Exploring the effect and mechanism of DaYuan Yin against acute lung injury by Network Pharmacology,molecular docking and experiment validation

Exploring the effect and mechanism of DaYuan Yin against acute lung injury by Network Pharmacology,molecular docking and experiment validation | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Exploring the effect and mechanism of DaYuan Yin against acute lung injury by Network Pharmacology,molecular docking and experiment validation Lei ZHANG, Wei Zhu, Cong Zhang This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4584646/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background: DayuanYin (DYY) is a traditional Chinese medicine (TCM) formula for the treatment of lung diseases.However, the substance and mechanism of its improvement on acute lung injury (ALI) still need to be studied. Methods: DYY's effective components and potential targets were identified using Traditional Chinese Medicine Systems Pharmacology(TCMSP), and a network of herb-component-targets was created with Cytoscape3.7.2. The target genes for ALI were sourced from GeneCards, DisGeNET, and DrugBank databases. The drug-disease target protein-protein interaction (PPI) network was constructed and core targets were visually identified with Cytoscape. Gene Ontology (GO) and Kyoto Encyclopedia of Gene and Genomes (KEGG) enrichment analysis were conducted using Metscape database.The effective components of DYY were further identified by UHPLC-MS/MS. Subsequently, the therapeutic effect of DYY on ALI and its possible mechanism were studied in LPS-induced ALI rats. Finally, the interaction between nuclear factor erythrocyte 2-associated factor 2(Nrf2), Heme Oxygenase-1 (HO-1), Toll-like receptor 4(TLR4) and active components was evaluated by molecular docking. Results: A total of 95 active compounds, 234 potential therapeutic targets and 2529 ALI related target genes were obtained. DYY and ALI share a target number of 111. KEGG analysis showed that the PI3K-AKT and MAPK signaling pathways and their mediated oxidative stress pathways are closely related to ALI, which may be the potential mechanism of DYY anti-ALI. Network pharmacology and UHPLC-MS/MS analysis showed that the active ingredients included quercetin, OroxylinA, Magnolol, Wogonin, Glabrone, Honokiol and LicochalconeA. Animal experiments have shown that DYY can reduce the lung wet-to-dry (W/D) ratio, the levels of interleukin-6 (IL-6) and tumor necrosis factor-α (TNF-α) in bronchoalveolar lavage fluid (BALF), and the contents of malondialdehyde (MDA), nitric oxide (NO) and reactive oxygen species (ROS) in lung tissue of LPS-treated rats. It is worth noting that DYY promotes the expression of Uncoupling protein 2 (UCP2) mRNA in vivo, increases the expression of Nrf2 and HO-1, and then inhibits the pro-inflammatory mediators mediated by TLR4. Molecular docking analysis showed that the main components of DYY had strong binding ability with HO-1. Conclusions: This study shows that DYY can alleviate inflammation, oxidative stress and pathological changes of ALI by targeting Nrf2/HO-1 mediated TLR4 signaling pathway, which has important implications for developing effective ALI treatments. Dayuan Yin Acute lung injury Oxidative stress Anti-inflammatory Network pharmacology Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Introduction ALI is a life-threatening disease with a high fatality rate of 30–40%[ 1 , 2 ]. Current treatments, such as supportive mechanical ventilation and drugs like glucocorticoids or antibiotics, have limited effectiveness, and even lead to permanent damage [ 3 , 4 ]. Therefore, the overall synergy of TCM may bring a better choice for the treatment of ALI. It has been confirmed that the complex pathogenesis of ALI involves uncontrolled pulmonary inflammation[ 5 , 6 ], driven by cytokines like TNF-α, IL-1 β, and IL-6[ 7 ]. Excessive inflammation leads to neutrophil infiltration in lung tissue, lung cell injury, alveolar-capillary permeability increase,and impaired gas exchange[ 8 ]. In addition,ALI pathogenesis involves oxidative stress from reactive oxygen species, which play a key role in inflammation[ 9 , 10 ]. ROS produced by phagocytes in response to microorganisms and inflammatory stimuli are necessary for defense but must be regulated to prevent excessive tissue damage[ 11 ]. Increased ROS production can in turn lead to higher endothelial permeability and inflammatory cell migration acrossing the endothelial barrier to tissue, which eventually leads to oxidative stress and acute inflammation[ 12 , 13 ]. It can be seen that blocking oxidative stress and inflammation of the lung may be a potential strategy for the treatment of ALI. DYY is a classic prescription of Wu Youyou, a famous doctor in China in the early Qing Dynasty, which can be used to treat febrile plagues. The whole prescription is composed of seven traditional Chinese medicines: Radix Paeoniae Alba, betel nut, licorice, Scutellaria baicalensis, Magnolia officinalis and Anemarrhena anemarrhena (Table 1 ):[ 14 ]. Recent pharmacological research has demonstrated that DYY can regulate respiratory tract infectionsinfection [ 15 ], decrease inflammatory factors, and protect lung tissue[ 16 ].Magnolol and honokiol[ 17 , 18 ], and licorice flavonoids[ 19 ], the main active ingredients in DYY, also reduce inflammation and enhance antioxidation. However, the effectiveness and mechanism of DYY for ALI require further investigation. Network pharmacology helps to understand how traditional Chinese medicine compounds work in treating diseases by analyzing their effects and mechanisms[ 20 ]. By studying the interaction network of multiple genes, targets, and pathways, we can predict the potential targets and mechanisms of traditional Chinese medicine in treating different diseases[ 21 ]. In this study, we used network pharmacology along with in vivo experiments and molecular docking to investigate how DYY works at the molecular level, confirming our findings. Table 1 Detailed information of herbs in DYY Pharmaceutical name Botanical plant name Chinese name Weight (g) Part(s) used Arecae Semen Areca catechu L. Binglang 7.46 seed Magnolia Officinalis Magnolia officinalis Rehd.et Wils. Houpo 3.73 barks Amomum tsao-ko Amomum tsao-ko Crevost et Lemaire. Caoguo 1.87 fruit Anemarrhena asphodeloides Anemarrhena asphodeloides Bunge Zhimu 3.73 rhizome Radix paeoniae Alba Paeonia lactiflora Pall. Baishao 3.73 roots Scutellaria Baicalensis Scutellaria baicalensis Georgi Huangqin 3.73 roots Glycyrrhiza glabra Glycyrrhiza uralensis Fisch. Gancao 1.87 roots and rhizomes Materials and methods Study on Network Pharmacology of DYY Anti-ALI DYY herbal compounds and their targets The active components and target proteins of DYY are derived from TCMSP database( https://old.tcmsp-e.com/tcmsp.php ), with the conditions of oral bioavailability (OB) ≥ 30%, Caco-2 permeability (Caco-2) ≥ -0.4, blood-brain barrier (BBB) ≥ -0.3,drug half-life (HL) ≥ 4 h and drug likeness (DL) ≥ 0.18[ 22 , 23 ], the active compounds and their protein targets were obtained. The target proteins were limited to humans, and unified in Uniprot protein database ( https:// www.Uniprot.Org/ ) standardize the specification [ 24 ]. Cytoscape 3.7.2 was used to create the "herb-active ingredients-targets" network [ 25 ]. Search of ALI-related genes With "acute lung injury" as the keyword, the duplicates were removed from GeneCards ( https://www.genecards.org/ ) (value ≥ median), DisGeNET ( https://www.disgenet.org ) and OMIM ( https://www.omim.org/ ) databases, and "Homo sapiens" was selected as the species. Construction of PPI network and selection of key targets Venn diagram ( https://bioinformatics.psb.ugent.be/webtools/Venn/)wa s used to identify common target genes for DYY and ALI, which were then analyzed in STRING12.0 ( https://cn.string-db.org ) with a minimum network interaction score confidence of 0.7[ 26 ].The resulting network was visualized and evaluated in Cytoscape3.7.2 after removing the free node from PPI network, and the target's network topology parameters were analyzed using CytoNCA, including degree centrality(DC), betweenness centrality (BC), and closeness centrality (CC).The central target of DYY was selected according to the degree value greater than the respective median (DC > 13, BC > 0.003, CC > 0.45) [ 27 ]. Filter the PPI network using the MCODE plug-in in Cytoscape using various cutoff values: degree = 2, k-core = 2, node score − 0.2, maximum depth = 100[ 28 ]. GO and KEGG enrichment analysis GO and KEGG pathway enrichment analysis of the main targets of DYY and ALI were performed using Metascape( https://metascape.org/ ) [ 29 ]. Based on the P-value less than 0.05,the top 20 of biological process (BP), cellular component (CC), molecular function (MF) terms and the top 30 of KEGG terms were imported and visualized on the bioinformatics platform ( http://www.bioinformatics.com.cn/ ) to analyze the key molecular biology processes and key targets' signal path. Molecular docking verification We identified active ingredients associated with ALI using “herb-active ingredients-targets” network and UHPLC-MS/MS results. The structures of these ingredients were downloaded from the TCMSP database in 2D and SDF formats. Using chem 3D software, we converted the structures to 3D structure in mol2 format. The 3D structures of Nrf2, HO-1, and TLR4 were obtained from the RCSB Protein Data Bank ( https://www.rcsb.org/ ), and the crystallographic structures of targets were prepared for dehydratation and hydrotreatment before using Autodock 1.5.7 ( http://autodock.scripps.edu/ ) for molecular docking[ 30 ]. Autodock Vina 1.1.2 ( http://vina.scripps.edu/ ) was selected to calculate binding energy between active ingredients and proteins. A binding energy ≤-5.0 kJ/mol is considered a standard for good binding efficiency[ 31 ]. Results were visualized using Pymol and LigPlot [ 32 ]. Preparation and quality control of DYY Materials and reagents Arecae Semen(Binglang), Magnolia Officinalis(Houpo), Amomum tsao-ko(Caoguo), Anemarrhena asphodeloides(Zhimu), Radix paeoniae Alba(Baishao), Scutellaria Baicalensis(Huangqin), Glycyrrhiza glabra(Gancao) were purchased from Suzhou Tianling traditional Chinese Medicine Co., Ltd. and were appraised by pharmacy experts. The criteria for the quality of the herbs were in accordance with the 2020 Chinese pharmacopoeia [ 33 ]. Methanol and acetonitrile were purchased from EMD Millipore Corporation(Germany),and formic acid from Aladdin Biochemical Technology Co., Ltd. (Shanghai, China), and all chemicals and solvents were analytical reagent or chromatographic grade. Ultra-pure water was prepared using a Milli-Q water purification system (Millipore, Bedford, MA, USA). Extraction for DYY testing sample According to the proportion of DYY in Table 1 , all the herbs were soaked in water with 10 times the amount of raw medicine for 30 minutes, and then extracted twice with electric heating sleeve for 1 hour each time[ 34 ]. The extract was mixed and concentrated to about 1g/kg. UHPLC-MS analysis Instruments Vanquish Ultra performance liquid chromatograph and QE Ultra Resolution Mass Spectrometer (Thermo Fisher Scientific, USA), ACQUITY UHPLC HSST3 (100 mm × 2.1 mm, 1.8 µm) column (Waters, USA), 5430R table-top high-speed refrigerated centrifuge (Shanghai Eppendorf ,China), KQ-2200E ultrasonic cleaning machine (Kunshan Ultrasonic instrument Co., Ltd., China). Sample treatment Took 1ml sample, added 2 times the volume of methanol-acetonitrile solution (1:1, v/v), vortex for 60s, sonicated for 30 min, and centrifugation for 20 min(12,000 rpm, 4°C), the supernatant was filtered using a 0.22 µm organic filter film,and transferred to insert-equipped vials for LC-MS analysis. Liquid chromatography-mass spectrometry conditions The sample extracts were analyzed using an UHPLC– Orbitrap-MS system (UHPLC, Vanquish; MS,HFX). The analytical conditions were as follows, UHPLC: column, Waters HSS T3(100*2.1 mm, 1.8µm); column temperature, 40 C; flow rate, 0.3 mL/min; injection volume, 2µL; solvent system, water (0.1% Acetic acid): acetonitrile (0.1% Acetic acid); gradient program,100: 0 V/V at 0–1 min, 5:95 V/V at 9.0 min, 5: 95 V/V at 9.0–13.0 min, 100:0 V/V at 13.1–17 min. HRMS data were recorded on a Q Exactive HFX Hybrid Quadrupole Orbitrap mass spectrometer equipped with a heated ESI source utilizing the Full-msddMS2 MS acquisition methods. The ESI source parameters were set as follows: spray voltage, -2.8 kV/3.0 kV; sheath gas pressure, 40 arb; aux gas pressure, 10 arb; sweep gas pressure, 0 arb; capillary temperature, 320℃; and aux gas heater temperature, 350℃ The original data were processed by metabonomics software ProgenesisQI (WatersCorporation,Milford,USA) for baseline filtering, peak identification, integration, retention time correction and peak alignment to obtain a data matrix of retention time, mass-to-charge ratio and peak intensity. The main parameters include: (1) only retain variables with non-zero values of more than 80% in any group of samples; (2) total peak normalization, and then delete variables with relative standard deviation (RSD) ≥ 30% of QC samples. Finally, Human Metabolome Database ( http://www.hmdb.ca/ ) [ 35 ]and METLIN ( https://metlin.scripps.edu/ ) database [ 36 ] were used for qualitative analysis. Animal experiments Reagents and instruments Lipopolysaccharides (LPS) ,RIPA Cracking Buffer and MDA kit were obtained from Solarbio Science & Technology Co., Ltd. (Beijing, China). IL-6 and TNF-α enzyme-linked immunosorbent assay (ELISA) kits were supplied by Enzyme-linked Biotechnology Co., Ltd. (Shanghai, China). NO kit was obtained from Jiancheng Bioengineering Institute (Nanjing, China).2,7-Dichlorodihydrofluorescein diacetate(DCFH-DA)kit was purchased from Biyuntian Biotechnology Co. (Shanghai, China). Trizol kit was obtained fromYeasen Biotechnology Co.,Ltd.(Shanghai,China). BCA kit was provided by Fisher Scientific Inc(Shanghai,China). UCP2 was obtained General biology Co., Ltd (Anhui,China).All antibodies Nrf2、HO-1 and TLR4were supplied by Proteintech Group, Inc (Wuhan,China). Animals SPF male Sprague-Dawley rats (6–8 weeks old) from Pengyue Experimental Animal breeding Co., Ltd.(Jinan, China) were fed under ventilated and temperature-controlled conditions (humidity of 25.55%, light / dark cycle for 12 hours. All animal procedures were approved by the Animal Experimental Ethics Committee (SWS20240130)and followed their guidelines. Establishment of ALI model and treatment of DYY After 1 week of domestication, rats were randomly divided into 3 groups (n = 6): Con, LPS, and DYY groups. ALI was induced by a single intraperitoneal injection of 10mg/kg LPS. DYY (4.7g/kg/d) was given by gavage once a day for 1 week. Con and LPS groups received saline. Rats were euthanized 12 hours after the last treatment for BALF and lung tissue collection. Histopathological analysis Left lung tissues of rats were taken, fixed with 10% formalin, then embedded in paraffin wax and made into 5µm thick sections, washed with PBS buffer, stained with hematoxylin and eosin, sealed with neutral gum, and images were captured by microscope (NikonTi,Japan). Pulmonary edema assessment Extract lung tissue, rinsed with normal saline and remove residual tissue. After absorbing the surface liquid, the wet mass of the lung was obtained, and then dried in an oven at 70 ℃ for 48 hours to obtain the dry weight. The ratio of W/D was calculated according to the weight to evaluate the degree of pulmonary edema[ 37 , 38 ]. Determination of proinflammatory factors in BALF The BALF liquid was centrifuged at 3000 rpm for 10 min at 4°C, then according to the manufacturer's instructions, the supernatants were used for detection of cytokines levels,such as TNF-α and IL-6 [ 39 , 40 ]。 Determination of MDA, NO and ROS in lung tissue ROS, MDA and NO are usually used to express local or systemic oxidative stress [ 41 ]. The lung tissue was broken into small pieces and homogenized in lysozyme at 37 ℃ for 1 hour. Then filter the homogenate, centrifuge 3000g 20min at 4 ℃, and collect the supernatant. Then, quantify the MDA according to the manufacturer's recommended scheme[ 42 ] and use a reagent based on the Gliese reaction to determine the nitrite level to indirectly evaluate the NO content[ 43 ]. Then, the level of ROS in lung tissue was detected by DCFH-DA kit. In short, after harvesting the single cell suspension, 5 × 10 5 cells were resuscitated in 1ml PBS with 1 µL DCFH-DA and analyzed for ROS response with the displayed fluorescence value using a microwell plate reader [ 44 ]. Real-time quantitative PCR analysis According to the manufacturer's instructions, the Trizol kit was used to extract total RNA from lung tissue and obtain cDNA. Finally, a two-step PCR amplification reaction was used to obtain threshold cycle (Ct) and average value from triplicate samples. Using GAPDH as the internal reference, 2-ΔΔCt was used to calculate the relative expression level of mRNA of target gene [ 45 ]. The primers were synthesized by General Biotechnology Co., LTD. (Anhui, China). Primer sequence sarelistedin Table 2 . Table 2 Primer sequence Gene Primer Sequence UCP2 F ATGTGGTAAAGGTCCGCTTCC R ACAGTTGACAATGGCATTTCG GAPDH F GGTCATCAACGGGAAACCCATCA R CGCCAGTAGACTCCACGACATAC Western blot analysis The lung tissue was homogenized using RIPA lysis bufferand proteins were extracted.Total protein was quantified using a BCA kit. The protein was then separated on a 10% SDS-PAGE gel and transferred to a PVDF membrane. The membrane was incubated with antibodies against Nrf2, HO-1, TLR4, and GAPDH overnight at 4°C, followed by a 2-hour incubation with a secondary antibody coupled with HRP.After washing with phosphate-buffered saline, antibodies were developed and exposed to enhanced chemiluminescence (ECL) to observe protein bands[ 46 ]. The strips were analyzed using ImageJ software (Bio-Rad, California, USA) with GAPDH as the loading control. Statistical analysis All the experimental data were displayed as means ± SD and analyzed using the SPSS 26.0 software (IBM Inc., USA).Comparisons of multiple groups were performed using one-way ANOVA and comparisons between two groups were performed using Student's t-test. A value of p < 0.05 was considered statistically significant. Results Network pharmacology predicted the potential mechanisms of DYY for treating ALI Collection of DYY targets and ALI targets A total of 95 active components were identified in the DYY prescription based on set screening conditions(Supplementary Material 1). Three compounds, Magnolol, honokiol, and quercetin, were considered active despite not meeting ADME parameters due to their known anti-inflammatory or antioxidant effects[ 17 , 18 , 47 ]. A total of 234 therapeutic target proteins for these compounds in DYY were identified and their gene names were adjusted using the Uniport database(Supplementary Material 2). Then the herbal-ingredient-target gene network was created using Cytoscape3.7.2(Fig. 1 A). It includes different herbs and active ingredients(the surrounding circle),shared ingredients(the upper hexagon), and targets(the middle prism).There were 15 medicinal ingredients with a degree of ≥ 15(Supplementary Material 3). 2529 ALI-related targets were gathered from GeneCards, DisGeNET, and OMIM databases(Fig. 1 B). 111 overlapping genes between DYY target and ALI target were identified by Venn map (Fig. 1 C and SupplementaryMaterial 4). PPI network analysis and core target screening We imported 111 genes into the STRING database, creating a PPI network with 108 nodes and 1716 edges due to 3 proteins did not participate(Fig. 2 B). Core targets were identified to construct a network based on their DC, BC, and CC values(Fig. 2 A),with the top 15 targets sorted by degree shown in Fig. 2 C and detailed in Table 3 . Subnetworks identified by MCODE were divided into four groups for further analysis(Fig. 2 D). Table 3 Information of 15 core targets No. UniProt ID Gene symbol Protein name Degree 1 P04637 TP53 Cellular tumor antigen p53 52 2 P31749 AKT1 RAC-alpha serine/threonine-protein kinase 49 3 P05231 IL6 Interleukin-6 49 4 P40763 STAT3 Signal transducer and activator of transcription 3 47 5 P10415 BCL2 Apoptosis regulator Bcl-2 42 6 P01375 TNF Tumor necrosis factor 42 7 P01106 MYC Myc proto-oncogene protein 41 8 P07900 HSP90AA1 Heat shock protein HSP 90-alpha 40 9 P05412 JUN Transcription factor Jun 40 10 P03372 ESR1 Estrogen receptor 38 11 P42574 CASP3 Caspase-3 38 12 Q16665 HIF1A Hypoxia-inducible factor 1-alpha 33 13 P28482 MAPK1 Mitogen-activated protein kinase 1 32 14 P24385 CCND1 G1/S-specific cyclin-D1 31 15 P01100 FOS Protein c-Fos 31 GO and KEGG enrichment analysis To better understand how DYY works against ALI, we analyzed 111 overlapping targets using GO and KEGG in metscape. Figure 3 A-C displays the each top 20 enrichment items for MF, CC, and BP. MF includes kinase binding, transcription factor binding, protein kinase activity, protein homodimerization activity, cytokine receptor binding, and more. CC includes membrane raft, membrane microdomain, transcriptional regulatory complex, mitochondrial membrane, and Bcl-2 family protein complex.BP involves response to hormones, response of cells to nitrogen compounds, response to peptides, regulation of apoptosis signal pathway, response to lipopolysaccharide, response of cells to cytokine stimulation, etc. DYY therapy can regulate the immune system, mitochondrial stress, apoptosis, and signal transduction to alleviate ALI symptoms. KEGG analysis revealed the top 30 signaling pathways, such as cancer pathway, AGE-RAGE signaling pathway in diabetic complications, fluid shear stress, and atherosclerosis, PI3K-Akt, MAPK and p53 signaling pathways, may be involved in the treatment of ALI by DYY (Fig. 3 D-E and Supplementary Material 5).we observed that 28 and 23 core targets were involved in the upstream and downstream regulation of PI3K-AKT and MAPK signaling pathways, respectively, and excess ROS could activate Nrf2 through these two signaling pathways, and then promote the transcriptional expression of HO-1, the downstream gene of Nrf2, to cope with the damage caused by oxidative stress [ 48 ]. In addition, Nrf2/HO-1 signal transduction can regulate TLR4-driven inflammatory response during stress [ 49 ]. These results suggest that DYY may treat ALI by regulating the pathways related to inflammation and oxidative stress. Identification and prediction of active ingredients in DYY The effective components of DYY prescription were identified by UHPLC-MS/MS. The representative LC-MS total ion current chromatography (TIC) obtained in positive (ESI+) and negative (ESI-) modes is shown (Fig. 4 A-B). Table 4 identified and labeled the representative compounds of DYY Chinese herbal medicine, in which Anhydroicaritin, quercetin, licochalconea, Wogonin and Honokiol were the main components confirmed by network pharmacological analysis. Table 4 Chemical characterization of main compounds in DYY No. Compound name Molecular Formula m/z Retention time (min) Class 1 Quercetin C15H10O7 303.04961 6.07225 Flavonols 2 Wogonin C16H12O5 283.06154 7.4849833 Flavonoids 3 formononetin C16H12O4 269.08059 7.12975 Isoflavones 4 Glabrone C20H16O5 337.10671 10.740933 Isoflavones 5 Anhydroicaritin C21H20O6 369.13308 11.340883 Isoprene flavonoid derivatives 6 Magnolol C18H18O2 265.12319 11.2761 Lignans 7 Glyasperin F C20H18O6 337.10654 11.294383 Flavonoids 8 Oroxylin A C16H12O5 285.07523 9.8511 Flavonoids 9 Honokiol C18H18O2 265.12319 10.72155 Lignans 10 Lupiwighteone C20H18O5 339.12235 9.8987 Isoflavones 11 Licochalcone A C21H22O4 339.1589 10.256 Flavonoids DYY improves LPS-induced ALI in rats To study DYY's role in ALI, we induced ALI in rats using LPS. Pulmonary edema, a common ALI change, can be measured by W/D ratio. Compared to the Con group, rats treated with LPS had significantly higher W/D ratios, which was reduced by DYY (Fig. 5 A). HE staining of lung tissue showed severe cell inflammation ,thickening of alveolar septum and partial destruction of alveolar structure in LPS group, which was improved by DYY(Fig. 5 B).In summary, the results confirmed the protective effect of DYY prescription on ALI rats. DYY inhibits lung inflammation and oxidative stress As previously described, uncontrolled inflammation and oxidative stress can worsen ALI[ 50 ].To study DYY's effects on LPS-induced inflammation and oxidative stress, we measured levels of IL-6, TNF-α ,ROS, MDA and NO in rats. Results showed DYY reduced levels of inflammatory factors in BALF(Fig. 6 A-B),meanwhile DYY significantly reduced levels of ROS, MDA, and NO in lung tissue(Fig. 6 C-E), which is consistent with the results of related studies [ 51 ], showing anti-inflammatory effects and reducing oxidative stress to improve lung injury. DYY up-regulates UCP2 mRNA expression in lung tissue UCP2 is involved in the maintenance of mitochondrial function, the regulation of immune response and oxidative stress under physiological or pathological conditions [ 45 ]. As shown in Fig. 6 F, LPS decreased the expression of UCP2 mRNA in lung tissue ( P < 0.01). However,DYY administration could up-regulate UCP2mRNA expression (P < 0.05). This suggests that UCP2 plays an active role in improving lung injury caused by LPS. DYY regulates the expression of Nrf2/HO-1-mediated TLR4 pathway protein Environmental and pathological stress activate Nrf2, leading to the regulation of downstream antioxidant factors like HO-1. This helps protect against oxidative stress and inflammation, and the associated TLR4 pathway plays an anti-inflammatory role[ 52 , 53 ]. KEGG analysis shows that PI3K-AKT and MAPK pathways are enriched, but its upstream and downstream gene Nrf2/HO-1-mediated TLR4 pathways are crucial for eliminating oxidative stress and inflammation, which was an important mechanism of ALI therapy. To study the effects of DYY on Nrf2, HO-1, and TLR4 proteins, we found thtough WB that DYY treatment reduced TLR4 expression and increased Nrf2 and HO-1 expression in response to LPS(Fig. 7 A-D), indicating DYY's anti-inflammatory and oxidative stress-regulating effects through the Nrf2/HO-1-mediated TLR4 pathway. Predicting active compounds of DYY through molecular docking We selected Anhydroicaritin, Wogonin, LicochalconeA, quercetin, and Honokiol for molecular docking with Nrf2, HO-1, and TLR4 proteins. Lower binding energy indicates stronger interaction [ 54 ]. We found that Anhydroicaritin had the highest docking score and lowest Honokiol (-4.9kcal/mol), but close to stability.The other compounds bind well to Nrf2, HO-1 and TLR4 proteins, indicating that they may be very important for the treatment of ALI. The typical docking results are shown in Table 5 and Fig. 8 . Table 5 Molecular docking predictes results of key active ingredient and target protein Item HMOX1 NF2L2 TLR4 Anhydroicaritin -8.1 -5.7 -6.6 Honokiol -7.5 -4.9 -5.9 LicochalconeA -7.6 -5.4 -5.8 Quercetin -7.1 -5.6 -5.9 Wogonin -7.4 -5 -5.9 Note :The binding free energy is kcal/mol. Discussion ALI is a syndrome with various causes, where oxidative stress and inflammation are key factors affecting lung function[55,56].Despite extensive research in determining the influencing factors and repair mechanisms[57], current treatments have not significantly reduced the high mortality rate of ALI[58]. Research has demonstrated that TCM is effective in treating coronavirus disease 2019 (COVID-19) caused by SARS-CoV-2[59].TCM targets inflammation, oxidative stress, and organ injuries associated with the virus, providing unique clinical advantages[60]. TCM is now a crucial component in preventing and treating ALI, classified as "lung heat syndrome" and "asthma syndrome"in TCM.The pathogenesis incloud evil toxin trapped in the lung causes heat to consume body fluid, leading to lung dysfunction and accumulation of phlegm and heat[61]. This can progress to ALI and potentially acute respiratory distress syndrome (ARDS). DYY has been used in China for centuries for epidemic diseases.It has the effect of eliminating turbid, clearing heat and detoxification. It is usually used to treat influenza, cold, fever and other upper respiratory diseases, showing a good effect. ALI is characterized by uncontrolled inflammation and redox imbalance[62], with a focus on oxidative stress, inflammatory response and apoptosis in treatment research[63]. Network pharmacology is commonly used to uncover the complex pharmacological mechanisms of traditional Chinese medicine for treating complex diseases.This study used network pharmacology and vivo experiments to investigate how DYY works as an anti-ALI treatment. We confirmed 15 main targets out of 111 potential targets identified, including TP53, TNF, IL6, MAPK1,CASP3, and BCL2, associating with oxidative stress, inflammation, and apoptosis. Oxidative stress causes the buildup of ROS in lung cells, impacting their function and triggering inflammation. In acute lung injury, excessive NO production due to oxidative stress can lead to the formation of reactive nitrogen species (RNS)[64],disrupting pulmonary function[65],which leads to induced NOS overexpression / activity and the release of pro-inflammatory cytokines [66]. In this study, we created an ALI rat model using LPS and treated it with DYY. Results showed that DYY effectively treated ALI by restoring normal W/D ratio, reducing inflammatory cell infiltration, and reconstructing alveolar structure.After LPS stimulation, pro-inflammatory cytokines like IL-6 and TNF-α were secreted in BALF, indicating pulmonary inflammation. DYY reversed this by reducing cytokines, indicating inhibition of the inflammatory response. It is well known that oxidative stress is caused by an imbalance between oxidants and antioxidants, leading to damage from ROS and depletion of antioxidants. This can worsen inflammation and harm mitochondria due to the production of oxides exceeding antioxidant defense[67].MDA is a common biomarker for oxidative stress[68],inducer NO synthase (iNOS) and endothelial nitric oxide synthase (eNOS)are enzymes involved in oxidative stress and can contribute to lung injury in ALI by increasing superoxide production such as NO and MDA[69].New research suggests that oxidative stress is a key factor in the development of ALI, with ROS playing a crucial role in the process. Mitochondrial channels like mPTP and inner membrane anion channel (IMAC),their activation may be involved in intra- and intermitochondrial redox-environment changes leading to ROS release[70]. It should be noted that while ROS can protect cells from oxidative stress, high levels can damage endothelial barriers and cause inflammation. Excessive ROS can deplete NO levels, and NO reacts with ROS to form excessive peroxynitrite, leading to oxidative damage and cell death through reacting with lipids, DNA and proteins[67].UCP2, an anion transporter, helps maintain mitochondrial function, immune response and regulate oxidative stress, and protect against cell apoptosis[71,45].Here, it may play a crucial role in protecting against LPS-induced ALI by stabilizing mitochondrial structure and reducing inflammation and oxidative stress induced by ROS, MDA and so on . To confirm DYY's inhibitory effect on ALI in rats, we observed changes in ROS, MDA, and NO levels. ROS levels increased significantly in ALI rats, indicating oxidative damage in lung tissue. MDA and NO levels also increased, indirectly reflecting tissue injury degree. DYY intervention effectively reduced intracellular ROS, inhibited ROS accumulation, decreased MDA and NO levels, tending to the Con group,and reversed the decrease in UCP2 mRNA expression induced by LPS. This suggests that DYY can alleviate lung tissue inflammation and improve ALI by regulating oxidative stress processes. We analyzed the mechanism of DYY in ALI through KEGG and GO enrichment , identifying involvement of mitochondrial membrane, cell response to nitrogen compounds and pathways like PI3K-AKT and MAPK signaling in ALI development. By studying the signaling cascade, we aim to understand the key regulatory roles of upstream and downstream targets in inflammation and oxidative stress pathways in ALI. Numerous studies have demonstrated the significance of Nrf2 in controlling oxidative stress[72] and its role in iron apoptosis by regulating iron homeostasis and lipid peroxidation [73,74]. Furthermore,the Nrf2/HO-1 pathway helps regulate anti-inflammatory and antioxidant responses, providing multi-organ protection[75,76]. Recent reports suggest that natural drug ingredients protect against ALI through the Nrf2 signaling pathway[77]. Our study shows that DYY activates the Nrf2/HO-1 pathway in ALI rats, reducing oxidative stress and inflammation in the lungs,such as the reduction of TLR4 expression and TNF-α,IL-6 levels,suggesting that DYY can prevent ALI by reducing inflammation and increasing antioxidant response. Nrf2 protects lung cells by influencing TLR4 signaling[78], confirming its role in inflammatory lung injury,consistenting with previous studies [79]. Molecular docking techniques were used to predict the binding activity of core components to key targets. Results showed Honokiol had good binding activity to HO-1 and TLR4, while other components bound well to Nrf2, HO-1, and TLR4. Quercetin, a flavonoid compound, regulates oxidative stress and inflammation by inhibiting inflammatory factors and excessive release of ROS, proving effective in treating various diseases[80].Wogonin is also flavonoids that reduce inflammation and oxidative stress by enhancing antioxidant capacity and counteracting inflammatory signals[81].Honokiol is a natural polyphenol that has been shown to counteract oxidative stress and inflammatory signals in a variety of ways, including reversing elevated levels of inflammatory factors, increasing the production of antioxidants GSH and SOD in the body, and alleviating LPS-induced apoptosis[82,83].Prior research has demonstrated that Licochalcone A has antimicrobial and anti-inflammatory properties, protects against oxidative stress, and activates nuclear translocation of Nrf2 and enhancing HO-1 expression in cells[84]. We speculate DYY improves ALI in rats by utilizing multiple compounds. Our study shows that DYY protects against ALI in rats by reducing oxidative stress and inflammation through the Nrf2/HO-1 pathway, inhibiting TLR4 signaling. However, further research is needed to identify the main bioactive ingredients and fully understand the complex signaling cascade mechanisms involved in its anti-ALI effects.Nevertheless, these findings provide a further pharmacological basis for DYY as a new treatment for ALI. Declarations Funding Declaration No Funding. Animal ethics statement All surgical procedures on the experimental animals met all ethical requirements and were approved by the animal ethics committee of Institute of Biology, Shandong Academy of Sciences(SWS20240130). Consent to publish All authors consent to publish. Author Contributions This study was designed by L Z.,W Z and L Z conducted animal experiments. C Z analyzed network pharmacology and molecular docking. W Z conducted data analysis. L Z wrote the manuscript, and all the authors read and approved the final draft. Data Availability Statement The data will be available upon request. Conflicts of Interest None.The authors declare no conflict of interest Acknowledgements We are very grateful to the Institute of Biology of Shandong Academy of Sciences for the help of animal experiments. References Li N, Zou SS, Wang B, Lin HQ.Targeting immunometabolism against acute lung injury.Clin Immunol.2023;249:109289. Li YR,Jiang YN,Zhang H, Zhang J,Ma JB,Yang Z, et al.Research on acute lung injury inflammatory network.Int J Clin Pharmacol Ther. 2023; 61(9):394-403. Bezerra FS, Lanzetti M, Nesi RT,Nagato AC, Silva CPE , KennedyFeitosa E,et al. Oxidative Stress and Inflammation in Acute and Chronic Lung Injuries.Antioxidants (Basel). 2023;12(3):548. Ding ZH, Zhong RX, Xia TY, Yang YN, Xing N , Wang WJ,et al. Advances in research into the mechanisms of Chinese Materia Medica against acute lung injury. Biomed Pharmacother. 2020;122:109706. Chen JY, Huang YL, Bian XH, He Y.Berberine Ameliorates Inflammation in Acute Lung Injury via NF-κB/Nlrp3 Signaling Pathway,Front Nutr. 2022;9:851255. Cheng HB, Zhu YF, Chen LJ, Wang YL.Nesfatin-1 alleviated lipopolysaccharide-induced acute lung injury through regulating inflammatory response associated with macrophages modulation.J Cardiothorac Surg. 2022;17(1):206. Liu ZF, Liu DS, Wang ZH, Zou YG , Wang HX , Li X,et al.Association between inflammatory biomarkers and acute respiratory distress syndrome or acute lung injury risk : A systematic review and meta-analysis.Wien Klin Wochenschr.2022;134(1-2):24-38. Mokrá D.Acute lung injury - from pathophysiology to treatment.Physiol Res. 2020;69(Suppl 3) :S353-S366. Liu X, Zhang JQ, Xie W.The role of ferroptosis in acute lung injury.Mol Cell Biochem. 2022;477(5) :1453-1461. Sul O, Ra SW.Quercetin Prevents LPS-Induced Oxidative Stress and Inflammation by Modulating NOX2/ROS/NF-kB in Lung Epithelial Cells.Molecules.2021;26(22): 6949. Leavy O.Inflammation: Regulating ROS.Nat Rev Immunol. 2014;14(6):357. Rius-Pérez S, Pérez S, Toledano M, Sastre J.Mitochondrial Reactive Oxygen Species and Lytic Programmed Cell Death in Acute Inflammation.Antioxid.Redox Signal. 2023;39(10-12) :708-727. Kellner M, Noonepalle S, Lu Q, Srivastava A, Zemskov E, Black SM.ROS Signaling in the Pathogenesis of Acute Lung Injury (ALI) and Acute Respiratory Distress Syndrome (ARDS).Adv Exp Med Biol. 2017;967:105-137. Guo LQ, Yang Y, Yuan J, Ren HL, Huang XL , Li M, et al.Da-Yuan-Yin decoction polyphenol fraction attenuates acute lung injury induced by lipopolysaccharide.Pharm Biol. 2023;61(1):228-240. Ruan XF, Du P, Zhao K, Huang JC, Xia HM, Dai D, et al.Mechanism of Dayuanyin in the treatment of coronavirus disease 2019 based on network pharmacology and molecular docking.Chin Med. 2020;15:62. Yang Y, Chen JL, Ren HL, Wei L, Huang XL, Li M, et al. Protective Effect of the Eluting Fraction of Da-Yuan-Yin Decoction on Acute Lung Injury. Altern Ther Health Med.2023;29(5) :242-254. Amorati R Zotova JL, Baschieri A, Valgimigli L.Antioxidant Activity of Magnolol and Honokiol: Kinetic and Mechanistic Investigations of Their Reaction with Peroxyl Radicals.J Org Chem. 2015;80(21) :10651-9. Luo J, Xu YW, Zhang MF, Gao L, Fang C, Zhou CQ.Magnolol inhibits LPS-induced inflammatory response in uterine epithelial cells : magnolol inhibits LPS-induced inflammatory response.Inflammation. 2013;36(5):997-1003. Frattaruolo L, Carullo G, Brindisi M, Mazzotta S, Bellissimo L, Rago V,et al. Antioxidant and Anti-Inflammatory Activities of Flavanones from Glycyrrhiza glabra L. (licorice) Leaf Phytocomplexes: Identification of Licoflavanone as a Modulator of NF-kB/MAPK Pathway.Antioxidants (Basel). 2019;8(6):186. Su D, Liao LL, Zeng Q, Liao Z, Liu YL, Jin C,et al.Study on the new anti-atherosclerosis activity of different Herba patriniae through down-regulating lysophosphatidylcholine of the glycerophospholipid metabolism pathway.Phytomedicine. 2022;94:153833. Jian GH, Su BZ, Zhou WJ, Xiong H.Application of network pharmacology and molecular docking to elucidate the potential mechanism of Eucommia ulmoides - Radix Achyranthis Bidentatae against osteoarthritis.BioData Min.2020;13:12. Chen RB, Yang YD, Sun K, Liu S, Guo W, Zhang JX, et al. Potential mechanism of Ziyin Tongluo Formula in the treatment of postmenopausal osteoporosis: based on network pharmacology and ovariectomized rat model.Chin Med.2021;16(1):88. Zhang WD, Chen Y, Jiang HH, Yang JX, Wang Q, Du YF,et al.Integrated strategy for accurately screening biomarkers based on metabolomics coupled with network pharmacology.Talanta. 2020;211:120710. UniProt Consortium.UniProt: the universal protein knowledgebase in 2021.Nucleic Acids Res. 2021;49(D1):D480-D489. Wang Y, Ding TT, Jiang X.Network Pharmacology Study on Herb Pair Bletilla striata-Galla chinensis in the Treatment of Chronic Skin Ulcers.Curr Pharm Des.2024. Wu YG, Fang YL, Li YN, Au R, Cheng C, Li WY, et al. A network pharmacology approach and experimental validation to investigate the anticancer mechanism of Qi-Qin-Hu-Chang formula against colitis-associated colorectal cancer through induction of apoptosis via JNK/p38 MAPK signaling pathway.J. Ethnopharmacol. 2024;319(Pt 3):117323, Zhao J, Pan BY, Zhou XL, Wu CN, Hao FC, Zhang J, et al.Polygonum cuspidatum inhibits the growth of osteosarcoma cells via impeding Akt/ERK/EGFR signaling pathways,Bioengineered. 2022;13(2) :2992-3006. Wang Y, Yuan Y, Wang WT, He Y, Zhong H, Zhou XX, et al.Mechanisms underlying the therapeutic effects of Qingfeiyin in treating acute lung injury based on GEO datasets, network pharmacology and molecular docking.Comput Biol Med. 2022;145:105454. Qiu JF, Zhang ZY, Hu AL, Zhao P, Wei XN, Song H, et al. Integrating UHPLC-HR-MS/MS, Network Pharmacology, and Experimental Validation to Uncover the Mechanisms of Jin'gan Capsules against Breast Cancer.ACS Omega. 2022;7(32):28003-28015. Song LL, Xu J , Shi YQ, Zhao HM , Zhang M , Wang YF, et al.An integrated strategy of UHPLC-Q-TOF-MS analysis, network pharmacology, and molecular docking to explore the chemical constituents and mechanism of Zixue Powder against febrile seizures.Heliyon. 2023;10(1) :e23865. Yuan C, Wang MH, Wang F, Chen PY, Ke XG, Yu B, et al.Network pharmacology and molecular docking reveal the mechanism of Scopoletin against non-small cell lung cancer.Life Sci. 2021;270:119105. Wang JW, Huang YL, Guo LH, Li JF, Zhou SF.Molecular mechanism of Achyranthis bidentatae radix and Morindae officinalis radix in osteoporosis therapy: An investigation based on network pharmacology, molecular docking, and molecular dynamics simulations.Biochem Biophys Rep. 2023;36:101586. Chinese Pharmacopoeia Commission.Pharmacopoeia of the People’s Republic of China.Chin Med Sci Press.Beijing, China, 2020. Wang XJ, Zhang XX, Li JX, Fu JY, Zhao MJ, Zhang WT, et al. Network pharmacology and LC-MS approachs to explore the active compounds and mechanisms of Yuanjiang decoction for treating bradyarrhythmia.Comput Biol Med. 2023;152:106435. Wishart DS , Oler Ep, Peters H, Guo AC, Girod S, Han S, et al.MiMeDB: the Human Microbial Metabolome Database.Nucleic Acids Res. 2023;51(D1):D611-D620. Xue JC, Guijas C, Benton HP, Warth B, Siuzdak G. METLIN MS2 molecular standards database: a broad chemical and biological resource.Nat Methods. 2020;17(10):953-954. Du ZA, Sun MN, Hu ZS.Saikosaponin a ameliorates LPS-induced acute lung injury in mice.Inflammation. 2018;41(1):193-198. Zhu LH, Wei MC, Yang N, Li XH.Glycyrrhizic acid alleviates the meconium-induced acute lung injury in neonatal rats by inhibiting oxidative stress through mediating the Keap1/Nrf2/HO-1 signal pathway.Bioengineered. 2021;12(1):)2616-2626. Ding ZH, Zhong RX, Yang YN, Xia TY, Wang WJ, Wang Y, et al.Systems pharmacology reveals the mechanism of activity of Ge-Gen-Qin-Lian decoction against LPS-induced acute lung injury: A novel strategy for exploring active components and effective mechanism of TCM formulae.Pharmacol Res. 2020;156:104759. Dhlamini Q, Wang W, Feng GF, Chen AP, Chong L, Li X et al.FGF1 alleviates LPS-induced acute lung injury via suppression of inflammation and oxidative stress.Mol Med. 2022;28(1) :73. Yin HL, Feng YJ, Duan Y, Ma SL, Guo ZL, Wei YZ.Hydrogen gas alleviates lipopolysaccharide-induced acute lung injury and inflammatory response in mice.J Inflamm (Lond). 2022;19(1):16. Fan DS, Wang D, Zhu LH.Protective role of scutellarin on LPS induced - Acute lung injury and regulation of apoptosis, oxidative stress and reduction of mitochondrial dysfunction.Saudi J Biol Sci. 2022;29(1):371-378. Hsieh YH, Deng JS, Pan HP, Liao JC , Huang SS, Huang GJ.Sclareol ameliorate lipopolysaccharide-induced acute lung injury through inhibition of MAPK and induction of HO-1 signaling.Int Immunopharmacol. 2017;44:16-25. Tang LL, Zhu LY, Zhang W, Yang XY, Chen QG, Meng ZY, et al.Qi-Xian Decoction Upregulated E-cadherin Expression in Human Lung Epithelial Cells and Ovalbumin-Challenged Mice by Inhibiting Reactive Oxygen Species-Mediated Extracellular-Signal-Regulated Kinase (ERK) Activation.Med Sci Monit. 2020;26:e922003. Ding Y, Zheng YJ, Huang JD, Peng WW, Chen XX Kang XJ, et al. UCP2 ameliorates mitochondrial dysfunction, inflammation, and oxidative stress in lipopolysaccharide-induced acute kidney injury.Int Immunopharmacol. 2019;71:336-349. Wang LL, Li ZY, Lu TL, Su LL, Mao CQ, Zhang YT, et al.The potential mechanism of Choulingdan mixture in improving acute lung injury based on HPLC-Q-TOF-MS, network pharmacology and in vivo experiments.Biomed Chromatogr. 2023;37(10):e5709. Song JQ, Du GL, Wu HY, Gao XL, Yang Z, Liu B, et al. Protective effects of quercetin on traumatic brain injury induced inflammation and oxidative stress in cortex through activating Nrf2/HO-1 pathway.Restor Neurol Neurosci. 2021;39(1):73-84. CHEN C, YIN YY, WU XF, Wu RR,Xu YY. Advance in researches on role of MAPK and PI3K/AKT pathways in ROS-induced activation of nuclear factor erythroid 2-related factor 2.Chin J Pub Health. 2016;32(6) :870-873. Rao J , Qian X , Li G , Pan X , Zhang C , Zhang F, et al.ATF3-mediated NRF2/HO-1 signaling regulates TLR4 innate immune responses in mouse liver ischemia/reperfusion injury.Am J Transplant. 2015;15(1):76-87. Nguyen TT, Deng Z, Guo RY, Chai JW, Li R, Zeng QY, et al.Periplaneta Americana Extract Ameliorates LPS-induced Acute Lung Injury Via Reducing Inflammation and Oxidative Stress.Curr Med Sci. 2023;43(3) :445-455. Chien TM, Hsieh PC, Huang SS, Deng JS, Ho YL, Chang YS, et al.Acanthopanax trifoliatus inhibits lipopolysaccharide-induced inflammatory response in vitro and in vivo.Kaohsiung J Med Sci. 2015;31(10):499-509. Oh Yong Jin , Jin Seong Eun , Shin HyeunKyoo , Ha Hyekyung.Daeshiho-tang attenuates inflammatory response and oxidative stress in LPS-stimulated macrophages by regulating TLR4/MyD88, NF-κB, MAPK, and Nrf2/HO-1 pathways.Sci Rep. 2023;13(1):18891. Song JZ, Zhao X, Bo JQ, Lv ZY, Li GR, Chen YY, et al.A polysaccharide from Alhagi honey protects the intestinal barrier and regulates the Nrf2/HO-1-TLR4/MAPK signaling pathway to treat alcoholic liver disease in mice.J Ethnopharmacol. 2024;321:117552. Zhang WJ, Sun MY, Lv GF,Guo WT,Hu JN,Gu JY, et al.Exploring the mechanism of tenghuang jiangu wan in osteoporosis treatment based on network pharmacology, molecular docking and experimental pharmacology.Chin J Analy Chem. 2024;52(1):100351. Proudfoot AG , McAuley DF , Griffiths MJD , Hind M.Human models of acute lung injury.Dis Model Mech. 2011;4(2) :145-53. Yu SL, Shi M, Liu CT, Liu QH, Guo J, Yu SY, et al.Time course changes of oxidative stress and inflammation in hyperoxia-induced acute lung injury in rats.Iran J Basic Med Sci. 2015;18(1) :98-10. Nieman GF , Andrews P, Satalin J, Wilcox K, KollischSingule M, Madden M, et al.Acute lung injury: how to stabilize a broken lung.Crit Care. 2018;22(1):136. Zheng YL, Zheng M, Shao J, Jiang CX, Shen J, Tao RJ, et al.Upregulation of claudin‑4 by Chinese traditional medicine Shenfu attenuates lung tissue damage by acute lung injury aggravated by acute gastrointestinal injury.Pharm Biol. 2022;60(1):1981-1993. Li L, Wu YZ, Wang JB, Yan HM, Lu J, Wan Y, et al.Potential Treatment of COVID-19 with Traditional Chinese Medicine: What Herbs Can Help Win the Battle with SARS-CoV-2? .Engineering (Beijing). 2022 ;19 :139-152. Zhang JL , Li WX, Li Y, Wong MS, Wang YJ, Zhang Y. Therapeutic options of TCM for organ injuries associated with COVID-19 and the underlying mechanism.Phytomedicine. 2021;85 :153297. Li XQ, Yang AD.Study on pathogenesis and traditional Chinese medicine syndrome differentiation of acute lung injury.Chin J TCM WM Crit Care. 2018;25(1):9-14. Roberts AM.Central role of oxidative stress and its signaling pathways in causing and preventing acute lung injury.Crit Care Med. 2011;39(12):2776-7. Zhang QQ, Feng AZ, Zeng MN, Zhang BB, Shi JY, Lv YX,et al.Chrysosplenol D protects mice against LPS-induced acute lung injury by inhibiting oxidative stress, inflammation, and apoptosis via TLR4-MAPKs/NF-κB signaling pathways.Innate Immun. 2021;27(7-8):514-524. Kara CS, Alexander VO, Evelyne G, Andrew MR.Differential effects of nitric oxide synthesis on pulmonary vascular function during lung ischemia-reperfusion injury.Arch Physiol Biochem. 2009;115:34-46. Knepler JL, Taher LN, Gupta MP, Patterson C, Pavalko F, Ober MD, et al.Peroxynitrite causes endothelial cell monolayer barrier dysfunction. Am J Physiol Cell Physiol. 2001;81: C1064-C1075. Ovechkin AV, Lominadze D, Sedoris KC, Robinson TW, Tyagi SC, Roberts AM. Lung ischemia-reperfusion injury: Implications of oxidative stress and plateletarteriolar wall interactions.Arch Physiol Biochem. 2007;113:1-12. Jiang SY, Pi X. Research advances in uncoupling effect of endothelial nitric oxide synthase in ventilator‑associated lung injury.Int J Anesth Resus. 2021;42(11):1213-1216. Tang Q, Su YW, Xian CJ.Determining Oxidative Damage by Lipid Peroxidation Assay in Rat Serum.Bio Protoc. 2019;9(12) :e3263. Kumar S, Sun XT, Noonepalle SK, Lu Q, Zemskov E, Wang T, et al. Hyper-activation of pp60Src limits nitric oxide signaling by increasing asymmetric dimethylarginine levels during acute lung injury.Free Radic Biol Med. 2017;102:217-228. Zorov DB , Juhaszova M, Sollott SJ.Mitochondrial reactive oxygen species (ROS) and ROS-induced ROS release.Physiol Rev. 2014;94(3):909-50. Zhong XY, He J, Zhang X, Li CS, Tian XF, Xia WY, et al. UCP2 alleviates tubular epithelial cell apoptosis in lipopolysaccharide-induced acute kidney injury by decreasing ROS production.Biomed Pharmacother. 2019; 115:108914. Yin XF, Zhu GS, Wang Q, Fu YD, Wang J, Xu B. Ferroptosis, a New Insight Into Acute Lung Injury.Front Pharmacol. 2021;12:709538. Dodson M, CastroPortuguez R, Zhang DD.NRF2 Plays a Critical Role in Mitigating Lipid Peroxidation and Ferroptosis.Redox Biol. 2019;23:101107. Kerins MJ, Ooi A.The Roles of NRF2 in Modulating Cellular Iron Homeostasis.Antioxid Redox Signaling. 2018;29 (17):1756-1773. Jiang T, Cheng H, Su JJ, Wang XC, Wang QX, Chu J, et al.Gastrodin Protects against Glutamate-Induced Ferroptosis in HT-22 Cells through Nrf2/ HO-1 Signaling Pathway.Toxicol In Vitro. 2020;62:104715. Zhang V, Nemeth E, Kim A.Iron in Lung Pathology.Pharmaceuticals.2019;12(1):30. Luan RM, Ding DY, Yang JL.The protective effect of natural medicines against excessive inflammation and oxidative stress in acute lung injury by regulating the Nrf2 signaling pathway.Front Pharmacol. 2022;13:1039022. Huang JH, Nong XP, Chen YL, Zhang AM, Chen LR.3-O-trans-caffeoyloleanolic acid improves acute lung injury via anti-inflammation and antioxidative stress-involved PI3K/AKT pathway.Chem Biol Drug Des. 2021;98(1):114-126. Yan J, Li JJ, Zhang L, Sun Y, Jiang J, Huang Y, et al. Nrf2 protects against acute lung injury and inflammation by modulating TLR4 and Akt signaling.Free Radic Biol Med. 2018;121: 78-85. Zhou YK, Qian C, Tang Y, Song MY, Zhang T, Dong GL, et al. Advance in the pharmacological effects of quercetin in modulating oxidative stress and inflammation related disorders.Phytother Res. 2023;37(11):4999-5016. Chen J, Liu J, Wang Y, Hu XM, Zhou F, Hu YM, et al.Wogonin mitigates nonalcoholic fatty liver disease via enhancing PPARα/AdipoR2, in vivo and in vitro,Biomed Pharmacother. 2017;91:621-631. Xia SL, Lin HL, Liu H, Lu ZD, Wang H, Fan ST, et al. Honokiol Attenuates Sepsis-Associated Acute Kidney Injury via the Inhibition of Oxidative Stress and Inflammation.Inflammation. 2019;42(3):826-834. Liu AJ, Xun SC, Zhou GZ, Zhang YL, Lin L. Honokiol alleviates sepsis-associated cardiac dysfunction via attenuating inflammation, apoptosis and oxidative stress.J Pharm Pharmacol. 2023 ;75(3):397-406. Kühnl J, Roggenkamp D, Gehrke SA , Stäb F, Wenck H, Kolbe L, et al. Licochalcone A activates Nrf2 in vitro and contributes to licorice extract-induced lowered cutaneous oxidative stress in vivo.Exp Dermatol. 2015;24(1):42-7. Additional Declarations No competing interests reported. Supplementary Files GAPDH.tif HO1.tif Nrf2.tif TLR4.tif SupplementaryMaterial1.docx SupplementaryMaterial2.docx SupplementaryMaterial3.docx SupplementaryMaterial4.docx SupplementaryMaterial5.docx Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4584646","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":322283148,"identity":"7dabb460-8859-46f9-a64d-5747ae5dc6b1","order_by":0,"name":"Lei ZHANG","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAu0lEQVRIiWNgGAWjYDACCeaGgx8qJOTY2NsPEKuFsfGxxBkbYz6eMwlEa2k24G1LS5wn4WBAnA752Y1tEhJsh9PbJBgSGH5UbCOshXHOwTaJAp7DuW3SjQcYe87cJqyFWSIRaIsEUIvMgQRmxjYitLCBtPAYHE5nk0gwIE4Lj0RiswFPQloC8VokJBKBgXzAxrANGMgHifKL/IzkAwc//pOQl29vP/jgRwURWlDAARLVj4JRMApGwSjABQDXkDruW9RZLgAAAABJRU5ErkJggg==","orcid":"","institution":"Kunshan Hospital of Traditional Chinese Medicine","correspondingAuthor":true,"prefix":"","firstName":"Lei","middleName":"","lastName":"ZHANG","suffix":""},{"id":322283149,"identity":"a9c9b9f5-c21c-4f9e-a71f-d2a77c4d99bb","order_by":1,"name":"Wei Zhu","email":"","orcid":"","institution":"Kunshan Hospital of Traditional Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Wei","middleName":"","lastName":"Zhu","suffix":""},{"id":322283150,"identity":"c7a7aba9-ec27-457d-b3b6-800734709c47","order_by":2,"name":"Cong Zhang","email":"","orcid":"","institution":"Kunshan Rehabilitation Hospital","correspondingAuthor":false,"prefix":"","firstName":"Cong","middleName":"","lastName":"Zhang","suffix":""}],"badges":[],"createdAt":"2024-06-15 03:23:19","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4584646/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4584646/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":60479653,"identity":"e773c7bd-2b0c-4da5-a4c3-65e9e7b775ba","added_by":"auto","created_at":"2024-07-17 08:28:36","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":82041,"visible":true,"origin":"","legend":"\u003cp\u003eTargets related to ALI and active ingredient-targets of DYY. (A) Herb-ingredient-targets gene network. (B) The Venn diagram of ALI therapeutic targets. (C) Venn diagram of ALI targets and DYY targets.\u003c/p\u003e","description":"","filename":"1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4584646/v1/db6a0a3bca2d2d5b20b46603.jpg"},{"id":60479638,"identity":"f470d2bc-0d00-4491-9e57-afbf3d1dddb2","added_by":"auto","created_at":"2024-07-17 08:28:35","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":72332,"visible":true,"origin":"","legend":"\u003cp\u003eThe PPI network of DYY’s targets for the treatment of ALI. (A) Topology screening process for PPI networks. (B) The core and non-core target networks. (C) Top 15 core targets. (D) PPI network based on cluster analysis.\u003c/p\u003e","description":"","filename":"2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4584646/v1/0ba7f88e2ba959dc8835857a.jpg"},{"id":60480376,"identity":"9e56d9d3-b491-4177-8d5a-4122ea2bc4e9","added_by":"auto","created_at":"2024-07-17 08:36:35","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":756610,"visible":true,"origin":"","legend":"\u003cp\u003eGO and KEGG enrichment analysis of 111 targets. (A) Molecular function category. (B) Cellular component category. (C) Biological process category.(D) KEGG pathway analysis. (E) Sankey diagram for KEGG signaling pathway analysis. The lines join the targets on the left and pathways on the right .\u003c/p\u003e","description":"","filename":"3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4584646/v1/0f36b5bbab21a9c659be49f6.jpg"},{"id":60481872,"identity":"7b0e6c07-1d96-4661-9b56-ff240ac3d324","added_by":"auto","created_at":"2024-07-17 08:52:35","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":52902,"visible":true,"origin":"","legend":"\u003cp\u003eIdentification of active compounds in DYY using UHPLC-MS/MS. (A) ESI- mode. (B) ESI+ mode.\u003c/p\u003e","description":"","filename":"4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4584646/v1/e2b20c725bb7d561095f97f9.jpg"},{"id":60479646,"identity":"2b86f793-f06b-435d-a092-1d8fb87ad81a","added_by":"auto","created_at":"2024-07-17 08:28:35","extension":"jpg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":70020,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of DYY on treating ALI rats.(A).Pulmonary wet-to-dry ratio (x±s, n= 6). compared with the Con group,**P \u0026lt; 0.01; compared with the LPS group,# p\u0026lt;0.05.(B).Histopathological changes in LPS-induced lung tissues（×200).\u003c/p\u003e","description":"","filename":"5.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4584646/v1/a8b9c070210673a8c6e1e178.jpg"},{"id":60480379,"identity":"15973f3d-d877-41e1-b2e8-2af7ad602964","added_by":"auto","created_at":"2024-07-17 08:36:35","extension":"jpg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":94462,"visible":true,"origin":"","legend":"\u003cp\u003eDYY alleviates LPS-induced inflammation and oxidative stress in ALI rats. (A) IL-6 level .(B) TNF-α level . (C) Nitrite level . (D) MDA level . (E) ROS level . (F) UCP2 expression. (G) DYY reduced ROS levels in ALI rats. compared with the Con group,**P \u0026lt; 0.01; compared with the LPS group,# p\u0026lt;0.05, # # p\u0026lt;0.01.\u003c/p\u003e","description":"","filename":"6.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4584646/v1/7941cc02945b2fcdb2045be3.jpg"},{"id":60481096,"identity":"0ea61b61-b9e0-45e9-84d0-5ab75ed6b3bb","added_by":"auto","created_at":"2024-07-17 08:44:35","extension":"jpg","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":40472,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of DYY on the expression of pathway proteins in lung tissue (x±s, n=3). (A)Overall expression of proteins.(B)Nrf2.(C).HO-1.(D).TLR4. compared with the Con group,**P \u0026lt; 0.01; compared with the LPS group,# p\u0026lt;0.05\u003c/p\u003e","description":"","filename":"7.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4584646/v1/b2346da5d47e77edaa42e62f.jpg"},{"id":60479655,"identity":"ccf6d05f-f584-4052-a70d-4ea55d1aad8b","added_by":"auto","created_at":"2024-07-17 08:28:36","extension":"jpg","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":77249,"visible":true,"origin":"","legend":"\u003cp\u003eMolecular docking patterns between representativecomponents and targets of DYY for treatment of ALI. (A) Anhydroicaritin-HO-1.(B) Honokiol-HO-1.(C) Licochalcone A—TLR4. (D) Wogonin—TLR4.(E) Quercetin—Nrf2.\u003c/p\u003e","description":"","filename":"8.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4584646/v1/00c4643006ac78d258a0d406.jpg"},{"id":60595107,"identity":"351b1728-4ed1-48c9-8e8d-12dc801317af","added_by":"auto","created_at":"2024-07-18 15:27:00","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2230590,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4584646/v1/9aafa35d-f8c5-418d-bafd-bd188e02a92d.pdf"},{"id":60481094,"identity":"b5ce9ac3-ab0f-4ef0-87a8-daf437d35e51","added_by":"auto","created_at":"2024-07-17 08:44:35","extension":"tif","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":1488650,"visible":true,"origin":"","legend":"","description":"","filename":"GAPDH.tif","url":"https://assets-eu.researchsquare.com/files/rs-4584646/v1/c7331d26c6c1ec6a2e008f09.tif"},{"id":60479642,"identity":"d162e828-ffb9-476a-9ed5-3847ef2041bf","added_by":"auto","created_at":"2024-07-17 08:28:35","extension":"tif","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":1488650,"visible":true,"origin":"","legend":"","description":"","filename":"HO1.tif","url":"https://assets-eu.researchsquare.com/files/rs-4584646/v1/96f9cb40b6a870842e8a84da.tif"},{"id":60479650,"identity":"13370b97-1294-4c14-84d0-1812c99bf970","added_by":"auto","created_at":"2024-07-17 08:28:35","extension":"tif","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":1488650,"visible":true,"origin":"","legend":"","description":"","filename":"Nrf2.tif","url":"https://assets-eu.researchsquare.com/files/rs-4584646/v1/a8573d2a853b6cb9bf8968d9.tif"},{"id":60479648,"identity":"2fe21ede-5cb2-4931-89da-4b6c8522bbe2","added_by":"auto","created_at":"2024-07-17 08:28:35","extension":"tif","order_by":4,"title":"","display":"","copyAsset":false,"role":"supplement","size":1488650,"visible":true,"origin":"","legend":"","description":"","filename":"TLR4.tif","url":"https://assets-eu.researchsquare.com/files/rs-4584646/v1/9672a85fe2a4db119844573b.tif"},{"id":60479654,"identity":"9c4cc38e-2c06-4357-bb29-4538ffb73b3b","added_by":"auto","created_at":"2024-07-17 08:28:36","extension":"docx","order_by":5,"title":"","display":"","copyAsset":false,"role":"supplement","size":21078,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryMaterial1.docx","url":"https://assets-eu.researchsquare.com/files/rs-4584646/v1/82654ec600627a112358712a.docx"},{"id":60480381,"identity":"2d2ab277-2ff7-4310-9d93-2bebd6d5956d","added_by":"auto","created_at":"2024-07-17 08:36:35","extension":"docx","order_by":6,"title":"","display":"","copyAsset":false,"role":"supplement","size":17981,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryMaterial2.docx","url":"https://assets-eu.researchsquare.com/files/rs-4584646/v1/4e6e4e15997a19f415f1ab41.docx"},{"id":60479651,"identity":"6f6b80ec-5860-42e5-8ef1-489daa1db1ad","added_by":"auto","created_at":"2024-07-17 08:28:35","extension":"docx","order_by":7,"title":"","display":"","copyAsset":false,"role":"supplement","size":14408,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryMaterial3.docx","url":"https://assets-eu.researchsquare.com/files/rs-4584646/v1/5784d2e149f472022fac75f0.docx"},{"id":60480383,"identity":"d0c2e974-4dd5-46cd-92c8-016032eb866b","added_by":"auto","created_at":"2024-07-17 08:36:35","extension":"docx","order_by":8,"title":"","display":"","copyAsset":false,"role":"supplement","size":16082,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryMaterial4.docx","url":"https://assets-eu.researchsquare.com/files/rs-4584646/v1/ff853fe2d0482398c1040a96.docx"},{"id":60479649,"identity":"9efa9441-1b37-406e-bcdc-b10a6cca215d","added_by":"auto","created_at":"2024-07-17 08:28:35","extension":"docx","order_by":9,"title":"","display":"","copyAsset":false,"role":"supplement","size":15454,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryMaterial5.docx","url":"https://assets-eu.researchsquare.com/files/rs-4584646/v1/0b1700db7e21ccf47cf6c4e4.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Exploring the effect and mechanism of DaYuan Yin against acute lung injury by Network Pharmacology,molecular docking and experiment validation","fulltext":[{"header":"Introduction","content":"\u003cp\u003eALI is a life-threatening disease with a high fatality rate of 30\u0026ndash;40%[\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. Current treatments, such as supportive mechanical ventilation and drugs like glucocorticoids or antibiotics, have limited effectiveness, and even lead to permanent damage [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. Therefore, the overall synergy of TCM may bring a better choice for the treatment of ALI.\u003c/p\u003e \u003cp\u003eIt has been confirmed that the complex pathogenesis of ALI involves uncontrolled pulmonary inflammation[\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e, \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e], driven by cytokines like TNF-α, IL-1 β, and IL-6[\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. Excessive inflammation leads to neutrophil infiltration in lung tissue, lung cell injury, alveolar-capillary permeability increase,and impaired gas exchange[\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. In addition,ALI pathogenesis involves oxidative stress from reactive oxygen species, which play a key role in inflammation[\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e, \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. ROS produced by phagocytes in response to microorganisms and inflammatory stimuli are necessary for defense but must be regulated to prevent excessive tissue damage[\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. Increased ROS production can in turn lead to higher endothelial permeability and inflammatory cell migration acrossing the endothelial barrier to tissue, which eventually leads to oxidative stress and acute inflammation[\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. It can be seen that blocking oxidative stress and inflammation of the lung may be a potential strategy for the treatment of ALI.\u003c/p\u003e \u003cp\u003eDYY is a classic prescription of Wu Youyou, a famous doctor in China in the early Qing Dynasty, which can be used to treat febrile plagues. The whole prescription is composed of seven traditional Chinese medicines: Radix Paeoniae Alba, betel nut, licorice, Scutellaria baicalensis, Magnolia officinalis and Anemarrhena anemarrhena (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e):[\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. Recent pharmacological research has demonstrated that DYY can regulate respiratory tract infectionsinfection [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e], decrease inflammatory factors, and protect lung tissue[\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e].Magnolol and honokiol[\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e, \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e], and licorice flavonoids[\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e], the main active ingredients in DYY, also reduce inflammation and enhance antioxidation. However, the effectiveness and mechanism of DYY for ALI require further investigation.\u003c/p\u003e \u003cp\u003eNetwork pharmacology helps to understand how traditional Chinese medicine compounds work in treating diseases by analyzing their effects and mechanisms[\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. By studying the interaction network of multiple genes, targets, and pathways, we can predict the potential targets and mechanisms of traditional Chinese medicine in treating different diseases[\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. In this study, we used network pharmacology along with in vivo experiments and molecular docking to investigate how DYY works at the molecular level, confirming our findings.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eDetailed information of herbs in DYY\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"5\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePharmaceutical name\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eBotanical plant name\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eChinese name\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eWeight (g)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003ePart(s) used\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eArecae Semen\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eAreca catechu\u003c/em\u003e L.\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eBinglang\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e7.46\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eseed\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMagnolia Officinalis\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eMagnolia officinalis Rehd.et\u003c/em\u003e Wils.\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eHoupo\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e3.73\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003ebarks\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAmomum tsao-ko\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eAmomum tsao-ko Crevost et\u003c/em\u003e Lemaire.\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCaoguo\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e1.87\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003efruit\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAnemarrhena asphodeloides\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eAnemarrhena asphodeloides\u003c/em\u003e\u0026nbsp;Bunge\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eZhimu\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e3.73\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003erhizome\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRadix paeoniae Alba\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003ePaeonia lactiflora\u003c/em\u003e\u0026nbsp;Pall.\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eBaishao\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e3.73\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eroots\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eScutellaria Baicalensis\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eScutellaria baicalensis\u003c/em\u003e\u0026nbsp;Georgi\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eHuangqin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e3.73\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eroots\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGlycyrrhiza\u0026nbsp;glabra\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eGlycyrrhiza uralensis\u003c/em\u003e\u0026nbsp;Fisch.\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGancao\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e1.87\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eroots and rhizomes\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eStudy on Network Pharmacology of DYY Anti-ALI\u003c/h2\u003e \u003cdiv id=\"Sec4\" class=\"Section3\"\u003e \u003ch2\u003eDYY herbal compounds and their targets\u003c/h2\u003e \u003cp\u003eThe active components and target proteins of DYY are derived from TCMSP database(\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://old.tcmsp-e.com/tcmsp.php\u003c/span\u003e\u003cspan address=\"https://old.tcmsp-e.com/tcmsp.php\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e), with the conditions of oral bioavailability (OB)\u0026thinsp;\u0026ge;\u0026thinsp;30%, Caco-2 permeability (Caco-2) \u0026ge; -0.4, blood-brain barrier (BBB) \u0026ge; -0.3,drug half-life (HL)\u0026thinsp;\u0026ge;\u0026thinsp;4 h and drug likeness (DL)\u0026thinsp;\u0026ge;\u0026thinsp;0.18[\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e, \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e], the active compounds and their protein targets were obtained. The target proteins were limited to humans, and unified in Uniprot protein database (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://\u003c/span\u003e\u003cspan address=\"https://\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e\u003ca href=\"https://old.tcmsp-e.com/tcmsp.php\" target=\"_blank\"\u003ewww.Uniprot.Org/\u003c/a\u003e\u003c/span\u003e\u003cspan address=\"http://www.Uniprot.Org/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) standardize the specification [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. Cytoscape 3.7.2 was used to create the \"herb-active ingredients-targets\" network [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e].\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eSearch of ALI-related genes\u003c/h2\u003e \u003cp\u003eWith \"acute lung injury\" as the keyword, the duplicates were removed from GeneCards (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.genecards.org/\u003c/span\u003e\u003cspan address=\"https://www.genecards.org/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) (value\u0026thinsp;\u0026ge;\u0026thinsp;median), DisGeNET (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.disgenet.org\u003c/span\u003e\u003cspan address=\"https://www.disgenet.org\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) and OMIM (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.omim.org/\u003c/span\u003e\u003cspan address=\"https://www.omim.org/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) databases, and \"Homo sapiens\" was selected as the species.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eConstruction of PPI network and selection of key targets\u003c/h2\u003e \u003cp\u003eVenn diagram (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://bioinformatics.psb.ugent.be/webtools/Venn/)wa\u003c/span\u003e\u003cspan address=\"https://bioinformatics.psb.ugent.be/webtools/Venn/)wa\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003es used to identify common target genes for DYY and ALI, which were then analyzed in STRING12.0 (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://cn.string-db.org\u003c/span\u003e\u003cspan address=\"https://cn.string-db.org\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) with a minimum network interaction score confidence of 0.7[\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e].The resulting network was visualized and evaluated in Cytoscape3.7.2 after removing the free node from PPI network, and the target's network topology parameters were analyzed using CytoNCA, including degree centrality(DC), betweenness centrality (BC), and closeness centrality (CC).The central target of DYY was selected according to the degree value greater than the respective median (DC\u0026thinsp;\u0026gt;\u0026thinsp;13, BC\u0026thinsp;\u0026gt;\u0026thinsp;0.003, CC\u0026thinsp;\u0026gt;\u0026thinsp;0.45) [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. Filter the PPI network using the MCODE plug-in in Cytoscape using various cutoff values: degree\u0026thinsp;=\u0026thinsp;2, k-core\u0026thinsp;=\u0026thinsp;2, node score \u0026minus;\u0026thinsp;0.2, maximum depth\u0026thinsp;=\u0026thinsp;100[\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e].\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eGO and KEGG enrichment analysis\u003c/h2\u003e \u003cp\u003eGO and KEGG pathway enrichment analysis of the main targets of DYY and ALI were performed using Metascape(\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://metascape.org/\u003c/span\u003e\u003cspan address=\"https://metascape.org/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. Based on the P-value less than 0.05,the top 20 of biological process (BP), cellular component (CC), molecular function (MF) terms and the top 30 of KEGG terms were imported and visualized on the bioinformatics platform (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://www.bioinformatics.com.cn/\u003c/span\u003e\u003cspan address=\"http://www.bioinformatics.com.cn/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) to analyze the key molecular biology processes and key targets' signal path.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eMolecular docking verification\u003c/h2\u003e \u003cp\u003eWe identified active ingredients associated with ALI using \u0026ldquo;herb-active ingredients-targets\u0026rdquo; network and UHPLC-MS/MS results. The structures of these ingredients were downloaded from the TCMSP database in 2D and SDF formats. Using chem 3D software, we converted the structures to 3D structure in mol2 format. The 3D structures of Nrf2, HO-1, and TLR4 were obtained from the RCSB Protein Data Bank (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.rcsb.org/\u003c/span\u003e\u003cspan address=\"https://www.rcsb.org/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e), and the crystallographic structures of targets were prepared for dehydratation and hydrotreatment before using Autodock 1.5.7 (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://autodock.scripps.edu/\u003c/span\u003e\u003cspan address=\"http://autodock.scripps.edu/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) for molecular docking[\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. Autodock Vina 1.1.2 (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://vina.scripps.edu/\u003c/span\u003e\u003cspan address=\"http://vina.scripps.edu/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) was selected to calculate binding energy between active ingredients and proteins. A binding energy \u0026le;-5.0 kJ/mol is considered a standard for good binding efficiency[\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. Results were visualized using Pymol and LigPlot [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e].\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003ePreparation and quality control of DYY\u003c/h2\u003e \u003cdiv id=\"Sec10\" class=\"Section3\"\u003e \u003ch2\u003eMaterials and reagents\u003c/h2\u003e \u003cp\u003eArecae Semen(Binglang), Magnolia Officinalis(Houpo), Amomum tsao-ko(Caoguo), Anemarrhena asphodeloides(Zhimu), Radix paeoniae Alba(Baishao), Scutellaria Baicalensis(Huangqin), Glycyrrhiza glabra(Gancao) were purchased from Suzhou Tianling traditional Chinese Medicine Co., Ltd. and were appraised by pharmacy experts. The criteria for the quality of the herbs were in accordance with the 2020 Chinese pharmacopoeia [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]. Methanol and acetonitrile were purchased from EMD Millipore Corporation(Germany),and formic acid from Aladdin Biochemical Technology Co., Ltd. (Shanghai, China), and all chemicals and solvents were analytical reagent or chromatographic grade. Ultra-pure water was prepared using a Milli-Q water purification system (Millipore, Bedford, MA, USA).\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eExtraction for DYY testing sample\u003c/h2\u003e \u003cp\u003eAccording to the proportion of DYY in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e, all the herbs were soaked in water with 10 times the amount of raw medicine for 30 minutes, and then extracted twice with electric heating sleeve for 1 hour each time[\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. The extract was mixed and concentrated to about 1g/kg.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eUHPLC-MS analysis\u003c/h2\u003e \u003cdiv id=\"Sec13\" class=\"Section3\"\u003e \u003ch2\u003eInstruments\u003c/h2\u003e \u003cp\u003eVanquish Ultra performance liquid chromatograph and QE Ultra Resolution Mass Spectrometer (Thermo Fisher Scientific, USA), ACQUITY UHPLC HSST3 (100 mm \u0026times; 2.1 mm, 1.8 \u0026micro;m) column (Waters, USA), 5430R table-top high-speed refrigerated centrifuge (Shanghai Eppendorf ,China), KQ-2200E ultrasonic cleaning machine (Kunshan Ultrasonic instrument Co., Ltd., China).\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eSample treatment\u003c/h2\u003e \u003cp\u003eTook 1ml sample, added 2 times the volume of methanol-acetonitrile solution (1:1, v/v), vortex for 60s, sonicated for 30 min, and centrifugation for 20 min(12,000 rpm, 4\u0026deg;C), the supernatant was filtered using a 0.22 \u0026micro;m organic filter film,and transferred to insert-equipped vials for LC-MS analysis.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eLiquid chromatography-mass spectrometry conditions\u003c/h2\u003e \u003cp\u003eThe sample extracts were analyzed using an UHPLC\u0026ndash; Orbitrap-MS system (UHPLC, Vanquish; MS,HFX). The analytical conditions were as follows, UHPLC: column, Waters HSS T3(100*2.1 mm, 1.8\u0026micro;m); column temperature, 40 C; flow rate, 0.3 mL/min; injection volume, 2\u0026micro;L; solvent system, water (0.1% Acetic acid): acetonitrile (0.1% Acetic acid); gradient program,100: 0 V/V at 0\u0026ndash;1 min, 5:95 V/V at 9.0 min, 5: 95 V/V at 9.0\u0026ndash;13.0 min, 100:0 V/V at 13.1\u0026ndash;17 min.\u003c/p\u003e \u003cp\u003eHRMS data were recorded on a Q Exactive HFX Hybrid Quadrupole Orbitrap mass spectrometer equipped with a heated ESI source utilizing the Full-msddMS2 MS acquisition methods. The ESI source parameters were set as follows: spray voltage, -2.8 kV/3.0 kV; sheath gas pressure, 40 arb; aux gas pressure, 10 arb; sweep gas pressure, 0 arb; capillary temperature, 320℃; and aux gas heater temperature, 350℃\u003c/p\u003e \u003cp\u003eThe original data were processed by metabonomics software ProgenesisQI (WatersCorporation,Milford,USA) for baseline filtering, peak identification, integration, retention time correction and peak alignment to obtain a data matrix of retention time, mass-to-charge ratio and peak intensity. The main parameters include: (1) only retain variables with non-zero values of more than 80% in any group of samples; (2) total peak normalization, and then delete variables with relative standard deviation (RSD)\u0026thinsp;\u0026ge;\u0026thinsp;30% of QC samples. Finally, Human Metabolome Database (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://www.hmdb.ca/\u003c/span\u003e\u003cspan address=\"http://www.hmdb.ca/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]and METLIN (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://metlin.scripps.edu/\u003c/span\u003e\u003cspan address=\"https://metlin.scripps.edu/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) database [\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e] were used for qualitative analysis.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003eAnimal experiments\u003c/h2\u003e \u003cdiv id=\"Sec17\" class=\"Section3\"\u003e \u003ch2\u003eReagents and instruments\u003c/h2\u003e \u003cp\u003eLipopolysaccharides (LPS) ,RIPA Cracking Buffer and MDA kit were obtained from Solarbio Science \u0026amp; Technology Co., Ltd. (Beijing, China). IL-6 and TNF-α enzyme-linked immunosorbent assay (ELISA) kits were supplied by Enzyme-linked Biotechnology Co., Ltd. (Shanghai, China). NO kit was obtained from Jiancheng Bioengineering Institute (Nanjing, China).2,7-Dichlorodihydrofluorescein diacetate(DCFH-DA)kit was purchased from Biyuntian Biotechnology Co. (Shanghai, China). Trizol kit was obtained fromYeasen Biotechnology Co.,Ltd.(Shanghai,China). BCA kit was provided by Fisher Scientific Inc(Shanghai,China). UCP2 was obtained General biology Co., Ltd (Anhui,China).All antibodies Nrf2、HO-1 and TLR4were supplied by Proteintech Group, Inc (Wuhan,China).\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003eAnimals\u003c/h2\u003e \u003cp\u003eSPF male Sprague-Dawley rats (6\u0026ndash;8 weeks old) from Pengyue Experimental Animal breeding Co., Ltd.(Jinan, China) were fed under ventilated and temperature-controlled conditions (humidity of 25.55%, light / dark cycle for 12 hours. All animal procedures were approved by the Animal Experimental Ethics Committee (SWS20240130)and followed their guidelines.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003eEstablishment of ALI model and treatment of DYY\u003c/h2\u003e \u003cp\u003eAfter 1 week of domestication, rats were randomly divided into 3 groups (n\u0026thinsp;=\u0026thinsp;6): Con, LPS, and DYY groups. ALI was induced by a single intraperitoneal injection of 10mg/kg LPS. DYY (4.7g/kg/d) was given by gavage once a day for 1 week. Con and LPS groups received saline. Rats were euthanized 12 hours after the last treatment for BALF and lung tissue collection.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003eHistopathological analysis\u003c/h2\u003e \u003cp\u003eLeft lung tissues of rats were taken, fixed with 10% formalin, then embedded in paraffin wax and made into 5\u0026micro;m thick sections, washed with PBS buffer, stained with hematoxylin and eosin, sealed with neutral gum, and images were captured by microscope (NikonTi,Japan).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec21\" class=\"Section2\"\u003e \u003ch2\u003ePulmonary edema assessment\u003c/h2\u003e \u003cp\u003eExtract lung tissue, rinsed with normal saline and remove residual tissue. After absorbing the surface liquid, the wet mass of the lung was obtained, and then dried in an oven at 70 ℃ for 48 hours to obtain the dry weight. The ratio of W/D was calculated according to the weight to evaluate the degree of pulmonary edema[\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e, \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e].\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec22\" class=\"Section2\"\u003e \u003ch2\u003eDetermination of proinflammatory factors in BALF\u003c/h2\u003e \u003cp\u003eThe BALF liquid was centrifuged at 3000 rpm for 10 min at 4\u0026deg;C, then according to the manufacturer's instructions, the supernatants were used for detection of cytokines levels,such as TNF-α and IL-6 [\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e, \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e]。\u003c/p\u003e \u003cdiv id=\"Sec23\" class=\"Section3\"\u003e \u003ch2\u003eDetermination of MDA, NO and ROS in lung tissue\u003c/h2\u003e \u003cp\u003eROS, MDA and NO are usually used to express local or systemic oxidative stress [\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e]. The lung tissue was broken into small pieces and homogenized in lysozyme at 37 ℃ for 1 hour. Then filter the homogenate, centrifuge 3000g 20min at 4 ℃, and collect the supernatant. Then, quantify the MDA according to the manufacturer's recommended scheme[\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e] and use a reagent based on the Gliese reaction to determine the nitrite level to indirectly evaluate the NO content[\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e]. Then, the level of ROS in lung tissue was detected by DCFH-DA kit. In short, after harvesting the single cell suspension, 5 \u0026times; 10\u003csup\u003e5\u003c/sup\u003e cells were resuscitated in 1ml PBS with 1 \u0026micro;L DCFH-DA and analyzed for ROS response with the displayed fluorescence value using a microwell plate reader [\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e].\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec24\" class=\"Section2\"\u003e \u003ch2\u003eReal-time quantitative PCR analysis\u003c/h2\u003e \u003cp\u003eAccording to the manufacturer's instructions, the Trizol kit was used to extract total RNA from lung tissue and obtain cDNA. Finally, a two-step PCR amplification reaction was used to obtain threshold cycle (Ct) and average value from triplicate samples. Using GAPDH as the internal reference, 2-ΔΔCt was used to calculate the relative expression level of mRNA of target gene [\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e]. The primers were synthesized by General Biotechnology Co., LTD. (Anhui, China). Primer sequence sarelistedin Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimer sequence\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePrimer\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSequence\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eUCP2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eATGTGGTAAAGGTCCGCTTCC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eACAGTTGACAATGGCATTTCG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGAPDH\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGGTCATCAACGGGAAACCCATCA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCGCCAGTAGACTCCACGACATAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cdiv id=\"Sec25\" class=\"Section3\"\u003e \u003ch2\u003eWestern blot analysis\u003c/h2\u003e \u003cp\u003eThe lung tissue was homogenized using RIPA lysis bufferand proteins were extracted.Total protein was quantified using a BCA kit. The protein was then separated on a 10% SDS-PAGE gel and transferred to a PVDF membrane. The membrane was incubated with antibodies against Nrf2, HO-1, TLR4, and GAPDH overnight at 4\u0026deg;C, followed by a 2-hour incubation with a secondary antibody coupled with HRP.After washing with phosphate-buffered saline, antibodies were developed and exposed to enhanced chemiluminescence (ECL) to observe protein bands[\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e]. The strips were analyzed using ImageJ software (Bio-Rad, California, USA) with GAPDH as the loading control.\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec26\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eAll the experimental data were displayed as means\u0026thinsp;\u0026plusmn;\u0026thinsp;SD and analyzed using the SPSS 26.0 software (IBM Inc., USA).Comparisons of multiple groups were performed using one-way ANOVA and comparisons between two groups were performed using Student's t-test. A value of p\u0026thinsp;\u0026lt;\u0026thinsp;0.05 was considered statistically significant.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec28\" class=\"Section2\"\u003e \u003ch2\u003eNetwork pharmacology predicted the potential mechanisms of DYY for treating ALI\u003c/h2\u003e \u003cdiv id=\"Sec29\" class=\"Section3\"\u003e \u003ch2\u003eCollection of DYY targets and ALI targets\u003c/h2\u003e \u003cp\u003eA total of 95 active components were identified in the DYY prescription based on set screening conditions(Supplementary Material 1). Three compounds, Magnolol, honokiol, and quercetin, were considered active despite not meeting ADME parameters due to their known anti-inflammatory or antioxidant effects[\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e, \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e, \u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e]. A total of 234 therapeutic target proteins for these compounds in DYY were identified and their gene names were adjusted using the Uniport database(Supplementary Material 2). Then the herbal-ingredient-target gene network was created using Cytoscape3.7.2(Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). It includes different herbs and active ingredients(the surrounding circle),shared ingredients(the upper hexagon), and targets(the middle prism).There were 15 medicinal ingredients with a degree of \u0026ge;\u0026thinsp;15(Supplementary Material 3). 2529 ALI-related targets were gathered from GeneCards, DisGeNET, and OMIM databases(Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB). 111 overlapping genes between DYY target and ALI target were identified by Venn map (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC and SupplementaryMaterial 4).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003c/div\u003e\n\u003ch3\u003ePPI network analysis and core target screening\u003c/h3\u003e\n\u003cp\u003eWe imported 111 genes into the STRING database, creating a PPI network with 108 nodes and 1716 edges due to 3 proteins did not participate(Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB). Core targets were identified to construct a network based on their DC, BC, and CC values(Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA),with the top 15 targets sorted by degree shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC and detailed in Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e. Subnetworks identified by MCODE were divided into four groups for further analysis(Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eInformation of 15 core targets\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"5\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNo.\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eUniProt ID\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGene symbol\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eProtein name\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eDegree\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eP04637\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTP53\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCellular tumor antigen p53\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e52\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eP31749\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAKT1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eRAC-alpha serine/threonine-protein kinase\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e49\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eP05231\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eIL6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eInterleukin-6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e49\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eP40763\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSTAT3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eSignal transducer and activator of transcription 3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e47\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eP10415\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eBCL2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eApoptosis regulator Bcl-2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e42\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eP01375\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTNF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eTumor necrosis factor\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e42\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eP01106\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eMYC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eMyc proto-oncogene protein\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e41\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eP07900\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eHSP90AA1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eHeat shock protein HSP 90-alpha\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e40\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eP05412\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eJUN\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eTranscription factor Jun\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e40\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eP03372\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eESR1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eEstrogen receptor\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e38\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eP42574\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCASP3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCaspase-3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e38\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eQ16665\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eHIF1A\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eHypoxia-inducible factor 1-alpha\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e33\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eP28482\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eMAPK1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eMitogen-activated protein kinase 1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e32\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eP24385\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCCND1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eG1/S-specific cyclin-D1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e31\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eP01100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eFOS\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eProtein c-Fos\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e31\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cdiv id=\"Sec31\" class=\"Section2\"\u003e \u003ch2\u003eGO and KEGG enrichment analysis\u003c/h2\u003e \u003cp\u003eTo better understand how DYY works against ALI, we analyzed 111 overlapping targets using GO and KEGG in metscape. Figure\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA-C displays the each top 20 enrichment items for MF, CC, and BP. MF includes kinase binding, transcription factor binding, protein kinase activity, protein homodimerization activity, cytokine receptor binding, and more. CC includes membrane raft, membrane microdomain, transcriptional regulatory complex, mitochondrial membrane, and Bcl-2 family protein complex.BP involves response to hormones, response of cells to nitrogen compounds, response to peptides, regulation of apoptosis signal pathway, response to lipopolysaccharide, response of cells to cytokine stimulation, etc. DYY therapy can regulate the immune system, mitochondrial stress, apoptosis, and signal transduction to alleviate ALI symptoms. KEGG analysis revealed the top 30 signaling pathways, such as cancer pathway, AGE-RAGE signaling pathway in diabetic complications, fluid shear stress, and atherosclerosis, PI3K-Akt, MAPK and p53 signaling pathways, may be involved in the treatment of ALI by DYY (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD-E and Supplementary Material 5).we observed that 28 and 23 core targets were involved in the upstream and downstream regulation of PI3K-AKT and MAPK signaling pathways, respectively, and excess ROS could activate Nrf2 through these two signaling pathways, and then promote the transcriptional expression of HO-1, the downstream gene of Nrf2, to cope with the damage caused by oxidative stress [\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e]. In addition, Nrf2/HO-1 signal transduction can regulate TLR4-driven inflammatory response during stress [\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e]. These results suggest that DYY may treat ALI by regulating the pathways related to inflammation and oxidative stress.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec32\" class=\"Section2\"\u003e \u003ch2\u003eIdentification and prediction of active ingredients in DYY\u003c/h2\u003e \u003cp\u003eThe effective components of DYY prescription were identified by UHPLC-MS/MS. The representative LC-MS total ion current chromatography (TIC) obtained in positive (ESI+) and negative (ESI-) modes is shown (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA-B). Table\u0026nbsp;\u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e4\u003c/span\u003e identified and labeled the representative compounds of DYY Chinese herbal medicine, in which Anhydroicaritin, quercetin, licochalconea, Wogonin and Honokiol were the main components confirmed by network pharmacological analysis.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab4\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 4\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eChemical characterization of main compounds in DYY\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"6\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNo.\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCompound name\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eMolecular Formula\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003em/z\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eRetention time (min)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eClass\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eQuercetin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eC15H10O7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e303.04961\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e6.07225\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eFlavonols\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eWogonin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eC16H12O5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e283.06154\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e7.4849833\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eFlavonoids\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eformononetin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eC16H12O4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e269.08059\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e7.12975\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eIsoflavones\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGlabrone\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eC20H16O5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e337.10671\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e10.740933\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eIsoflavones\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAnhydroicaritin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eC21H20O6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e369.13308\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e11.340883\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eIsoprene flavonoid derivatives\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMagnolol\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eC18H18O2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e265.12319\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e11.2761\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eLignans\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGlyasperin F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eC20H18O6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e337.10654\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e11.294383\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eFlavonoids\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eOroxylin A\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eC16H12O5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e285.07523\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e9.8511\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eFlavonoids\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eHonokiol\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eC18H18O2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e265.12319\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e10.72155\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eLignans\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eLupiwighteone\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eC20H18O5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e339.12235\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e9.8987\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eIsoflavones\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eLicochalcone A\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eC21H22O4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e339.1589\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e10.256\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eFlavonoids\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cdiv id=\"Sec33\" class=\"Section3\"\u003e \u003ch2\u003eDYY improves LPS-induced ALI in rats\u003c/h2\u003e \u003cp\u003eTo study DYY's role in ALI, we induced ALI in rats using LPS. Pulmonary edema, a common ALI change, can be measured by W/D ratio. Compared to the Con group, rats treated with LPS had significantly higher W/D ratios, which was reduced by DYY (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA). HE staining of lung tissue showed severe cell inflammation ,thickening of alveolar septum and partial destruction of alveolar structure in LPS group, which was improved by DYY(Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB).In summary, the results confirmed the protective effect of DYY prescription on ALI rats.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec34\" class=\"Section3\"\u003e \u003ch2\u003eDYY inhibits lung inflammation and oxidative stress\u003c/h2\u003e \u003cp\u003eAs previously described, uncontrolled inflammation and oxidative stress can worsen ALI[\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e].To study DYY's effects on LPS-induced inflammation and oxidative stress, we measured levels of IL-6, TNF-α ,ROS, MDA and NO in rats. Results showed DYY reduced levels of inflammatory factors in BALF(Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA-B),meanwhile DYY significantly reduced levels of ROS, MDA, and NO in lung tissue(Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eC-E), which is consistent with the results of related studies [\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e], showing anti-inflammatory effects and reducing oxidative stress to improve lung injury.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003c/div\u003e\n\u003ch3\u003eDYY up-regulates UCP2 mRNA expression in lung tissue\u003c/h3\u003e\n\u003cp\u003eUCP2 is involved in the maintenance of mitochondrial function, the regulation of immune response and oxidative stress under physiological or pathological conditions [\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e]. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eF, LPS decreased the expression of UCP2 mRNA in lung tissue (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01). However,DYY administration could up-regulate UCP2mRNA expression (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05). This suggests that UCP2 plays an active role in improving lung injury caused by LPS.\u003c/p\u003e\n\u003ch3\u003eDYY regulates the expression of Nrf2/HO-1-mediated TLR4 pathway protein\u003c/h3\u003e\n\u003cp\u003eEnvironmental and pathological stress activate Nrf2, leading to the regulation of downstream antioxidant factors like HO-1. This helps protect against oxidative stress and inflammation, and the associated TLR4 pathway plays an anti-inflammatory role[\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e, \u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e]. KEGG analysis shows that PI3K-AKT and MAPK pathways are enriched, but its upstream and downstream gene Nrf2/HO-1-mediated TLR4 pathways are crucial for eliminating oxidative stress and inflammation, which was an important mechanism of ALI therapy. To study the effects of DYY on Nrf2, HO-1, and TLR4 proteins, we found thtough WB that DYY treatment reduced TLR4 expression and increased Nrf2 and HO-1 expression in response to LPS(Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eA-D), indicating DYY's anti-inflammatory and oxidative stress-regulating effects through the Nrf2/HO-1-mediated TLR4 pathway.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cdiv id=\"Sec37\" class=\"Section2\"\u003e \u003ch2\u003ePredicting active compounds of DYY through molecular docking\u003c/h2\u003e \u003cp\u003eWe selected Anhydroicaritin, Wogonin, LicochalconeA, quercetin, and Honokiol for molecular docking with Nrf2, HO-1, and TLR4 proteins. Lower binding energy indicates stronger interaction [\u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e]. We found that Anhydroicaritin had the highest docking score and lowest Honokiol (-4.9kcal/mol), but close to stability.The other compounds bind well to Nrf2, HO-1 and TLR4 proteins, indicating that they may be very important for the treatment of ALI. The typical docking results are shown in Table\u0026nbsp;\u003cspan refid=\"Tab5\" class=\"InternalRef\"\u003e5\u003c/span\u003e and Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab5\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 5\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eMolecular docking predictes results of key active ingredient and target protein\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eItem\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eHMOX1\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eNF2L2\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eTLR4\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAnhydroicaritin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e-8.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-5.7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e-6.6\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHonokiol\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e-7.5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-4.9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e-5.9\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLicochalconeA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e-7.6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-5.4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e-5.8\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eQuercetin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e-7.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-5.6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e-5.9\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eWogonin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e-7.4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e-5.9\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"4\"\u003e\u003cb\u003eNote\u003c/b\u003e:The binding free energy is kcal/mol.\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eALI is a syndrome with various causes, where oxidative stress and inflammation are key factors affecting lung function[55,56].Despite extensive research in determining the influencing factors and repair mechanisms[57], current treatments have not significantly reduced the high mortality rate of ALI[58].\u003c/p\u003e\n\u003cp\u003eResearch has demonstrated that TCM is effective in treating coronavirus disease 2019 (COVID-19) caused by SARS-CoV-2[59].TCM targets inflammation, oxidative stress, and organ injuries associated with the virus, providing unique clinical advantages[60]. TCM is now a crucial component in preventing and treating ALI, classified as \u0026quot;lung heat syndrome\u0026quot; and \u0026quot;asthma syndrome\u0026quot;in TCM.The pathogenesis incloud evil toxin trapped in the lung causes heat to consume body fluid, leading to lung dysfunction and accumulation of phlegm and heat[61]. This can progress to ALI and potentially acute respiratory distress syndrome (ARDS). DYY has been used in China for centuries for epidemic diseases.It has the effect of eliminating turbid, clearing heat and detoxification. It is usually used to treat influenza, cold, fever and other upper respiratory diseases, showing a good effect.\u003c/p\u003e\n\u003cp\u003eALI is characterized by uncontrolled inflammation and redox imbalance[62], with a focus on oxidative stress, inflammatory response and apoptosis in treatment research[63]. Network pharmacology is commonly used to uncover the complex pharmacological mechanisms of traditional Chinese medicine for treating complex diseases.This study used network pharmacology and vivo experiments to investigate how DYY works as an anti-ALI treatment. We confirmed 15 main targets out of 111 potential targets identified, including TP53, TNF, IL6, MAPK1,CASP3, and BCL2, \u0026nbsp;associating with oxidative stress, inflammation, and apoptosis.\u003c/p\u003e\n\u003cp\u003eOxidative stress causes the buildup of ROS in lung cells, impacting their function and triggering inflammation. In acute lung injury, excessive NO production due to oxidative stress can lead to the formation of reactive nitrogen species (RNS)[64],disrupting pulmonary function[65],which leads to induced NOS overexpression / activity and the release of pro-inflammatory cytokines [66]. In this study, we created an ALI rat model using LPS and treated it with DYY. Results showed that DYY effectively treated ALI by restoring normal W/D ratio, reducing inflammatory cell infiltration, and reconstructing alveolar structure.After LPS stimulation, pro-inflammatory cytokines like IL-6 and TNF-\u0026alpha;\u0026nbsp;were secreted in BALF, indicating pulmonary inflammation. DYY reversed this by reducing cytokines, indicating inhibition of the inflammatory response.\u003c/p\u003e\n\u003cp\u003eIt is well known that oxidative stress is caused by an imbalance between oxidants and antioxidants, leading to damage from ROS and depletion of antioxidants. This can worsen inflammation and harm mitochondria due to the production of oxides exceeding antioxidant defense[67].MDA is a common biomarker for oxidative stress[68],inducer NO synthase (iNOS) and endothelial nitric oxide synthase (eNOS)are enzymes involved in oxidative stress and can contribute to lung injury in ALI by increasing superoxide production such as NO and MDA[69].New research suggests that oxidative stress is a key factor in the development of ALI, with ROS playing a crucial role in the process. Mitochondrial channels like mPTP and inner membrane anion channel (IMAC),their activation may be involved in intra- and intermitochondrial redox-environment changes leading to ROS release[70].\u0026nbsp;It should be noted that while ROS can protect cells from oxidative stress, high levels can damage endothelial barriers and cause inflammation. Excessive ROS can deplete NO levels, and NO reacts with ROS to form excessive peroxynitrite, leading to oxidative damage and cell death through reacting with lipids, DNA and proteins[67].UCP2, an anion transporter, helps maintain mitochondrial function, immune response and regulate oxidative stress, and protect against cell apoptosis[71,45].Here, it may play a crucial role in protecting against LPS-induced ALI by stabilizing mitochondrial structure and reducing inflammation and oxidative stress induced by ROS, MDA and so on .\u0026nbsp;To confirm DYY\u0026apos;s inhibitory effect on ALI in rats, we observed changes in ROS, MDA, and NO levels. ROS levels increased significantly in ALI rats, indicating oxidative damage in lung tissue. MDA and NO levels also increased, indirectly reflecting tissue injury degree. DYY intervention effectively reduced intracellular ROS, inhibited ROS accumulation, decreased MDA and NO levels, tending to the Con group,and reversed the decrease in UCP2 mRNA expression induced by LPS. This suggests that DYY can alleviate lung tissue inflammation and improve ALI by regulating oxidative stress processes.\u003c/p\u003e\n\u003cp\u003eWe analyzed the mechanism of DYY in ALI through KEGG and GO enrichment , identifying involvement of mitochondrial membrane, cell response to nitrogen compounds and pathways like PI3K-AKT and MAPK signaling in ALI development. By studying the signaling cascade, we aim to understand the key regulatory roles of upstream and downstream targets in inflammation and oxidative stress pathways in ALI. Numerous studies have demonstrated the significance of Nrf2 in controlling oxidative stress[72] and its role in iron apoptosis by regulating iron homeostasis and lipid peroxidation [73,74]. Furthermore,the Nrf2/HO-1 pathway helps regulate anti-inflammatory and antioxidant responses, providing multi-organ protection[75,76]. Recent reports suggest that natural drug ingredients protect against ALI through the Nrf2 signaling pathway[77]. Our study shows that DYY activates the Nrf2/HO-1 pathway in ALI rats, reducing oxidative stress and inflammation in the lungs,such as the reduction of TLR4 expression and TNF-\u0026alpha;,IL-6 levels,suggesting that DYY can prevent ALI by reducing inflammation and increasing antioxidant response. Nrf2 protects lung cells by influencing TLR4 signaling[78], confirming its role in inflammatory lung injury,consistenting with previous studies [79].\u003c/p\u003e\n\u003cp\u003eMolecular docking techniques were used to predict the binding activity of core components to key targets. Results showed Honokiol had good binding activity to HO-1 and TLR4, while other components bound well to Nrf2, HO-1, and TLR4. Quercetin, a flavonoid compound, regulates oxidative stress and inflammation by inhibiting inflammatory factors and excessive release of ROS, proving effective in treating various diseases[80].Wogonin is also flavonoids that reduce inflammation and oxidative stress by enhancing antioxidant capacity and counteracting inflammatory signals[81].Honokiol is a natural polyphenol that has been shown to counteract oxidative stress and inflammatory signals in a variety of ways, including reversing elevated levels of inflammatory factors, increasing the production of antioxidants GSH and SOD in the body, and alleviating LPS-induced apoptosis[82,83].Prior research has demonstrated that Licochalcone A has antimicrobial and anti-inflammatory properties, protects against oxidative stress, and activates nuclear translocation of Nrf2 and enhancing HO-1 expression in cells[84]. We speculate DYY improves ALI in rats by utilizing multiple compounds.\u003c/p\u003e\n\u003cp\u003eOur study shows that DYY protects against ALI in rats by reducing oxidative stress and inflammation through the Nrf2/HO-1 pathway, inhibiting TLR4 signaling. However, further research is needed to identify the main bioactive ingredients and fully understand the complex signaling cascade mechanisms involved in its anti-ALI effects.Nevertheless, these findings provide a further pharmacological basis for DYY as a new treatment for ALI.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eFunding Declaration\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNo Funding.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAnimal ethics statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll surgical procedures on the experimental animals met all ethical requirements and were approved by the animal ethics committee of Institute of Biology, Shandong Academy of Sciences(SWS20240130).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent to publish\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll authors consent to publish.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor Contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study was designed by L Z.,W Z and L Z conducted animal experiments. C Z \u0026nbsp;analyzed network pharmacology and molecular docking. W Z conducted data analysis. L Z wrote the manuscript, and all the authors read and approved the final draft.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData Availability Statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe data will be available upon request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflicts of Interest\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNone.The authors declare no conflict of interest\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe are very grateful to the Institute of Biology of Shandong Academy of Sciences for the help of animal experiments.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eLi N, Zou SS, Wang B, Lin HQ.Targeting immunometabolism against acute lung injury.Clin Immunol.2023;249:109289.\u003c/li\u003e\n\u003cli\u003eLi YR,Jiang YN,Zhang H, Zhang J,Ma JB,Yang Z, et al.Research on acute lung injury inflammatory network.Int J Clin Pharmacol Ther. 2023; 61(9):394-403. \u003c/li\u003e\n\u003cli\u003eBezerra FS, Lanzetti M, Nesi RT,Nagato AC, Silva CPE , KennedyFeitosa E,et al. Oxidative Stress and Inflammation in Acute and Chronic Lung Injuries.Antioxidants (Basel). 2023;12(3):548.\u003c/li\u003e\n\u003cli\u003eDing ZH, Zhong RX, Xia TY, Yang YN, Xing N , Wang WJ,et al. Advances in research into the mechanisms of Chinese Materia Medica against acute lung injury. Biomed Pharmacother. 2020;122:109706.\u003c/li\u003e\n\u003cli\u003eChen JY, Huang YL, Bian XH, He Y.Berberine Ameliorates Inflammation in Acute Lung Injury via NF-\u0026kappa;B/Nlrp3 Signaling Pathway,Front Nutr. 2022;9:851255.\u003c/li\u003e\n\u003cli\u003eCheng HB, Zhu YF, Chen LJ, Wang YL.Nesfatin-1 alleviated lipopolysaccharide-induced acute lung injury through regulating inflammatory response associated with macrophages modulation.J Cardiothorac Surg. 2022;17(1):206. \u003c/li\u003e\n\u003cli\u003eLiu ZF, Liu DS, Wang ZH, Zou YG , Wang HX , Li X,et al.Association between inflammatory biomarkers and acute respiratory distress syndrome or acute lung injury risk : A systematic review and meta-analysis.Wien Klin Wochenschr.2022;134(1-2):24-38.\u003c/li\u003e\n\u003cli\u003eMokr\u0026aacute; D.Acute lung injury - from pathophysiology to treatment.Physiol Res. 2020;69(Suppl 3) :S353-S366. \u003c/li\u003e\n\u003cli\u003eLiu X, Zhang JQ, Xie W.The role of ferroptosis in acute lung injury.Mol Cell Biochem. 2022;477(5) :1453-1461. \u003c/li\u003e\n\u003cli\u003eSul O, Ra SW.Quercetin Prevents LPS-Induced Oxidative Stress and Inflammation by Modulating NOX2/ROS/NF-kB in Lung Epithelial Cells.Molecules.2021;26(22): 6949. \u003c/li\u003e\n\u003cli\u003eLeavy O.Inflammation: Regulating ROS.Nat Rev Immunol. 2014;14(6):357. \u003c/li\u003e\n\u003cli\u003eRius-P\u0026eacute;rez S, P\u0026eacute;rez S, Toledano M, Sastre J.Mitochondrial Reactive Oxygen Species and Lytic Programmed Cell Death in Acute Inflammation.Antioxid.Redox Signal. 2023;39(10-12) :708-727.\u003c/li\u003e\n\u003cli\u003eKellner M, Noonepalle S, Lu Q, Srivastava A, Zemskov E, Black SM.ROS Signaling in the Pathogenesis of Acute Lung Injury (ALI) and Acute Respiratory Distress Syndrome (ARDS).Adv Exp Med Biol. 2017;967:105-137. \u003c/li\u003e\n\u003cli\u003eGuo LQ, Yang Y, Yuan J, Ren HL, Huang XL , Li M, et al.Da-Yuan-Yin decoction polyphenol fraction attenuates acute lung injury induced by lipopolysaccharide.Pharm Biol. 2023;61(1):228-240. \u003c/li\u003e\n\u003cli\u003eRuan XF, Du P, Zhao K, Huang JC, Xia HM, Dai D, et al.Mechanism of Dayuanyin in the treatment of coronavirus disease 2019 based on network pharmacology and molecular docking.Chin Med. 2020;15:62.\u003c/li\u003e\n\u003cli\u003eYang Y, Chen JL, Ren HL, Wei L, Huang XL, Li M, et al. Protective Effect of the Eluting Fraction of Da-Yuan-Yin Decoction on Acute Lung Injury. Altern Ther Health Med.2023;29(5) :242-254. \u003c/li\u003e\n\u003cli\u003eAmorati R Zotova JL, Baschieri A, Valgimigli L.Antioxidant Activity of Magnolol and Honokiol: Kinetic and Mechanistic Investigations of Their Reaction with Peroxyl Radicals.J Org Chem. 2015;80(21) :10651-9. \u003c/li\u003e\n\u003cli\u003eLuo J, Xu YW, Zhang MF, Gao L, Fang C, Zhou CQ.Magnolol inhibits LPS-induced inflammatory response in uterine epithelial cells : magnolol inhibits LPS-induced inflammatory response.Inflammation. 2013;36(5):997-1003. \u003c/li\u003e\n\u003cli\u003eFrattaruolo L, Carullo G, Brindisi M, Mazzotta S, Bellissimo L, Rago V,et al. Antioxidant and Anti-Inflammatory Activities of Flavanones from Glycyrrhiza glabra L. (licorice) Leaf Phytocomplexes: Identification of Licoflavanone as a Modulator of NF-kB/MAPK Pathway.Antioxidants (Basel). 2019;8(6):186. \u003c/li\u003e\n\u003cli\u003eSu D, Liao LL, Zeng Q, Liao Z, Liu YL, Jin C,et al.Study on the new anti-atherosclerosis activity of different Herba patriniae through down-regulating lysophosphatidylcholine of the glycerophospholipid metabolism pathway.Phytomedicine. 2022;94:153833. \u003c/li\u003e\n\u003cli\u003eJian GH, Su BZ, Zhou WJ, Xiong H.Application of network pharmacology and molecular docking to elucidate the potential mechanism of \u003cem\u003eEucommia ulmoides\u003c/em\u003e-\u003cem\u003eRadix Achyranthis Bidentatae\u003c/em\u003e against osteoarthritis.BioData Min.2020;13:12. \u003c/li\u003e\n\u003cli\u003eChen RB, Yang YD, Sun K, Liu S, Guo W, Zhang JX, et al. Potential mechanism of Ziyin Tongluo Formula in the treatment of postmenopausal osteoporosis: based on network pharmacology and ovariectomized rat model.Chin Med.2021;16(1):88.\u003c/li\u003e\n\u003cli\u003eZhang WD, Chen Y, Jiang HH, Yang JX, Wang Q, Du YF,et al.Integrated strategy for accurately screening biomarkers based on metabolomics coupled with network pharmacology.Talanta. 2020;211:120710. \u003c/li\u003e\n\u003cli\u003eUniProt Consortium.UniProt: the universal protein knowledgebase in 2021.Nucleic Acids Res. 2021;49(D1):D480-D489. \u003c/li\u003e\n\u003cli\u003eWang Y, Ding TT, Jiang X.Network Pharmacology Study on Herb Pair Bletilla striata-Galla chinensis in the Treatment of Chronic Skin Ulcers.Curr Pharm Des.2024. \u003c/li\u003e\n\u003cli\u003eWu YG, Fang YL, Li YN, Au R, Cheng C, Li WY, et al. A network pharmacology approach and experimental validation to investigate the anticancer mechanism of Qi-Qin-Hu-Chang formula against colitis-associated colorectal cancer through induction of apoptosis via JNK/p38 MAPK signaling pathway.J. Ethnopharmacol. 2024;319(Pt 3):117323, \u003c/li\u003e\n\u003cli\u003eZhao J, Pan BY, Zhou XL, Wu CN, Hao FC, Zhang J, et al.Polygonum cuspidatum inhibits the growth of osteosarcoma cells via impeding Akt/ERK/EGFR signaling pathways,Bioengineered. 2022;13(2) :2992-3006. \u003c/li\u003e\n\u003cli\u003eWang Y, Yuan Y, Wang WT, He Y, Zhong H, Zhou XX, et al.Mechanisms underlying the therapeutic effects of Qingfeiyin in treating acute lung injury based on GEO datasets, network pharmacology and molecular docking.Comput Biol Med. 2022;145:105454. \u003c/li\u003e\n\u003cli\u003eQiu JF, Zhang ZY, Hu AL, Zhao P, Wei XN, Song H, et al. Integrating UHPLC-HR-MS/MS, Network Pharmacology, and Experimental Validation to Uncover the Mechanisms of Jin\u0026apos;gan Capsules against Breast Cancer.ACS Omega. 2022;7(32):28003-28015.\u003c/li\u003e\n\u003cli\u003eSong LL, Xu J , Shi YQ, Zhao HM , Zhang M , Wang YF, et al.An integrated strategy of UHPLC-Q-TOF-MS analysis, network pharmacology, and molecular docking to explore the chemical constituents and mechanism of Zixue Powder against febrile seizures.Heliyon. 2023;10(1) :e23865.\u003c/li\u003e\n\u003cli\u003eYuan C, Wang MH, Wang F, Chen PY, Ke XG, Yu B, et al.Network pharmacology and molecular docking reveal the mechanism of Scopoletin against non-small cell lung cancer.Life Sci. 2021;270:119105. \u003c/li\u003e\n\u003cli\u003eWang JW, Huang YL, Guo LH, Li JF, Zhou SF.Molecular mechanism of Achyranthis bidentatae radix and Morindae officinalis radix in osteoporosis therapy: An investigation based on network pharmacology, molecular docking, and molecular dynamics simulations.Biochem Biophys Rep. 2023;36:101586. \u003c/li\u003e\n\u003cli\u003eChinese Pharmacopoeia Commission.Pharmacopoeia of the People\u0026rsquo;s Republic of China.Chin Med Sci Press.Beijing, China, 2020.\u003c/li\u003e\n\u003cli\u003eWang XJ, Zhang XX, Li JX, Fu JY, Zhao MJ, Zhang WT, et al. Network pharmacology and LC-MS approachs to explore the active compounds and mechanisms of Yuanjiang decoction for treating bradyarrhythmia.Comput Biol Med. 2023;152:106435. \u003c/li\u003e\n\u003cli\u003eWishart DS , Oler Ep, Peters H, Guo AC, Girod S, Han S, et al.MiMeDB: the Human Microbial Metabolome Database.Nucleic Acids Res. 2023;51(D1):D611-D620. \u003c/li\u003e\n\u003cli\u003eXue JC, Guijas C, Benton HP, Warth B, Siuzdak G. METLIN MS2 molecular standards database: a broad chemical and biological resource.Nat Methods. 2020;17(10):953-954. \u003c/li\u003e\n\u003cli\u003eDu ZA, Sun MN, Hu ZS.Saikosaponin a ameliorates LPS-induced acute lung injury in mice.Inflammation. 2018;41(1):193-198. \u003c/li\u003e\n\u003cli\u003eZhu LH, Wei MC, Yang N, Li XH.Glycyrrhizic acid alleviates the meconium-induced acute lung injury in neonatal rats by inhibiting oxidative stress through mediating the Keap1/Nrf2/HO-1 signal pathway.Bioengineered. 2021;12(1):)2616-2626. \u003c/li\u003e\n\u003cli\u003eDing ZH, Zhong RX, Yang YN, Xia TY, Wang WJ, Wang Y, et al.Systems pharmacology reveals the mechanism of activity of Ge-Gen-Qin-Lian decoction against LPS-induced acute lung injury: A novel strategy for exploring active components and effective mechanism of TCM formulae.Pharmacol Res. 2020;156:104759. \u003c/li\u003e\n\u003cli\u003eDhlamini Q, Wang W, Feng GF, Chen AP, Chong L, Li X et al.FGF1 alleviates LPS-induced acute lung injury via suppression of inflammation and oxidative stress.Mol Med. 2022;28(1) :73. \u003c/li\u003e\n\u003cli\u003eYin HL, Feng YJ, Duan Y, Ma SL, Guo ZL, Wei YZ.Hydrogen gas alleviates lipopolysaccharide-induced acute lung injury and inflammatory response in mice.J Inflamm (Lond). 2022;19(1):16. \u003c/li\u003e\n\u003cli\u003eFan DS, Wang D, Zhu LH.Protective role of scutellarin on LPS induced - Acute lung injury and regulation of apoptosis, oxidative stress and reduction of mitochondrial dysfunction.Saudi J Biol Sci. 2022;29(1):371-378. \u003c/li\u003e\n\u003cli\u003eHsieh YH, Deng JS, Pan HP, Liao JC , Huang SS, Huang GJ.Sclareol ameliorate lipopolysaccharide-induced acute lung injury through inhibition of MAPK and induction of HO-1 signaling.Int Immunopharmacol. 2017;44:16-25.\u003c/li\u003e\n\u003cli\u003eTang LL, Zhu LY, Zhang W, Yang XY, Chen QG, Meng ZY, et al.Qi-Xian Decoction Upregulated E-cadherin Expression in Human Lung Epithelial Cells and Ovalbumin-Challenged Mice by Inhibiting Reactive Oxygen Species-Mediated Extracellular-Signal-Regulated Kinase (ERK) Activation.Med Sci Monit. 2020;26:e922003. \u003c/li\u003e\n\u003cli\u003eDing Y, Zheng YJ, Huang JD, Peng WW, Chen XX Kang XJ, et al. UCP2 ameliorates mitochondrial dysfunction, inflammation, and oxidative stress in lipopolysaccharide-induced acute kidney injury.Int Immunopharmacol. 2019;71:336-349. \u003c/li\u003e\n\u003cli\u003eWang LL, Li ZY, Lu TL, Su LL, Mao CQ, Zhang YT, et al.The potential mechanism of Choulingdan mixture in improving acute lung injury based on HPLC-Q-TOF-MS, network pharmacology and in vivo experiments.Biomed Chromatogr. 2023;37(10):e5709. \u003c/li\u003e\n\u003cli\u003eSong JQ, Du GL, Wu HY, Gao XL, Yang Z, Liu B, et al. Protective effects of quercetin on traumatic brain injury induced inflammation and oxidative stress in cortex through activating Nrf2/HO-1 pathway.Restor Neurol Neurosci. 2021;39(1):73-84.\u003c/li\u003e\n\u003cli\u003eCHEN C, YIN YY, WU XF, Wu RR,Xu YY. Advance in researches on role of MAPK and PI3K/AKT pathways in ROS-induced activation of nuclear factor erythroid 2-related factor 2.Chin J Pub Health. 2016;32(6) :870-873.\u003c/li\u003e\n\u003cli\u003eRao J , Qian X , Li G , Pan X , Zhang C , Zhang F, et al.ATF3-mediated NRF2/HO-1 signaling regulates TLR4 innate immune responses in mouse liver ischemia/reperfusion injury.Am J Transplant. 2015;15(1):76-87. \u003c/li\u003e\n\u003cli\u003eNguyen TT, Deng Z, Guo RY, Chai JW, Li R, Zeng QY, et al.Periplaneta Americana Extract Ameliorates LPS-induced Acute Lung Injury Via Reducing Inflammation and Oxidative Stress.Curr Med Sci. 2023;43(3) :445-455. \u003c/li\u003e\n\u003cli\u003eChien TM, Hsieh PC, Huang SS, Deng JS, Ho YL, Chang YS, et al.Acanthopanax trifoliatus inhibits lipopolysaccharide-induced inflammatory response in vitro and in vivo.Kaohsiung J Med Sci. 2015;31(10):499-509. \u003c/li\u003e\n\u003cli\u003eOh Yong Jin , Jin Seong Eun , Shin HyeunKyoo , Ha Hyekyung.Daeshiho-tang attenuates inflammatory response and oxidative stress in LPS-stimulated macrophages by regulating TLR4/MyD88, NF-\u0026kappa;B, MAPK, and Nrf2/HO-1 pathways.Sci Rep. 2023;13(1):18891. \u003c/li\u003e\n\u003cli\u003eSong JZ, Zhao X, Bo JQ, Lv ZY, Li GR, Chen YY, et al.A polysaccharide from Alhagi honey protects the intestinal barrier and regulates the Nrf2/HO-1-TLR4/MAPK signaling pathway to treat alcoholic liver disease in mice.J Ethnopharmacol. 2024;321:117552. \u003c/li\u003e\n\u003cli\u003eZhang WJ, Sun MY, Lv GF,Guo WT,Hu JN,Gu JY, et al.Exploring the mechanism of tenghuang jiangu wan in osteoporosis treatment based on network pharmacology, molecular docking and experimental pharmacology.Chin J Analy Chem. 2024;52(1):100351.\u003c/li\u003e\n\u003cli\u003eProudfoot AG , McAuley DF , Griffiths MJD , Hind M.Human models of acute lung injury.Dis Model Mech. 2011;4(2) :145-53.\u003c/li\u003e\n\u003cli\u003eYu SL, Shi M, Liu CT, Liu QH, Guo J, Yu SY, et al.Time course changes of oxidative stress and inflammation in hyperoxia-induced acute lung injury in rats.Iran J Basic Med Sci. 2015;18(1) :98-10.\u003c/li\u003e\n\u003cli\u003eNieman GF , Andrews P, Satalin J, Wilcox K, KollischSingule M, Madden M, et al.Acute lung injury: how to stabilize a broken lung.Crit Care. 2018;22(1):136. \u003c/li\u003e\n\u003cli\u003eZheng YL, Zheng M, Shao J, Jiang CX, Shen J, Tao RJ, et al.Upregulation of claudin‑4 by Chinese traditional medicine Shenfu attenuates lung tissue damage by acute lung injury aggravated by acute gastrointestinal injury.Pharm Biol. 2022;60(1):1981-1993. \u003c/li\u003e\n\u003cli\u003eLi L, Wu YZ, Wang JB, Yan HM, Lu J, Wan Y, et al.Potential Treatment of COVID-19 with Traditional Chinese Medicine: What Herbs Can Help Win the Battle with SARS-CoV-2? .Engineering (Beijing). 2022 ;19 :139-152. \u003c/li\u003e\n\u003cli\u003eZhang JL , Li WX, Li Y, Wong MS, Wang YJ, Zhang Y. Therapeutic options of TCM for organ injuries associated with COVID-19 and the underlying mechanism.Phytomedicine. 2021;85 :153297. \u003c/li\u003e\n\u003cli\u003eLi XQ, Yang AD.Study on pathogenesis and traditional Chinese medicine syndrome differentiation of acute lung injury.Chin J TCM WM Crit Care. 2018;25(1):9-14.\u003c/li\u003e\n\u003cli\u003eRoberts AM.Central role of oxidative stress and its signaling pathways in causing and preventing acute lung injury.Crit Care Med. 2011;39(12):2776-7.\u003c/li\u003e\n\u003cli\u003eZhang QQ, Feng AZ, Zeng MN, Zhang BB, Shi JY, Lv YX,et al.Chrysosplenol D protects mice against LPS-induced acute lung injury by inhibiting oxidative stress, inflammation, and apoptosis via TLR4-MAPKs/NF-\u0026kappa;B signaling pathways.Innate Immun. 2021;27(7-8):514-524. \u003c/li\u003e\n\u003cli\u003eKara CS, Alexander VO, Evelyne G, Andrew MR.Differential effects of nitric oxide synthesis on pulmonary vascular function during lung ischemia-reperfusion injury.Arch Physiol Biochem. 2009;115:34-46.\u003c/li\u003e\n\u003cli\u003eKnepler JL, Taher LN, Gupta MP, Patterson C, Pavalko F, Ober MD, et al.Peroxynitrite causes endothelial cell monolayer barrier dysfunction. Am J Physiol Cell Physiol. 2001;81: C1064-C1075.\u003c/li\u003e\n\u003cli\u003eOvechkin AV, Lominadze D, Sedoris KC, Robinson TW, Tyagi SC, Roberts AM. Lung ischemia-reperfusion injury: Implications of oxidative stress and plateletarteriolar wall interactions.Arch Physiol Biochem. 2007;113:1-12.\u003c/li\u003e\n\u003cli\u003eJiang SY, Pi X. Research advances in uncoupling effect of endothelial nitric oxide synthase in ventilator‑associated lung injury.Int J Anesth Resus. 2021;42(11):1213-1216.\u003c/li\u003e\n\u003cli\u003eTang Q, Su YW, Xian CJ.Determining Oxidative Damage by Lipid Peroxidation Assay in Rat Serum.Bio Protoc. 2019;9(12) :e3263. \u003c/li\u003e\n\u003cli\u003eKumar S, Sun XT, Noonepalle SK, Lu Q, Zemskov E, Wang T, et al. Hyper-activation of pp60Src limits nitric oxide signaling by increasing asymmetric dimethylarginine levels during acute lung injury.Free Radic Biol Med. 2017;102:217-228.\u003c/li\u003e\n\u003cli\u003eZorov DB , Juhaszova M, Sollott SJ.Mitochondrial reactive oxygen species (ROS) and ROS-induced ROS release.Physiol Rev. 2014;94(3):909-50. \u003c/li\u003e\n\u003cli\u003eZhong XY, He J, Zhang X, Li CS, Tian XF, Xia WY, et al. UCP2 alleviates tubular epithelial cell apoptosis in lipopolysaccharide-induced acute kidney injury by decreasing ROS production.Biomed Pharmacother. 2019; 115:108914. \u003c/li\u003e\n\u003cli\u003eYin XF, Zhu GS, Wang Q, Fu YD, Wang J, Xu B. Ferroptosis, a New Insight Into Acute Lung Injury.Front Pharmacol. 2021;12:709538. \u003c/li\u003e\n\u003cli\u003eDodson M, CastroPortuguez R, Zhang DD.NRF2 Plays a Critical Role in Mitigating Lipid Peroxidation and Ferroptosis.Redox Biol. 2019;23:101107. \u003c/li\u003e\n\u003cli\u003eKerins MJ, Ooi A.The Roles of NRF2 in Modulating Cellular Iron Homeostasis.Antioxid Redox Signaling. 2018;29 (17):1756-1773. \u003c/li\u003e\n\u003cli\u003eJiang T, Cheng H, Su JJ, Wang XC, Wang QX, Chu J, et al.Gastrodin Protects against Glutamate-Induced Ferroptosis in HT-22 Cells through Nrf2/ HO-1 Signaling Pathway.Toxicol In Vitro. 2020;62:104715. \u003c/li\u003e\n\u003cli\u003eZhang V, Nemeth E, Kim A.Iron in Lung Pathology.Pharmaceuticals.2019;12(1):30. \u003c/li\u003e\n\u003cli\u003eLuan RM, Ding DY, Yang JL.The protective effect of natural medicines against excessive inflammation and oxidative stress in acute lung injury by regulating the Nrf2 signaling pathway.Front Pharmacol. 2022;13:1039022. \u003c/li\u003e\n\u003cli\u003eHuang JH, Nong XP, Chen YL, Zhang AM, Chen LR.3-O-trans-caffeoyloleanolic acid improves acute lung injury via anti-inflammation and antioxidative stress-involved PI3K/AKT pathway.Chem Biol Drug Des. 2021;98(1):114-126. \u003c/li\u003e\n\u003cli\u003eYan J, Li JJ, Zhang L, Sun Y, Jiang J, Huang Y, et al. Nrf2 protects against acute lung injury and inflammation by modulating TLR4 and Akt signaling.Free Radic Biol Med. 2018;121: 78-85. \u003c/li\u003e\n\u003cli\u003eZhou YK, Qian C, Tang Y, Song MY, Zhang T, Dong GL, et al. Advance in the pharmacological effects of quercetin in modulating oxidative stress and inflammation related disorders.Phytother Res. 2023;37(11):4999-5016. \u003c/li\u003e\n\u003cli\u003eChen J, Liu J, Wang Y, Hu XM, Zhou F, Hu YM, et al.Wogonin mitigates nonalcoholic fatty liver disease via enhancing PPAR\u0026alpha;/AdipoR2, in vivo and in vitro,Biomed Pharmacother. 2017;91:621-631. \u003c/li\u003e\n\u003cli\u003eXia SL, Lin HL, Liu H, Lu ZD, Wang H, Fan ST, et al. Honokiol Attenuates Sepsis-Associated Acute Kidney Injury via the Inhibition of Oxidative Stress and Inflammation.Inflammation. 2019;42(3):826-834.\u003c/li\u003e\n\u003cli\u003eLiu AJ, Xun SC, Zhou GZ, Zhang YL, Lin L. Honokiol alleviates sepsis-associated cardiac dysfunction via attenuating inflammation, apoptosis and oxidative stress.J Pharm Pharmacol. 2023 ;75(3):397-406. \u003c/li\u003e\n\u003cli\u003eK\u0026uuml;hnl J, Roggenkamp D, Gehrke SA , St\u0026auml;b F, Wenck H, Kolbe L, et al. Licochalcone A activates Nrf2 in vitro and contributes to licorice extract-induced lowered cutaneous oxidative stress in vivo.Exp Dermatol. 2015;24(1):42-7.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Dayuan Yin, Acute lung injury, Oxidative stress, Anti-inflammatory, Network pharmacology","lastPublishedDoi":"10.21203/rs.3.rs-4584646/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4584646/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003eBackground:\u003c/strong\u003e\u003cem\u003e \u003c/em\u003eDayuanYin (DYY) is a traditional Chinese medicine (TCM) formula for the treatment of lung diseases.However, the substance and mechanism of its improvement on acute lung injury (ALI) still need to be studied.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMethods:\u003c/strong\u003e DYY's effective components and potential targets were identified using Traditional Chinese Medicine Systems Pharmacology(TCMSP), and a network of herb-component-targets was created with Cytoscape3.7.2. The target genes for ALI were sourced from GeneCards, DisGeNET, and DrugBank databases. The drug-disease target protein-protein interaction (PPI) network was constructed and core targets were visually identified with Cytoscape. Gene Ontology (GO) and Kyoto Encyclopedia of Gene and Genomes (KEGG) enrichment analysis were conducted using Metscape database.The effective components of DYY were further identified by UHPLC-MS/MS. Subsequently, the therapeutic effect of DYY on ALI and its possible mechanism were studied in LPS-induced ALI rats. Finally, the interaction between nuclear factor erythrocyte 2-associated factor 2(Nrf2), Heme Oxygenase-1 (HO-1), Toll-like receptor 4(TLR4) and active components was evaluated by molecular docking.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eResults: \u003c/strong\u003eA total of 95 active compounds, 234 potential therapeutic targets and 2529 ALI related target genes were obtained. DYY and ALI share a target number of 111. KEGG analysis showed that the PI3K-AKT and MAPK signaling pathways and their mediated oxidative stress pathways are closely related to ALI, which may be the potential mechanism of DYY anti-ALI. Network pharmacology and UHPLC-MS/MS analysis showed that the active ingredients included quercetin, OroxylinA, Magnolol, Wogonin, Glabrone, Honokiol and LicochalconeA. Animal experiments have shown that DYY can reduce the lung wet-to-dry (W/D) ratio, the levels of interleukin-6 (IL-6) and tumor necrosis factor-α (TNF-α) in bronchoalveolar lavage fluid (BALF), and the contents of malondialdehyde (MDA), nitric oxide (NO) and reactive oxygen species (ROS) in lung tissue of LPS-treated rats. It is worth noting that DYY promotes the expression of Uncoupling protein 2 (UCP2) mRNA in vivo, increases the expression of Nrf2 and HO-1, and then inhibits the pro-inflammatory mediators mediated by TLR4. Molecular docking analysis showed that the main components of DYY had strong binding ability with HO-1.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConclusions: \u003c/strong\u003eThis study shows that DYY can alleviate inflammation, oxidative stress and pathological changes of ALI by targeting Nrf2/HO-1 mediated TLR4 signaling pathway, which has important implications for developing effective ALI treatments.\u003c/p\u003e","manuscriptTitle":"Exploring the effect and mechanism of DaYuan Yin against acute lung injury by Network Pharmacology,molecular docking and experiment validation","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-07-17 08:28:30","doi":"10.21203/rs.3.rs-4584646/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"fa601722-c5f1-40f4-8c0c-e9f95cacfea6","owner":[],"postedDate":"July 17th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-07-18T15:18:53+00:00","versionOfRecord":[],"versionCreatedAt":"2024-07-17 08:28:30","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4584646","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4584646","identity":"rs-4584646","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}