irradiation time points. Notably, compared with untreated cells, BRC8-expressing cells exhibited significantly increased RAD51 foci at 8, 16, 24, 32, and 40 h, with a peak trend maintained for 40 h. In contrast, control cells showed significant increases relative to their basal levels only at 8, 16, 24, and 32 h, with a peak trend maintained until 16 h (Fig. 3f).\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eIn this study, BRC8 overexpression significantly increased RAD51 protein levels without altering transcript levels and reduced RAD51 polyubiquitination and prolonged RAD51 half-life. BRC8-expressing cells showed increased basal RAD51 foci and more RAD51 foci formation after X-ray irradiation compared to control cells. Previous in vitro studies have demonstrated that BRC8 preferentially binds to RAD51 already loaded onto single-stranded DNA (ssDNA) and enhances and stabilizes the formation of RAD51 nucleoprotein filaments, but does not influence DNA strand exchange activity \u003cem\u003ein vitro\u003c/em\u003e [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. Based on these findings, overexpression of BRC8 in cells may promote stabilization of RAD51 nucleoprotein filaments and their retention at DNA damage sites. When normalized to their respective basal conditions (without treatment), both control and BRC8-expressing cells exhibited a comparable ratio of increase in RAD51 foci after irradiation. However, the foci persisted longer in BRC8-expressing cells, indicating delayed disassembly of RAD51 from DNA damage sites. Although RAD51 protein levels were significantly elevated in BRC8-expressing cells, overall homologous recombination (HR) efficiency was notably reduced. The formation of RAD51 foci generally reflects the recruitment of RAD51 to DNA damage sites and serves as an indicator of an effective HR response. However, successful HR progression requires RAD51 filament formation and timely disassembly. Specifically, the progression of HR into later stages requires the timely removal of RAD51 from DNA damage sites, a process mediated by the E3 ligase RFWD3 [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. Disruption of ubiquitin-mediated removal results in the abnormal persistence of RAD51 foci, impaired loading of downstream repair factors, and decreased HR efficiency. Therefore, we hypothesized that BRC8 overexpression promotes RAD51 recruitment to DNA damage sites, inhibits RAD51 ubiquitination, and leads to excessive stabilization of RAD51 at these sites, thereby interfering with RAD51 removal and impairing HR completion.\u003c/p\u003e \u003cp\u003eFurthermore, we observed that their formation was significantly increased in BRC8-expressing cells even in the absence of exogenous DNA damage. Cell cycle analysis revealed an increased proportion of cells in the S and G2/M phases and a corresponding decrease in the G1 phase. These findings suggest that impaired RAD51 dissociation causes incomplete DNA repair, leading to activation of the S/G2 DNA damage checkpoint [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e] and a consequent delay in cell cycle progression, resulting in the accumulation of cells in the S and G2/M phases. Although HR and NHEJ typically act as competing repair pathways, with increased NHEJ often accompanied by reduced HR [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e], our results revealed an unexpected decrease in both HR and NHEJ efficiencies in BRC8-expressing cells. Because NHEJ functions actively across the cell cycle, whereas HR is primarily restricted to the S and G2 phases, NHEJ serves as the predominant repair pathway in the G1 phase. The markedly reduced G1 cell population may therefore have contributed to the observed reduction in NHEJ repair efficiency, explaining why both pathways were impaired.\u003c/p\u003e \u003cp\u003eAlthough our study focused primarily on BRC8, it should be noted that among the eight BRC repeat peptides expressed, only BRC8 showed extremely high expression levels. Therefore, we cannot rule out the possibility that other BRC repeats similarly influence RAD51 ubiquitination and DNA repair dynamics if expressed at comparable levels. Future studies should investigate the effects of other BRC on RAD51 ubiquitination and DNA repair efficiency.\u003c/p\u003e \u003cp\u003eIn summary, our findings suggest that BRC8 stabilizes RAD51 by inhibiting its ubiquitin-mediated degradation, consequently impairing both HR and NHEJ efficiency and increasing cellular sensitivity to DNA-damaging agents. Our results provide an experimental foundation for using BRC8 overexpression to modulate RAD51 protein turnover by interfering with its ubiquitin-mediated degradation and offer new insights into therapeutic strategies for regulating RAD51 stability mediated by the BRC repeats of BRCA2.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cp\u003eCHX, cycloheximide;\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eDSB, double-strand break;\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eHR, homologous recombination;\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eMMC, mitomycin C;\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eNHEJ, non-homologous end joining;\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eqRT-PCR, quantitative reverse transcription-polymerase chain reaction\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e"},{"header":"Declarations","content":"\u003ch2\u003eCompeting Interests\u003c/h2\u003e\n\u003cp\u003eThe authors declare that they have no competing interests.\u003c/p\u003e\n\u003ch2\u003eConsent for publication\u003c/h2\u003e\n\u003cp\u003eAll authors have read and approved the final manuscript.\u003c/p\u003e\n\u003ch2\u003eEthics approval\u003c/h2\u003e\n\u003cp\u003eThe author has confirmed that no ethical approval is required for this study.\u003c/p\u003e\n\u003ch2\u003eConsent to participate\u003c/h2\u003e\n\u003cp\u003eInformed consent was obtained from all participants included in the study.\u003c/p\u003e\n\u003ch2\u003eConsent to publish\u003c/h2\u003e\n\u003cp\u003eThis study did not contain any identifiable personal data. Therefore, consent for publication of this manuscript was not required.\u003c/p\u003e\n\u003ch2\u003eFunding\u003c/h2\u003e\n\u003cp\u003eThis work was supported by a Grant-in-Aid for Scientific Research (C) (grant number 23K05575) and a Grant-in-Aid for JSPS Fellows (grant number 24KJ1924) from the Japan Society for the Promotion of Science.\u003c/p\u003e\n\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\n\u003cp\u003eConceptualization Z.Z., T.K., M.M., and Y.Y.; Data curation Z.Z., T.K., and Y.Y.; Formal analysis Z.Z. and Y.Y.; Funding acquisition Z.Z. and Y.Y.; Investigation Z.Z., T.K., and Y.Y.; Methodology M.M. and Y.Y.; Project administration Y.Y.; Resources M.M. and Y.Y.; Software Z.Z. and Y.Y.; Supervision M.M., T.K., K.O., and Y.Y.; Validation Z.Z. and Y.Y.; Visualization Z.Z., T.K., and Y.Y.; Writing \u0026ndash; original draft Z.Z. and Y.Y.; Writing \u0026ndash; review and editing M.M., Y.Y., and K.O. .\u003c/p\u003e\n\u003ch2\u003eAcknowledgement\u003c/h2\u003e\n\u003cp\u003eThis work was supported in part by Grant-in-Aid for JSPS Fellows (No. 24KJ1924) and Grants-in-Aid for Young Scientists (B) (No. 23K05575) from the Japan Society for the Promotion of Science. We thank Editage (www.editage.jp (accessed on 10th January 2026)) for English language editing.\u003c/p\u003e\n\u003ch2\u003eData Availability\u003c/h2\u003e\n\u003cp\u003eThe datasets used and analyzed in this study are available from the corresponding author upon reasonable request.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n \u003cli\u003eLi X, Heyer W-D. Homologous recombination in DNA repair and DNA damage tolerance. Cell Res 2008;18:99\u0026ndash;113. https://doi.org/10.1038/cr.2008.1.\u003c/li\u003e\n \u003cli\u003ePrakash R, Zhang Y, Feng W, Jasin M. Homologous Recombination and Human Health: The Roles of BRCA1, BRCA2, and Associated Proteins. Cold Spring Harb Perspect Biol 2015;7:a016600. https://doi.org/10.1101/cshperspect.a016600.\u003c/li\u003e\n \u003cli\u003eCarreira A, Kowalczykowski SC. Two classes of BRC repeats in BRCA2 promote RAD51 nucleoprotein filament function by distinct mechanisms. Proc Natl Acad Sci 2011;108:10448\u0026ndash;53. https://doi.org/10.1073/pnas.1106971108.\u003c/li\u003e\n \u003cli\u003eOrhan E, Velazquez C, Tabet I, Sardet C, Theillet C. Regulation of RAD51 at the Transcriptional and Functional Levels: What Prospects for Cancer Therapy? Cancers 2021;13:2930. https://doi.org/10.3390/cancers13122930.\u003c/li\u003e\n \u003cli\u003eBrown ET, Holt JT. Rad51 overexpression rescues radiation resistance in BRCA2-defective cancer cells. Mol Carcinog 2009;48:105\u0026ndash;9. https://doi.org/10.1002/mc.20463.\u003c/li\u003e\n \u003cli\u003eLee SA, Roques C, Magwood AC, Masson J-Y, Baker MD. Recovery of deficient homologous recombination in Brca2-depleted mouse cells by wild-type Rad51 expression. DNA Repair 2009;8:170\u0026ndash;81. https://doi.org/10.1016/j.dnarep.2008.10.002.\u003c/li\u003e\n \u003cli\u003eTripathi K, Mani C, Clark DW, Palle K. Rad18 is required for functional interactions between FANCD2, BRCA2, and Rad51 to repair DNA topoisomerase 1-poisons induced lesions and promote fork recovery. Oncotarget 2016;7:12537\u0026ndash;53. https://doi.org/10.18632/oncotarget.7247.\u003c/li\u003e\n \u003cli\u003eZhu Z, Kitano T, Morimatsu M, Ochiai K, Ishiguro-Oonuma T, Oosumi K, et al. A Highly Conserved Region in BRCA2 Suppresses the RAD51-Interaction Activity of BRC Repeats. Vet Sci 2023;10:145. https://doi.org/10.3390/vetsci10020145.\u003c/li\u003e\n \u003cli\u003eLindenburg LH, Pantelejevs T, Gielen F, Zuazua-Villar P, Butz M, Rees E, et al. Improved RAD51 binders through motif shuffling based on the modularity of BRC repeats. Proc Natl Acad Sci 2021;118:e2017708118. https://doi.org/10.1073/pnas.2017708118.\u003c/li\u003e\n \u003cli\u003eYoshikawa Y, Morimatsu M, Ochiai K, Ishiguro-Oonuma T, Wada S, Orino K, et al. Reduced canine BRCA2 expression levels in mammary gland tumors. BMC Vet Res 2015;11:159. https://doi.org/10.1186/s12917-015-0483-9.\u003c/li\u003e\n \u003cli\u003eZhu Z, Kitano T, Morimatsu M, Tanaka A, Morioka R, Lin X, et al. BRCA2 C-Terminal RAD51-Binding Domain Confers Resistance to DNA-Damaging Agents. Int J Mol Sci 2022;23:4060. https://doi.org/10.3390/ijms23074060.\u003c/li\u003e\n \u003cli\u003ePierce AJ, Johnson RD, Thompson LH, Jasin M. XRCC3 promotes homology-directed repair of DNA damage in mammalian cells. Genes Dev 1999;13:2633\u0026ndash;8.\u003c/li\u003e\n \u003cli\u003eBennardo N, Cheng A, Huang N, Stark JM. Alternative-NHEJ Is a Mechanistically Distinct Pathway of Mammalian Chromosome Break Repair. PLoS Genet 2008;4:e1000110. https://doi.org/10.1371/journal.pgen.1000110.\u003c/li\u003e\n \u003cli\u003eArnoult N, Correia A, Ma J, Merlo A, Garcia-Gomez S, Maric M, et al. Regulation of DNA repair pathway choice in S and G2 phases by the NHEJ inhibitor CYREN. Nature 2017;549:548\u0026ndash;52. https://doi.org/10.1038/nature24023.\u003c/li\u003e\n \u003cli\u003eStirling DR, Swain-Bowden MJ, Lucas AM, Carpenter AE, Cimini BA, Goodman A. CellProfiler 4: improvements in speed, utility and usability. BMC Bioinformatics 2021;22:433. https://doi.org/10.1186/s12859-021-04344-9.\u003c/li\u003e\n \u003cli\u003eShrivastav M, De Haro LP, Nickoloff JA. Regulation of DNA double-strand break repair pathway choice. Cell Res 2008;18:134\u0026ndash;47. https://doi.org/10.1038/cr.2007.111.\u003c/li\u003e\n \u003cli\u003eChatterjee G, Jimenez-Sainz J, Presti T, Nguyen T, Jensen RB. Distinct binding of BRCA2 BRC repeats to RAD51 generates differential DNA damage sensitivity. Nucleic Acids Res 2016;44:5256--5270. https://doi.org/10.1093/nar/gkw242.\u003c/li\u003e\n \u003cli\u003eInano S, Sato K, Katsuki Y, Kobayashi W, Tanaka H, Nakajima K, et al. RFWD3-Mediated Ubiquitination Promotes Timely Removal of Both RPA and RAD51 from DNA Damage Sites to Facilitate Homologous Recombination. Mol Cell 2017;66:622-634.e8. https://doi.org/10.1016/j.molcel.2017.04.022.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"molecular-biology-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"mole","sideBox":"Learn more about [Molecular Biology Reports](https://www.springer.com/journal/11033)","snPcode":"11033","submissionUrl":"https://submission.nature.com/new-submission/11033/3","title":"Molecular Biology Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"BRCA2, RAD51, Homologous Recombination, Ubiquitination, DNA Damage, Genome Stability","lastPublishedDoi":"10.21203/rs.3.rs-8590288/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-8590288/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBackground\u003c/h2\u003e \u003cp\u003eRAD51 plays an essential role in maintaining genomic stability via homologous recombination (HR). Aberrant RAD51 expression compromises genomic integrity and influences cellular responses to DNA-damaging agents. RAD51 expression is tightly regulated in normal cells, and its increased expression is associated with therapeutic resistance and poor prognosis in various cancers. BRCA2, a tumor suppressor gene product, promotes HR by directly interacting with RAD51 through eight evolutionarily conserved BRC repeats (BRC1\u0026ndash;8). Individual BRC repeats in BRCA2 share a relatively low sequence similarity and possess distinct biochemical properties. We previously reported that the expression of certain BRC repeats alters RAD51 protein levels, suggesting that individual BRC repeats distinctly affect RAD51 expression.\u003c/p\u003e\u003ch2\u003eMethods and Results\u003c/h2\u003e \u003cp\u003eWe aimed to determine the specific BRC repeat regions that affect RAD51 protein levels. Notably, BRC8 expression significantly elevated protein levels and foci formation, possibly due to the inhibition of ubiquitin-mediated RAD51 degradation. Paradoxically, despite increased RAD51 foci formation, BRC8 expression significantly reduced HR repair efficiency and sensitivity to DNA-damaging agents.\u003c/p\u003e\u003ch2\u003eConclusion\u003c/h2\u003e \u003cp\u003eOur findings suggest that BRC8 overexpression stabilizes RAD51 by inhibiting ubiquitin-dependent degradation of RAD51, leading to increased persistence in RAD51 foci, indicating impaired timely removal of RAD51 from DNA damage sites and reduced HR efficiency. Additionally, altered cell cycle distribution may contribute to reduced non-homologous end-joining (NHEJ) efficiency, thereby further enhancing cellular sensitivity to DNA-damaging agents. These findings provide a basis for exploring the potential of BRC8-based peptides as tools for modulating RAD51 stability and sensitizing cells to DNA damage.\u003c/p\u003e","manuscriptTitle":"Overexpression of the BRC repeat 8 of BRCA2 hyperstabilizes RAD51 and alters DNA repair dynamics","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2026-02-23 16:14:42","doi":"10.21203/rs.3.rs-8590288/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2026-01-16T18:24:24+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2026-01-15T14:07:43+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2026-01-15T14:05:22+00:00","index":"","fulltext":""},{"type":"submitted","content":"Molecular Biology Reports","date":"2026-01-13T09:39:07+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"molecular-biology-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"mole","sideBox":"Learn more about [Molecular Biology Reports](https://www.springer.com/journal/11033)","snPcode":"11033","submissionUrl":"https://submission.nature.com/new-submission/11033/3","title":"Molecular Biology Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"ff918904-4f59-4f8d-96ef-ac2bee638a8c","owner":[],"postedDate":"February 23rd, 2026","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"in-revision","subjectAreas":[],"tags":[],"updatedAt":"2026-03-02T15:39:10+00:00","versionOfRecord":[],"versionCreatedAt":"2026-02-23 16:14:42","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-8590288","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-8590288","identity":"rs-8590288","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}