The PI3K-AKT-mTOR pathway maintains germ cell survival in obese mice by regulating stress granule assembly

The PI3K-AKT-mTOR pathway maintains germ cell survival in obese mice by regulating stress granule assembly | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article The PI3K-AKT-mTOR pathway maintains germ cell survival in obese mice by regulating stress granule assembly shikun zhang, zhijuan Ge, Mingan Li, yan Jiao, shujuan zhang, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-8811652/v1 This work is licensed under a CC BY 4.0 License Status: Under Revision Version 1 posted 10 You are reading this latest preprint version Abstract Obesity is a well-recognized risk factor for male infertility by disrupting spermatogenesis. However, in the testicular microenvironment of obese individuals, a subset of spermatogenic cells can still survive normally and differentiate into mature sperm. our study demonstrated that inguinal fat accumulation-induced testicular hyperthermia activates the PI3K-AKT signaling pathway. This pathway plays a pivotal role in cell growth, proliferation, and survival. Its activation leads to reduced expression of tumor suppressor genes TSC1/TSC2, which are negative regulators of mTORC1. Subsequent mTORC1 activation further promoted the formation of stress granules (SGs). Critically, these SGs recruit RACK1, a key component of the MAPK signaling pathway, thereby blocking apoptotic pathways in spermatogenic cells.This anti-apoptotic effect enabled the protected subset of germ cells to survive and differentiate into mature sperm despite the adverse testicular microenvironment in obesity.​ In conclusion, obesity plays a critical role in male infertility through multiple mechanisms that disrupt spermatogenesis.However, a subset of spermatogenic cells survives via activation of the PI3K-AKT pathway, SG formation, and suppression of apoptosis. This discovery provides novel insights and potential therapeutic targets for obesity-associated male infertility. Biological sciences/Cell biology/Cell death/Apoptosis Biological sciences/Developmental biology/Germline development/Spermatogenesis obesity spermatogenesis stress granule MAPK Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Introduction The World Health Organization reports that 10% to 15% of couples of childbearing age may have fertility problems, with male factors accounting for 30% to 50% [1] .The main factors leading to male infertility include chromosomal abnormalities, endocrine disorders, environmental pollution, and unhealthy lifestyle habits [2-3] . In recent years, the prevalence of obesity has been escalating, and its effects on male fertility including poor semen quality and erectile dysfunction have garnered significant attention. Research shows that obesity is related to systemic pre-inflammatory state and the increase of local oxidative stress. Oxidative stress at the level of testicular micro-environment will lead to spermatogenesis disorder and damage. The increase of body mass index (BMI) is related to decrease of mitochondrial activity, the number of forward moving sperm and the increase of DNA breakage [4-5] . In addition, the testicles are located far away from the abdominal organs within the scrotum, with a temperature about 2℃lower than abdominal cavity, which is necessary for spermatogenic function. Spermatozoa are very sensitive to temperature in the process of development. Obesity patients can increase scrotal temperature due to reduced movement, sedentary lifestyle and local fat deposition, and ultimately inhibit spermatogenesis, resulting in decreased sperm quality, even testicular atrophy and spermatogenesis stagnation. The rise of scrotal temperature will not only affect mature sperm, but also have adverse effects on spermatocyte and early sperm [6-7] . Eukaryotic cells maintain cell survival by forming stress granules (SGs) in adverse environments such as heat shock, oxidative stress, high osmotic pressure [8] . SG is a membrane free organelle located in the cytoplasm and involved in post transcriptional regulation and translation control, mainly composed of RNA binding proteins and untranslated mRNA [9] .The RNA composition of SG is selective, including transcription encoding house-keeping genes but not encoding stress-induced genes such as HSP70. In most cases, environmental pressure leads to eIF2α activation of upstream kinases to phosphorylate eIF2α, translation initiation obstructed or delayed. Subsequently, proteins such as TIA-1, TTP, and G3BP quickly bind to mRNP and aggregate into SG, and with the help of microtubule proteins, further aggregate into the nucleus to form mature SG [10-11] . Another scenario is not dependent on eIF2α phosphorylated stress granules encapsulate untranslated mRNA, inhibiting its translation and enabling cells to better adapt to environmental stress. When the pressure disappears, SG relies on microtubules and their motor proteins for depolymerization, releasing encapsulated mRNA and proteins [12-13] . SGs are mainly composed of non-canonical stalled 48S preinitiation. In addition, many other proteins accumulate into SGs, but this list is still incomplete. Spermatogenesis is a highly coordinated and extremely complex process, and its microenvironment is strictly regulated. Testis, the main site of spermatogenesis in males, 2 to 4℃ lower than body temperature. Heat shock, cryptorchidism, varicocele, and severe fever can cause testicular temperature increase, and spermatogenesis block. Obesity is also an important factor in inducing testicular heat stress. Although a large number of germ cells went to apoptosis after heat stress, some cells still survived and developed into mature spermatozoa. The protective mechanism governing the survival of these undamaged germ cells has not been clearly defined. Furthermore, whether this protection is linked to cell adaptive compartments like stress granules remains an unresolved question. Collectively, the answers to these key scientific inquiries have yet to be fully elucidated. Materials and Methods Ethics statement This study was approved by the Animal Research Committee of Xu zhou medical University (approval number IACUC Issue No.202207s030). All experiments were performed in accordance with ARRIVE guidelines. All procedures were performed in accordance with relevant guidelines' in the manuscript. Animals Four-week-old male C57BL/6 mice were obtained from Shandong Laboratory Animal Center. All animals were housed in the Animal Center of Xuzhou Medical University under a 12-h light/12-h dark cycle, with temperature maintained at 20–25°C and relative humidity at 45–55%. Following a 1-week acclimatization period, a total of 30 C57BL/6J male mice (6 weeks old, SPF grade) were randomly allocated into two groups with 15 mice per group using a random number table method: the control group received a normal diet (ND; catalog no.: XTCON50J, 10% fat, 70% carbohydrate, and 20% protein by caloric content; Nanjing, China) for 10 consecutive weeks, while the treatment group was fed a high-fat diet (HFD; catalog no.: XTHF60, 60% fat, 20% carbohydrate, and 20% protein by caloric content; Nanjing, China) to induce diet-induced obesity. Drug Administration and Experimental Design The mice were randomly divided into HFD, HFD+DMSO, HFD+LY294002, and HFD + ISRIB groups. HFD + LY294002 Group:LY294002 (Cat. No.HY-10108, MedChemExpress, USA) was dissolved in dimethyl sulfoxide (DMSO; Cat. No.D2650, Sigma-Aldrich, USA; Merck KGaA, Germany) to prepare the drug solution. The drug was administered to mice via intraperitoneal injection at a dose of 10 mg/kg body weight. The injection volume was adjusted according to the real-time body weight of each mouse to ensure the accuracy of the administered dose. HFD + ISRIB Group:ISRIB (Cat. No.T2027, TargetMol, USA) was dissolved in 0.9% sodium chloride solution (normal saline) to form a homogeneous solution. The drug was delivered to mice by intraperitoneal injection at a fixed dose of 0.5 mg/kg body weight, and the administration was performed once daily for 14 consecutive days. Sperm count and sperm motility Following intraperitoneal anesthesia with 2,2,2-tribromoethanol at a dosage of 250 mg/kg body weight, mice were humanely euthanized via cervical dislocation. Sperm concentration (per mL) was determined using a hemocytometer, following these steps: One caudal epididymis was collected and placed in 1 mL of pre-warmed (37°C) 1×HBSS, then dissected into several small pieces. It was subsequently incubated at 37°C for 30 minutes to facilitate sperm release. Total sperm motility was analyzed using the computer-assisted sperm analysis (CASA, Hamilton Thorne, TOX IVOS) system, with the following steps: One caudal epididymis was collected and placed in 200 μL of pre-warmed (37°C) 1×HBSS, then dissected into several small pieces. It was then incubated at 37°C for 5 minutes to facilitate sperm release. Fertility assays To assess the fertility of male mice fed a normal diet (ND) or high-fat diet (HFD), males from each group were paired with wild-type (WT) female mice at a 1:2 ratio for mating, with the mating period lasting at least 2 months. This experiment included 5 ND male mice and 5 HFD male mice, and the litter size of each breeding pair was recorded. RNA extraction and quantitative real-time PCR (qPCR) Using TRIzol Reagent (Invitrogen) as per the manufacturer's instructions, RNA was extracted and its amount was quantified by measuring the optical density at 260nm. Reverse transcription (RT) was carried out following standard procedures using random primers and PrimeScript RT Master Mix (Takara). Real-time PCR was done with an ABI Prism StepOne device (Applied) using SYBR Green Master Mix (Vazyme, Q141) and the primers given in S1 Table. Three samples from different mice for each group were used. Quantifications were made in triplicate for each sample from individual testes. For analysis of the mRNA expression, the comparative Ct method (ΔΔCT) was used. S1 Primers Used for qPCR Gene Forward Primer Reverse Primer Pum1 GCAGCTACAAACTCTGCTACTC CAAGACTGGATAACCTGGCATAC Pum2 GCAGGTCAGCGTCCTATTACTC GTGCTGCCTGTAAGACTATTTGC Dazl GGATGAAACCGAAATCAGGA ATAGCCCTTCGACACACCAG Boule GGCTGGAACAATGTATCTGAC ATAGTGATATGCAGGCTGTTG Pdk1 CTGGCCCGAGAACTG GTCGTCCTGAAATGTAAA Tsc1 GGGACTGTGAGTGAGTGACCATGAA CCAGGACGTGTGCTAAAGGT Tsc2 GCTGAGAAGAAGGTGGTGAA CAGGTAGGTGGTGGTGATGT Rptor GCAGAGCTGGAGAATGAAGG GTCGAGGCTCTGCTTGTACC Actin CAGCCTTCCTTCTTGGGTAT TGGCATAGAGGTCTTTACGG Biochemical analyses Serum was extracted from the blood through centrifugation at 1000g for 15 minutes. Blood glucose concentrations were checked with a Roche ACCU-CHEK meter from Basel, Switzerland. Simultaneously, serum lipids and liver index parameters such as total protein, albumin, ALT, and AST were analyzed using a Fully Automatic Biochemistry Analyzer (HITACHI 3100, Tokyo, Japan). Tissue Immunohistochemistry and Immunofluorescence Tissue samples were rinsed with PBS and fixed in 10% formalin for 24 hours. Subsequently, they were placed in cassettes and stored at 4°C in 70% ethanol until they were embedded in paraffin, sectioned into 5-μm slices, and mounted on glass slides. Tissue slides were de-paraffinized using xylene and rehydrated through a decreasing ethanol gradient. Subsequently, the sections underwent heat-induced antigen retrieval using a citrate buffer (0.01M sodium citrate/0.05% Tween-20, pH 6.0). For one hour at room temperature, tissue samples were blocked in a solution of 10 mM Tris-HCl, 0.1M MgCl2, 0.05% Tween-20, 1% BSA, and 10%. The slides were subsequently stained with a primary antibody overnight at 4°C in a humidified environment. Primary antibodies included DAZL (1:200, Epitomics Cat# 3564-1) and BOULE (1:200, Cat# J91-1). After washing the slides in TBST (0.1% Tween-20, TBS), they were incubated with the correct secondary antibodies for an hour at room temperature. Sections underwent TBST washing, followed by a 5-minute DAPI staining at room temperature, and were then mounted with ProlongGold (Invitrogen, P36934). Apoptosis assays Following the manufacturer's instructions, apoptotic assays were conducted through the TUNEL reaction using Roche's In Situ Cell Death Detection Kit (Cat#11684817910). Sections were stained with DAB chromogen and counterstained with hematoxylin. DAB chromogen was used to stain the sections, followed by counterstaining with hematoxylin. The percentage of TUNEL-positive cells was determined by averaging the number of apoptotic cells across 10 seminiferous tubules. For each testis, three non-continuous sections were counted, and a minimum of three animals per genotype were evaluated. RNA Extraction, library construction and sequencing Total RNA was extracted using Trizol reagent kit (Invitrogen, Carlsbad, CA,USA) according to the manufacturer’s protocol. RNA quality was assessed on an Agilent 2100 Bioanalyzer (Agilent Technologies, Palo Alto, CA, USA) and checked using RNase free agarose gel electrophoresis. After total RNA was extracted, eukaryotic mRNA was enriched by Oligo(dT) beads.Then the enriched mRNA was fragmented into short fragments using fragmentation buffer and reversly transcribed into cDNA by using NEBNext Ultra RNA Library Prep Kit for Illumina(NEB #7530,New England Biolabs, Ipswich, MA, USA).The purified double-stranded cDNA fragments were end repaired, A base added, and ligated to Illumina sequencing adapters.The ligation reaction was purified with the AMPure XP Beads(1.0X).Ligated fragments were subjected to size selection by agarose gel electrophoresis and polymerase chain reaction (PCR) amplified.The resulting cDNA library was sequenced using Illumina Novaseq6000 by Gene Denovo Biotechnology Co. (Guangzhou, China). Statistical Analysis SPSS 26.0 software was used for all statistical analyses. Continuous variables are shown as mean ± standard deviation (SD). The Shapiro-Wilk test was employed to evaluate data normality, and all groups were found to have a normal distribution ( P >0.05), arametric tests were judged to be appropriate. Levene's test was performed to assess homoscedasticity before conducting group comparisons. For groups with consistent variances, the independent two-sample t-test was used to analyze differences between them. In situations where heteroscedasticity was present ( P <0.05), Welch’s correction was utilized to adjust for unequal variances. The threshold for statistical significance was set at α=0.05, with P <0.05 considered significant. Error bars in the figures represent SD, and statistical significance is marked by * P < 0.05, ** P < 0.01, *** P < 0.001. Results Phenotype evaluation of male mice exposed to high-fat diet C57BL/6 mice received a high-fat diet (HFD) consisting of 60% fat for 10 weeks, commencing from the fourth week, in order to establish an obesity model. At 8-14 weeks of age, HFD mice exhibited significantly higher body weights than that of the mice on a normal diet (ND) (Fig1 A and B). Adipose tissue analysis revealed that the HFD group had a markedly elevated fat percentage (40.45%±1.61%) compared to the ND group (19.25%±1.34%) (Fig1 C). Additionally, the weight of HFD inguinal fat (2160±381.80)mg, which was significantly elevated than ND group (732±33.71)mg (Fig1 D). Compared to the ND group, the high-fat diet group showed significant increase in Glu, TC, and LDL level ( P <0.05), while HDL level was significantly reduced ( P 0.05) (Fig1 E). The testis weight of HFD mice was decreased (Fig1 F and G), and ratio of testis weight to body weight was also significantly lower than that in ND mice (Fig1 H). Collectively, these results demonstrate that high-fat diet induced obesity promotes inguinal fat accumulation and impairs testicular development in mice. Increased apoptosis of germ cells in HFD mice To evaluate the fertility of HFD male mice, we analyzed the sperm number, motility and morphology of ND and HFD male mice. HFD mice showed a significant decrease in sperm count (10.60±0.93×10⁶) compared to ND controls (19.80±1.16×10⁶, P <0.05), along with reduced motility (65.13%±2.26% vs. 83.07%±1.73%, P <0.05), indicating that obesity impairs sperm production and viability (Fig2 A and B). Morphological analysis revealed frequent abnormalities in HFD sperm, primarily head and tail defects (round/irregular/triangular heads, folded tails; Fig2 C), with only 55% normal morphology versus 89% in ND mice. These findings align with Kahn's report [14] that obesity compromises sperm motility and morphology. Mating experiments further confirmed reduced fertility in HFD males when paired with wild-type females (Fig2 D). H&E staining showed a significant increase in abnormal testicular tubules in HFD mice (Fig2 E-F). To elucidate the impact of obesity on testis lumens, we compared lumens across various stages of development. Result indicated that obesity significantly elevated the number of abnormal tubules at all stages, with the most substantial increases observed in stages I-VIII (Fig 2G). TUNEL immunofluorescence staining revealed that obesity mainly caused extensive apoptosis of spermatocytes in testis lumen, as indicated by the red arrow (Fig 2H). TUNEL positive signals demonstrated that number of positive signals in testicular lumen of HFD group (20.25±2.84) was significantly higher than that of ND group (0.33±0.21) (Fig. 2I). Collectively, these data demonstrate that obesity-induced germ cell apoptosis contributes to male infertility by disrupting spermatogenesis. Obesity mainly leads to increasing apoptosis of late spermatocytes and round spermatid in testis Comparative analysis of H&E staining between ND and HFD mice revealed a significant reduction in germ cells of HFD group. Flow cytometry was used to assess the levels of haploid, diploid, and tetraploid germ cells in both ND and HFD mice. The results demonstrated that the proportion of haploid germ cells in HFD mice was significantly diminished, whereas the proportion of diploid germ cells was markedly increased. No significant differences were observed in the proportion of tetraploid germ cells (Fig 3A-3C).To characterize apoptotic germ cell types, stage-specific tubule analysis showed that apoptotic cells primarily included spermatogonia, early pachytene spermatocytes, late pachytene spermatocytes, and round spermatids (Fig 3D-3E). To explore the impact of obesity on testicular germ cells across different stages, we assessed the survival rates of different germ cell types. Compared to ND mice, the number of spermatogonia, early pachytene spermatocytes, late pachytene spermatocytes, and round spermatocytes in the testis of HFD mice were significantly increased, while no significant differences were observed in preleptotene, leptotene, zygotene, and elongated spermatid (Fig 3F). We categorized and compared spermatogonia, revealing a significant increase in the apoptosis of type B and In, while type A spermatogonia showed no significant change in apoptosis (Fig 3G). In summary, our data show that obesity can lead to an increase in apoptosis of mice germ cells, however, the proportion of 2N germ cells increased and the proportion of 1N germ cells significantly decreased at the overall germ cell level. It is speculated that there may be a potential protective mechanism to protect 2N germ cells in obese mice germ cells. Obese mice may protect germ cells via SGs formation. Stresses such as heat, hypoxia and oxidative conditions often trigger general translation inhibition and induce the formation of stress granules (SGs) in eukaryotic cells [15-16] . It is reports that DAZL protein is essential for stress granule formation, which prevent male germ cells from undergoing apoptosis upon heat stress. Obese mice experience an increase in testicular temperature due to the accumulation of a large amount of fat in the groin and abnormal heat dissipation in the testis. So we performed immunofluorescence staining on the testis sections of mice. Results showed that in normal mice testis, DAZL protein was uniformly distributed in the cytoplasm of spermatogonia and spermatocytes, while BOULE protein was uniformly distributed in the cytoplasm of spermatocytes and round sperm. However, in the testicular lumen of HFD mice, we were surprised to find that DAZL protein forms many SGs in the cytoplasm of spermatogonia and spermatocytes, while BOULE protein forms many SGs in the cytoplasm of spermatocytes, and the SGs are completely colocalized (Fig 4A).We performed quantitative analysis of DAZL and BOULE protein fluorescence intensity in testicular tissues from HFD and ND mice. Results demonstrated no statistically significant difference in DAZL protein fluorescence intensity in HFD group testes compared to ND controls, whereas BOULE protein fluorescence intensity was significantly reduced (Fig 4B-4C). This observation may be associated with extensive apoptosis of round spermatids in obese mouse testes. Additionally, we separately counted the number of SGs in various types of germ cells and found that early pachytene (EP) cells had the highest number of stress granules, with an average of 10.40±1.57 SGs produced per early pachytene cell. The formation of a large number of stress granules in early pachytene cells may be related to their high sensitivity to heat shock (Fig 4D). The above data show that stress granules are mainly distributed in spermatogonia (Spg), preleptotene (PL), leptotene (L), and early pachytene (EP) cells, but no stress granules are distributed in late pachytene (LP), round spermatids (RS) and Elongated spermatid (Fig 4D). Apoptosis of testicular germ cells in obese mice is mainly concentrated in late pachytene, round spermatid and elongated spermatid cells (Fig 3F). Byunghyuk Kim [13] found that DAZL is an essential component of stress granules, which can protect male germ cells from apoptosis under heat stress. Therefore, this study speculates that obese mice can also protect certain types of germ cells by forming stress granules, but the mechanism of their formation is still unclear. SG assembly through the activation of PI3K/AKT signal pathway To explore the potential mechanism underlying SG formation in the testis of obese mice, we purified germ cells from adult mouse testes and performed RNA-Seq analysis. Using a fold change (FC)≥2 and P ≤0.05 as the screening criteria, we identified differentially expressed mRNAs (DEMs) with statistically significant changes via volcano plot analysis. Microarray analysis revealed 664 DEMs in HFD group, including 184 significantly upregulated and 480 downregulated transcripts (Fig 5A-5B). KEGG pathway enrichment analysis [17-18] showed that dysregulated genes were primarily enriched in steroid hormone biosynthesis, retinol metabolism, metabolism of xenobiotics by cytochrome P450, phosphatidylinositol-3-kinase/protein kinase B (PI3K-Akt) signaling pathway, focal adhesion, complement and coagulation cascades, chemical carcinogenesis receptor activation (Fig 5C). Notably, previous studies have confirmed that the PI3K-Akt signaling pathway is involved in stress granule formation [19] . These findings suggest that the testes of obese mice may regulate stress granule assembly via the PI3K-Akt signaling pathway, thereby protecting germ cells from apoptosis. PI3K/AKT/mTOR maintains germ cell survival by regulating stress granule assembly We validated the expression of RNA binding protein genes potentially involved in stress granule formation in germ cells. The results showed that the mRNA expression levels of Pum1 , Pum2 , and Dazl showed no significant changes in obese mice, while the mRNA expression level of Boule was significantly decreased, which may be associated with the apoptosis of a large number of round spermatids. In addition, the study also found that the mRNA expression of Pdk1 and Rptor was significantly upregulated, while the mRNA expression of Tsc1 and Tsc2 was significantly downregulated (Figure 6A). In somatic cells, stress granules (SGs) block the MAPK signaling pathway by sequestering RACK1. In male germ cells, we investigated the co-localization of RACK1 protein with DAZL, a specific marker of germ cell stress granules. Immunofluorescence analysis revealed that RACK1 and DAZL proteins co-localize in the cytoplasm of spermatogonia and spermatocytes from obese mice, demonstrating their collaborative role in stress granule formation (Figure 6B). These findings indicate that obese mice may regulate stress granule assembly through activation of the PI3K/AKT/mTOR signaling axis, thereby inhibiting MAPK pathway activation to sustain germ cell viability. To validate the above hypothesis, we intraperitoneally injected obese mice with LY294002 (a PI3K signaling pathway inhibitor) and ISRIB (a stress granule assembly inhibitor), respectively. Results showed that the number of stress granules in spermatocytes was significantly reduced in both the HFD+LY294002 group and HFD+ISRIB group (Fig 7A-7B). Further findings from H&E staining indicated a marked increase in testicular cell apoptosis in these two groups (Fig 7C). These data confirm that obesity can regulate stress granule assembly by activating the PI3K/AKT/mTOR signaling axis, thereby inhibiting the activation of the MAPK pathway and ultimately maintaining the viability of germ cells. Discussion Numerous studies have demonstrated that obesity represents a crucial factor in the induction of testicular heat stress [20-21] . Excessive adipose tissue in the region of the spermatic cord and the base of the thighs is detrimental to the heat dissipation of the testicles, thereby giving rise to abnormal spermatogenesis [22] . Surgical removal of excessive fat deposits in the pubic bone and scrotum in obese patients can partially alleviate and treat male infertility due to obesity. In addition, some studies have found that although a large number of germ cells undergo apoptosis after heat stress, some of these cells survive and eventually develop into mature sperm, yet the underlying mechanism remains to be elucidated. In this study, obese mouse model was established via a high-fat diet. It was discovered that the weight of the mouse testes decreased, and a significant number of germ cells underwent apoptosis. Qi et al [23] found that a high-fat diet induces the accumulation of large amounts of ectopic lipids in the testicular interstitium of rodents, forming a lipid toxic microenvironment that leads to severe testicular damage. The research results on the impact of obesity on male fertility indicate that obesity can cause male reproductive dysfunction by affecting endocrine hormones, chronic reproductive inflammation, and oxidative stress. The experimental results showed that obese mice exhibited an increase in 2N proportion and a significant decrease in 1N proportion at the overall germ cell level. It is speculated that there may be a potential protective mechanism in the 2N germ cells of obese mice.Further research found that the apoptotic germ cells in obese mice were mainly RS cells and LP cells. Although there was an increase in germ cell apoptosis at other stages, it was not significant. In order to clarify the reasons for the different cell fates at different stages, we performed immunofluorescence staining on testicular germ cells. It was found that many stress granules were formed in these germ cells with less apoptosis. Stress granule (SG) is a highly dynamic assembly formed by liquid-liquid phase separation (LLPS) of eukaryotic cells under stress, mainly containing untranslated mRNA and protein [14] . Eukaryotic cells respond to external environmental stress in various ways, from activating survival defense mechanisms to initiating cell death signaling. The main destructive response under stress is inducing cell apoptosis, and the assembly of stress granules is an important way to protect cells from external stimuli [15] . This protective and destructive signaling pathway intersects with each other, and their interaction determines the fate of cells under stress. SGs are mainly composed of non-canonical stalled 48S preinitiation. In addition, many other proteins accumulate into SGs, but this list is still incomplete. Thus, the formation of stress granules in testicular germ cells of obese mice may be associated with elevated testicular temperature induced by obesity. To further investigate the function and mechanism underlying stress granule formation in testicular germ cells of obese mice, this study performed sequencing analysis on testicular cells from obese mice and conducted KEGG signaling pathway analysis. The results showed that obese mice might promote stress granule formation by activating the PI3K/AKT signaling pathway. Additionally, protein localization results indicated that stress granules in the testes of obese mice can protect germ cells by recruiting RACK1 protein and blocking apoptotic signals. ISRIB is the first reported antagonist of the integrated stress response (ISR), which blocks signaling downstream of all eIF2α kinases [24-26] . Studies have confirmed that treating endoplasmic reticulum-stressed cells with ISRIB not only significantly and comprehensively abrogates the translational effects induced by eIF2α phosphorylation, but also inhibits the formation of stress granules (SGs) triggered by eIF2α phosphorylation. In this study, injecting ISRIB into obese mice led to a significant reduction in the number of stress granules in testicular germ cells, accompanied by a marked increase in germ cell apoptosis, indicating that SGs exert a protective role in testicular germ cells.PI3K/AKT inhibitors Ly294002 as a highly selective phosphatidylinositol 3 (PI3) kinase inhibitor in vivo, capable of blocking PI3 kinase-dependent Akt phosphorylation and its kinase activity [27] . Intraperitoneal injection of the PI3K/AKT inhibitor Ly294002 into high-fat diet (HFD)-induced obese mice resulted in a significant reduction in the number of stress granules (SGs) in testicular germ cells, accompanied by a marked increase in germ cell apoptosis. These findings suggest that activation of the PI3K/AKT signaling pathway in HFD-induced obese mice can promote the formation of stress granules, thereby exerting a protective effect on germ cells. We have demonstrated that the testes of obese mice can regulate the formation of stress granules through the PI3K/AKT signaling pathway, thereby exerting a protective effect on germ cells. Although we have performed gene silencing studies on relevant genes in the PI3K/AKT signaling pathway, overexpression experiments remain unconducted; thus, the core role of this pathway in stress granule formation requires further validation. Additionally, the reactive oxygen species (ROS) concentration and testicular temperature in obese mice were not measured in this study. Subsequent in vitro experiments will clarify the required ROS concentration and temperature thresholds for stress granule formation, and explore the specific effects of different ROS concentrations and temperatures on the quantity of stress granules formed and the fate of germ cells. Declarations Acknowledgements We would like to thank Eugene Yujun Xu professor for discussion and assistance throughout this project. Author contributions Zhang Shikun: Conceptualization, Methodology, Funding acquisition, Supervision, Project administration, Writing-review & editing. Ge Zhijuan: Methodology, Writing-review & editing. Li Mingan: Conceptualization, Methodology. Jiao Yan: Data curation, Methodology, Writing—review & editing. Xu Yanling: Methodology, Writing—review & editing. Zhang Shujuan: Data curation. Funding This work was supported by Open Project of the Jiangsu Provincial Key Laboratory of Colleges and Universities [grant number XZSYSKF2025039], Traditional Chinese Medicine Science and Technology Project of Suqian City [grant number HD202410], Health and Healthcare Scientific Research Project of Suqian City [grant number MS202405],Suqian Guiding Science and Technology Plan Project [grant number Z2024025]. Declaration of Interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper. Data Availability The datasets generated and analysed during the current study are available in the Gene Expression Omnibus (GEO) repository, https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE317745 with the accession number GSE317745. References Pandruvada S, Royfman R, Shah TA, Sindhwani P, Dupree JM, Schon S, Avidor-Reiss T. Lack of trusted diagnostic tools for undetermined male infertility. J Assist Reprod Genet. 2021, 38(2):265-276. Marie-Eve Piché, André Tchernof, Jean-Pierre Després. Obesity Phenotypes, Diabetes, and Cardiovascular Diseases [J]. Circ Res. 2020, 126(11):1477-1500. Du Plessis SS, Cabler S, McAlister DA et al. The effect of obesity on sperm disorders and male infertility[J]. Nat Rev Urol. 2010, 7(3):153-161. Engin-Ustun Y, Ylmaz N, Akgun N et a1.Body Mass Index Effects Kruger’s Criteria in Infertile Men[J]. Int J Fertil Steri1. 2018, 11(4):258-262. Liu H, Liu X, Wang L et a1. Brown adipose tissue transplantation ameliorates male fertility impairment caused by diet induced obesity[J]. Obes Res Clin Pract. 2017,11(2):198-205. Han J, Zhao C, Guo H, Liu T, Li Y, Qi Y, Deussing JM, Zhang Y, Tan J, Han H, Ma X. Obesity induces male mice infertility via oxidative stress, apoptosis, and glycolysis [J]. Reproduction, 2023, 166(1):27-36. Slaine PD, Kleer M, Smith NK, Khaperskyy DA, McCormick C. Stress Granule-Inducing Eukaryotic Translation Initiation Factor 4A Inhibitors Block Influenza A Virus Replication[J]. Viruses. 2017, 9(12):388. Hofmann S, Kedersha N, Anderson P, Ivanov P. Molecular mechanisms of stress granule assembly and disassembly[J]. Biochim Biophys Acta Mol Cell Res. 2021, 1868(1):118876. Zeng W, Lu C, Shi Y, Wu C, Chen X, Li C, Yao J, 2020. Initiation of stress granule assembly by rapid clustering of IGF2BP proteins upon osmotic shock. Biochim. Biophys. Acta BBA-Mol. Cell Res. 1867, 118795. Ivanov P, Kedersha N, Anderson P. Stress Granules and Processing Bodies in Translational Control[J]. Cold Spring Harb Perspect Biol. 2019, 11(5):a032813. Aulas, A, Fay, MM, Lyons, S.M, Achorn, C.A, Kedersha, N, Anderson, P. and Ivanov, P. Stress-specific differences in assembly and composition of stress granules and related foci[J]. J Cell Sci, 2017. 130:927-937. Gwon Y, Maxwell BA, Kolaitis RM, Zhang P, Kim HJ, Taylor JP. Ubiquitination of G3BP1 mediates stress granule disassembly in a context-specific manner[J]. Science. 2021, 72(6549):eabf6548. Byunghyuk Kim, Howard J. Cooke, Kunsoo Rhee. DAZL is essential for stress granule formation implicated in germ cell survival upon heat stress [J]. Development, 2012, 139(3):568-578. Kahn BE, Brannigan RE. Obesity and male infertility [J]. Curr Opin Urol, 2017, 27(5):441-445. Yang C, Wang Z, Kang Y et al. Stress granule homeostasis is modulated by TRIM21-mediated ubiquitination of G3BP1 and autophagy-dependent elimination of stress granules [J]. Autophagy, 2023, 19(7):1934-1951. Zhou Y, Yang Z, Wang Y, et al. Stress granule assembly impairs macrophage efferocytosis to aggravate allergic rhinitis in mice. Nat Commun. 2025, 16(1):5610. Kanehisa M, Sato Y, Kawashima M, Furumichi M, Tanabe M. KEGG as a reference resource for gene and protein annotation. Nucleic Acids Res. 2016 Jan 4;44(D1):D457-62. Kanehisa M, Goto S. KEGG: kyoto encyclopedia of genes and genomes. Nucleic Acids Res. 2000 Jan 1;28(1):27-30. Heberle AM, Razquin Navas P, Langelaar-Makkinje M, Kasack K, Sadik A, Faessler E, Hahn U, Marx-Stoelting P, Opitz CA, Sers C, Heiland I, Schäuble S, Thedieck K. The PI3K and MAPK/p38 pathways control stress granule assembly in a hierarchical manner[J]. Life Sci Alliance. 2019, 2(2):e201800257. Venigalla G, Ila V, Dornbush J, Bernstein A, et al. Male obesity: Associated effects on fertility and the outcomes of offspring [J]. Andrology. 2025, 13(1):64-71. Qing H, Hu J, Fu H, Zhao Z, Nong W, Wang J, Yang F, Zhao S. Activation of thermogenesis pathways in testis of diet-induced obesity mice [J]. Reprod Biol. 2022, 22(3):100652. Palmer NO, Bakos HW, Fullston T, et al. Impact of obesity on male fertility, sperm function and molecular composition [J]. Spermatogenesis. 2012, 2(4):253-263. Qi X, Zhang M, Sun M, Luo D, Guan Q, Yu C. Restoring Impaired Fertility Through Diet: Observations of Switching From High-Fat Diet During Puberty to Normal Diet in Adulthood Among Obese Male Mice[J]. Front Endocrinol (Lausanne). 2022,13:839034. Sidrauski C, McGeachy AM, Ingolia NT, Walter P. The small molecule ISRIB reverses the effects of eIF2α phosphorylation on translation and stress granule assembly. Elife. 2015, 4:e05033. Tong F, Hu H, Xu Y, Zhou Y, Xie R, Lei T, Du Y, Yang W, He S, Huang Y, Gong T, Gao H. Hollow copper sulfide nanoparticles carrying ISRIB for the sensitized photothermal therapy of breast cancer and brain metastases through inhibiting stress granule formation and reprogramming tumor-associated macrophages. Acta Pharm Sin B. 2023, 13(8):3471-3488. Zyryanova AF, Kashiwagi K, Rato C, Harding HP, Crespillo-Casado A, Perera LA, Sakamoto A, Nishimoto M, Yonemochi M, Shirouzu M, Ito T, Ron D. ISRIB Blunts the Integrated Stress Response by Allosterically Antagonising the Inhibitory Effect of Phosphorylated eIF2 on eIF2B. Mol Cell. 2021, 81(1):88-103. Wu X, Pu L, Chen W, et al. LY294002 attenuates inflammatory response in endotoxin-induced uveitis by downregulating JAK3 and inactivating the PI3K/Akt signaling. Immunopharmacol Immunotoxicol. 2022, 44(4):510-518. Additional Declarations There is a conflict of interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper. Cite Share Download PDF Status: Under Revision Version 1 posted Editorial decision: revise 20 Mar, 2026 Review # 3 received at journal 08 Mar, 2026 Review # 2 received at journal 26 Feb, 2026 Reviewer # 3 agreed at journal 20 Feb, 2026 Reviewer # 2 agreed at journal 16 Feb, 2026 Reviewer # 1 agreed at journal 16 Feb, 2026 Reviewers invited by journal 16 Feb, 2026 Submission checks completed at journal 09 Feb, 2026 Editor assigned by journal 06 Feb, 2026 First submitted to journal 06 Feb, 2026 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-8811652","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":592420374,"identity":"2cebf027-ee9e-4e89-8b25-f6c3d6b243bd","order_by":0,"name":"shikun zhang","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABHUlEQVRIie3QMUvDQBTA8RcC1+VK1wsV+wmEFwJXh4qbn+NCoFMQRJBM9Urhpn6ACPodCkLALSHQLmdds9nuCgEnqaC2q0nI6HD/8XE/3uMATKZ/2PlqKtMSR8cEXjZYAojDmDYZnWfbOBp7PUvDVdyKFBeBR3Xu3800fNA2xIopZ11lW4vlc/Z4piaXJ7GwNu8KBsMaYvfnnDmK2KjXgRdqcs0LYbsPCtwnWU3IkebMVZRgkXIvjKifFIL0uwoEptWEspAzXzGKr5vh7hTZnnR2TYSxcYCpRuZIjR5EeNhiNxGkv58sI4E9WAp3roWf6O3MuV8zd1FHOlOZf+H3rYI8xU818ZNVkJVvN6NB3ZaqLLm/uP17k8lkMv3pBxmHZgwHXOB8AAAAAElFTkSuQmCC","orcid":"https://orcid.org/0009-0006-0020-8989","institution":"Shuyang Hospital","correspondingAuthor":true,"prefix":"","firstName":"shikun","middleName":"","lastName":"zhang","suffix":""},{"id":592420375,"identity":"3703e2a7-7fd2-4ea8-95b4-8924c7804c4e","order_by":1,"name":"zhijuan Ge","email":"","orcid":"","institution":"Shuyang Hospital","correspondingAuthor":false,"prefix":"","firstName":"zhijuan","middleName":"","lastName":"Ge","suffix":""},{"id":592420376,"identity":"e1e8dc81-6ae2-4e42-886c-edcbcda65d2a","order_by":2,"name":"Mingan Li","email":"","orcid":"","institution":"Shuyang Hospital","correspondingAuthor":false,"prefix":"","firstName":"Mingan","middleName":"","lastName":"Li","suffix":""},{"id":592420377,"identity":"ceb26251-0878-49c3-9ec6-59f2f912ab59","order_by":3,"name":"yan Jiao","email":"","orcid":"","institution":"Shuyang Hospital","correspondingAuthor":false,"prefix":"","firstName":"yan","middleName":"","lastName":"Jiao","suffix":""},{"id":592420378,"identity":"cbfad03a-e98f-4ed9-b7cd-2475d0ada4e3","order_by":4,"name":"shujuan zhang","email":"","orcid":"","institution":"Shuyang Hospital","correspondingAuthor":false,"prefix":"","firstName":"shujuan","middleName":"","lastName":"zhang","suffix":""},{"id":592420379,"identity":"55f72b52-42e9-4495-9ad3-6430a5ece0c3","order_by":5,"name":"yanling xu","email":"","orcid":"","institution":"Shuyang Hospital","correspondingAuthor":false,"prefix":"","firstName":"yanling","middleName":"","lastName":"xu","suffix":""}],"badges":[],"createdAt":"2026-02-07 02:25:23","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-8811652/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-8811652/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":103260183,"identity":"4e3b87a1-519c-49b2-bcfb-76f69ff2eb0b","added_by":"auto","created_at":"2026-02-23 17:48:19","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":4652938,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eHigh-fat diet-induced obese mice testis weight was significantly reduced\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A) Male mice receive a normal diet (ND) or high-fat diet (HFD) for 10 weeks, n=15; (B) 14 weeks ND and HFD mice photos; (C) Evaluate the body fat content of mice, n=10; (D) Inguinal fat weight, n=10; (E) Detection of serological indexes. Glu, blood glucose; TC, Total Cholesterol; TG,Triglyceride; HDL, High density lipoprotein; LDL, Low Density Lipoprotein Cholesterol; n=6(F) Inguinal fat and testicular photography (G and H) Comparison of testis weight and testis/body weight ratio among ND and HFD, n=10.\u003c/p\u003e\n\u003cp\u003eData are expressed as mean ± s.d. Student’s t test (two-tailed) was used for statistical analysis (*\u003cem\u003eP\u003c/em\u003e\u0026lt;0.05,**\u003cem\u003eP\u003c/em\u003e\u0026lt;0.01,***\u003cem\u003eP\u003c/em\u003e\u0026lt;0.001).\u003c/p\u003e","description":"","filename":"fig12025.07.09.png","url":"https://assets-eu.researchsquare.com/files/rs-8811652/v1/28718a9bc68463d41caab13e.png"},{"id":103260189,"identity":"89638121-3973-4295-893f-996cd9d15df7","added_by":"auto","created_at":"2026-02-23 17:48:20","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":15799055,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eObesity can affect fertility of male mice\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A-B) Comparison of sperm counts and sperm motility, n=10;\u003c/p\u003e\n\u003cp\u003e(C) Pie charts show the proportion of normal and abnormal sperm in ND and HFD mice; (D) Fertility assay of ND, HFD males revealed significantly reduced, n=5; (E) H\u0026amp;E staining of adult ND and HFD testis sections revealed increased degenerated tubules in HFD. Scale bar=50μm; (F-G) Comparison of proportion of abnormal tubes and the proportion of abnormal tubes in different periods, n=6; (H) TUNEL immunofluorescence staining of testicular lumen, Scale bar = 20μm; (I) Numerical comparison of TUNEL positive signals in testicular lumen, n=6. (**\u003cem\u003eP\u003c/em\u003e\u0026lt;0.01, ***\u003cem\u003eP\u003c/em\u003e\u0026lt;0.001).\u003c/p\u003e","description":"","filename":"Fig22025.07.09.png","url":"https://assets-eu.researchsquare.com/files/rs-8811652/v1/bca15fd2b8db11fe535bfd36.png"},{"id":103260188,"identity":"b2eaf107-f2e6-4895-8665-8cb930dc44df","added_by":"auto","created_at":"2026-02-23 17:48:20","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":25984994,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eDifferent types of spermatogenic cells in obese mice have different fate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A-B) Flow cytometry was used to count the number of 1N/2N/4N testicular cells in ND mice and HFD mice; (C) Changes in the proportion of HFD germ cells (1N/2N/4N), n=3; (D) HE staining of HFD testicular lumen at different stages. Scale bar = 50μm; (E) HE staining of HFD mice different types germ cells. Spg, spermatogonium; PL, preleptotene; L, leptotene; Z, zygotene; EP, early pachytene; LP, late pachytene; RS Round spermatid; ES Elongated spermatid; (F) Comparison of apoptotic germ cells proportion in the same type of cells, n=3; (G) The proportion of apoptotic cells in different types of spermatogonia. A, Type A spermatogonia; In, Intermediate spermatogonia; B, Type B spermatogonia; n=3(**\u003cem\u003eP\u003c/em\u003e\u0026lt;0.01, ***\u003cem\u003eP\u003c/em\u003e\u0026lt;0.001).\u003c/p\u003e","description":"","filename":"Fig32025.07.09.png","url":"https://assets-eu.researchsquare.com/files/rs-8811652/v1/f01385309ff4fe50808dbe4c.png"},{"id":103260186,"identity":"e4423e86-3104-4c69-8837-3e12c66c0769","added_by":"auto","created_at":"2026-02-23 17:48:19","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":16064345,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eTranscriptome sequencing analysis of reproductive cells in obese mice\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A) The top 664 dysregulated genes were shown in this heatmap, n=3; (B) Histogram of differentially expressed genes; (C) KEGG pathway analysis of these dysregulated genes.\u003c/p\u003e","description":"","filename":"FIG420250709.png","url":"https://assets-eu.researchsquare.com/files/rs-8811652/v1/cec0f40def68fa0cd8abdf38.png"},{"id":103260184,"identity":"43698981-08fb-4724-9ea5-43a7b409ff85","added_by":"auto","created_at":"2026-02-23 17:48:19","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":3068117,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eTranscriptome sequencing analysis of reproductive cells in obese mice\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A) The top 664 dysregulated genes were shown in this heatmap, n=3; (B) Histogram of differentially expressed genes; (C) KEGG pathway analysis of these dysregulated genes.\u003c/p\u003e","description":"","filename":"Fig52025.07.10.png","url":"https://assets-eu.researchsquare.com/files/rs-8811652/v1/d33bc981015fe6a030518cbd.png"},{"id":103260185,"identity":"f30084c6-9f0a-4d2a-8569-bc261c99da6f","added_by":"auto","created_at":"2026-02-23 17:48:19","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":4679989,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSequestration of RACK1 in SGs and inhibition of the apoptotic MAPK in germ cells of obese mice\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A) Relative levels of \u003cem\u003ePum1\u003c/em\u003e, \u003cem\u003ePum2\u003c/em\u003e, \u003cem\u003eDazl\u003c/em\u003e, \u003cem\u003eBoule\u003c/em\u003e,\u003cem\u003ePdk1\u003c/em\u003e,\u003cem\u003eTsc1\u003c/em\u003e,\u003cem\u003eTsc2\u003c/em\u003e, \u003cem\u003eRptor \u003c/em\u003emRNAs in the testis, n=3; (B) Adult testis of ND and HFD mice were immunostained for RACK1 (green), along with the SG markers DAZL (red), DNA stained with DAPI (blue), Scale bar, 2μm.\u003c/p\u003e","description":"","filename":"FIG62025.11.11.png","url":"https://assets-eu.researchsquare.com/files/rs-8811652/v1/a56444b6d081968409759e6d.png"},{"id":103260187,"identity":"114c9f86-455e-4026-b0a2-6e763399f237","added_by":"auto","created_at":"2026-02-23 17:48:19","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":12952777,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eObese mice can protect germ cells by activating the PI3K/AKT signaling pathway to promote the formation of stress granules\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A) Immunofluorescence staining results of testicular sections from mice in different groups (high-fat diet group, high-fat diet + DMSO group, high-fat diet + LY294002 group, high-fat diet + ISRIB group), DAZL is labeled with red fluorescence, and BOULE is labeled with green fluorescence.\u003c/p\u003e\n\u003cp\u003e(B) Statistical results of the number of stress granules in germ cells of mice in different groups.\u003c/p\u003e\n\u003cp\u003e(C) HE staining results of the lumens of testicular seminiferous tubules in mice from different groups.\u003c/p\u003e","description":"","filename":"fig72025.11.11.png","url":"https://assets-eu.researchsquare.com/files/rs-8811652/v1/18451e5a2acc7f03ae166c31.png"},{"id":103505818,"identity":"3b10747c-7a57-4cd1-bd30-cf7b84928483","added_by":"auto","created_at":"2026-02-26 13:33:08","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":76254696,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8811652/v1/33de3333-0468-410e-aa70-ac7fdaf0e3a4.pdf"}],"financialInterests":"There is a conflict of interest\nThe authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.","formattedTitle":"The PI3K-AKT-mTOR pathway maintains germ cell survival in obese mice by regulating stress granule assembly","fulltext":[{"header":"Introduction","content":"\u003cp\u003eThe World Health Organization reports that 10% to 15% of couples of childbearing age may have fertility problems, with male factors accounting for 30% to 50%\u003csup\u003e[1]\u003c/sup\u003e.The main factors leading to male infertility include chromosomal abnormalities, endocrine disorders, environmental pollution, and unhealthy lifestyle habits\u003csup\u003e[2-3]\u003c/sup\u003e. In recent years, the prevalence of obesity has been escalating, and its effects on male fertility including poor semen quality and erectile dysfunction have garnered significant attention. Research shows that obesity is related to systemic pre-inflammatory state and the increase of local oxidative stress. Oxidative stress at the level of testicular micro-environment will lead to spermatogenesis disorder and damage. The increase of body mass index (BMI) is related to decrease of mitochondrial activity, the number of forward moving sperm and the increase of DNA breakage\u003csup\u003e[4-5]\u003c/sup\u003e. In addition, the testicles are located far away from the abdominal organs within the scrotum, with a temperature about 2℃lower than abdominal cavity, which is necessary for spermatogenic function. Spermatozoa are very sensitive to temperature in the process of development. Obesity patients can increase scrotal temperature due to reduced movement, sedentary lifestyle and local fat deposition, and ultimately inhibit spermatogenesis, resulting in decreased sperm quality, even testicular atrophy and spermatogenesis stagnation. The rise of scrotal temperature will not only affect mature sperm, but also have adverse effects on spermatocyte and early sperm\u003csup\u003e[6-7]\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003eEukaryotic cells maintain cell survival by forming stress granules (SGs) in adverse environments such as heat shock, oxidative stress, high osmotic pressure\u003csup\u003e[8]\u003c/sup\u003e. SG is a membrane free organelle located in the cytoplasm and involved in post transcriptional regulation and translation control, mainly composed of RNA binding proteins and untranslated mRNA\u003csup\u003e[9]\u003c/sup\u003e.The RNA composition of SG is selective, including transcription encoding house-keeping genes but not encoding stress-induced genes such as HSP70. In most cases, environmental pressure leads to eIF2α activation of upstream kinases to phosphorylate eIF2α, translation initiation obstructed or delayed. Subsequently, proteins such as TIA-1, TTP, and G3BP quickly bind to mRNP and aggregate into SG, and with the help of microtubule proteins, further aggregate into the nucleus to form mature SG\u003csup\u003e[10-11]\u003c/sup\u003e. Another scenario is not dependent on eIF2α\u0026nbsp;phosphorylated stress granules encapsulate untranslated mRNA, inhibiting its translation and enabling cells to better adapt to environmental stress. When the pressure disappears, SG relies on microtubules and their motor proteins for depolymerization, releasing encapsulated mRNA and proteins\u003csup\u003e[12-13]\u003c/sup\u003e. SGs are mainly composed of non-canonical stalled 48S preinitiation. In addition, many other proteins accumulate into SGs, but this list is still incomplete.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eSpermatogenesis is a highly coordinated and extremely complex process, and its microenvironment is strictly regulated. Testis, the main site of spermatogenesis in males, 2 to 4℃ lower than body temperature. Heat shock, cryptorchidism, varicocele, and severe fever can cause testicular temperature increase, and spermatogenesis block. Obesity is also an important factor in inducing testicular heat stress. Although a large number of germ cells went to apoptosis after heat stress, some cells still survived and developed into mature spermatozoa. The protective mechanism governing the survival of these undamaged germ cells has not been clearly defined. Furthermore, whether this protection is linked to cell adaptive compartments like stress granules remains an unresolved question. Collectively, the answers to these key scientific inquiries have yet to be fully elucidated.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cp\u003e\u003cstrong\u003eEthics statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study was approved by the Animal Research Committee of Xu zhou medical University (approval number IACUC Issue No.202207s030). All experiments were performed in accordance with ARRIVE guidelines. All procedures were performed in accordance with relevant guidelines' in the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAnimals\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFour-week-old male C57BL/6 mice were obtained from Shandong Laboratory Animal Center. All animals were housed in the Animal Center of Xuzhou Medical University under a 12-h light/12-h dark cycle, with temperature maintained at 20–25°C and relative humidity at 45–55%. Following a 1-week acclimatization period,\u0026nbsp;a total of 30 C57BL/6J male mice (6 weeks old, SPF grade)\u0026nbsp;were randomly allocated into two groups with\u0026nbsp;15 mice per group\u0026nbsp;using a random number table method: the control group received a normal diet (ND; catalog no.: XTCON50J, 10% fat, 70% carbohydrate, and 20% protein by caloric content; Nanjing, China) for 10 consecutive weeks, while the treatment group was fed a high-fat diet (HFD; catalog no.: XTHF60, 60% fat, 20% carbohydrate, and 20% protein by caloric content; Nanjing, China) to induce diet-induced obesity.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDrug Administration and Experimental Design\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;The mice were randomly divided into HFD, HFD+DMSO, HFD+LY294002, and HFD + ISRIB groups. HFD + LY294002 Group:LY294002 (Cat. No.HY-10108, MedChemExpress, USA) was dissolved in dimethyl sulfoxide (DMSO; Cat. No.D2650, Sigma-Aldrich, USA; Merck KGaA, Germany) to prepare the drug solution. The drug was administered to mice via intraperitoneal injection at a dose of 10 mg/kg body weight. The injection volume was adjusted according to the real-time body weight of each mouse to ensure the accuracy of the administered dose. HFD + ISRIB Group:ISRIB (Cat. No.T2027, TargetMol, USA) was dissolved in 0.9% sodium chloride solution (normal saline) to form a homogeneous solution. The drug was delivered to mice by intraperitoneal injection at a fixed dose of 0.5 mg/kg body weight, and the administration was performed once daily for 14 consecutive days.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eSperm count and sperm motility\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFollowing intraperitoneal anesthesia with 2,2,2-tribromoethanol at a dosage of 250 mg/kg body weight, mice were humanely euthanized via cervical dislocation. Sperm concentration (per mL) was determined using a hemocytometer, following these steps: One caudal epididymis was collected and placed in 1 mL of pre-warmed (37°C) 1×HBSS, then dissected into several small pieces. It was subsequently incubated at 37°C for 30 minutes to facilitate sperm release. Total sperm motility was analyzed using the computer-assisted sperm analysis (CASA, Hamilton Thorne, TOX IVOS) system, with the following steps: One caudal epididymis was collected and placed in 200 μL of pre-warmed (37°C) 1×HBSS, then dissected into several small pieces. It was then incubated at 37°C for 5 minutes to facilitate sperm release.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFertility assays\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo assess the fertility of male mice fed a normal diet (ND) or high-fat diet (HFD), males from each group were paired with wild-type (WT) female mice at a 1:2 ratio for mating, with the mating period lasting at least 2 months. This experiment included 5 ND male mice and 5 HFD male mice, and the litter size of each breeding pair was recorded.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eRNA extraction and quantitative real-time PCR (qPCR)\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eUsing TRIzol Reagent (Invitrogen) as per the manufacturer's instructions, RNA was extracted and its amount was quantified by measuring the optical density at 260nm. Reverse transcription (RT) was carried out following standard procedures using random primers and PrimeScript RT Master Mix (Takara). Real-time PCR was done with an ABI Prism StepOne device (Applied) using SYBR Green Master Mix (Vazyme, Q141) and the primers given in S1 Table. Three samples from different mice for each group were used. Quantifications were made in triplicate for each sample from individual testes. For analysis of the mRNA expression, the comparative Ct method (ΔΔCT) was used.\u003c/p\u003e\n\u003cp\u003eS1 Primers Used for qPCR\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eGene\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eForward Primer\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eReverse Primer\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003ePum1\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eGCAGCTACAAACTCTGCTACTC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eCAAGACTGGATAACCTGGCATAC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003ePum2\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eGCAGGTCAGCGTCCTATTACTC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eGTGCTGCCTGTAAGACTATTTGC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eDazl\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eGGATGAAACCGAAATCAGGA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eATAGCCCTTCGACACACCAG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eBoule\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eGGCTGGAACAATGTATCTGAC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eATAGTGATATGCAGGCTGTTG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003ePdk1\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eCTGGCCCGAGAACTG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eGTCGTCCTGAAATGTAAA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eTsc1\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eGGGACTGTGAGTGAGTGACCATGAA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eCCAGGACGTGTGCTAAAGGT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eTsc2\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eGCTGAGAAGAAGGTGGTGAA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eCAGGTAGGTGGTGGTGATGT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eRptor\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eGCAGAGCTGGAGAATGAAGG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eGTCGAGGCTCTGCTTGTACC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eActin\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eCAGCCTTCCTTCTTGGGTAT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eTGGCATAGAGGTCTTTACGG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003cstrong\u003eBiochemical analyses\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSerum was extracted from the blood through centrifugation at 1000g for 15 minutes. Blood glucose concentrations were checked with a Roche ACCU-CHEK meter from Basel, Switzerland. Simultaneously, serum lipids and liver index parameters such as total protein, albumin, ALT, and AST were analyzed using a Fully Automatic Biochemistry Analyzer (HITACHI 3100, Tokyo, Japan).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTissue Immunohistochemistry and Immunofluorescence\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTissue samples were rinsed with PBS and fixed in 10% formalin for 24 hours. Subsequently, they were placed in cassettes and stored at 4°C in 70% ethanol until they were embedded in paraffin, sectioned into 5-μm slices, and mounted on glass slides. Tissue slides were de-paraffinized using xylene and rehydrated through a decreasing ethanol gradient. Subsequently, the sections underwent heat-induced antigen retrieval using a citrate buffer (0.01M sodium citrate/0.05% Tween-20, pH 6.0). For one hour at room temperature, tissue samples were blocked in a solution of 10 mM Tris-HCl, 0.1M MgCl2, 0.05% Tween-20, 1% BSA, and 10%. The slides were subsequently stained with a primary antibody overnight at 4°C in a humidified environment. Primary antibodies included DAZL (1:200, Epitomics Cat# 3564-1) and BOULE (1:200, Cat# J91-1). After washing the slides in TBST (0.1% Tween-20, TBS), they were incubated with the correct secondary antibodies for an hour at room temperature. Sections underwent TBST washing, followed by a 5-minute DAPI staining at room temperature, and were then mounted with ProlongGold (Invitrogen, P36934).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eApoptosis assays\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFollowing the manufacturer's instructions, apoptotic assays were conducted through the TUNEL reaction using Roche's In Situ Cell Death Detection Kit (Cat#11684817910). Sections were stained with DAB chromogen and counterstained with hematoxylin. DAB chromogen was used to stain the sections, followed by counterstaining with hematoxylin. The percentage of TUNEL-positive cells was determined by averaging the number of apoptotic cells across 10 seminiferous tubules. For each testis, three non-continuous sections were counted, and a minimum of three animals per genotype were evaluated.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eRNA Extraction, library construction and sequencing\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTotal RNA was extracted using Trizol reagent kit (Invitrogen, Carlsbad, CA,USA) according to the manufacturer’s protocol. RNA quality was assessed on an Agilent 2100 Bioanalyzer (Agilent Technologies, Palo Alto, CA, USA) and checked using RNase free agarose gel electrophoresis. After total RNA was extracted, eukaryotic mRNA was enriched by Oligo(dT) beads.Then the enriched mRNA was fragmented into short fragments using fragmentation buffer and reversly transcribed into cDNA by using NEBNext Ultra RNA Library Prep Kit for Illumina(NEB #7530,New England Biolabs, Ipswich, MA, USA).The purified double-stranded cDNA fragments were end repaired, A base added, and ligated to Illumina sequencing adapters.The ligation reaction was purified with the AMPure XP Beads(1.0X).Ligated fragments were subjected to size selection by agarose gel electrophoresis and polymerase chain reaction (PCR) amplified.The resulting cDNA library was sequenced using Illumina Novaseq6000 by Gene Denovo Biotechnology Co. (Guangzhou, China).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eStatistical Analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSPSS 26.0 software was used for all statistical analyses. Continuous variables are shown as mean ± standard deviation (SD). The Shapiro-Wilk test was employed to evaluate data normality, and all groups were found to have a normal distribution (\u003cem\u003eP\u003c/em\u003e\u0026gt;0.05), arametric tests were judged to be appropriate. Levene's test was performed to assess homoscedasticity before conducting group comparisons. For groups with consistent variances, the independent two-sample t-test was used to analyze differences between them. In situations where heteroscedasticity was present (\u003cem\u003eP\u003c/em\u003e\u0026lt;0.05), Welch’s correction was utilized to adjust for unequal variances. The threshold for statistical significance was set at α=0.05, with \u003cem\u003eP\u003c/em\u003e\u0026lt;0.05 considered significant. Error bars in the figures represent SD, and statistical significance is marked by *\u003cem\u003eP\u003c/em\u003e\u0026lt; 0.05, **\u003cem\u003eP\u003c/em\u003e\u0026lt; 0.01, ***\u003cem\u003eP\u003c/em\u003e\u0026lt; 0.001.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cstrong\u003ePhenotype evaluation of male mice exposed to high-fat diet\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eC57BL/6 mice received a high-fat diet (HFD) consisting of 60% fat for 10 weeks, commencing from the fourth week, in order to establish an obesity model. At 8-14 weeks of age, HFD mice exhibited significantly higher body weights than that of the mice on a normal diet (ND) (Fig1 A and B). Adipose tissue analysis revealed that the HFD group had a markedly elevated fat percentage (40.45%\u0026plusmn;1.61%) compared to the ND group (19.25%\u0026plusmn;1.34%) (Fig1 C). Additionally, the weight of HFD inguinal fat (2160\u0026plusmn;381.80)mg, which was significantly elevated than ND group (732\u0026plusmn;33.71)mg (Fig1 D). Compared to the ND group, the high-fat diet group showed significant increase in Glu, TC, and LDL level (\u003cem\u003eP\u003c/em\u003e\u0026lt;0.05), while HDL level was significantly reduced (\u003cem\u003eP\u003c/em\u003e\u0026lt;0.05), with no significant change in TG level (\u003cem\u003eP\u003c/em\u003e\u0026gt;0.05) (Fig1 E). The testis weight of HFD mice was decreased (Fig1 F and G), and ratio of testis weight to body weight was also significantly lower than that in ND mice (Fig1 H). Collectively, these results demonstrate that high-fat diet induced obesity promotes inguinal fat accumulation and impairs testicular development in mice.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eIncreased apoptosis of germ cells in HFD mice\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo evaluate the fertility of HFD male mice, we analyzed the sperm number, motility and morphology of ND and HFD male mice. HFD mice showed a significant decrease in sperm count (10.60\u0026plusmn;0.93\u0026times;10⁶) compared to ND controls (19.80\u0026plusmn;1.16\u0026times;10⁶, \u003cem\u003eP\u003c/em\u003e\u0026lt;0.05), along with reduced motility (65.13%\u0026plusmn;2.26% vs. 83.07%\u0026plusmn;1.73%, \u003cem\u003eP\u003c/em\u003e\u0026lt;0.05), indicating that obesity impairs sperm production and viability (Fig2 A and B). Morphological analysis revealed frequent abnormalities in HFD sperm, primarily head and tail defects (round/irregular/triangular heads, folded tails; Fig2 C), with only 55% normal morphology versus 89% in ND mice. These findings align with Kahn\u0026apos;s report \u003csup\u003e[14]\u003c/sup\u003e that obesity compromises sperm motility and morphology.\u003c/p\u003e\n\u003cp\u003eMating experiments further confirmed reduced fertility in HFD males when paired with wild-type females (Fig2 D). H\u0026amp;E staining showed a significant increase in abnormal testicular tubules in HFD mice (Fig2 E-F). To elucidate the impact of obesity on testis lumens, we compared lumens across various stages of development. Result indicated that obesity significantly elevated the number of abnormal tubules at all stages, with the most substantial increases observed in stages I-VIII (Fig 2G). TUNEL immunofluorescence staining revealed that obesity mainly caused extensive apoptosis of spermatocytes in testis lumen, as indicated by the red arrow (Fig 2H). TUNEL positive signals demonstrated that number of positive signals in testicular lumen of HFD group (20.25\u0026plusmn;2.84) was significantly higher than that of ND group (0.33\u0026plusmn;0.21) (Fig. 2I). Collectively, these data demonstrate that obesity-induced germ cell apoptosis contributes to male infertility by disrupting spermatogenesis.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eObesity mainly leads to increasing apoptosis of late spermatocytes and round spermatid in testis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eComparative analysis of H\u0026amp;E staining between ND and HFD mice revealed a significant reduction in germ cells of HFD group. Flow cytometry was\u0026nbsp;used\u0026nbsp;to assess the levels of haploid, diploid, and tetraploid germ cells in both ND and HFD mice. The results demonstrated that the proportion of haploid germ cells in HFD mice was significantly diminished, whereas the proportion of diploid germ cells was markedly increased. No significant differences were observed in the proportion of tetraploid germ cells (Fig 3A-3C).To characterize apoptotic germ cell types, stage-specific tubule analysis showed that apoptotic cells primarily included spermatogonia, early pachytene spermatocytes, late pachytene spermatocytes, and round spermatids (Fig 3D-3E).\u003c/p\u003e\n\u003cp\u003eTo explore the impact of obesity on testicular germ cells across different stages, we assessed the survival rates of different germ cell types. Compared to ND mice, the number of spermatogonia, early pachytene spermatocytes, late pachytene spermatocytes, and round spermatocytes in the testis of HFD mice were significantly increased, while no significant differences were observed in preleptotene, leptotene, zygotene, and elongated spermatid (Fig 3F). We categorized and compared spermatogonia, revealing a significant increase in the apoptosis of type B and In, while type A spermatogonia showed no significant change in apoptosis (Fig 3G). In summary, our data show that obesity can lead to an increase in apoptosis of mice germ cells, however, the proportion of 2N germ cells increased and the proportion of 1N germ cells significantly decreased at the overall germ cell level. It is speculated that there may be a potential protective mechanism to protect 2N germ cells in obese mice germ cells.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eObese mice may protect germ cells via SGs formation.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eStresses such as heat, hypoxia and oxidative conditions often trigger general translation inhibition and induce the formation of stress granules (SGs) in eukaryotic cells\u003csup\u003e[15-16]\u003c/sup\u003e. It is reports that DAZL protein is essential for stress granule formation, which prevent male germ cells from undergoing apoptosis upon heat stress. Obese mice experience an increase in testicular temperature due to the accumulation of a large amount of fat in the groin and abnormal heat dissipation in the testis. So we performed immunofluorescence staining on the testis sections of mice. Results showed that in normal mice testis, DAZL protein was uniformly distributed in the cytoplasm of spermatogonia and spermatocytes, while BOULE protein was uniformly distributed in the cytoplasm of spermatocytes and round sperm. However, in the testicular lumen of HFD mice, we were surprised to find that DAZL protein forms many SGs in the cytoplasm of spermatogonia and spermatocytes, while BOULE protein forms many SGs in the cytoplasm of spermatocytes, and the SGs are completely colocalized (Fig 4A).We performed quantitative analysis of DAZL and BOULE protein fluorescence intensity in testicular tissues from HFD and ND mice. Results demonstrated no statistically significant difference in DAZL protein fluorescence intensity in HFD group testes compared to ND controls, whereas BOULE protein fluorescence intensity was significantly reduced (Fig 4B-4C). This observation may be associated with extensive apoptosis of round spermatids in obese mouse testes. Additionally, we separately counted the number of SGs in various types of germ cells and found that early pachytene (EP) cells had the highest number of stress granules, with an average of 10.40\u0026plusmn;1.57 SGs produced per early pachytene cell. The formation of a large number of stress granules in early pachytene cells may be related to their high sensitivity to heat shock (Fig 4D). The above data show that stress granules are mainly distributed in spermatogonia (Spg), preleptotene (PL), leptotene (L), and early pachytene (EP) cells, but no stress granules are distributed in late pachytene (LP), round spermatids (RS) and Elongated spermatid (Fig 4D). Apoptosis of testicular germ cells in obese mice is mainly concentrated in late pachytene, round spermatid and elongated spermatid cells (Fig 3F). Byunghyuk Kim\u003csup\u003e[13]\u003c/sup\u003e found that DAZL is an essential component of stress granules, which can protect male germ cells from apoptosis under heat stress. Therefore, this study speculates that obese mice can also protect certain types of germ cells by forming stress granules, but the mechanism of their formation is still unclear.\u003c/p\u003e\n\u003cp\u003eSG assembly through the activation of\u0026nbsp;PI3K/AKT signal pathway\u003c/p\u003e\n\u003cp\u003eTo explore the potential mechanism underlying SG formation in the testis of obese mice, we purified germ cells from adult mouse testes and performed RNA-Seq analysis. Using a fold change (FC)\u0026ge;2 and \u003cem\u003eP\u003c/em\u003e\u0026le;0.05 as the screening criteria, we identified differentially expressed mRNAs (DEMs) with statistically significant changes via volcano plot analysis. Microarray analysis revealed 664 DEMs in HFD group, including 184 significantly upregulated and 480 downregulated transcripts (Fig 5A-5B). KEGG pathway enrichment analysis\u003csup\u003e[17-18]\u0026nbsp;\u003c/sup\u003eshowed that dysregulated genes were primarily enriched in steroid hormone biosynthesis, retinol metabolism, metabolism of xenobiotics by cytochrome P450, phosphatidylinositol-3-kinase/protein kinase B (PI3K-Akt) signaling pathway, focal adhesion, complement and coagulation cascades, chemical carcinogenesis receptor activation (Fig 5C). Notably, previous studies have confirmed that the PI3K-Akt signaling pathway is involved in stress granule formation\u003csup\u003e[19]\u003c/sup\u003e. These findings suggest that the testes of obese mice may regulate stress granule assembly via the PI3K-Akt signaling pathway, thereby protecting germ cells from apoptosis.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ePI3K/AKT/mTOR maintains germ cell survival by regulating stress granule assembly\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe validated the expression of RNA binding protein genes potentially involved in stress granule formation in germ cells. The results showed that the mRNA expression levels of \u003cem\u003ePum1\u003c/em\u003e, \u003cem\u003ePum2\u003c/em\u003e, and \u003cem\u003eDazl\u003c/em\u003e showed no significant changes in obese mice, while the mRNA expression level of Boule was significantly decreased, which may be associated with the apoptosis of a large number of round spermatids. In addition, the study also found that the mRNA expression of \u003cem\u003ePdk1\u003c/em\u003e and \u003cem\u003eRptor\u003c/em\u003e was significantly upregulated, while the mRNA expression of \u003cem\u003eTsc1\u003c/em\u003e and \u003cem\u003eTsc2\u003c/em\u003e was significantly downregulated (Figure 6A). In somatic cells, stress granules (SGs) block the MAPK signaling pathway by sequestering RACK1. In male germ cells, we investigated the co-localization of RACK1 protein with DAZL, a specific marker of germ cell stress granules. Immunofluorescence analysis revealed that RACK1 and DAZL proteins co-localize in the cytoplasm of spermatogonia and spermatocytes from obese mice, demonstrating their collaborative role in stress granule formation (Figure 6B). These findings indicate that obese mice may regulate stress granule assembly through activation of the PI3K/AKT/mTOR signaling axis, thereby inhibiting MAPK pathway activation to sustain germ cell viability.\u0026nbsp;\u0026nbsp; \u0026nbsp;\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eTo validate the above hypothesis, we intraperitoneally injected obese mice with LY294002 (a PI3K signaling pathway inhibitor) and ISRIB (a stress granule assembly inhibitor), respectively. Results showed that the number of stress granules in spermatocytes was significantly reduced in both the HFD+LY294002 group and HFD+ISRIB group (Fig 7A-7B). Further findings from H\u0026amp;E staining indicated a marked increase in testicular cell apoptosis in these two groups (Fig 7C). These data confirm that obesity can regulate stress granule assembly by activating the PI3K/AKT/mTOR signaling axis, thereby inhibiting the activation of the MAPK pathway and ultimately maintaining the viability of germ cells.\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eNumerous studies have demonstrated that obesity represents a crucial factor in the induction of testicular heat stress\u003csup\u003e[20-21]\u003c/sup\u003e. Excessive adipose tissue in the region of the spermatic cord and the base of the thighs is detrimental to the heat dissipation of the testicles, thereby giving rise to abnormal spermatogenesis\u003csup\u003e[22]\u003c/sup\u003e. Surgical removal of excessive fat deposits in the pubic bone and scrotum in obese patients can partially alleviate and treat male infertility due to obesity. In addition, some studies have found that although a large number of germ cells undergo apoptosis after heat stress, some of these cells survive and eventually develop into mature sperm, yet the underlying mechanism remains to be elucidated.\u003c/p\u003e\n\u003cp\u003eIn this study, obese mouse model was established via a high-fat diet. It was discovered that the weight of the mouse testes decreased, and a significant number of germ cells underwent apoptosis. Qi et al\u003csup\u003e[23]\u003c/sup\u003e found that a high-fat diet induces the accumulation of large amounts of ectopic lipids in the testicular interstitium of rodents, forming a lipid toxic microenvironment that leads to severe testicular damage. The research results on the impact of obesity on male fertility indicate that obesity can cause male reproductive dysfunction by affecting endocrine hormones, chronic reproductive inflammation, and oxidative stress. The experimental results showed that obese mice exhibited an increase in 2N proportion and a significant decrease in 1N proportion at the overall germ cell level. It is speculated that there may be a potential protective mechanism in the 2N germ cells of obese mice.Further research found that the apoptotic germ cells in obese mice were mainly RS cells and LP cells. Although there was an increase in germ cell apoptosis at other stages, it was not significant. In order to clarify the reasons for the different cell fates at different stages, we performed immunofluorescence staining on testicular germ cells. It was found that many stress granules were formed in these germ cells with less apoptosis.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eStress granule (SG) is a highly dynamic assembly formed by liquid-liquid phase separation (LLPS) of eukaryotic cells under stress, mainly containing untranslated mRNA and protein\u003csup\u003e[14]\u003c/sup\u003e. Eukaryotic cells respond to external environmental stress in various ways, from activating survival defense mechanisms to initiating cell death signaling. The main destructive response under stress is inducing cell apoptosis, and the assembly of stress granules is an important way to protect cells from external stimuli\u003csup\u003e[15]\u003c/sup\u003e. This protective and destructive signaling pathway intersects with each other, and their interaction determines the fate of cells under stress. SGs are mainly composed of non-canonical stalled 48S preinitiation. In addition, many other proteins accumulate into SGs, but this list is still incomplete.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThus, the formation of stress granules in testicular germ cells of obese mice may be associated with elevated testicular temperature induced by obesity. To further investigate the function and mechanism underlying stress granule formation in testicular germ cells of obese mice, this study performed sequencing analysis on testicular cells from obese mice and conducted KEGG signaling pathway analysis. The results showed that obese mice might promote stress granule formation by activating the PI3K/AKT signaling pathway. Additionally, protein localization results indicated that stress granules in the testes of obese mice can protect germ cells by recruiting RACK1 protein and blocking apoptotic signals.\u003c/p\u003e\n\u003cp\u003eISRIB is the first reported antagonist of the integrated stress response (ISR), which blocks signaling downstream of all eIF2α\u0026nbsp;kinases\u003csup\u003e[24-26]\u003c/sup\u003e. Studies have confirmed that treating endoplasmic reticulum-stressed cells with ISRIB not only significantly and comprehensively abrogates the translational effects induced by eIF2α\u0026nbsp;phosphorylation, but also inhibits the formation of stress granules (SGs) triggered by eIF2α\u0026nbsp;phosphorylation. In this study, injecting ISRIB into obese mice led to a significant reduction in the number of stress granules in testicular germ cells, accompanied by a marked increase in germ cell apoptosis, indicating that SGs exert a protective role in testicular germ cells.PI3K/AKT inhibitors Ly294002 as a highly selective phosphatidylinositol 3 (PI3) kinase inhibitor in vivo, capable of blocking PI3 kinase-dependent Akt phosphorylation and its kinase activity\u003csup\u003e[27]\u003c/sup\u003e. Intraperitoneal injection of the PI3K/AKT inhibitor Ly294002 into high-fat diet (HFD)-induced obese mice resulted in a significant reduction in the number of stress granules (SGs) in testicular germ cells, accompanied by a marked increase in germ cell apoptosis. These findings suggest that activation of the PI3K/AKT signaling pathway in HFD-induced obese mice can promote the formation of stress granules, thereby exerting a protective effect on germ cells.\u003c/p\u003e\n\u003cp\u003eWe have demonstrated that the testes of obese mice can regulate the formation of stress granules through the PI3K/AKT signaling pathway, thereby exerting a protective effect on germ cells. Although we have performed gene silencing studies on relevant genes in the PI3K/AKT signaling pathway, overexpression experiments remain unconducted; thus, the core role of this pathway in stress granule formation requires further validation. Additionally, the reactive oxygen species (ROS) concentration and testicular temperature in obese mice were not measured in this study. Subsequent in vitro experiments will clarify the required ROS concentration and temperature thresholds for stress granule formation, and explore the specific effects of different ROS concentrations and temperatures on the quantity of stress granules formed and the fate of germ cells.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe would like to thank Eugene Yujun Xu professor for discussion and assistance throughout this project.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eZhang Shikun: Conceptualization, Methodology, Funding acquisition, Supervision, Project administration, Writing-review \u0026amp; editing. Ge Zhijuan: Methodology, Writing-review \u0026amp; editing. Li Mingan: Conceptualization, Methodology. Jiao Yan: Data curation, Methodology, Writing\u0026mdash;review \u0026amp; editing. Xu Yanling: Methodology, Writing\u0026mdash;review \u0026amp; editing. Zhang Shujuan: Data curation.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by Open Project of the Jiangsu Provincial Key Laboratory of Colleges and Universities [grant number XZSYSKF2025039], \u0026nbsp; Traditional Chinese Medicine Science and Technology Project of Suqian City [grant number HD202410], Health and Healthcare Scientific Research Project of Suqian City [grant number MS202405],Suqian Guiding Science and Technology Plan Project [grant number Z2024025].\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDeclaration of Interest\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData Availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe datasets generated and analysed during the current study are available in the Gene Expression Omnibus (GEO) repository, https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE317745 with the accession number GSE317745.\u003c/p\u003e"},{"header":"References","content":" \u003col\u003e\n\u003cli\u003ePandruvada S, Royfman R, Shah TA, Sindhwani P, Dupree JM, Schon S, Avidor-Reiss T. Lack of trusted diagnostic tools for undetermined male infertility. J Assist Reprod Genet. 2021, 38(2):265-276.\u003c/li\u003e\n\u003cli\u003eMarie-Eve Pich\u0026eacute;, Andr\u0026eacute; Tchernof, Jean-Pierre Despr\u0026eacute;s. Obesity Phenotypes, Diabetes, and Cardiovascular Diseases [J]. Circ Res. 2020, 126(11):1477-1500. \u003c/li\u003e\n\u003cli\u003eDu Plessis SS, Cabler S, McAlister DA et al. The effect of obesity on sperm disorders and male infertility[J]. Nat Rev Urol. 2010, 7(3):153-161.\u003c/li\u003e\n\u003cli\u003eEngin-Ustun Y, Ylmaz N, Akgun N et a1.Body Mass Index Effects Kruger\u0026rsquo;s Criteria in Infertile Men[J]. Int J Fertil Steri1. 2018, 11(4):258-262.\u003c/li\u003e\n\u003cli\u003eLiu H, Liu X, Wang L et a1. Brown adipose tissue transplantation ameliorates male fertility impairment caused by diet induced obesity[J]. Obes Res Clin Pract. 2017,11(2):198-205.\u003c/li\u003e\n\u003cli\u003eHan J, Zhao C, Guo H, Liu T, Li Y, Qi Y, Deussing JM, Zhang Y, Tan J, Han H, Ma X. Obesity induces male mice infertility via oxidative stress, apoptosis, and glycolysis [J]. Reproduction, 2023, 166(1):27-36. \u003c/li\u003e\n\u003cli\u003eSlaine PD, Kleer M, Smith NK, Khaperskyy DA, McCormick C. Stress Granule-Inducing Eukaryotic Translation Initiation Factor 4A Inhibitors Block Influenza A Virus Replication[J]. Viruses. 2017, 9(12):388.\u003c/li\u003e\n\u003cli\u003eHofmann S, Kedersha N, Anderson P, Ivanov P. Molecular mechanisms of stress granule assembly and disassembly[J]. Biochim Biophys Acta Mol Cell Res. 2021, 1868(1):118876.\u003c/li\u003e\n\u003cli\u003eZeng W, Lu C, Shi Y, Wu C, Chen X, Li C, Yao J, 2020. Initiation of stress granule assembly by rapid clustering of IGF2BP proteins upon osmotic shock. Biochim. Biophys. Acta BBA-Mol. Cell Res. 1867, 118795.\u003c/li\u003e\n\u003cli\u003eIvanov P, Kedersha N, Anderson P. Stress Granules and Processing Bodies in Translational Control[J]. Cold Spring Harb Perspect Biol. 2019, 11(5):a032813.\u003c/li\u003e\n\u003cli\u003eAulas, A, Fay, MM, Lyons, S.M, Achorn, C.A, Kedersha, N, Anderson, P. and Ivanov, P. Stress-specific differences in assembly and composition of stress granules and related foci[J]. J Cell Sci, 2017. 130:927-937.\u003c/li\u003e\n\u003cli\u003eGwon Y, Maxwell BA, Kolaitis RM, Zhang P, Kim HJ, Taylor JP. Ubiquitination of G3BP1 mediates stress granule disassembly in a context-specific manner[J]. Science. 2021, 72(6549):eabf6548.\u003c/li\u003e\n\u003cli\u003eByunghyuk Kim, Howard J. Cooke, Kunsoo Rhee. DAZL is essential for stress granule formation implicated in germ cell survival upon heat stress [J]. Development, 2012, 139(3):568-578.\u003c/li\u003e\n\u003cli\u003eKahn BE, Brannigan RE. Obesity and male infertility [J]. Curr Opin Urol, 2017, 27(5):441-445. \u003c/li\u003e\n\u003cli\u003eYang C, Wang Z, Kang Y et al. Stress\u0026ensp;granule\u0026ensp;homeostasis is modulated by TRIM21-mediated ubiquitination of G3BP1 and autophagy-dependent elimination of\u0026ensp;stress\u0026ensp;granules [J]. Autophagy, 2023, 19(7):1934-1951. \u003c/li\u003e\n\u003cli\u003eZhou Y, Yang Z, Wang Y, et al. Stress granule assembly impairs macrophage efferocytosis to aggravate allergic rhinitis in mice. Nat Commun. 2025, 16(1):5610.\u003c/li\u003e\n\u003cli\u003eKanehisa M, Sato Y, Kawashima M, Furumichi M, Tanabe M. KEGG as a reference resource for gene and protein annotation. Nucleic Acids Res. 2016 Jan 4;44(D1):D457-62. \u003c/li\u003e\n\u003cli\u003eKanehisa M, Goto S. KEGG: kyoto encyclopedia of genes and genomes. Nucleic Acids Res. 2000 Jan 1;28(1):27-30.\u003c/li\u003e\n\u003cli\u003eHeberle AM, Razquin Navas P, Langelaar-Makkinje M, Kasack K, Sadik A, Faessler E, Hahn U, Marx-Stoelting P, Opitz CA, Sers C, Heiland I, Sch\u0026auml;uble S, Thedieck K. The PI3K and MAPK/p38 pathways control stress granule assembly in a hierarchical manner[J]. Life Sci Alliance. 2019, 2(2):e201800257.\u003c/li\u003e\n\u003cli\u003eVenigalla G, Ila V, Dornbush J, Bernstein A, et al. Male obesity: Associated effects on fertility and the outcomes of offspring [J]. Andrology. 2025, 13(1):64-71. \u003c/li\u003e\n\u003cli\u003eQing H, Hu J, Fu H, Zhao Z, Nong W, Wang J, Yang F, Zhao S. Activation of thermogenesis pathways in testis of diet-induced obesity mice [J]. Reprod Biol. 2022, 22(3):100652.\u003c/li\u003e\n\u003cli\u003ePalmer NO, Bakos HW, Fullston T, et al. Impact\u0026ensp;of\u0026ensp;obesity\u0026ensp;on\u0026ensp;male\u0026ensp;fertility,\u0026ensp;sperm\u0026ensp;function\u0026ensp;and\u0026ensp;molecular\u0026ensp;composition [J]. Spermatogenesis. 2012, 2(4):253-263.\u003c/li\u003e\n\u003cli\u003eQi X, Zhang M, Sun M, Luo D, Guan Q, Yu C. Restoring Impaired Fertility Through Diet: Observations of Switching From High-Fat Diet During Puberty to Normal Diet in Adulthood Among Obese Male Mice[J]. Front Endocrinol (Lausanne). 2022,13:839034. \u003c/li\u003e\n\u003cli\u003eSidrauski C, McGeachy AM, Ingolia NT, Walter P. The small molecule ISRIB reverses the effects of eIF2\u0026alpha; phosphorylation on translation and stress granule assembly. Elife. 2015, 4:e05033. \u003c/li\u003e\n\u003cli\u003eTong F, Hu H, Xu Y, Zhou Y, Xie R, Lei T, Du Y, Yang W, He S, Huang Y, Gong T, Gao H. Hollow copper sulfide nanoparticles carrying ISRIB for the sensitized photothermal therapy of breast cancer and brain metastases through inhibiting stress granule formation and reprogramming tumor-associated macrophages. Acta Pharm Sin B. 2023, 13(8):3471-3488. \u003c/li\u003e\n\u003cli\u003eZyryanova AF, Kashiwagi K, Rato C, Harding HP, Crespillo-Casado A, Perera LA, Sakamoto A, Nishimoto M, Yonemochi M, Shirouzu M, Ito T, Ron D. ISRIB Blunts the Integrated Stress Response by Allosterically Antagonising the Inhibitory Effect of Phosphorylated eIF2 on eIF2B. Mol Cell. 2021, 81(1):88-103.\u003c/li\u003e\n\u003cli\u003eWu X, Pu L, Chen W, et al. LY294002 attenuates inflammatory response in endotoxin-induced uveitis by downregulating JAK3 and inactivating the PI3K/Akt signaling. Immunopharmacol Immunotoxicol. 2022, 44(4):510-518.\u003c/li\u003e\n \u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"cell-death-discovery","isNatureJournal":false,"hasQc":false,"allowDirectSubmit":false,"externalIdentity":"cddiscovery","sideBox":"Learn more about [Cell Death Discovery](http://www.nature.com/cddiscovery/)","snPcode":"41420","submissionUrl":"https://mts-cddiscovery.nature.com/","title":"Cell Death Discovery","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"ejp","reportingPortfolio":"Nature AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"obesity, spermatogenesis, stress granule, MAPK","lastPublishedDoi":"10.21203/rs.3.rs-8811652/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-8811652/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"Obesity is a well-recognized risk factor for male infertility by disrupting spermatogenesis. However, in the testicular microenvironment of obese individuals, a subset of spermatogenic cells can still survive normally and differentiate into mature sperm. our study demonstrated that inguinal fat accumulation-induced testicular hyperthermia activates the PI3K-AKT signaling pathway. This pathway plays a pivotal role in cell growth, proliferation, and survival. Its activation leads to reduced expression of tumor suppressor genes TSC1/TSC2, which are negative regulators of mTORC1. Subsequent mTORC1 activation further promoted the formation of stress granules (SGs). Critically, these SGs recruit RACK1, a key component of the MAPK signaling pathway, thereby blocking apoptotic pathways in spermatogenic cells.This anti-apoptotic effect enabled the protected subset of germ cells to survive and differentiate into mature sperm despite the adverse testicular microenvironment in obesity.​ \r\nIn conclusion, obesity plays a critical role in male infertility through multiple mechanisms that disrupt spermatogenesis.However, a subset of spermatogenic cells survives via activation of the PI3K-AKT pathway, SG formation, and suppression of apoptosis. This discovery provides novel insights and potential therapeutic targets for obesity-associated male infertility.","manuscriptTitle":"The PI3K-AKT-mTOR pathway maintains germ cell survival in obese mice by regulating stress granule assembly","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2026-02-23 17:48:14","doi":"10.21203/rs.3.rs-8811652/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"revise","date":"2026-03-20T16:57:04+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"This content is not available.","date":"2026-03-08T20:05:08+00:00","index":3,"fulltext":"This content is not available."},{"type":"editorInvitedReview","content":"This content is not available.","date":"2026-02-27T03:28:30+00:00","index":2,"fulltext":"This content is not available."},{"type":"reviewerAgreed","content":"This content is not available.","date":"2026-02-20T16:05:14+00:00","index":3,"fulltext":"This content is not available."},{"type":"reviewerAgreed","content":"This content is not available.","date":"2026-02-17T03:50:13+00:00","index":2,"fulltext":"This content is not available."},{"type":"reviewerAgreed","content":"This content is not available.","date":"2026-02-16T23:42:50+00:00","index":1,"fulltext":"This content is not available."},{"type":"reviewersInvited","content":"","date":"2026-02-16T23:39:40+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2026-02-09T17:16:30+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2026-02-07T02:24:08+00:00","index":"","fulltext":""},{"type":"submitted","content":"Cell Death Discovery","date":"2026-02-07T02:24:07+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"cell-death-discovery","isNatureJournal":false,"hasQc":false,"allowDirectSubmit":false,"externalIdentity":"cddiscovery","sideBox":"Learn more about [Cell Death Discovery](http://www.nature.com/cddiscovery/)","snPcode":"41420","submissionUrl":"https://mts-cddiscovery.nature.com/","title":"Cell Death Discovery","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"ejp","reportingPortfolio":"Nature AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"f1420a60-af9a-4201-afca-1f4851efdfa5","owner":[],"postedDate":"February 23rd, 2026","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"in-revision","subjectAreas":[{"id":63035716,"name":"Biological sciences/Cell biology/Cell death/Apoptosis"},{"id":63035717,"name":"Biological sciences/Developmental biology/Germline development/Spermatogenesis"}],"tags":[],"updatedAt":"2026-03-20T17:02:25+00:00","versionOfRecord":[],"versionCreatedAt":"2026-02-23 17:48:14","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-8811652","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-8811652","identity":"rs-8811652","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}