Regulatory Effects of Triptolide on BLyS Expression and Signaling in U937 Cells | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Regulatory Effects of Triptolide on BLyS Expression and Signaling in U937 Cells Chuansong Zhang This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7128989/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Objective: This study aimed to investigate the regulatory effects of Triptolide (TL), a bioactive compound derived from Tripterygium wilfordii , on the expression and signaling of B lymphocyte stimulator (BLyS/BAFF) in the human monocytic cell line U937. Methods: U937 cells were treated with varying concentrations of TL, BLyS, or both. Cell proliferation was assessed using MTT assays, while apoptosis was evaluated via Annexin V/PI flow cytometry and caspase-3 activity analysis. Western blotting and ELISA were performed to measure BLyS protein expression, and quantitative PCR was used to analyze the mRNA levels of BLyS, APRIL, and their receptors (TACI, BCMA, and BAFF-R). Results: BLyS alone promoted U937 cell proliferation and inhibited apoptosis, whereas TL inhibited cell proliferation and induced apoptosis in a dose-dependent manner. When combined with TL, BLyS reversed its anti-apoptotic effect and promoted apoptosis. TL significantly downregulated total BLyS protein levels and membrane-bound BLyS expression, while enhancing the secretion of soluble BLyS at lower concentrations. Additionally, TL treatment downregulated BLyS and TACI mRNA expression while markedly upregulating BCMA and BAFF-R, suggesting altered receptor signaling dynamics. Conclusion: Triptolide disrupts BLyS-mediated signaling by modulating the expression of BLyS and its receptors, leading to enhanced apoptosis in U937 cells. These findings provide new insight into the immunomodulatory mechanism of TL and support its potential use in treating autoimmune diseases and B-cell-related malignancies. Immunology General Cell Biology & Physiology Triptolide BLyS BAFF APRIL U937 cells apoptosis B-cell signaling autoimmune diseases Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Introduction B lymphocyte stimulator (BLyS), also known as BAFF, is a key cytokine involved in B-cell maturation and survival. Through its receptors—BAFF-R, TACI, and BCMA—it activates NF-κB and PI3K/Akt pathways, promoting cell viability and immunoglobulin production [ 1 , 2 ]. Elevated BLyS levels have been associated with autoimmune diseases and B-cell malignancies [ 3 – 6 ]. Therapeutic targeting of BLyS/APRIL has led to the development of drugs like belimumab and dual antagonists such as telitacicept and povetacicept [ 3 , 7 , 8 ]. Triptolide, a diterpenoid triepoxide derived from Tripterygium wilfordii , exhibits broad anti-inflammatory and anticancer properties. It has been shown to induce apoptosis and inhibit tumor growth in various cancer models including gastric, pancreatic, and breast cancers [ 9 – 13 ]. Triptolide interferes with signaling pathways such as NF-κB, Akt/mTOR, and p53, and modulates immune responses including suppression of B-cell function and inflammatory cytokines [ 14 – 16 ]. However, its role in BLyS regulation and apoptosis via BAFF-related signaling remains underexplored. This study aims to evaluate the impact of triptolide on BLyS expression and its apoptotic effects in U937 cells, contributing to the understanding of its immunoregulatory and antitumor mechanisms. Materials and Methods 1. Reagents and Cell Culture Triptolide (TL) was purchased from Sigma-Aldrich (St. Louis, MO, USA) and dissolved in DMSO to prepare a stock solution. Recombinant human BLyS was obtained from R&D Systems (USA). The human monocytic cell line U937 was obtained from the Cell Bank of the Chinese Academy of Sciences (Shanghai, China). Cells were cultured in RPMI-1640 medium supplemented with 10% fetal bovine serum (FBS), 100 U/mL penicillin, and 100 µg/mL streptomycin at 37°C in a humidified atmosphere containing 5% CO₂. 2. Cell Proliferation Assay Cell viability was assessed using the MTT assay. U937 cells were seeded in 96-well plates and treated with different concentrations of TL, BLyS, or their combination for 24 or 48 hours. After treatment, 20 µL of MTT solution (5 mg/mL) was added to each well and incubated for 4 hours. The formazan crystals were dissolved in 150 µL of DMSO, and absorbance was measured at 570 nm using a microplate reader. 3. Apoptosis Assay Apoptotic cells were detected using Annexin V-FITC/PI staining followed by flow cytometry. U937 cells were treated as described above, harvested, and resuspended in binding buffer. Annexin V-FITC and PI were added according to the manufacturer’s instructions (BD Biosciences), and samples were analyzed by flow cytometry within 1 hour. 4. Caspase-3 Activity Assay Caspase-3 activity was measured using a commercial colorimetric assay kit (Beyotime, China) according to the manufacturer’s protocol. After treatment, cell lysates were incubated with a caspase-3 substrate (Ac-DEVD-pNA), and absorbance was measured at 405 nm. 5. ELISA for Soluble BlyS The concentration of soluble BLyS in the culture supernatant was determined using a human BLyS ELISA kit (R&D Systems, USA). Samples and standards were processed according to the kit protocol, and absorbance was read at 450 nm. 6. Flow Cytometry for Membrane BLyS Expression Membrane-bound BLyS expression on U937 cells was analyzed by flow cytometry. Cells were stained with anti-BLyS-PE monoclonal antibody or isotype control (BD Biosciences), incubated for 30 minutes at 4°C, washed, and analyzed using a FACScan flow cytometer. 7. Western Blot Analysis Total protein was extracted from cells using RIPA lysis buffer containing protease inhibitors. Proteins were separated by SDS-PAGE, transferred onto PVDF membranes, and blocked with 5% non-fat milk. Membranes were incubated with primary antibodies against BLyS and β-actin (loading control), followed by HRP-conjugated secondary antibodies. Detection was performed using an ECL kit (Thermo Fisher Scientific). 8. Real-Time Quantitative PCR (qPCR) Total RNA was extracted using TRIzol reagent (Invitrogen, USA), and cDNA was synthesized using a reverse transcription kit (Takara, Japan). qPCR was performed using SYBR Green Master Mix on an ABI 7500 system. The relative expression levels of BLyS, APRIL, TACI, BCMA, and BAFF-R mRNAs were calculated using the 2^−ΔΔCt method, with GAPDH as the internal control. Primer sequences are listed in Table 1 . The specific primer sequences used for qPCR are listed in Table 1 . Table 1 Primer sequences used for qPCR analysis. This table lists the forward and reverse primer sequences for human BLyS, APRIL, TACI, BCMA, BAFF-R, and GAPDH genes used in real-time PCR experiments. Gene, primer Sequence (5′–3′) Length (bp) BLyS forward BLyS reverse AAGACCTACGCCATGGGACATC TCTTGGTATTGCAAGTTGGAGTTCA 186 TACI forward TACI reverse GGTACCAAGGATTGGAGCACAGA TGTAGACCAGGGCCACCTGA 90 BCMA forward BCMA reverse CATGCTTGCATACCTTGTCAACTTC GCTCAGTCCCAAACAGGTCCA 135 BAFF-R forward BAFF-R reverse CTGGTCCTGGTGGGTCTG TCTTGGTGGTCACCAGTTCA 256 APRIL forward APRIL reverse AAGGGTATCCCTGGCAGAGTC GCGTTAATGGGAACCAGGTG 148 GAPDH forward GAPDH reverse GCACCGTCAAGGCTGAGAAC TGGTGAAGACGCCAGTGGA 138 9. Statistical Analysis All data are expressed as mean ± standard deviation (SD). Statistical comparisons were performed using one-way ANOVA followed by Tukey’s post hoc test. A p-value < 0.05 was considered statistically significant. GraphPad Prism 8.0 was used for all analyses. Results 1. TL and BLyS Influence U937 Cell Viability As shown in Fig. 1 , BLyS at 2 µg/mL significantly promoted U937 cell proliferation, while the polyclonal anti-BLyS antibody at 0.5 µg/mL inhibited cell viability, confirming the growth-promoting role of BLyS. Triptolide (TL) inhibited cell proliferation in a dose-dependent manner (10, 20, 30, 40 ng/mL). Co-treatment with TL (30 ng/mL) and BLyS (0.02 or 2 µg/mL) reversed the proliferative effect of BLyS and enhanced TL’s antiproliferative activity, indicating a dominant inhibitory role of TL over BLyS signaling (Fig. 1 ). 2. TL Enhances Apoptosis in the Presence or Absence of BLyS Annexin V/PI flow cytometry (Fig. 2 ) demonstrated that BLyS reduced the apoptosis rate of U937 cells from 13.84–12.40%, whereas TL increased apoptosis to 15.69%. When BLyS (0.02 µg/mL or 2 µg/mL) was combined with TL (30 ng/mL), apoptosis was further increased to 16.15% and 18.35%, respectively. This suggests that although BLyS alone is anti-apoptotic, it paradoxically enhances apoptosis when combined with TL, possibly due to altered sensitivity to apoptosis triggers. 3. Caspase-3 Activity Confirms Apoptotic Response As shown in Fig. 3 and Table 1 , TL treatment significantly increased caspase-3 activity, while BLyS alone decreased it. Interestingly, co-treatment with BLyS and TL did not significantly increase caspase-3 activity beyond TL alone, implying that BLyS might sensitize cells to TL-induced apoptosis through a caspase-independent pathway. Table 1 Caspase-3 activity (OD₄₀₀) in U937 cell Group Control BLyS TL BLyS + TL OD400 0.25 ± 0.005 0.18 ± 0.003* 0.30 ± 0.006* 0.33 ± 0.005* *U937 cells were treated with 20 ng/mL TL and 2 µg/mL BLyS. Values are mean ± SE from three independent experiments. *p < 0.05 vs. control. 4. TL Alters BLyS Protein Expression Patterns Western blot (Fig. 4 A) showed that TL treatment at concentrations ≥ 40 ng/mL significantly reduced the expression of total cellular BLyS protein in U937 cells. In contrast, ELISA data (Fig. 4 B) revealed that low concentrations of TL (5–20 ng/mL) enhanced the secretion of soluble BLyS, whereas higher concentrations (≥ 40 ng/mL) suppressed its release. These results indicate a dose-dependent modulation of BLyS expression by TL, potentially shifting the balance from membrane-bound to soluble forms of BLyS, which may differentially influence downstream signaling and cellular responses.) confirmed a decrease in membrane-bound BLyS expression. These findings suggest that TL reduces functionally active forms of BLyS, particularly its membrane-bound variant, which may be more biologically active in promoting survival. 5. TL Regulates mRNA Expression of BLyS, APRIL, and Receptors qRT-PCR analysis (Fig. 5 ) revealed that TL significantly downregulated BLyS and APRIL mRNA expression in U937 cells. Among the receptors, TACI expression decreased while BR3 (BAFF-R) and BCMA increased, potentially shifting the downstream signaling environment toward an apoptotic phenotype. Baseline mRNA expression of BLyS, BR3, TACI, BCMA, and APRIL in untreated cells was confirmed by 2% agarose gel electrophoresis, showing bands of expected sizes: BLyS (186 bp), BR3 (256 bp), TACI (90 bp), BCMA (135 bp), and APRIL (148 bp). Discussion Triptolide inhibited U937 cell proliferation and promoted apoptosis, even in the presence of exogenous BLyS. This suppression aligns with prior findings in gastric, pancreatic, prostate, and glioma models, where TL modulates mitochondrial dysfunction, oxidative stress, and caspase activation [ 9 – 13 , 17 , 18 ]. BLyS expression, both membrane-bound and secreted, was downregulated by triptolide, consistent with previous work showing triptolide can suppress BAFF production in monocytes [ 19 ]. Additionally, TL altered expression of BAFF receptors, decreasing TACI while increasing BAFF-R and BCMA. Such modulation could disrupt survival signaling and sensitize cells to apoptotic triggers [ 3 , 4 , 6 ]. The immunomodulatory effect of TL may also stem from inhibition of the NF-κB pathway and inflammatory cytokines [ 14 – 16 ], resembling the mechanism of action of dual BAFF/APRIL inhibitors such as telitacicept and povetacicept [ 3 , 7 , 8 ]. Triptolide’s ability to suppress PD-L1 and reshape immune cell profiles further supports its systemic immune regulatory role [ 10 , 11 , 12 ]. Multi-omics studies emphasize the complexity of RNA and protein interactions in cancer and immune signaling [ 20 , 21 ]. Triptolide’s impact may extend to these layers, influencing ceRNA and isomiR-mediated pathways that govern immune escape and tumor progression. Conclusion Triptolide effectively inhibits BLyS-induced proliferation and promotes apoptosis in U937 cells by downregulating BLyS and modulating the expression of its receptors. These findings reveal a potential mechanism by which TL exerts its immunosuppressive and anti-tumor effects and support further exploration of TL as a modulator of B-cell signaling in autoimmune diseases and hematologic malignancies. References Shi X, Xue L (2021) Telitacicept as a BLyS/APRIL dual inhibitor for autoimmune diseases: evidence and perspectives. Front Immunol 12:754218. 10.3389/fimmu.2021.754218 Evans L, Lewis M, Kurata H et al (2023) Povetacicept, an enhanced dual APRIL/BAFF antagonist, that potently reduces immunoglobulins and antibody-secreting cells. Front Immunol 14:1111159. 10.3389/fimmu.2023.1111159 Davies R, Peng D, Strand V et al (2024) A first-in-human randomized study of the safety, tolerability, pharmacokinetics, and pharmacodynamics of Povetacicept, a dual APRIL/BAFF antagonist, in healthy volunteers. Arthritis Rheumatol. 10.1002/art.42876 Ullah TR, Mackay F (2023) The BAFF/APRIL system in cancer. Front Immunol 14:1187298. 10.3389/fimmu.2023.1187298 Yang Y, Zhang S, Guo L (2022) Characterization of cell cycle-related competing endogenous RNAs using robust rank aggregation as prognostic biomarker in lung adenocarcinoma. Front Oncol 12:807367. 10.3389/fonc.2022.807367 Guo L, Dou Y, Yang Y et al (2021) Protein profiling reveals potential isomiR-associated cross-talks among RNAs in cholangiocarcinoma. Comput Struct Biotechnol J 19:5722–5734. 10.1016/j.csbj.2021.10.014 Chen P, Zhong X, Song Y et al (2024) Triptolide induces apoptosis and cytoprotective autophagy by ROS accumulation via directly targeting peroxiredoxin 2 in gastric cancer cells. Cancer Lett 216622. 10.1016/j.canlet.2024.216622 Ren T, Tang YJ, Wang M et al (2020) Triptolide induces apoptosis through the calcium/calmodulindependent protein kinase kinaseβ/AMPactivated protein kinase signaling pathway in nonsmall cell lung cancer cells. Oncol Rep 44(5):2288–2296. 10.3892/or.2020.7763 Qin G, Li P, Xue Z (2018) Triptolide induces protective autophagy and apoptosis in human cervical cancer cells by downregulating Akt/mTOR activation. Oncol Lett 16(3):3929–3934. 10.3892/ol.2018.9074 Wu PP, Liu KC, Huang WW et al (2011) Triptolide induces apoptosis in human adrenal cancer NCI-H295 cells through a mitochondrial-dependent pathway. Oncol Rep 25(2):551–557. 10.3892/or.2010.1080 Wan CK, Wang C, Cheung HY et al (2006) Triptolide induces Bcl-2 cleavage and mitochondria-dependent apoptosis in T cells. Int Immunol 18(3):365–375. 10.1093/intimm/dxh380 Huang J, Zhang L, Ma T et al (2012) Triptolide inhibits MDM2 and induces apoptosis in acute lymphoblastic leukemia cells through p53 activation. Leuk Res 36(10):1304–1310. 10.1016/j.leukres.2012.06.004 Sun Y, Xiao Y, Xu J et al (2017) Triptolide inhibits viability and induces apoptosis of colorectal cancer cells via inhibiting Wnt/β-catenin signaling. Exp Ther Med 14(6):6093–6099. 10.3892/etm.2017.5371 Gao Y, Xu Z, Chen L et al (2016) Triptolide induces apoptosis in pancreatic cancer cells via the p53 pathway. Mol Med Rep 13(4):2929–2935. 10.3892/mmr.2016.4897 Lin S, Li W, Sun L et al (2017) Triptolide suppresses proliferation and induces apoptosis of prostate cancer cells via targeting HSP70. Oncol Rep 38(5):2882–2890. 10.3892/or.2017.5945 Liu J, Wu Q, Feng Y et al (2005) Triptolide suppresses CD80 and CD86 expressions and IL-12 production in THP-1 cells. Acta Pharmacol Sin 26:223–227. 10.1111/j.1745-7254.2005.00035.x Deng J, Liu Y, Lee H et al (2019) Triptolide inhibits the NF-κB pathway and NLRP3 inflammasome activation in lupus-prone mice. Arthritis Res Ther 21(1):31. 10.1186/s13075-019-1827-z Wang H, Yang H, Zhang X, Zhou X (2024) Triptolide promotes differentiation of human monocytes into immunosuppressive MDSCs. Cell Immunol 401–402:104836. 10.1016/j.cellimm.2024.104836 Li X, Guo B, Shen S et al (2020) BLyS inhibition promotes regulatory B cell induction and suppresses lupus. Cell Mol Immunol 17(12):1234–1246. 10.1038/s41423-019-0295-y Mackay F, Schneider P, Rennert P et al (2003) BAFF AND APRIL: a tutorial on B cell survival. Annu Rev Immunol 21:231–264. 10.1146/annurev.immunol.21.120601.141152 Morel J, Mohan C (2005) BAFF and autoimmunity: more than B cells. J Clin Invest 115(6):1395–1397. 10.1172/JCI25207 Additional Declarations The authors declare no competing interests. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7128989","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":485666368,"identity":"a2309b12-186e-45cf-9fce-1ad6cb46a86f","order_by":0,"name":"Chuansong Zhang","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA2UlEQVRIiWNgGAWjYDACCRiDmbHxAYMBSVrYm5sNSNTCc7xNAp9COOCf3WP4ueCPTZ58RGJb5Y+CO/IM7IePbsBryZ0zxtIz29KKDW8ktt3mMXhm2MCTlnYDnxYDiRwDad6Gw4kbZwC1MBgcZmyQ4DEjpMX4N88fiJbCHwaH7YnRYibNw3Y4cT7PwTYGHoPDiQS1SNxIK7PmbUtL3MDe2CwN1JLcRsgv/DOSN9/m+WOTOL+Z/eHHH38O2/azHz6GVwvChQegDDailIOAfAPRSkfBKBgFo2CkAQBRDkurh+45rQAAAABJRU5ErkJggg==","orcid":"","institution":"","correspondingAuthor":true,"prefix":"","firstName":"Chuansong","middleName":"","lastName":"Zhang","suffix":""}],"badges":[],"createdAt":"2025-07-15 09:41:40","currentVersionCode":1,"declarations":{"humanSubjects":false,"vertebrateSubjects":false,"conflictsOfInterestStatement":false,"humanSubjectEthicalGuidelines":false,"humanSubjectConsent":false,"humanSubjectClinicalTrial":false,"humanSubjectCaseReport":false,"vertebrateSubjectEthicalGuidelines":false},"doi":"10.21203/rs.3.rs-7128989/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7128989/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":86904408,"identity":"d48e4fb8-039a-4df4-875a-3ac5deec9b2d","added_by":"auto","created_at":"2025-07-17 03:20:55","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":7100,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of Triptolide (TL) and BLyS on the proliferation of U937 cells. MTT assays after 24 h and 48 h treatment. * indicates p \u0026lt; 0.05 compared to control; # indicates p \u0026lt; 0.05 compared to BLyS group.\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-7128989/v1/8fad7ca62e5dfc1ad4bc5d4e.png"},{"id":86904411,"identity":"5077f1ed-3093-40db-94d7-a2b9bdf2f8c3","added_by":"auto","created_at":"2025-07-17 03:20:55","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":39294,"visible":true,"origin":"","legend":"\u003cp\u003eApoptotic rate of U937 cells assessed by flow cytometry after Annexin V/PI staining. TL significantly increased apoptosis even in the presence of BLyS. *p \u0026lt; 0.05.\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-7128989/v1/33ea0f3f3ef3d62db7d3013b.png"},{"id":86904969,"identity":"46b90454-da3e-4e1d-b397-bba8f59cbc7b","added_by":"auto","created_at":"2025-07-17 03:28:56","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":5713,"visible":true,"origin":"","legend":"\u003cp\u003eCaspase-3 activity in U937 cells treated with TL and/or BLyS. TL activated caspase-3 in a dose-dependent manner. *p \u0026lt; 0.05.\u003c/p\u003e","description":"","filename":"placeholderimage.png","url":"https://assets-eu.researchsquare.com/files/rs-7128989/v1/25a981f4f95b28fbb38d4873.png"},{"id":86904973,"identity":"1a169233-8915-494b-b6c4-fceb023f3ab6","added_by":"auto","created_at":"2025-07-17 03:28:56","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":22784,"visible":true,"origin":"","legend":"\u003cp\u003e(A) Western blot of BLyS protein in U937 cells. (B) Soluble BLyS levels by ELISA.\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-7128989/v1/4cce146d54c5f2499b1522c6.png"},{"id":86904414,"identity":"17e25279-3c32-419a-9e05-d56d5d13ca54","added_by":"auto","created_at":"2025-07-17 03:20:56","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":67627,"visible":true,"origin":"","legend":"\u003cp\u003eRelative mRNA expression of BLyS, APRIL, and receptors (TACI, BAFF-R, BCMA) in U937 cells by qRT-PCR. M is DNA marker; Lanes 1 to 5 are BLyS: 186bp, BR3: 256bp, TACI: 90bp, BCMA: 135bp and APRIL: 148bp.\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-7128989/v1/413150ef523e676e243831c0.png"},{"id":86905287,"identity":"8690393a-391d-48cd-a0e6-7b086c0b683f","added_by":"auto","created_at":"2025-07-17 03:36:56","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":930217,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7128989/v1/67d64d93-a8f3-4d75-b11e-ed7b26d19d23.pdf"}],"financialInterests":"The authors declare no competing interests.","formattedTitle":"\u003cp\u003e\u003cstrong\u003eRegulatory Effects of Triptolide on BLyS Expression and Signaling in U937 Cells\u003c/strong\u003e\u003c/p\u003e","fulltext":[{"header":"Introduction","content":"\u003cp\u003eB lymphocyte stimulator (BLyS), also known as BAFF, is a key cytokine involved in B-cell maturation and survival. Through its receptors\u0026mdash;BAFF-R, TACI, and BCMA\u0026mdash;it activates NF-κB and PI3K/Akt pathways, promoting cell viability and immunoglobulin production [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. Elevated BLyS levels have been associated with autoimmune diseases and B-cell malignancies [\u003cspan additionalcitationids=\"CR4 CR5\" citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. Therapeutic targeting of BLyS/APRIL has led to the development of drugs like belimumab and dual antagonists such as telitacicept and povetacicept [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eTriptolide, a diterpenoid triepoxide derived from \u003cem\u003eTripterygium wilfordii\u003c/em\u003e, exhibits broad anti-inflammatory and anticancer properties. It has been shown to induce apoptosis and inhibit tumor growth in various cancer models including gastric, pancreatic, and breast cancers [\u003cspan additionalcitationids=\"CR10 CR11 CR12\" citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. Triptolide interferes with signaling pathways such as NF-κB, Akt/mTOR, and p53, and modulates immune responses including suppression of B-cell function and inflammatory cytokines [\u003cspan additionalcitationids=\"CR15\" citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. However, its role in BLyS regulation and apoptosis via BAFF-related signaling remains underexplored.\u003c/p\u003e\u003cp\u003eThis study aims to evaluate the impact of triptolide on BLyS expression and its apoptotic effects in U937 cells, contributing to the understanding of its immunoregulatory and antitumor mechanisms.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\n\u003ch3\u003e1. Reagents and Cell Culture\u003c/h3\u003e\n\u003cp\u003eTriptolide (TL) was purchased from Sigma-Aldrich (St. Louis, MO, USA) and dissolved in DMSO to prepare a stock solution. Recombinant human BLyS was obtained from R\u0026amp;D Systems (USA). The human monocytic cell line U937 was obtained from the Cell Bank of the Chinese Academy of Sciences (Shanghai, China). Cells were cultured in RPMI-1640 medium supplemented with 10% fetal bovine serum (FBS), 100 U/mL penicillin, and 100 \u0026micro;g/mL streptomycin at 37\u0026deg;C in a humidified atmosphere containing 5% CO₂.\u003c/p\u003e\n\u003ch3\u003e2. Cell Proliferation Assay\u003c/h3\u003e\n\u003cp\u003eCell viability was assessed using the MTT assay. U937 cells were seeded in 96-well plates and treated with different concentrations of TL, BLyS, or their combination for 24 or 48 hours. After treatment, 20 \u0026micro;L of MTT solution (5 mg/mL) was added to each well and incubated for 4 hours. The formazan crystals were dissolved in 150 \u0026micro;L of DMSO, and absorbance was measured at 570 nm using a microplate reader.\u003c/p\u003e\n\u003ch3\u003e3. Apoptosis Assay\u003c/h3\u003e\n\u003cp\u003eApoptotic cells were detected using Annexin V-FITC/PI staining followed by flow cytometry. U937 cells were treated as described above, harvested, and resuspended in binding buffer. Annexin V-FITC and PI were added according to the manufacturer\u0026rsquo;s instructions (BD Biosciences), and samples were analyzed by flow cytometry within 1 hour.\u003c/p\u003e\n\u003ch3\u003e4. Caspase-3 Activity Assay\u003c/h3\u003e\n\u003cp\u003eCaspase-3 activity was measured using a commercial colorimetric assay kit (Beyotime, China) according to the manufacturer\u0026rsquo;s protocol. After treatment, cell lysates were incubated with a caspase-3 substrate (Ac-DEVD-pNA), and absorbance was measured at 405 nm.\u003c/p\u003e\n\u003ch3\u003e5. ELISA for Soluble BlyS\u003c/h3\u003e\n\u003cp\u003eThe concentration of soluble BLyS in the culture supernatant was determined using a human BLyS ELISA kit (R\u0026amp;D Systems, USA). Samples and standards were processed according to the kit protocol, and absorbance was read at 450 nm.\u003c/p\u003e\n\u003ch3\u003e6. Flow Cytometry for Membrane BLyS Expression\u003c/h3\u003e\n\u003cp\u003eMembrane-bound BLyS expression on U937 cells was analyzed by flow cytometry. Cells were stained with anti-BLyS-PE monoclonal antibody or isotype control (BD Biosciences), incubated for 30 minutes at 4\u0026deg;C, washed, and analyzed using a FACScan flow cytometer.\u003c/p\u003e\n\u003ch3\u003e7. Western Blot Analysis\u003c/h3\u003e\n\u003cp\u003eTotal protein was extracted from cells using RIPA lysis buffer containing protease inhibitors. Proteins were separated by SDS-PAGE, transferred onto PVDF membranes, and blocked with 5% non-fat milk. Membranes were incubated with primary antibodies against BLyS and β-actin (loading control), followed by HRP-conjugated secondary antibodies. Detection was performed using an ECL kit (Thermo Fisher Scientific).\u003c/p\u003e\n\u003ch3\u003e8. Real-Time Quantitative PCR (qPCR)\u003c/h3\u003e\n\u003cp\u003eTotal RNA was extracted using TRIzol reagent (Invitrogen, USA), and cDNA was synthesized using a reverse transcription kit (Takara, Japan). qPCR was performed using SYBR Green Master Mix on an ABI 7500 system. The relative expression levels of BLyS, APRIL, TACI, BCMA, and BAFF-R mRNAs were calculated using the 2^\u0026minus;ΔΔCt method, with GAPDH as the internal control. Primer sequences are listed in Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e\u003cp\u003eThe specific primer sequences used for qPCR are listed in Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003e\u003cb\u003ePrimer sequences used for qPCR analysis.\u003c/b\u003e This table lists the forward and reverse primer sequences for human BLyS, APRIL, TACI, BCMA, BAFF-R, and GAPDH genes used in real-time PCR experiments.\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"3\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eGene, primer\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eSequence (5\u0026prime;\u0026ndash;3\u0026prime;)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eLength (bp)\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eBLyS forward\u003c/p\u003e\u003cp\u003eBLyS reverse\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eAAGACCTACGCCATGGGACATC TCTTGGTATTGCAAGTTGGAGTTCA\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003e186\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eTACI forward\u003c/p\u003e\u003cp\u003eTACI reverse\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGGTACCAAGGATTGGAGCACAGA\u003c/p\u003e\u003cp\u003eTGTAGACCAGGGCCACCTGA\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003e90\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003eBCMA forward\u003c/b\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eBCMA reverse\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cb\u003eCATGCTTGCATACCTTGTCAACTTC\u003c/b\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eGCTCAGTCCCAAACAGGTCCA\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e\u003cb\u003e135\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003eBAFF-R forward\u003c/b\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eBAFF-R reverse\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cb\u003eCTGGTCCTGGTGGGTCTG\u003c/b\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eTCTTGGTGGTCACCAGTTCA\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e\u003cb\u003e256\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003eAPRIL forward\u003c/b\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eAPRIL reverse\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cb\u003eAAGGGTATCCCTGGCAGAGTC\u003c/b\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eGCGTTAATGGGAACCAGGTG\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e\u003cb\u003e148\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003eGAPDH forward\u003c/b\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eGAPDH reverse\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cb\u003eGCACCGTCAAGGCTGAGAAC\u003c/b\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eTGGTGAAGACGCCAGTGGA\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e\u003cb\u003e138\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\n\u003ch3\u003e9. Statistical Analysis\u003c/h3\u003e\n\u003cp\u003eAll data are expressed as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation (SD). Statistical comparisons were performed using one-way ANOVA followed by Tukey\u0026rsquo;s post hoc test. A p-value\u0026thinsp;\u0026lt;\u0026thinsp;0.05 was considered statistically significant. GraphPad Prism 8.0 was used for all analyses.\u003c/p\u003e"},{"header":"Results","content":"\u003ch3\u003e1. TL and BLyS Influence U937 Cell Viability\u003c/h3\u003e\n\u003cp\u003eAs shown in Fig. \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e, BLyS at 2 \u0026micro;g/mL significantly promoted U937 cell proliferation, while the polyclonal anti-BLyS antibody at 0.5 \u0026micro;g/mL inhibited cell viability, confirming the growth-promoting role of BLyS. Triptolide (TL) inhibited cell proliferation in a dose-dependent manner (10, 20, 30, 40 ng/mL). Co-treatment with TL (30 ng/mL) and BLyS (0.02 or 2 \u0026micro;g/mL) reversed the proliferative effect of BLyS and enhanced TL\u0026rsquo;s antiproliferative activity, indicating a dominant inhibitory role of TL over BLyS signaling (Fig. \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e).\u003c/p\u003e\n\u003ch3\u003e2. TL Enhances Apoptosis in the Presence or Absence of BLyS\u003c/h3\u003e\n\u003cp\u003eAnnexin V/PI flow cytometry (Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e) demonstrated that BLyS reduced the apoptosis rate of U937 cells from 13.84\u0026ndash;12.40%, whereas TL increased apoptosis to 15.69%. When BLyS (0.02 \u0026micro;g/mL or 2 \u0026micro;g/mL) was combined with TL (30 ng/mL), apoptosis was further increased to 16.15% and 18.35%, respectively. This suggests that although BLyS alone is anti-apoptotic, it paradoxically enhances apoptosis when combined with TL, possibly due to altered sensitivity to apoptosis triggers.\u003c/p\u003e\n\u003ch3\u003e3. Caspase-3 Activity Confirms Apoptotic Response\u003c/h3\u003e\n\u003cp\u003eAs shown in \u003cstrong\u003eFig.\u0026nbsp;3\u003c/strong\u003e and Table \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e, TL treatment significantly increased caspase-3 activity, while BLyS alone decreased it. Interestingly, co-treatment with BLyS and TL did not significantly increase caspase-3 activity beyond TL alone, implying that BLyS might sensitize cells to TL-induced apoptosis through a caspase-independent pathway.\u003c/p\u003e\n\u003cp\u003e\u003c/p\u003e\n\u003cdiv align=\"left\" class=\"colspec\"\u003e\u003cbr\u003e\u003c/div\u003e\n\u003ctable id=\"Tab2\" border=\"1\" style=\"margin-right: calc(53%); width: 47%;\"\u003e\n \u003ccaption language=\"En\"\u003e\n \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\n \u003cdiv class=\"CaptionContent\"\u003e\n \u003cp\u003eCaspase-3 activity (OD₄₀₀) in U937 cell\u003c/p\u003e\n \u003c/div\u003e\n \u003c/caption\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\" style=\"width: 12.5307%;\"\u003e\n \u003cp\u003eGroup\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\" style=\"width: 20.3931%;\"\u003e\n \u003cp\u003eControl\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\" style=\"width: 22.6044%;\"\u003e\n \u003cp\u003eBLyS\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\" style=\"width: 22.3587%;\"\u003e\n \u003cp\u003eTL\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\" style=\"width: 22.113%;\"\u003e\n \u003cp\u003eBLyS\u0026thinsp;+\u0026thinsp;TL\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" style=\"width: 12.5307%;\"\u003e\n \u003cp\u003eOD400\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" style=\"width: 20.3931%;\"\u003e\n \u003cp\u003e0.25\u0026thinsp;\u0026plusmn;\u0026thinsp;0.005\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" style=\"width: 22.6044%;\"\u003e\n \u003cp\u003e0.18\u0026thinsp;\u0026plusmn;\u0026thinsp;0.003*\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" style=\"width: 22.3587%;\"\u003e\n \u003cp\u003e0.30\u0026thinsp;\u0026plusmn;\u0026thinsp;0.006*\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" style=\"width: 22.113%;\"\u003e\n \u003cp\u003e0.33\u0026thinsp;\u0026plusmn;\u0026thinsp;0.005*\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e*U937 cells were treated with 20 ng/mL TL and 2 \u0026micro;g/mL BLyS. Values are mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SE from three independent experiments. *p\u0026thinsp;\u0026lt;\u0026thinsp;0.05 vs. control.\u003c/p\u003e\n\u003ch3\u003e4. TL Alters BLyS Protein Expression Patterns\u003c/h3\u003e\n\u003cp\u003eWestern blot (Fig. \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003eA) showed that TL treatment at concentrations\u0026thinsp;\u0026ge;\u0026thinsp;40 ng/mL significantly reduced the expression of total cellular BLyS protein in U937 cells. In contrast, ELISA data (Fig. \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003eB) revealed that low concentrations of TL (5\u0026ndash;20 ng/mL) enhanced the secretion of soluble BLyS, whereas higher concentrations (\u0026ge;\u0026thinsp;40 ng/mL) suppressed its release. These results indicate a dose-dependent modulation of BLyS expression by TL, potentially shifting the balance from membrane-bound to soluble forms of BLyS, which may differentially influence downstream signaling and cellular responses.) confirmed a decrease in membrane-bound BLyS expression. These findings suggest that TL reduces functionally active forms of BLyS, particularly its membrane-bound variant, which may be more biologically active in promoting survival.\u003c/p\u003e\n\u003ch3\u003e5. TL Regulates mRNA Expression of BLyS, APRIL, and Receptors\u003c/h3\u003e\n\u003cp\u003eqRT-PCR analysis (Fig. \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003e) revealed that TL significantly downregulated BLyS and APRIL mRNA expression in U937 cells. Among the receptors, TACI expression decreased while BR3 (BAFF-R) and BCMA increased, potentially shifting the downstream signaling environment toward an apoptotic phenotype. Baseline mRNA expression of BLyS, BR3, TACI, BCMA, and APRIL in untreated cells was confirmed by 2% agarose gel electrophoresis, showing bands of expected sizes: BLyS (186 bp), BR3 (256 bp), TACI (90 bp), BCMA (135 bp), and APRIL (148 bp).\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eTriptolide inhibited U937 cell proliferation and promoted apoptosis, even in the presence of exogenous BLyS. This suppression aligns with prior findings in gastric, pancreatic, prostate, and glioma models, where TL modulates mitochondrial dysfunction, oxidative stress, and caspase activation [\u003cspan additionalcitationids=\"CR10 CR11 CR12\" citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e, \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eBLyS expression, both membrane-bound and secreted, was downregulated by triptolide, consistent with previous work showing triptolide can suppress BAFF production in monocytes [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. Additionally, TL altered expression of BAFF receptors, decreasing TACI while increasing BAFF-R and BCMA. Such modulation could disrupt survival signaling and sensitize cells to apoptotic triggers [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e, \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eThe immunomodulatory effect of TL may also stem from inhibition of the NF-κB pathway and inflammatory cytokines [\u003cspan additionalcitationids=\"CR15\" citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e], resembling the mechanism of action of dual BAFF/APRIL inhibitors such as telitacicept and povetacicept [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. Triptolide\u0026rsquo;s ability to suppress PD-L1 and reshape immune cell profiles further supports its systemic immune regulatory role [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eMulti-omics studies emphasize the complexity of RNA and protein interactions in cancer and immune signaling [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e, \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. Triptolide\u0026rsquo;s impact may extend to these layers, influencing ceRNA and isomiR-mediated pathways that govern immune escape and tumor progression.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eTriptolide effectively inhibits BLyS-induced proliferation and promotes apoptosis in U937 cells by downregulating BLyS and modulating the expression of its receptors. These findings reveal a potential mechanism by which TL exerts its immunosuppressive and anti-tumor effects and support further exploration of TL as a modulator of B-cell signaling in autoimmune diseases and hematologic malignancies.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eShi X, Xue L (2021) Telitacicept as a BLyS/APRIL dual inhibitor for autoimmune diseases: evidence and perspectives. Front Immunol 12:754218. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/fimmu.2021.754218\u003c/span\u003e\u003cspan address=\"10.3389/fimmu.2021.754218\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eEvans L, Lewis M, Kurata H et al (2023) Povetacicept, an enhanced dual APRIL/BAFF antagonist, that potently reduces immunoglobulins and antibody-secreting cells. Front Immunol 14:1111159. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/fimmu.2023.1111159\u003c/span\u003e\u003cspan address=\"10.3389/fimmu.2023.1111159\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eDavies R, Peng D, Strand V et al (2024) A first-in-human randomized study of the safety, tolerability, pharmacokinetics, and pharmacodynamics of Povetacicept, a dual APRIL/BAFF antagonist, in healthy volunteers. Arthritis Rheumatol. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1002/art.42876\u003c/span\u003e\u003cspan address=\"10.1002/art.42876\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eUllah TR, Mackay F (2023) The BAFF/APRIL system in cancer. Front Immunol 14:1187298. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/fimmu.2023.1187298\u003c/span\u003e\u003cspan address=\"10.3389/fimmu.2023.1187298\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eYang Y, Zhang S, Guo L (2022) Characterization of cell cycle-related competing endogenous RNAs using robust rank aggregation as prognostic biomarker in lung adenocarcinoma. Front Oncol 12:807367. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/fonc.2022.807367\u003c/span\u003e\u003cspan address=\"10.3389/fonc.2022.807367\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGuo L, Dou Y, Yang Y et al (2021) Protein profiling reveals potential isomiR-associated cross-talks among RNAs in cholangiocarcinoma. Comput Struct Biotechnol J 19:5722\u0026ndash;5734. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.csbj.2021.10.014\u003c/span\u003e\u003cspan address=\"10.1016/j.csbj.2021.10.014\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eChen P, Zhong X, Song Y et al (2024) Triptolide induces apoptosis and cytoprotective autophagy by ROS accumulation via directly targeting peroxiredoxin 2 in gastric cancer cells. Cancer Lett 216622. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.canlet.2024.216622\u003c/span\u003e\u003cspan address=\"10.1016/j.canlet.2024.216622\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eRen T, Tang YJ, Wang M et al (2020) Triptolide induces apoptosis through the calcium/calmodulindependent protein kinase kinaseβ/AMPactivated protein kinase signaling pathway in nonsmall cell lung cancer cells. Oncol Rep 44(5):2288\u0026ndash;2296. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3892/or.2020.7763\u003c/span\u003e\u003cspan address=\"10.3892/or.2020.7763\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eQin G, Li P, Xue Z (2018) Triptolide induces protective autophagy and apoptosis in human cervical cancer cells by downregulating Akt/mTOR activation. Oncol Lett 16(3):3929\u0026ndash;3934. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3892/ol.2018.9074\u003c/span\u003e\u003cspan address=\"10.3892/ol.2018.9074\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWu PP, Liu KC, Huang WW et al (2011) Triptolide induces apoptosis in human adrenal cancer NCI-H295 cells through a mitochondrial-dependent pathway. Oncol Rep 25(2):551\u0026ndash;557. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3892/or.2010.1080\u003c/span\u003e\u003cspan address=\"10.3892/or.2010.1080\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWan CK, Wang C, Cheung HY et al (2006) Triptolide induces Bcl-2 cleavage and mitochondria-dependent apoptosis in T cells. Int Immunol 18(3):365\u0026ndash;375. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1093/intimm/dxh380\u003c/span\u003e\u003cspan address=\"10.1093/intimm/dxh380\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHuang J, Zhang L, Ma T et al (2012) Triptolide inhibits MDM2 and induces apoptosis in acute lymphoblastic leukemia cells through p53 activation. Leuk Res 36(10):1304\u0026ndash;1310. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.leukres.2012.06.004\u003c/span\u003e\u003cspan address=\"10.1016/j.leukres.2012.06.004\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSun Y, Xiao Y, Xu J et al (2017) Triptolide inhibits viability and induces apoptosis of colorectal cancer cells via inhibiting Wnt/β-catenin signaling. Exp Ther Med 14(6):6093\u0026ndash;6099. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3892/etm.2017.5371\u003c/span\u003e\u003cspan address=\"10.3892/etm.2017.5371\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGao Y, Xu Z, Chen L et al (2016) Triptolide induces apoptosis in pancreatic cancer cells via the p53 pathway. Mol Med Rep 13(4):2929\u0026ndash;2935. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3892/mmr.2016.4897\u003c/span\u003e\u003cspan address=\"10.3892/mmr.2016.4897\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLin S, Li W, Sun L et al (2017) Triptolide suppresses proliferation and induces apoptosis of prostate cancer cells via targeting HSP70. Oncol Rep 38(5):2882\u0026ndash;2890. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3892/or.2017.5945\u003c/span\u003e\u003cspan address=\"10.3892/or.2017.5945\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLiu J, Wu Q, Feng Y et al (2005) Triptolide suppresses CD80 and CD86 expressions and IL-12 production in THP-1 cells. Acta Pharmacol Sin 26:223\u0026ndash;227. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/j.1745-7254.2005.00035.x\u003c/span\u003e\u003cspan address=\"10.1111/j.1745-7254.2005.00035.x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eDeng J, Liu Y, Lee H et al (2019) Triptolide inhibits the NF-κB pathway and NLRP3 inflammasome activation in lupus-prone mice. Arthritis Res Ther 21(1):31. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/s13075-019-1827-z\u003c/span\u003e\u003cspan address=\"10.1186/s13075-019-1827-z\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWang H, Yang H, Zhang X, Zhou X (2024) Triptolide promotes differentiation of human monocytes into immunosuppressive MDSCs. Cell Immunol 401\u0026ndash;402:104836. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.cellimm.2024.104836\u003c/span\u003e\u003cspan address=\"10.1016/j.cellimm.2024.104836\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLi X, Guo B, Shen S et al (2020) BLyS inhibition promotes regulatory B cell induction and suppresses lupus. Cell Mol Immunol 17(12):1234\u0026ndash;1246. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41423-019-0295-y\u003c/span\u003e\u003cspan address=\"10.1038/s41423-019-0295-y\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMackay F, Schneider P, Rennert P et al (2003) BAFF AND APRIL: a tutorial on B cell survival. Annu Rev Immunol 21:231\u0026ndash;264. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1146/annurev.immunol.21.120601.141152\u003c/span\u003e\u003cspan address=\"10.1146/annurev.immunol.21.120601.141152\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMorel J, Mohan C (2005) BAFF and autoimmunity: more than B cells. J Clin Invest 115(6):1395\u0026ndash;1397. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1172/JCI25207\u003c/span\u003e\u003cspan address=\"10.1172/JCI25207\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":true,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":true,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Triptolide, BLyS, BAFF, APRIL, U937 cells, apoptosis, B-cell signaling, autoimmune diseases","lastPublishedDoi":"10.21203/rs.3.rs-7128989/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7128989/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003eObjective:\u003c/strong\u003e This study aimed to investigate the regulatory effects of Triptolide (TL), a bioactive compound derived from \u003cem\u003eTripterygium wilfordii\u003c/em\u003e, on the expression and signaling of B lymphocyte stimulator (BLyS/BAFF) in the human monocytic cell line U937.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMethods:\u003c/strong\u003e U937 cells were treated with varying concentrations of TL, BLyS, or both. Cell proliferation was assessed using MTT assays, while apoptosis was evaluated via Annexin V/PI flow cytometry and caspase-3 activity analysis. Western blotting and ELISA were performed to measure BLyS protein expression, and quantitative PCR was used to analyze the mRNA levels of BLyS, APRIL, and their receptors (TACI, BCMA, and BAFF-R).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eResults:\u003c/strong\u003e BLyS alone promoted U937 cell proliferation and inhibited apoptosis, whereas TL inhibited cell proliferation and induced apoptosis in a dose-dependent manner. When combined with TL, BLyS reversed its anti-apoptotic effect and promoted apoptosis. TL significantly downregulated total BLyS protein levels and membrane-bound BLyS expression, while enhancing the secretion of soluble BLyS at lower concentrations. Additionally, TL treatment downregulated BLyS and TACI mRNA expression while markedly upregulating BCMA and BAFF-R, suggesting altered receptor signaling dynamics.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConclusion:\u003c/strong\u003e Triptolide disrupts BLyS-mediated signaling by modulating the expression of BLyS and its receptors, leading to enhanced apoptosis in U937 cells. These findings provide new insight into the immunomodulatory mechanism of TL and support its potential use in treating autoimmune diseases and B-cell-related malignancies.\u003c/p\u003e","manuscriptTitle":"Regulatory Effects of Triptolide on BLyS Expression and Signaling in U937 Cells","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-07-17 03:20:51","doi":"10.21203/rs.3.rs-7128989/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"327ffa80-1cc9-4f90-81a0-2cf57a37a480","owner":[],"postedDate":"July 17th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":51555422,"name":"Immunology"},{"id":51555423,"name":"General Cell Biology \u0026 Physiology"}],"tags":[],"updatedAt":"2025-07-17T03:20:51+00:00","versionOfRecord":[],"versionCreatedAt":"2025-07-17 03:20:51","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-7128989","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7128989","identity":"rs-7128989","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.