Identification of Evolutionary Trade-Offs Associated with High-Level Colistin Resistance in Acinetobacter baumannii

preprint OA: closed CC-BY-ND-4.0
📄 Open PDF Full text JSON View at publisher
Full text 75,993 characters · extracted from preprint-html · click to expand
Identification of Evolutionary Trade-Offs Associated with High-Level Colistin Resistance in Acinetobacter baumannii | bioRxiv /* */ /* */ <!-- <!-- /*! * yepnope1.5.4 * (c) WTFPL, GPLv2 */ (function(a,b,c){function d(a){return"[object Function]"==o.call(a)}function e(a){return"string"==typeof a}function f(){}function g(a){return!a||"loaded"==a||"complete"==a||"uninitialized"==a}function h(){var a=p.shift();q=1,a?a.t?m(function(){("c"==a.t?B.injectCss:B.injectJs)(a.s,0,a.a,a.x,a.e,1)},0):(a(),h()):q=0}function i(a,c,d,e,f,i,j){function k(b){if(!o&&g(l.readyState)&&(u.r=o=1,!q&&h(),l.onload=l.onreadystatechange=null,b)){"img"!=a&&m(function(){t.removeChild(l)},50);for(var d in y[c])y[c].hasOwnProperty(d)&&y[c][d].onload()}}var j=j||B.errorTimeout,l=b.createElement(a),o=0,r=0,u={t:d,s:c,e:f,a:i,x:j};1===y[c]&&(r=1,y[c]=[]),"object"==a?l.data=c:(l.src=c,l.type=a),l.width=l.height="0",l.onerror=l.onload=l.onreadystatechange=function(){k.call(this,r)},p.splice(e,0,u),"img"!=a&&(r||2===y[c]?(t.insertBefore(l,s?null:n),m(k,j)):y[c].push(l))}function j(a,b,c,d,f){return q=0,b=b||"j",e(a)?i("c"==b?v:u,a,b,this.i++,c,d,f):(p.splice(this.i++,0,a),1==p.length&&h()),this}function k(){var a=B;return a.loader={load:j,i:0},a}var l=b.documentElement,m=a.setTimeout,n=b.getElementsByTagName("script")[0],o={}.toString,p=[],q=0,r="MozAppearance"in l.style,s=r&&!!b.createRange().compareNode,t=s?l:n.parentNode,l=a.opera&&"[object Opera]"==o.call(a.opera),l=!!b.attachEvent&&!l,u=r?"object":l?"script":"img",v=l?"script":u,w=Array.isArray||function(a){return"[object Array]"==o.call(a)},x=[],y={},z={timeout:function(a,b){return b.length&&(a.timeout=b[0]),a}},A,B;B=function(a){function b(a){var a=a.split("!"),b=x.length,c=a.pop(),d=a.length,c={url:c,origUrl:c,prefixes:a},e,f,g;for(f=0;f<d;f++)g=a[f].split("="),(e=z[g.shift()])&&(c=e(c,g));for(f=0;f<b;f++)c=x[f](c);return c}function g(a,e,f,g,h){var i=b(a),j=i.autoCallback;i.url.split(".").pop().split("?").shift(),i.bypass||(e&&(e=d(e)?e:e[a]||e[g]||e[a.split("/").pop().split("?")[0]]),i.instead?i.instead(a,e,f,g,h):(y[i.url]?i.noexec=!0:y[i.url]=1,f.load(i.url,i.forceCSS||!i.forceJS&&"css"==i.url.split(".").pop().split("?").shift()?"c":c,i.noexec,i.attrs,i.timeout),(d(e)||d(j))&&f.load(function(){k(),e&&e(i.origUrl,h,g),j&&j(i.origUrl,h,g),y[i.url]=2})))}function h(a,b){function c(a,c){if(a){if(e(a))c||(j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}),g(a,j,b,0,h);else if(Object(a)===a)for(n in m=function(){var b=0,c;for(c in a)a.hasOwnProperty(c)&&b++;return b}(),a)a.hasOwnProperty(n)&&(!c&&!--m&&(d(j)?j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}:j[n]=function(a){return function(){var b=[].slice.call(arguments);a&&a.apply(this,b),l()}}(k[n])),g(a[n],j,b,n,h))}else!c&&l()}var h=!!a.test,i=a.load||a.both,j=a.callback||f,k=j,l=a.complete||f,m,n;c(h?a.yep:a.nope,!!i),i&&c(i)}var i,j,l=this.yepnope.loader;if(e(a))g(a,0,l,0);else if(w(a))for(i=0;i (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0];var j=d.createElement(s);var dl=l!='dataLayer'?'&l='+l:'';j.src='//www.googletagmanager.com/gtm.js?id='+i+dl;j.type='text/javascript';j.async=true;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-M677548'); Skip to main content Home About Submit ALERTS / RSS Search for this keyword Advanced Search New Results Identification of Evolutionary Trade-Offs Associated with High-Level Colistin Resistance in Acinetobacter baumannii Kusumita Acharya , Upasana Bhattacharya , Shatarupa Biswas , Mallika Ghosh , View ORCID Profile Arijit Bhattacharya doi: https://doi.org/10.1101/2025.01.17.633615 Kusumita Acharya 1 AMR⍰Research Laboratory, Department of Biological Sciences, Adamas University , Barasat⍰Barrackpore Rd., Kolkata 700126, India Find this author on Google Scholar Find this author on PubMed Search for this author on this site Upasana Bhattacharya 1 AMR⍰Research Laboratory, Department of Biological Sciences, Adamas University , Barasat⍰Barrackpore Rd., Kolkata 700126, India Find this author on Google Scholar Find this author on PubMed Search for this author on this site Shatarupa Biswas 1 AMR⍰Research Laboratory, Department of Biological Sciences, Adamas University , Barasat⍰Barrackpore Rd., Kolkata 700126, India Find this author on Google Scholar Find this author on PubMed Search for this author on this site Mallika Ghosh 2 Dr. Lal PathLabs-Kolkata Reference Lab , Newtown, Kolkata 700156, India Find this author on Google Scholar Find this author on PubMed Search for this author on this site Arijit Bhattacharya 1 AMR⍰Research Laboratory, Department of Biological Sciences, Adamas University , Barasat⍰Barrackpore Rd., Kolkata 700126, India Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Arijit Bhattacharya For correspondence: arijit.bhattacharya{at}adamasuniversity.ac.in arijbhatta{at}gmail.com Abstract Full Text Info/History Metrics Supplementary material Preview PDF ABSTRACT Colistin (COL) belongs to the polymyxin group of drugs which possesses a positive charge and interacts with lipopolysaccharide (LPS) of Gram-negative bacterial outer membrane. Additionally, it can penetrate the cell membrane and disrupt the integrity of the phospholipid leading to cell death. Resistance against COL has been reported in Acinetobacter baumannii , a bacteria in the ‘ESKAPE’ group of ‘priority pathogens’ of the World Health Organization. Multiple and pan-drug-resistant strains of A. baumannii are rising in many medical facilities and they are becoming resistant to last-resort antibiotics including colistin. Though plasmid-encoded acquisition of mcr -1 has been associated with clinical resistance, drug efflux, complete loss of LPS by inactivation of the biosynthetic pathway ( lpx ACD), and modifications of target LPS by-products of chromosomal pmr CAB genes has been ascribed with resistance evolution against COL. To further delve into the evolutionary dynamics of COL-resistance here we report experimental evolution of extreme COL-resistance by adaptive evolution of the reference strain A. baumannii ATCC 19606. Phenotypic characterization has been performed for the evolved strains, which demonstrated hyperbiofilm phenotype and striking decrease in fitness. A comprehensive antibiotic susceptibility profiling has been performed on the evolved strains. Whole genome sequencing of the resistant strains led to the identification of mutations prospectively associated with COL resistance. Phenotypic characterization of three COL-resistant clinical isolates of A. baumannii revealed similarity with experimentally evolved resistant mutants at least in one of the isolates. Introduction Bacterial Antimicrobial resistance (AMR) is arguably the major challenge in the global health scenario in the present century with approximately 4.71 million deaths associated with it in 2021 with an immense rise in Gram-negative infection burden [ 1 ]. Among the major Gram-negative pathogens, Acinetobacter baumannii (Ab) has emerged as a critical concern as a nosocomial opportunistic pathogen due to its global dissemination and acquisition of resistance against last-resort antibiotics [ 2 ]. The bacteria cause infections in the respiratory tract, urinary tract, other soft tissues, and wounds with an attributable mortality rate nearing 35% [ 3 ]. The bacterium demonstrates considerable phenotypic and genotypic diversity with a four times higher propensity of multidrug resistance (MDR) compared to other nosocomial pathogens and rapid development of pan-drug resistance [ 4 ]. Though carbapenem-resistant Ab (CRAB) has been highlighted as a ‘priority pathogen’ with an immediate need for new antibiotics ( https://www.who.int/publications/i/item/9789240093461 ), reports for clinical resistance against the other last-resort antibiotic colistin are increasing owing to increased use of the antibiotic to treat infections caused by MDR isolates [ 5 ]. The bactericidal antibiotic colistin (polymyxin E, COL) is a polycationic lipopeptide, comprising a cyclic decapeptide conjugated to a fatty acyl chain [ 6 ]. The lipopeptide moiety can directly bind to the negatively charged phosphates of lipid-A part of lipopolysaccharide, a major constituent of the outer membrane (OM) of Gram-negative bacteria. The interaction displaces Ca 2+ and Mg 2+ ions from lipid-A and impairs the integrity of OM. Following its passage to the cytoplasmic membrane it manifests leakage of cellular contents [ 7 ]. In addition to the well-studied mechanism, COL induces the production of hydroxyl radicals, contributing to immediate cell death. This hydroxyl radical-mediated cell death pathway is observed in clinical Ab isolates [ 8 , 9 ]. Among diverse groups of Gram-negative bacteria, COL-resistance is conferred by chromosomal mutations in LPS biosynthesizing genes and genes encoding two-component systems modulating LPS biosynthesis, efflux pumps, and plasmid-encoded genes belonging to phosphoethanolamine transferase family [ 10 ]. In A. baumannii , COL-resistance has been studied with resistant experimentally raised mutants and resistant clinical isolates [ 7 ]. Mutations in LPS core biosynthesizing genes like lps B have been attributed to the high level of intrinsic COL-resistance [ 11 ]. In line with gene inactivation identified in other bacteria, nucleotide substitution, insertion-deletion (InDels), and insertion inactivation of lipid-A biosynthetic genes lpx A, lpx C, and lpx D have been identified in several LPS deficient COL R mutants [ 12 – 14 ]. Deletion in the translocase LptD encoding gene was identified to be associated with COL-resistance in Ab ATCC 19606, where LPS biosynthesis is not essential in vitro [ 15 ]. Modification of lipid-A by addition of phosphoethanolamine by phosphoethanolamine transferase PmrC mitigates COL binding to OM [ 16 ]. PmrC expression is controlled by the two-component system containing the response regulator PmrA and the sensor histidine kinase PmrB [ 17 , 18 ]. Mutations in both pmr A and pmr B and overexpression as well, have strongly been associated with various degrees of COL-resistance [ 5 , 19 ]. The plasmid harbored mobilized COL resistance genes ( mcr ) that have been identified in clinical isolates of Ab. The gene is transmitted horizontally and encodes a phosphoethanolamine transferase (PET), a lipid modifier [ 20 ]. Of the ten different mcr genes and various variants identified, mcr1 and mcr4 .3 have been commonly identified in COL R isolates of Ab [ 21 , 22 ]. COL exposure to Ab also inflicts ‘colistin dependency’ for in vitro growth [ 23 ]. Apart from these mechanisms, Ab can develop resistance through the efflux system EmrAB, which pumps out antibiotics, and the production of enzymes facilitating proteolytic cleavage of drugs [ 24 , 25 ]. Succeeding previous studies to characterize COL-resistance in Ab, in this study, extremely COL-resistant A. baumannii ATCC19606 (Ab19606) mutants evolved experimentally by step-wise selection. The mutants evolved are compromised in terms of fitness and are profound biofilm formers. Albeit no mcr or change in copy number for pmr A or pmr B could be detected, the mutants are impaired in outer membrane integrity. Whole genome sequencing identified an intentional mutation leading to the duplication of proline in LpxA2, along with mutations in several other genes. Comprehensive cross-resistance and collateral sensitivity (CR-CS) profiling revealed sensitivity to several antibiotics as possible evolutionary trade-offs including susceptibility to vancomycin (VAN), which corroborated earlier reports [ 26 ]. Three COL-R clinical isolates of Ab were also characterized, one of which indicated hyperbiofilm formation and antibiotic sensitivity trade-offs similar to the laboratory-evolved mutants. Methodology Strains and reagents Acinetobacter baumannii (ATCC19606) (Ab19606 ) was maintained in Luria-Bertani agar and broth (Himedia). LB broth with 1% glucose is used for biofilm assays. Leeds Acinetobacter Agar (Himedia) was used for selective assays involving Ab. Antimicrobial susceptibility tests were performed in Mueller Hinton Broth (Himedia). All the reagents including antibiotics like colistin (COL) and ciprofloxacin (CIP) were purchased from Sigma-Aldrich unless mentioned otherwise. Antibiotic disks and antibiotic strips were procured from Himedia. Laboratory evolution of resistant mutants A source clonal population was generated from a single clone of Ab19606. Laboratory evolution experiments involve serial transfer of growing bacterial populations in parallel for hundreds of generations with gradually increasing concentrations of each of COL and CIP. For each step of adaptation, cultures were allowed to grow till OD 600 nm of 0.8 (late log phase). In parallel, untreated cultures were passaged as control lines (Fig. S1). Clones derived from single colonies derived from evolved lines were verified by PCR amplification of genomic DNA for gapdh and 16S rRNA gene using primer pairs -AbgapdhF: ATGCAACGTATCGCCATT, AbgapdhR: TCGTACATGACACACTCGAT and Ab16SF: GAATAAGCACCGGCTAACTCTGT and Ab16SR: TAAGGTTCTTCGCGTTGCAT using T100 Thermal Cycler (Biorad), followed by Sanger sequencing. The clones were also profiled for changes in susceptibilities against COL and CIP. Obtaining clinical isolates Three clinical isolates were obtained with identifiable COL-resistance. Pathological “Resistance (R)” was assigned according to automated AST assay with VITEK 2 system version 9.02 in accordance with Global CLSI-based 2023. After collection, strain confirmations were done on Leeds Acinetobacter agar. Characterizing clonal population of evolved lines and clinical isolates The level of resistance of each isolate was tested by determining MIC through microdilution as described earlier [ 27 ]. Alongside MBC each isolate was evaluated by determining CFU at break point concentrations. The extent of resistance was expressed in terms of fold-MIC change compared to control lines. MICs were determined as suggested by the Clinical and Laboratory Standards Institute (CLSI) guidelines with a cell number of 5X10 5 / ml using 9-step serial dilutions in 96-well tissue culture plates. For measurement of small changes, 1.2–1.5 times dilutions were used in macrodilution. Growth and fitness assessment of the resistant clonal population against source clonal population The fitness cost of the resistant mutations was analyzed by comparative growth profiling as described by Lenski et al. [ 28 ] where the growth parameter for a strain is the number of doublings that it experiences over a given period of time. Screening for cross-resistance and collateral sensitivity Disk-diffusion susceptibility testing- 0.5 McFarland matched bacterial suspension was spread on LB plates and sterile disks containing the antibiotic were placed on top. Plates were incubated at 37°C for 24 h and inhibition zones were measured using ImageJ. ZOI resistant > ZOI WT indicates CS and ZOI resistant < ZOI WT indicates CR. Such a profile would serve as a preliminary indicator for CR-CS. The extent of CS was expressed in terms of MIC WT : MIC resistant strain. Hierarchical clustering of resistant isolates The diameter of the zone of inhibitions was considered a quantitative trait and hierarchical clustering was performed with average linkage and Euclidian distance assessment. Heatmap and cladograms were generated to illustrate the clustering. Determining copy number variation by qPCR QPCR has been implemented in determining gene copy number in Acinetobacter spp. [ 29 ]. Comparative copy number analysis was performed by qPCR with primers selective for pmr A and pmr B genes with an amplicon size of 150-180 bp with oligonucleotides enlisted in Table S-1. SYBR green-based qPCR was performed with 1 ng of genomic DNA preparation. Copy number change was scored based on ΔCt against gapdh gene amplification from the same preparation. Sanger sequencing Sanger sequencing was performed for amplicons obtained from PCR targeting selective genes. PCR amplicons were gel-purified prior to sequencing. The Primer sequences are mentioned separately (Table S1). Testing the presence of mcr gene For detecting the presence of mcr genes, primers were designed for the various mcr genes (mcr1-10), and PCR amplifications were performed from the genomic DNA isolated from the evolved and resistant lines using primers enlisted in Table S1. Whole-genome sequencing Resistant mutant displaying significant CR/ CS was ranked according to the extent and number of antibiotics against altered susceptibility. 3 clonal populations obtained from independently evolved lines have been sent for whole genome sequencing. For genome sequencing, total DNAs were prepared using the QIAamp DNA Purification Kit. NexteraXT libraries were prepared and sequenced on an Illumina Novaseq 6000. Paired sequence reads will be mapped using BWA-MEM [ 30 ] to the Ab19606 genome. The variants were called from the aligned bam file using FreeBays available in BV-BRC [ 31 ]. Biofilm assay Biofilm assay was performed as described earlier [ 32 ]. Briefly, bacteria were inoculated from log phase cultures grown in Luria-Bertani broth with glucose at 37 °C till 0.6 OD 600 was reached. The cultures were then distributed into the wells of 96-well polystyrene and will be incubated at 30 °C for 24 h discarding the media carefully, the wells were washed thrice with sterile distilled water. Biofilm formation at the liquid-substratum interface was quantified by measuring OD 570 nm for stain (crystal violate) retention by the biofilm. For each set of experiments an uninoculated well and a well, freshly filled with overnight culture, were used as negative control and a non-biofilm negative control system respectively. To examine biofilm formation silicone surface associated with medical tubing, a catheter biofilm formation assay was performed as described elsewhere [ 15 ] and biofilm formation was observed by crystal violate retention. Viability in biofilm cells Biofilms of Ab were allowed to develop in a liquid-polystyrene substratum interface for 24 h. The impact of antibiotic-pigment combinations on the viability of biofilm cells was estimated for the preformed biofilms by resazurin-reduction as described elsewhere [ 33 ]. Briefly, following removal of the exhausted medium, the preformed biofilms were washed twice with saline and were incubated in 200 µl of MHB with 25 µl of resazurin (200 µg/ ml) for 60 mins. The extent of resazurin reduction was monitored by estimating OD 570 nm . CFU/ ml for the biofilms was enumerated by suspending the biofilm, dilution, and further plating. Autoaggregation assay After growing bacteria in LB broth for 24 h at 37°C, cells were centrifuged and suspended in phosphate-buffered saline (PBS) to 0·5 OD units at 600 nm. 2 ml bacterial suspension was placed in each tube, centrifuged and then re-suspended in PBS. After 2-3 h exposure at 37°C, 1 ml of the upper layer of suspension was transferred to another tube and the OD 595 nm was measured. Aggregation was expressed as 1−(O.D upper suspension /O.D total bacterial suspension )×100. Hydrophobicity of the cell surface A 1.2 ml volume of cell suspension in phosphate/urea/Mg (PUM) buffer, pH 7.5 (22.2 g K 2 HPO 4 . 3H 2 O, 7.26 g KH 2 PO 4 , 1.8 g urea, 0.2 g MgSO 4 . 6H 2 O, 1 l deionized water), was mixed with 200 ml of n-hexadecane with vigorous stirring for 2 min. After phase separation at room temperature for 15 min, the lower aqueous phase was removed and its OD 580nm was measured. Surface motility Surface-assisted motility was visualized according to Mayer et al., 2018 [ 34 ]. One microliter from overnight cultures at 0.3 optical density (OD 600 nm ) was seeded in the center of the plates. Subsequently, plates were incubated at 37°C in the dark. Surface-associated motility trail was observed after 48 h. EPS extraction and assay Bacterial biomass was carefully harvested from the biofilms developed in a solid-liquid interface and suspended in saline. Following dispersion by vigorous stirring and clarification by high-speed centrifugation the supernatant was filtered through cellulose acetate membranes to obtain a cell-free EPS solution. Relative quantitation of eDNA was performed after extraction using a Soil DNA purification kit (HiMedia) by PCR amplification of gapdh and 16SrRNA . The total carbohydrate content was estimated by the anthrone method as described earlier [ 35 ]. Briefly, 80 µl of the supernatant was mixed with 160 µl of anthrone reagent (0.125% Anthrone in 94.5 % H 2 SO 4 ) and were incubated in the water bath at 100° C for 14 minutes and then cooled at 4°C. The OD 630 nm was measured using a microplate reader iMark microplate reader (Biorad). Outermembrane integrity The integrity of the outer membrane was examined by N-phenyl-1-naphthylamine (NPN) - permeability assay according to Abdullah et al. [ 36 ]. Briefly, 10 6 log phase bacteria were resuspended in 10 mM sodium phosphate buffer to achieve a final OD 600 nm 0.1 exposed to 0.2mM NPN in of and Em 420nm was measured (Ex at 350 nm). Statistical analysis Statistical analysis was performed for the experiments with Students pairwise t-test. At least three technical replicates were tested for each biological replicate. Result Experimental evolution of colistin-resistant lines of A. baumannii19606 A single clonal population of Ab19606 was isolated by dilution plating and the population was used as a source clonal population for step-wise selection against increasing doses of COL and CIP (Fig. S1). MIC values of 0.625 µg/ ml and 1 µg/ ml for COL and CIP respectively against Ab were determined by microdilution ( Table 1 ). Following each level of selection strain confirmation by Ab gene-specific primers ( gapdh and/or 16SrRNA) was performed (Fig. S1). After final selection, the PCR amplicons were analyzed by Sanger sequencing followed by BLASTN against Ab19606 genome version AP022836.1. The time-line evolutionary selection trail, for the antibiotics was determined by measuring the time required to attain late log-phase (OD 600 nm = 0.8). As depicted in Fig. S2A, for CIP the selection pressure worked at its highest at the initial stages for selection (1X and 2X MIC) while it depleted in the following steps (Fig. S2A). For COL, the population adopted at the lowest rate at 1X MIC, though it remained slow-growing throughout the next levels of selection ( Fig. 1A ). Download figure Open in new tab Fig. 1. Experimental evolution of antibiotic-resistant lines and fitness of the evolved lines. Antibiotic-resistant lines were evolved by step-wise selection of a source clonal population against gradually increasing doses of antibiotic starting from 0.25XMIC (0.156 µg/ ml) for COL to a maximal selection at 20X MIC (12.5 µg/ ml) (A). Selection dynamics (trail) at each stage of variation is projected in the time needed to reach the late-log phase (OD600nm = 0.8) at each step of selection. Data represents mean ±SEM for three independent lines (n=3 for each). (B) Growth kinetics for the Ab source, AbCOL-R1, R2, and R3 clonal populations selected against COL were performed by monitoring OD600 nm for 24 h while growing in the absence of the antibiotic. Data represents mean ±SEM for three independent lines (n=3 for each). (C) Generation time for exponential growth for Ab source, AbCOL-R1, R2, and R3 clonal populations was determined by estimating the time needed for doubling in CFU/ ml value between 4h -7h post inoculation (log-phase). Data represents mean ±SEM for three independent lines (n=3 for each). ***p<0.001, two tailed paired Student’s t-test. (D) The stability of the resistance phenotype for AbCOL-R1, R2, and R3 was assessed by determination of MIC after nonselective growth for ∼500 generations and ∼1000 generations by serial subculture and comparing the value with MIC determined for populations (control, C) cultured with 0.5XMIC of COL for respective lines. A parallel set was replicated for the Ab source clonal population (Ab19606) cultured in the absence of COL. © COL-dependence of AbCOL-R1, R2, and R3 was examined by enumerating changes in CFU/ ml for AbCOL-R1, R2, and R3 when plated on MHA with or without 0.5 µg/ ml of COL. The source clonal population (Ab19606) was verified for susceptibility to COL under a similar set-up (n=3 for each). Ns, not significant, ***p<0.001, two-tailed paired student t-test. View this table: View inline View popup Download powerpoint Table 1. MIC of reference strain against the test. MIC (µg/ ml) for the reference A. baumannii 19606 and experimentally evolved colistin, ciprofloxacin, and vancomycin-resistant lines were determined by microdilution assay. Growth, colistin dependence, and fitness of the evolved colistin-resistant lines Growth of each evolved line in the absence of selection pressure was recorded by measuring OD 600 nm at specific time intervals. As represented in Fig. S2B, clonal populations derived from the lines evolved against CIP demonstrated a growth profile similar to Ab19606 with slopes 0.166, 0.193, and 0.184 against 0.167 for Ab19606 source clonal population for exponential growth respectively. The three evolved COL-R lines displayed a considerably reduced growth rate compared to the Ab19606 line ( Fig. 1B ), with mean slopes of 0.119, 0.1, and 0.109 against a mean slope of 0.167 for exponential growth. Generation time for three clonal populations for each of the AbCOL-R lines was determined by estimating CFU at a 3h time interval with an exponential phase of growth for each. As depicted in Fig. 1C , 2.22±0.22, 2.19±0.21, 2.13±0.24 –fold increase in generation time was estimated for AbCOL-R1, AbCOL-R2, and AbCOL-R3 clonal population against the generation time of 35.66±4.92 mins for Ab19606 clonal population ( Fig. 1C ) indicating significant (P<0.001, n=3) compromise of fitness associated with resistance evolution. To examine the stability of the resistant phenotype, three independent clonal populations from each of the AbCOL-R lines were grown without COL. Following growth of 500 and 1000 generations, the resistance phenotype was verified by determining MIC against COL, and no apparent alteration for MIC was observed for the resistant bacteria ( Fig. 1D ). COL-dependent growth has been reported for several extremely COL-resistant isolates of A. baumannii [ 37 ]. When AbCOL-R1, AbCOL-R2, and AbCOL-R3 clonal populations were grown on MHA plates in the absence of COL and the presence of COL (0.5 µg/ ml), no significant difference in CFU was noted for the two conditions ( Fig. 1E ), suggesting that the extremely resistant evolved strains were not dependent on COL for growth. Colistin-resistant mutants demonstrated hyperbiofilm formation AbCOL-R1, R2, and R3 grew slowly compared to the source ( Fig. 1B ) and the evolved strains are profound biofilm formers. As determined by static biofilm formation assay on polystyrene substratum, clonal populations from AbCOL-R1, R2, and R3 forms profound biofilms compared to the source (4.77±0.24, 4.90±0.72, 4.93±0.49-fold respectively, p<0.001, Fig. 2A ). The AbCIP-R1, AbCIP-R2, and AbCIP-R3 clonal population demonstrated biofilm forming potential similar to the Ab19606 source clonal population with 1.16±0.06, 1.09±0.36, and 1.16±0.30-fold change in crystal violate retention (Fig. S3). The static biofilm forming potential of the AbCOL-R1 and AbCOL-R2 strains were further validated in an in vitro catheter surface biofilm formation model where the evolved lined showed markedly enhanced adherence and film development on catheter wall compared to Ab19606 ( Fig. 2B ). To evaluate bacterial autoaggregation, sedimentation assays were performed with late log-phase cultures of Ab, AbCOL-R1, R2, and R3 by measuring the OD 600nm value of the bacterial culture supernatant after 1 h of settling period. Compared to Ab19606, AbCOL-R1, and R2 demonstrated 55.26±2.57% and 28.57±5.69% aggregation. No significant difference was noted for AbCOL-R3 compared to the source clonal population ( Fig. 2C ). To characterize biofilm development in the evolved lines further, EPS was extracted from the submerged biofilms formed by clonal populations, and total polysaccharide and eDNA were estimated. As resented in Fig. 2D , 4.18±0.52, 5.03±0.78, and 5.43±0.94 fold production of EPS polysaccharide was determined for biofilms formed by AbCOL-R1, AbCOL-R2, and AbCOL-R3 respectively. Indirect quantification of eDNA from the EPS preparations by PCR for gapdh genes indicated 1.88±0.12, 2.02±0.14, and 1.85±0.13-fold enrichment of eDNA in the EPS preparations derived from biofilms formed by AbCOL-R1, AbCOL-R2, and AbCOL-R3 respectively ( Fig. 2E ). Cell surface hydrophobicity has been identified as a major determinant of biofilm development in A. baumannii [ 38 ]. Comparative analysis of cell surface hydrophobicity indicates that the surface of clonal populations derived from AbCOL-R1, and R2 are 2.13±0.02 and 1.49±0.04-fold more hydrophobic respectively compared to the source Ab19606 clonal population ( Fig. 2F ). At the same time, no significant difference could be detected for AbCOL-R3. Download figure Open in new tab Fig. 2. Biofilm development by COL-R mutants. (A) Static biofilm formation on polystyrene substratum was envisioned by crystal violate retention for each of the Ab source populations (Ab19606), AbCOL-R1, R2, and R3. Results represent mean±SEM for three independent experiments. ***p<0.001, two-tailed paired Student t-test. In the set: representative data from one replicate of the experiment demonstrating biofilm development. (B) Log-phase cultures of Ab19606, AbCOL-R1, and AbCOL-R2 were allowed to form biofilm on the catheter interior surface. The extent of bacterial biofilm formation was envisioned by crystal violate staining. (C) Log-phase Ab source population (Ab19606), AbCOL-R1, R2, and R3 bacterial population were allowed to form an aggregate in a sedimentation buffer for 2h. Autoaggregation was estimated by measuring OD600nm of the top layer of the suspension. Results represent mean±SEM for three independent experiments. Ns, not significant, ***p<0.001, two-tailed unpaired Student’s t-test. (D) Late log phase cultures of Ab19606, AbCOL-R1, R2, and R3 were allowed for biofilm at the liquid-polystyrene substratum interface. EPS was extracted from the matured biofilms and total EPS polysaccharide was estimated by the anthrone acid method (n=3, for each). Results represent mean±SEM for three independent experiments. ***p<0.001, two-tailed unpaired Student’s t-test. © eDNA was indirectly quantitated by performing PCR with gapdh gene-specific primers with an amplicon size of 500 bp, subsequent agarose gel electrophoresis, and densitometric analysis. Data represent mean±SEM for three independent experiments. ***p<0.001, two-tailed unpaired Student’s t-test. (F) Cell surface hydrophobicity was compared for each treatment after allowing log-phase bacterial cells of the source population (Ab19606), AbCOL-R1, R2, and R3 suspended in PUM buffer to accumulate into the n-hexadecane phase. Results represent mean±SEM for three independent experiments. Ns, not significant, ***p<0.001, **p<0.01, two tailed unpaired Student’s t-test. To determine the viability of biofilm cells, conversion of resazurin to resorufin was tracked for biofilms formed by AbCOL-R1, AbCOL-R2, and AbCOL-R3, and 2.84±0.53, 2.74±0.11, 3.05±0.42-fold (P<0.001, n=3 for each) greater conversion was noted compared to biofilm cells of the source clonal population ( Fig. 3A ). Biofilm formation in A. baumannii is linked with regulation of surface motility [ 39 ]. The surface motility of the evolved lines was examined on motility agar (0.5%) plates following a spot inoculation and the maximal distance of the front in any direction was enumerated after 30h. As depicted in Fig. 3B , AbCOL-R1, AbCOL-R2, and AbCOL-R3 were substantially compromised in surface motility with ∼85.64%, ∼90.83%, and ∼88.80% decline in distance traveled compared to Ab19606 ( Fig. 3B ). The results indicated enhanced biofilm development, along with retarded growth rate, as a significant trade-off in experimental evolution of COL-resistance. To further explore the trade-off, the expression of three genes, ascribed to biofilm development and maturation in Ab, namely bap , ompa , csu E were analyzed from AbCOL-R1. As presented in Fig. 3C , the expression of ompa remained unaltered compared to the source clonal population, while the expression bap was determined to be down-regulated by 2.1±0.39 –fold. Despite being a major facilitator for biofilm development, expression of csuE was markedly down-regulated by 8.66±0.14 –fold in the hyperbiofilm-forming AbCOL-R1 clonal populations ( Fig. 3C ). Download figure Open in new tab Fig. 3. Biofilm-associated attributes for COL-resistant mutants. (A) The viability of biofilm cells for the Ab source population (Ab19606), AbCOL-R1, R2, and R3 bacterial population was estimated after allowing late log-phase Ab source population (Ab19606), AbCOL-R1, R2, and R3 bacterial population to form biofilms and enumerating metabolic activity of the biofilms by resazurine assay. Results represent mean±SEM for three independent experiments. ***p<0.001, two-tailed unpaired Student’s t-test. (B) Surface motility of Ab19606, AbCOL-R1, R2, and R3 was envisioned by spot inoculation on 0.5% motility agar from log phase cultures of the lines and tracking motility for 48 h of the distance of the progressive-front for each (n=3). Results represent mean±SEM for three independent experiments. ***p<0.001, two tailed paired Student’s t-test. (C) Analysis of expression for bap, ompa, and csuE genes in late-log phase Ab19606, AbCOL-R1, R2, and R3 clonal population was performed by qPCR. Expression with respect to gapdh expression is expressed as ΔCt. Results represent mean±SEM for three independent experiments. Ns, not significant, ***p<0.001, two-tailed unpaired Student’s t-test. Colistin-resistant mutants are impaired of outer-membrane integrity As a primary characterization at the molecular level known genetic markers for COL-resistance line presence of mcr genes, and copy number variation (CNV) of single nucleotide variation (SNV) in pmr CAB and lpx ABC loci were analyzed by PCR amplification, qPCR, and by whole genome sequencing. The outer membrane synthesis linked pmr and lpx genes have been associated with COL resistance [ 5 , 40 ] along with mcr genes encoding an array of phosphoethanolamine transferase [ 22 ]. Various mcr genes ( mcr 1-10) were amplified with specific primers with amplicon sizes ranging from 322 to 1644 bp. For mcr 1 and mcr 2 positive control isolates were available in the laboratory. For all, amplification was performed for genomic DNA isolated from AbCOLR-1, AbCOLR-2, and AbCOLR-3. As depicted in Fig. 4A , none of the evolved strains harbored any of the mcr genes ( Fig. 4A ). The copy number for pmr A and pmr B genes were enumerated from the isolated genomic DNAs of the resistant strains by qPCR. As demonstrated in Fig. 4B , the ΔCt value against gapdh for pmr A were 1.29±0.12, 1.21±0.18, 1.10±0.09, and 1.16±0.16 for Ab19606, AbCOLR-1, AbCOLR-2, and AbCOLR-3 respectively. Similarly, for pmr B, the ΔCt value against gapdh were 1.40±0.07, 1.28±0.12, 1.14±0.10, and 1.24±0.066 for Ab19606, AbCOLR-1, AbCOLR-2, and AbCOLR-3 respectively, indicating no apparent change in copy number ( Fig. 4B ). To identify genomic variations associated with experimental evolution of COL resistance, WGS was performed with the DNA isolated from single clonal population from AbCOL-R1, AbCOL-R2, and AbCOL-R3 along with the source clonal population of Ab19606. As enlisted in Table-XX a number of variants could be called in the mutant genomes which included both InDels and nonsynonymous SNPs. Among the high-confidence (score>2500) nonsynonymous SNPs identified, the lpxA2 gene has earlier been ascribed to COL resistance. The InDel identified resulted in a duplication of proline (P190), rendering possible disruption of the structure of the catalytic core ( Table 2 ). Alongside, a G87C mutation was identified hvrA, and a putative DNA binding protein, R1136C mutation was predicted in rpoC gene encoding DNA-directed RNA polymerase β’ subunit. A S34L mutation was identified as a common variation in sigma-fimbriae tip adhesion protein. In addition, in AbCOL-R1 and AbCOL-R2, L1F substitution was enlisted and A220T substitution was identified in a transcriptional regulator of the AraC family in AbCOL-R3 ( Table 2 ). The integrity of the outer membrane was assessed by NPN assay with log-phase culture of Ab source, AbCOL-R1, R2, and R3 clonal population. As depicted in Fig. 4C , 1.79±0.06, 1.74±0.13, and 2.28±0.17 –fold increase in emission (420 nm) were recorded for AbCOL-R1, AbCOL-R2, and AbCOL-R3 respectively compared to the Ab source clone population ( Fig. 4C ). The result indicated impairment of outer membrane in the resistant mutants. Download figure Open in new tab Fig. 4. Analysis of COL-resistance markers and outer membrane integrity. (A) The presence of extrachromosomal transmitted COL-resistance marker mcr genes was profiled in Ab19606 (2), AbCOL-R1 (3), AbCOL-R2 (4), and AbCOL-R3 (5) by mcr-specific primers (mcr1 to 10). Specific amplicon sizes for each of the mcr are mentioned and detected with respect to the 1 kb DNA ladder (M). Positive controls for known DNA containing specific mcrs were available for mcr1 and mcr2 only (1). (B) Copy number variations for pmrA and pmrB were examined by qPCR with specific markers for the genes and genomic DNA isolated from the Ab19606, AbCOL-R1, R2, and R3. CNV was expressed in terms of ΔCt against gapdh amplification. Results represent mean±SEM for three independent experiments. Ns, not significant, two-tailed unpaired Student’s t-test. (C) The integrity of the outer membrane for Ab19606, AbCOL-R1, R2, and R3 was examined by NPN permeability assay. Log phase bacteria were exposed to 0.2mM of N-phenyl-1-naphthylamine (NPN) and Em420nm was measured (Ex at 350 nm). Results represent mean±SEM for three independent experiments. ***p<0.001, **p<0.01, *p<0.05, two tailed unpaired Student’s t-test. View this table: View inline View popup Table 2. Intragenic variation identified in colistin-resistant mutants. Whole genome sequencing was performed from clones derived from three colistin-resistant lines (Col-R1, R2, and R3) and the source clonal population. Reads were aligned with A. baumannii 19606 reference genome and single nucleotide variants (SNV) were called. For the unique SNVs identified in COL-R mutants, positions in chromosomes, changes in nucleotide, and changes in amino acid, gene ID, gene names, and functions are enlisted. The clones in which the variations were identified are also mentioned. View this table: View inline View popup Download powerpoint Table 3. MIC and FICI values for antibiotic combinations. MIC values for colistin (COL) and vancomycin (VNC) independently, COL in combination with VNC, and VNC in combination with COL were determined against A. baumannii 19606. A FICI value of ≤0.5 indicates synergy between the two antibiotics. Colistin resistance mutants demonstrated cross-resistance and collateral sensitivity against antibiotics CR A comprehensive analysis of antibiotic responsiveness was performed for AbCOL-R1, AbCOL-R2, and Ab_COLR3 against 27 antibiotics representing all major groups of antibiotics. The lines demonstrated cross-resistance against and aztreonam while collateral sensitivity (CS) was observed against CIP, cefepime, chloramphenicol (CAM), fosfomycin, and vancomycin (VNC) compared to source Ab19606 ( Fig. 5A ). Intriguingly, A. baumannii is reportedly resistant to VNC [ 41 ] and that has been corroborated for Ab19606 (MIC 25-50 µg/ ml). The CS against VNC was validated by determining MIC, which showed ∼25-12.5-fold resensitization in AbCOL-R strains ( Figs. 5B ). The failure of the evolved COL-R strains to grow in Leeds Acinetobacter agar (Table-1) possibly can be attributed to the sensitivity to VNC [ 42 ]. To examine whether resistance emergence against VNC can demonstrate CS against COL, a VNC-resistant population was evolved by step-wise selection up to 500 µg/ ml. The AbVNC-R clonal populations did not demonstrate CS against CL, with no significant difference in MIC as determined by microdilution (0.6 to 1.2 µg/ ml vs. 0.3 to 0.6 µg/ ml, Fig. S4) and E-test ( Fig. 5C ). CS was also observed for CIP and fosfomycin, which was confirmed by MIC determination by microdilution demonstrating ∼20-fold sensitization against CIP (Table-1) and E-strip assay demonstrating significant sensitization (intrinsic resistant in Ab19606 vs. MIC of 2 µg/ ml in COL-R) against fosfomycin (Fig. S5). . Determination of MIC for gentamicin for which no significant CR or CS was determined by agar diffusion, indicated similar MIC (∼1.3 µg/ ml) for the clonal populations from evolved lines and the source clonal population of Ab19606 (Table-1). Though disc diffusion assay indicated modest CR against aztreonam for AbCOL-R mutants with slight increase in ZoI, the observation was not corroborated by MIC determination by microdilution (Table-1). Download figure Open in new tab Fig. 5. Comprehensive profiling for cross-resistance and collateral sensitivity against antibiotics for COL-resistant mutants. (A) The Kirby-Bauer disc diffusion-based CR-CS profiling was performed against 27 antibiotics for Ab19606 and AbCRP-R1, R2, and R3 lines. Data represent cumulative mean obtained from the three mutants±SEM for the three clones obtained from the lines. ***p<0.001, two-tailed paired Student t-test. (B) MIC against COL, VNC, and gentamicin (GEN) was determined for COL and VNC-resistant lines (COL-R and VNC-R) and Ab19606 cultured in parallel while generating resistant lines by microdilution. Results are represented as mean±SEM as observed from three independent experiments. (C) MIC against COL and VNC was also determined for An19606 and AbCOL-R1 by an E-test using MIC strips to confirm collateral sensitivity to VNC for AbCOL-R mutants. Representative images from three independent tests are included. Colistin-resistant cliniacal isolate demonstrated features similar to the experimentally evolved line Three COL-resistant clinical isolates (DLPL20, DLPL37, and DLPL47) were availed and characterized for systemic antibiotic sensitivity trade-offs against 27 antibiotics comprising all major groups of antibiotics. Primary characterization against 12 antibiotics by VTEK2 reported DLPL20 to be resistant to pipericillin/ tazobactam, ceftazidime, meropenem, amikacin, gentamicin, levofloxacin, ciprofloxacin, and minocycline along with resistance against COL. DLPL37 demonstrated resistance against piperacillin/ tazobactam and COL (Table S2). DLPL47 demonstrated resistance only against COL (Table S2). Further characterization of antibiotic resistance by agar diffusion indicated that DLPL37 was resistant against ampicillin, penicillin G, and ceftazidime, and susceptibility against VNC, azithromycin, CIP, imipenem, and tigecycline ( Fig. 6A ). DLPL20 is a MDR strains resistant against majority of the test antibiotics. For DLPL47 susceptibility was noted against majority of the test antibiotic except mecillinam and ciprofloxacin ( Fig. 6A ). Among the isolates, DLPL37 showed biofilm formation and aggregation trade-offs similar to the experimentally evolved resistant lines ( Fig.6B ). The strain forms robust biofilms (∼4.1-fold, p<0.001) compared to Ab19606 ( Fig. 6C ). Download figure Open in new tab Fig. 6. (A) Heat-map representation of the zone diameters (cm) as obtained from Kirby-Bauer disc diffusion based CR-CS profiling was performed against 27 antibiotics for DLPL20, DLPL37, and DLPL47. Data represent the cumulative mean obtained from the inhibition zone diameter from three experiments for the three resistant isolates. Hierarchical clustering was also performed for the isolates on the basis of the data obtained. (B) Late log-phase cultures of DLPL20, DLPL37, and DLPL47 were allowed to form biofilm. Visible aggregation and adherence were observed for DLPL37. (C) Static biofilm formation on polystyrene substratum was envisioned by crystal violate retention for each of the COL-resistant isolates. Results represent mean±SEM for three independent experiments (n=3). ***p<0.001, two-tailed paired Student t-test. Discussion Owing to its tremendous genomic plasticity, Ab can promptly adapt to altered environmental conditions [ 43 ]. Such adaptations are commonly associated with phenotypic trade-offs influencing the physiology, metabolism, and fitness of bacteria in a broader sense [ 44 ]. Association of loss of LPS with COL resistance in A. baumannii has been described earlier with several mutations in lpxA, lpxB, and lpxC genes [ 12 ]. Alongside, variations in lipid A phosphoethanolamine (PEtN) transferase pmrC [ 5 ] and the two-component system associated with its expression of LPS, pmrA-B have been identified in COL-resistant mutants [ 45 ]. Plasmid-mediated polymyxin resistance (encoded by mcr, phosphoethanolamine transferase enzymes), particularly mcr-1 and mcr-4.3 has been revealed recently [ 21 ]. Here we aim to experimentally evolve COL-R-resistant mutants and a few clinical isolates to systematically profile cross-resistance and collateral sensitivity against antibiotics and other phenotypic trade-offs. The three experimentally evolved COL-R mutants were compromised in terms of LPS content. Of the previously reported COL-resistance-associated genes, variation of which is frequently attributed to loss or modification of LPS in Ab, in the three COL-R evolved mutants, only a single mutation in the lpxA2 gene could be identified. The mutation is an insertion resulting in the duplication of a proline (P190dup) residue. Whether the mutation impacts the function of lpxA2 warrants further experimentation. Among other common variations, the nonsynonymous substitution of the hvrA gene leading to G87C mutations warrants further exploration to identify whether such mutations are compensatory mutations or directly associated with COL resistance. No copy number variation for pmr genes could be observed in the mutants. The impact of COL-R mutation on fitness and virulence attributes has been explored in various mutants and clinical isolates both in vitro and in vivo. In general, the term fitness is evaluated with comparative growth kinetic profiling and change in generation time. Mu et al reported variation in fitness cost among different COL-R mutants linked to genomic variation associated with COL resistance evolution [ 46 ]. Lower fitness in COL-R clinical isolates has been observed consistently [ 7 , 47 ]. The majority of the mutations identified in pmrA loci including E8D as associated with greater fitness cost. Tough P233S mutation in pmrB is not linked to fitness cost, other COL-R associated with the genomic variations inducted fitness cost [ 7 ]. Deletion, nonsynonymous, and frame-shift mutations associated with lpxA, C, and D are associated with fitness cost and virulence [ 48 ]. Corroborating the observation, the COL-R mutants evolved in this study by step-wise selection under submerged conditions demonstrated a significant fitness cost of ∼2-fold. However, whether the major mutation identified here in lpxA2 gene P190dup in terms of COL resistance or the Arg1136Cys mutation in DNA-directed RNA polymerase beta subunit (rpoC) is responsible for the cost, needs intricate exploration. Disruptive mutations of insertional elements IS Aba1 , IS Ajo2 , and ISAba13 leading to perturbed LPS and lipooligosaccharide synthesis render COL susceptible population to COL-dependent growth [ 37 ]. In the experimentally evolved COL-R mutants, no such insertions could be detected and the mutants did not display typical features of COL-dependent growth. Acinetobacter sp. can form biofilm in various substratum at both solid-liquid and air-liquid interface [ 49 ]. Compared to other species, the intrinsic biofilm formation rate at the solid-liquid interface is around 3-times higher for Ab [ 50 , 51 ]. Antibiotic-resistant Ab isolates including CRABs have been reported to be prolific biofilm formers [ 50 , 52 ]. Moreover, higher expression levels for biofilm-associated genes like ompA, bap, csuE, epsA, blaPER−1, and bfmS expression have been observed in clinical isolates from diverse regions [ 53 ]. However, for COL-R strains, biofilm deficiency has been reported previously [ 47 ]. For both laboratory-induced and clinical isolates considerable depreciation in biofilm formation has been detected earlier and associated with LPS deficiency [ 26 ]. Contrary to earlier observations, in this study for AbCOL-R1-R3 robust biofilm formation was observed accompanied by significantly reduced surface motility. Moreover, severe depletion in the expression of csuE and significant depletion of bap expression was detected in the mutants. The results suggest that biofilm formation by the COL-R mutants is accomplished by some alternate mechanism involving the formation of a robust EPS enriched in polysaccharides and eDNA. Also, the mutation S34L mutation, identified in sigma-fimbriae tip adhesion protein, might be responsible for enhanced aggregation and adherence. In clinical isolates of Ab, COL-resistance coupled with LPS-loss inflicted hypersensitivity to azithromycin, rifampicin, and VNC [ 54 ]. Among the laboratory-evolved strains of Ab17978, for several LPS-deficient strains 16arbouring a mutation in lpx genes, sensitivity was recorded against CIP, gentamicin, amikacin, minocycline, tigecycline, ampicillin, meropenem, and imipenem, while LPS modified strain demonstrated cross-resistance against most of the antibiotics [ 46 ]. For single strep selected LPS-deficient COL-R mutants hypersusceptibility was observed against VNC, rifampicin, and azithromycin, while against tigecycline and CIP the mutants were cross-resistant and minimal variation was observed for other β-lactam, carbapenems, amikacin, minocycline, and doxycycline [ 26 ]. For LPS-modified COL-R strains 16arbouring a mutation in pmrB, no significant difference was observed in antibiotic responsiveness [ 26 ]. Such reports clearly emphasized the heterogeneity among COL-R mutants in terms of antibiotic sensitivity trade-offs. In this study, we performed a comprehensive screening for CR-CS profiling which indicated significant collateral sensitivity of the laboratory-evolved strains against VNC. Transmission of mcr genes has been associated with an enhanced rate of COL-R emergence particularly among nosocomial isolates obtained from the ICU. [ 55 ]. However, the data on COL resistance from community isolates are still scanty. Here we examined three distinct clinical isolates of Ab for biofilm-forming and antibiotic responsiveness trade-offs. Profiling for mcr genes revealed the absence of mcr1 or mcr4 in the isolates. Quite interestingly, in one of the isolates, phenotypic attributes like cellular aggregation and biofilm formation, similar to the laboratory-evolved strains, were observed. The strains also demonstrated a similar antibiotic sensitivity profile to the evolved COL-R strains with hypersusceptibility to VNC. Additionally the study identified potentiation of CIP and fosfomycin coupled to evolution of COL-resistance. Due to the immense genomic plasticity of Ab, even a susceptible bacterial population often manifests heteroresistance rendering the emergence of a subpopulation resistant to antibiotics [ 56 , 57 ]. The phenomenon is frequently reported for clinical isolates of Ab including several MDR isolates demonstrating heteroresistance against COL [ 58 ]. Identification of similar mutations in three independently evolved COL-R lines suggests the presence of a heteroresistant subpopulation within the source clonal population. Whether LPS deficiency in Ab emerges as one of the phenotypically varied subpopulations as observed in A. baylyi ADP1 awaits further investigation [ 59 ]. Loss of LPS due to the process of COL-resistant evolution is considered a trade-off between resistance and virulence [ 60 ]. However, the genetic regulation and systemic impact of resistance-associated genomic variations is complex and also dependent on the genomic background and selection pressure implemented. Hence, an intricate and comprehensive approach linked to multi-omics [ 61 ] might offer a more clarified view on resistance emergence-associated trade-offs and phenotypic variations. Funding AB is funded by ICMR Adhoc research grant-Project ID: 2021-14059 (ICMR, Govt. of India) Conflict of interest The authors declare no conflict of interest. None of the authors were paid for the funding of the project. Availability of data and materials The data set supporting the conclusions of this article is available in the Sequencing Read Archive ( https://www.ncbi.nlm.nih.gov/sra ) repository under BioProject accession no. PRJNA1188730 with sample accession numbers SRX26787849, SRX26878385, SRX26878386, and SRX26878387. Author contribution Kusumita Acharya, Upasana Bhattacharya, and Shatarupa Biswas performed the experiments. Mallika Ghosh isolated, identified, and provided the resistant clinical isolates. Arijit Bhattacharya conceptualized the work and prepared the final manuscript. All approved the final draft. Ethical approval The study was performed with due ethical approvals from Institutional Ethical Committee, Adamas University and Institutional Biosafety Committee, Adamas University. No personally identifiable patient/ human subject information was disclosed to the researchers. Consent to participate NA Consent for publication NA Acknowledgement The authors acknowledge all the open-source software and server providers. The authors acknowledge Dr. Priyanka Bhowmik, Adamas University, and Dr. Sulagna Basu, ICMR-NIBRI for providing us with mcrt-1 and mcr-2 DNA samples and contributions to our project work. The authors are obliged to Subhash Mukhopadhyay Centre for Stem Cell Biology Regenerative Medicine, Dept. of Chemistry, and Central Instrumentation facility, Adamas University for support with instrument facilities. The authors also acknowledge Mr. Saikat Samanta, Adamas University for his constant support in laboratory activities. AB is funded by Adhoc Grant-Project ID: AMR/Adhoc/284/2022-ECD-II (ICMR, Govt. of India) and SEED grant, Adamas University. References [1]. ↵ G.B.D.A.R. Collaborators , Global burden of bacterial antimicrobial resistance 1990-2021: a systematic analysis with forecasts to 2050 , Lancet . 404 ( 2024 ) 1199 – 1226 . doi: 10.1016/S0140-6736(24)01867-1 . OpenUrl CrossRef PubMed [2]. ↵ A. Maure , E. Robino , C. Van der Henst , The intracellular life of Acinetobacter baumannii , Trends Microbiol . 31 ( 2023 ) 1238 – 1250 . doi: 10.1016/j.tim.2023.06.007 . OpenUrl CrossRef [3]. ↵ I. Cavallo , A. Oliva , R. Pages , F. Sivori , M. Truglio , G. Fabrizio , M. Pasqua , F. Pimpinelli , E.G. Di Domenico , Acinetobacter baumannii in the critically ill: complex infections get complicated , Front Microbiol . 14 ( 2023 ) 1196774 . doi: 10.3389/fmicb.2023.1196774 . OpenUrl CrossRef PubMed [4]. ↵ S.E. Weinberg , A. Villedieu , N. Bagdasarian , N. Karah , L. Teare , W.F. Elamin , Control and management of multidrug resistant Acinetobacter baumannii: A review of the evidence and proposal of novel approaches , Infect Prev Pract . 2 ( 2020 ) 100077 . doi: 10.1016/j.infpip.2020.100077 . OpenUrl CrossRef PubMed [5]. ↵ S.M. Seleim , M.S. Mostafa , N.H. Ouda , R.Y. Shash , The role of pmrCAB genes in colistin-resistant Acinetobacter baumannii , Sci Rep . 12 ( 2022 ) 20951 . doi: 10.1038/s41598-022-25226-x . OpenUrl CrossRef [6]. ↵ A. Sabnis , K.L. Hagart , A. Klockner , M. Becce , L.E. Evans , R.C.D. Furniss , D.A. Mavridou , R. Murphy , M.M. Stevens , J.C. Davies , G.J. Larrouy-Maumus , T.B. Clarke , A.M. Edwards , Colistin kills bacteria by targeting lipopolysaccharide in the cytoplasmic membrane , Elife . 10 ( 2021 ). doi: 10.7554/eLife.65836 . OpenUrl CrossRef PubMed [7]. ↵ G.J. Da Silva , S. Domingues , Interplay between Colistin Resistance, Virulence and Fitness in Acinetobacter baumannii , Antibiotics (Basel ). 6 ( 2017 ). doi: 10.3390/antibiotics6040028 . OpenUrl CrossRef [8]. ↵ A.Z. Bialvaei , H. Samadi Kafil , Colistin, mechanisms and prevalence of resistance , Curr Med Res Opin . 31 ( 2015 ) 707 – 721 . doi: 10.1185/03007995.2015.1018989 . OpenUrl CrossRef PubMed [9]. ↵ T.R. Sampson , X. Liu , M.R. Schroeder , C.S. Kraft , E.M. Burd , D.S. Weiss , Rapid killing of Acinetobacter baumannii by polymyxins is mediated by a hydroxyl radical death pathway , Antimicrob Agents Chemother . 56 ( 2012 ) 5642 – 5649 . doi: 10.1128/AAC.00756-12 . OpenUrl Abstract / FREE Full Text [10]. ↵ A.H. Mondal , K. Khare , P. Saxena , P. Debnath , K. Mukhopadhyay , D. Yadav , A Review on Colistin Resistance: An Antibiotic of Last Resort , Microorganisms . 12 ( 2024 ). doi: 10.3390/microorganisms12040772 . OpenUrl CrossRef [11]. ↵ M.I. Hood , K.W. Becker , C.M. Roux , P.M. Dunman , E.P. Skaar, genetic determinants of intrinsic colistin tolerance in Acinetobacter baumannii , Infect Immun . 81 ( 2013 ) 542 – 551 . doi: 10.1128/IAI.00704-12 . OpenUrl Abstract / FREE Full Text [12]. ↵ J.H. Moffatt , M. Harper , P. Harrison , J.D. Hale , E. Vinogradov , T. Seemann , R. Henry , B. Crane , F. St Michael , A.D. Cox , B. Adler , R.L. Nation , J. Li , J.D. Boyce , Colistin resistance in Acinetobacter baumannii is mediated by complete loss of lipopolysaccharide production , Antimicrob Agents Chemother . 54 ( 2010 ) 4971 – 4977 . doi: 10.1128/AAC.00834-10 . OpenUrl Abstract / FREE Full Text [13]. J.H. Moffatt , M. Harper , B. Adler , R.L. Nation , J. Li , J.D. Boyce , Insertion sequence ISAba11 is involved in colistin resistance and loss of lipopolysaccharide in Acinetobacter baumannii , Antimicrob Agents Chemother . 55 ( 2011 ) 3022 – 3024 . doi: 10.1128/AAC.01732-10 . OpenUrl Abstract / FREE Full Text [14]. ↵ S. Vijayakumar , R.G. Swetha , Y.D. Bakthavatchalam , K. Vasudevan , B. Abirami Shankar , A. Kirubananthan , K. Walia , S. Ramaiah , I. Biswas , B. Veeraraghavan , A. Anbarasu , Genomic investigation unveils colistin resistance mechanism in carbapenem-resistant Acinetobacter baumannii clinical isolates , Microbiol Spectr . 12 ( 2024 ) e0251123 . doi: 10.1128/spectrum.02511-23 . OpenUrl CrossRef [15]. ↵ A.L. Polasko , P. Ramos , R.B. Kaner , S. Mahendra , A multipronged approach for systematic in vitro quantification of catheter-associated biofilms , Journal of Hazardous Materials Letters . 2 ( 2021 ). doi: 10.1016/j.hazl.2021.100032 . OpenUrl CrossRef [16]. ↵ L.A. Arroyo , C.M. Herrera , L. Fernandez , J.V. Hankins , M.S. Trent , R.E. Hancock , The pmrCAB operon mediates polymyxin resistance in Acinetobacter baumannii ATCC 17978 and clinical isolates through phosphoethanolamine modification of lipid A , Antimicrob Agents Chemother . 55 ( 2011 ) 3743 – 3751 . doi: 10.1128/AAC.00256-11 . OpenUrl Abstract / FREE Full Text [17]. ↵ Y.K. Park , J.Y. Choi , D. Shin , K.S. Ko , Correlation between overexpression and amino acid substitution of the PmrAB locus and colistin resistance in Acinetobacter baumannii , Int J Antimicrob Agents . 37 ( 2011 ) 525 – 530 . doi: 10.1016/j.ijantimicag.2011.02.008 . OpenUrl CrossRef PubMed [18]. ↵ S. Gerson , J.W. Betts , K. Lucassen , C.S. Nodari , J. Wille , M. Josten , S. Gottig , J. Nowak , D. Stefanik , I. Roca , J. Vila , J.M. Cisneros , R.M. La Ragione , H. Seifert , P.G. Higgins , Investigation of Novel pmrB and eptA Mutations in Isogenic Acinetobacter baumannii Isolates Associated with Colistin Resistance and Increased Virulence In Vivo , Antimicrob Agents Chemother . 63 ( 2019 ). doi: 10.1128/AAC.01586-18 . OpenUrl Abstract / FREE Full Text [19]. ↵ V. Marano , N. Marascio , G. Pavia , A.G. Lamberti , A. Quirino , R. Musarella , F. Casalinuovo , M. Mazzitelli , E.M. Trecarichi , C. Torti , G. Matera , M.C. Liberto , Identification of pmrB mutations as putative mechanism for colistin resistance in A. baumannii strains isolated after in vivo colistin exposure , Microb Pathog . 142 ( 2020 ) 104058 . doi: 10.1016/j.micpath.2020.104058 . OpenUrl CrossRef PubMed [20]. ↵ A. Gaballa , M. Wiedmann , L.M. Carroll , More than mcr: canonical plasmid- and transposon-encoded mobilized colistin resistance genes represent a subset of phosphoethanolamine transferases , Front Cell Infect Microbiol . 13 ( 2023 ) 1060519 . doi: 10.3389/fcimb.2023.1060519 . OpenUrl CrossRef PubMed [21]. ↵ N. Martins-Sorenson , E. Snesrud , D.E. Xavier , L.C. Cacci , A.T. Iavarone , P. McGann , L.W. Riley , B.M. Moreira , A novel plasmid-encoded mcr-4.3 gene in a colistin-resistant Acinetobacter baumannii clinical strain , J Antimicrob Chemother . 75 ( 2020 ) 60 – 64 . doi: 10.1093/jac/dkz413 . OpenUrl CrossRef PubMed [22]. ↵ S.S. Sobieh , S.A.H. Mohamed , M.A. El-Sayed , S.A. Abdallah , Molecular Assessment of MCR-1 Gene among Pandrug-Resistant Acinetobacter baumannii , Microbiology Research . 14 ( 2023 ) 1238 – 1251 . doi: 10.3390/microbiolres14030083 . OpenUrl CrossRef [23]. ↵ H. Kon , A. Hameir , E. Temkin , A. Keren-Paz , D. Schwartz , V. Schechner , Y. Carmeli , Colistin Dependency among Colistin-Heteroresistant Acinetobacter baumannii Isolates , Microorganisms . 10 ( 2021 ). doi: 10.3390/microorganisms10010058 . OpenUrl CrossRef [24]. ↵ M.F. Lin , Y.Y. Lin , C.Y. Lan , Contribution of EmrAB efflux pumps to colistin resistance in Acinetobacter baumannii , J Microbiol . 55 ( 2017 ) 130 – 136 . doi: 10.1007/s12275-017-6408-5 . OpenUrl CrossRef PubMed [25]. ↵ K. Novovic , B. Jovcic , Colistin Resistance in Acinetobacter baumannii: Molecular Mechanisms and Epidemiology , Antibiotics (Basel ). 12 ( 2023 ). doi: 10.3390/antibiotics12030516 . OpenUrl CrossRef [26]. ↵ Z. Farshadzadeh , B. Taheri , S. Rahimi , S. Shoja , M. Pourhajibagher , M.A. Haghighi , A. Bahador , Growth Rate and Biofilm Formation Ability of Clinical and Laboratory-Evolved Colistin-Resistant Strains of Acinetobacter baumannii , Front Microbiol . 9 ( 2018 ) 153 . doi: 10.3389/fmicb.2018.00153 . OpenUrl CrossRef PubMed [27]. ↵ K. Acharya , S. Borborah , A. Chatterjee , M. Ghosh , A. Bhattacharya , A comprehensive profiling of quorum quenching by bacterial pigments identifies quorum sensing inhibition and antibiofilm action of prodigiosin against Acinetobacter baumannii , Arch Microbiol . 205 ( 2023 ) 364 . doi: 10.1007/s00203-023-03710-w . OpenUrl CrossRef PubMed [28]. ↵ M.J. Wiser , R.E. Lenski , A Comparison of Methods to Measure Fitness in Escherichia coli , PLoS One . 10 ( 2015 ) e0126210 . doi: 10.1371/journal.pone.0126210 . OpenUrl CrossRef PubMed [29]. ↵ J. Hubeny , E. Korzeniewska , M. Buta-Hubeny , W. Zielinski , D. Rolbiecki , M. Harnisz , Characterization of carbapenem resistance in environmental samples and Acinetobacter spp. isolates from wastewater and river water in Poland , Sci Total Environ . 822 ( 2022 ) 153437 . doi: 10.1016/j.scitotenv.2022.153437 . OpenUrl CrossRef PubMed [30]. ↵ H. Li , R. Durbin , Fast and accurate short read alignment with Burrows-Wheeler transform , Bioinformatics . 25 ( 2009 ) 1754 – 1760 . doi: 10.1093/bioinformatics/btp324 . OpenUrl CrossRef PubMed Web of Science [31]. ↵ R.D. Olson , R. Assaf , T. Brettin , N. Conrad , C. Cucinell , J.J. Davis , D.M. Dempsey , A. Dickerman , E.M. Dietrich , R.W. Kenyon , M. Kuscuoglu , E.J. Lefkowitz , J. Lu , D. Machi , C. Macken , C. Mao , A. Niewiadomska , M. Nguyen , G.J. Olsen , J.C. Overbeek , B. Parrello , V. Parrello , J.S. Porter , G.D. Pusch , M. Shukla , I. Singh , L. Stewart , G. Tan , C. Thomas , M. VanOeffelen , V. Vonstein , Z.S. Wallace , A.S. Warren , A.R. Wattam , F. Xia , H. Yoo , Y. Zhang , C.M. Zmasek , R.H. Scheuermann , R.L. Stevens , Introducing the Bacterial and Viral Bioinformatics Resource Center (BV-BRC): a resource combining PATRIC, IRD and ViPR , Nucleic Acids Res . 51 ( 2023 ) D678 – D689 . doi: 10.1093/nar/gkac1003 . OpenUrl CrossRef PubMed [32]. ↵ S. Paul Bhattacharya , A. Mitra , A. Bhattacharya , A. Sen , Quorum quenching activity of pentacyclic triterpenoids leads to inhibition of biofilm formation by Acinetobacter baumannii , Biofouling . 36 ( 2020 ) 922 – 937 . doi: 10.1080/08927014.2020.1831480 . OpenUrl CrossRef PubMed [33]. ↵ S. Paytubi , M. de La Cruz , J.R. Tormo , J. Martin , I. Gonzalez , V. Gonzalez-Menendez , O. Genilloud , F. Reyes , F. Vicente , C. Madrid , C. Balsalobre , A High-Throughput Screening Platform of Microbial Natural Products for the Discovery of Molecules with Antibiofilm Properties against Salmonella , Front Microbiol . 8 ( 2017 ) 326 . doi: 10.3389/fmicb.2017.00326 . OpenUrl CrossRef PubMed [34]. ↵ C. Mayer , A. Muras , A. Parga , M. Romero , S. Rumbo-Feal , M. Poza , J. Ramos-Vivas , A. Otero , Quorum Sensing as a Target for Controlling Surface Associated Motility and Biofilm Formation in Acinetobacter baumannii ATCC((R)) 17978(TM) , Front Microbiol . 11 ( 2020 ) 565548 . doi: 10.3389/fmicb.2020.565548 . OpenUrl CrossRef PubMed [35]. ↵ A. Kumar , S.K. Saha , P. Banerjee , K. Prasad , T.K. Sengupta , Antibiotic-Induced Biofilm Formations in Pseudomonas aeruginosa Strains KPW.1-S1 and HRW.1-S3 are Associated with Increased Production of eDNA and Exoproteins, Increased ROS Generation, and Increased Cell Surface Hydrophobicity , Curr Microbiol. 81 ( 2023 ) 11 . doi: 10.1007/s00284-023-03495-7 . OpenUrl CrossRef PubMed [36]. ↵ S.J. Abdullah , B.T.S. Yan , N. Palanivelu , V.B. Dhanabal , J.P. Bifani , S. Bhattacharjya , Outer-Membrane Permeabilization , LPS Transport Inhibition: Activity, Interactions, and Structures of Thanatin Derived Antimicrobial Peptides , Int J Mol Sci . 25 ( 2024 ). doi: 10.3390/ijms25042122 . OpenUrl CrossRef [37]. ↵ S. Chamoun , J. Welander , M.M. Martis-Thiele , M. Ntzouni , C. Claesson , E. Vikstrom , M.V. Turkina , Colistin Dependence in Extensively Drug-Resistant Acinetobacter baumannii Strain Is Associated with ISAjo2 and ISAba13 Insertions and Multiple Cellular Responses , Int J Mol Sci . 22 ( 2021 ). doi: 10.3390/ijms22020576 . OpenUrl CrossRef PubMed [38]. ↵ J. Skerniskyte , R. Krasauskas , C. Pechoux , S. Kulakauskas , J. Armalyte , E. Suziedeliene , Surface-Related Features and Virulence Among Acinetobacter baumannii Clinical Isolates Belonging to International Clones I and II , Front Microbiol . 9 ( 2018 ) 3116 . doi: 10.3389/fmicb.2018.03116 . OpenUrl CrossRef PubMed [39]. ↵ J. Armalyte , A. Cepauskas , G. Sakalyte , J. Martinkus , J. Skerniskyte , C. Martens , E. Suziedeliene , A. Garcia-Pino , D. Jurenas , A polyamine acetyltransferase regulates the motility and biofilm formation of Acinetobacter baumannii , Nat Commun . 14 ( 2023 ) 3531 . doi: 10.1038/s41467-023-39316-5 . OpenUrl CrossRef [40]. ↵ G. Kamoshida , N. Yamada , T. Nakamura , D. Yamaguchi , D. Kai , M. Yamashita , C. Hayashi , N. Kanda , M. Sakaguchi , H. Morimoto , T. Sawada , T. Okada , Y. Kaya , N. Takemoto , K. Yahiro , Preferential Selection of Low-Frequency, Lipopolysaccharide-Modified, Colistin-Resistant Mutants with a Combination of Antimicrobials in Acinetobacter baumannii , Microbiol Spectr . 10 ( 2022 ) e0192822 . doi: 10.1128/spectrum.01928-22 . OpenUrl CrossRef PubMed [41]. ↵ N.C. Gordon , K. Png , D.W. Wareham , Potent synergy and sustained bactericidal activity of a vancomycin-colistin combination versus multidrug-resistant strains of Acinetobacter baumannii , Antimicrob Agents Chemother . 54 ( 2010 ) 5316 – 5322 . doi: 10.1128/AAC.00922-10 . OpenUrl Abstract / FREE Full Text [42]. ↵ A. Jawad , P.M. Hawkey , J. Heritage , A.M. Snelling , Description of Leeds Acinetobacter Medium, a new selective and differential medium for isolation of clinically important Acinetobacter spp., and comparison with Herellea agar and Holton’s agar , J Clin Microbiol . 32 ( 1994 ) 2353 – 2358 . doi: 10.1128/jcm.32.10.2353-2358.1994 . OpenUrl Abstract / FREE Full Text [43]. ↵ T. Karampatakis , K. Tsergouli , P. Behzadi , Pan-Genome Plasticity and Virulence Factors: A Natural Treasure Trove for Acinetobacter baumannii , Antibiotics (Basel ). 13 ( 2024 ). doi: 10.3390/antibiotics13030257 . OpenUrl CrossRef [44]. ↵ K. Phan , T. Ferenci , The fitness costs and trade-off shapes associated with the exclusion of nine antibiotics by OmpF porin channels , ISME J . 11 ( 2017 ) 1472 – 1482 . doi: 10.1038/ismej.2016.202 . OpenUrl CrossRef PubMed [45]. ↵ N. Yamada , G. Kamoshida , T. Shiraishi , D. Yamaguchi , M. Matsuoka , R. Yamauchi , N. Kanda , R. Kamioka , N. Takemoto , Y. Morita , M. Fujimuro , S.i. Yokota, K. Yahiro, PmrAB, the two-component system of Acinetobacter baumannii, controls the phosphoethanolamine modification of lipooligosaccharide in response to metal ions , J Bacteriol . 206 ( 2024 ) e0043523 . doi: 10.1128/jb.00435-23 . OpenUrl CrossRef PubMed [46]. ↵ X. Mu , N. Wang , X. Li , K. Shi , Z. Zhou , Y. Yu , X. Hua , The Effect of Colistin Resistance-Associated Mutations on the Fitness of Acinetobacter baumannii , Front Microbiol . 7 ( 2016 ) 1715 . doi: 10.3389/fmicb.2016.01715 . OpenUrl CrossRef PubMed [47]. ↵ K. Dafopoulou , B.B. Xavier , A. Hotterbeekx , L. Janssens , C. Lammens , E. De , H. Goossens , A. Tsakris , S. Malhotra-Kumar , S. Pournaras , Colistin-Resistant Acinetobacter baumannii Clinical Strains with Deficient Biofilm Formation , Antimicrob Agents Chemother . 60 ( 2015 ) 1892 – 1895 . doi: 10.1128/AAC.02518-15 . OpenUrl Abstract / FREE Full Text [48]. ↵ N. Thi Khanh Nhu, D.W. Riordan, T. Do Hoang Nhu, D.P. Thanh, G. Thwaites, N.P. Huong Lan, B.W. Wren, S. Baker, R.A. Stabler , The induction and identification of novel Colistin resistance mutations in Acinetobacter baumannii and their implications , Sci Rep . 6 ( 2016 ) 28291 . doi: 10.1038/srep28291 . OpenUrl CrossRef PubMed [49]. ↵ S. Marti , J. Rodriguez-Bano , M. Catel-Ferreira , T. Jouenne , J. Vila , H. Seifert , E. De , Biofilm formation at the solid-liquid and air-liquid interfaces by Acinetobacter species , BMC Res Notes . 4 ( 2011 ) 5 . doi: 10.1186/1756-0500-4-5 . OpenUrl CrossRef PubMed [50]. ↵ C.H. Yang , P.W. Su , S.H. Moi , L.Y. Chuang , Biofilm Formation in Acinetobacter Baumannii: Genotype-Phenotype Correlation , Molecules . 24 ( 2019 ). doi: 10.3390/molecules24101849 . OpenUrl CrossRef [51]. ↵ H. Zeighami , F. Valadkhani , R. Shapouri , E. Samadi , F. Haghi , Virulence characteristics of multidrug resistant biofilm forming Acinetobacter baumannii isolated from intensive care unit patients , BMC Infect Dis . 19 ( 2019 ) 629 . doi: 10.1186/s12879-019-4272-0 . OpenUrl CrossRef [52]. ↵ A.M. Shenkutie , M.Z. Yao , G.K. Siu , B.K.C. Wong , P.H. Leung , Biofilm-Induced Antibiotic Resistance in Clinical Acinetobacter baumannii Isolates , Antibiotics (Basel ). 9 ( 2020 ). doi: 10.3390/antibiotics9110817 . OpenUrl CrossRef [53]. ↵ S. Roy , G. Chowdhury , A.K. Mukhopadhyay , S. Dutta , S. Basu , Convergence of Biofilm Formation and Antibiotic Resistance in Acinetobacter baumannii Infection , Front Med (Lausanne ). 9 ( 2022 ) 793615 . doi: 10.3389/fmed.2022.793615 . OpenUrl CrossRef PubMed [54]. ↵ M. Garcia-Quintanilla , M. Carretero-Ledesma , P. Moreno-Martinez , R. Martin-Pena , J. Pachon , M.J. McConnell , Lipopolysaccharide loss produces partial colistin dependence and collateral sensitivity to azithromycin, rifampicin and vancomycin in Acinetobacter baumannii , Int J Antimicrob Agents . 46 ( 2015 ) 696 – 702 . doi: 10.1016/j.ijantimicag.2015.07.017 . OpenUrl CrossRef PubMed [55]. ↵ D. Irusan , S.D. Akshay , V.P. Shetty , I. Karunasagar , V.K. Deekshit , A. Rohit , Analysis of mcr family of colistin resistance genes in Gram-negative isolates from a tertiary care hospital in India , J Appl Microbiol . 135 ( 2024 ). doi: 10.1093/jambio/lxae172 . OpenUrl CrossRef [56]. ↵ O.M. El-Halfawy , M.A. Valvano , Antimicrobial heteroresistance: an emerging field in need of clarity , Clin Microbiol Rev . 28 ( 2015 ) 191 – 207 . doi: 10.1128/CMR.00058-14 . OpenUrl Abstract / FREE Full Text [57]. ↵ Y.K. Hong , H. Kim , K.S. Ko , Two types of colistin heteroresistance in Acinetobacter baumannii isolates , Emerg Microbes Infect . 9 ( 2020 ) 2114 – 2123 . doi: 10.1080/22221751.2020.1821584 . OpenUrl CrossRef PubMed [58]. ↵ L. Chen , J. Lin , H. Lu , X. Zhang , C. Wang , H. Liu , X. Zhang , J. Li , J. Cao , T. Zhou , Deciphering colistin heteroresistance in Acinetobacter baumannii clinical isolates from Wenzhou, China , J Antibiot (Tokyo ). 73 ( 2020 ) 463 – 470 . doi: 10.1038/s41429-020-0289-2 . OpenUrl CrossRef PubMed [59]. ↵ B.A. Renda , A. Dasgupta , D. Leon , J.E. Barrick , Genome instability mediates the loss of key traits by Acinetobacter baylyi ADP1 during laboratory evolution , J Bacteriol . 197 ( 2015 ) 872 – 881 . doi: 10.1128/JB.02263-14 . OpenUrl Abstract / FREE Full Text [60]. ↵ M. Carretero-Ledesma , M. Garcia-Quintanilla , R. Martin-Pena , M.R. Pulido , J. Pachon , M.J. McConnell , Phenotypic changes associated with Colistin resistance due to Lipopolysaccharide loss in Acinetobacter baumannii , Virulence . 9 ( 2018 ) 930 – 942 . doi: 10.1080/21505594.2018.1460187 . OpenUrl CrossRef PubMed [61]. ↵ X. Hua , L. Liu , Y. Fang , Q. Shi , X. Li , Q. Chen , K. Shi , Y. Jiang , H. Zhou , Y. Yu , Colistin Resistance in Acinetobacter baumannii MDR-ZJ06 Revealed by a Multiomics Approach , Front Cell Infect Microbiol . 7 ( 2017 ) 45 . doi: 10.3389/fcimb.2017.00045 . OpenUrl CrossRef PubMed View the discussion thread. Back to top Previous Next Posted January 18, 2025. Download PDF Supplementary Material Email Thank you for your interest in spreading the word about bioRxiv. NOTE: Your email address is requested solely to identify you as the sender of this article. Your Email * Your Name * Send To * Enter multiple addresses on separate lines or separate them with commas. You are going to email the following Identification of Evolutionary Trade-Offs Associated with High-Level Colistin Resistance in Acinetobacter baumannii Message Subject (Your Name) has forwarded a page to you from bioRxiv Message Body (Your Name) thought you would like to see this page from the bioRxiv website. Your Personal Message CAPTCHA This question is for testing whether or not you are a human visitor and to prevent automated spam submissions. Share Identification of Evolutionary Trade-Offs Associated with High-Level Colistin Resistance in Acinetobacter baumannii Kusumita Acharya , Upasana Bhattacharya , Shatarupa Biswas , Mallika Ghosh , Arijit Bhattacharya bioRxiv 2025.01.17.633615; doi: https://doi.org/10.1101/2025.01.17.633615 Share This Article: Copy Citation Tools Identification of Evolutionary Trade-Offs Associated with High-Level Colistin Resistance in Acinetobacter baumannii Kusumita Acharya , Upasana Bhattacharya , Shatarupa Biswas , Mallika Ghosh , Arijit Bhattacharya bioRxiv 2025.01.17.633615; doi: https://doi.org/10.1101/2025.01.17.633615 Citation Manager Formats BibTeX Bookends EasyBib EndNote (tagged) EndNote 8 (xml) Medlars Mendeley Papers RefWorks Tagged Ref Manager RIS Zotero Tweet Widget Facebook Like Google Plus One Subject Area Microbiology Subject Areas All Articles Animal Behavior and Cognition (7628) Biochemistry (17659) Bioengineering (13881) Bioinformatics (41909) Biophysics (21435) Cancer Biology (18576) Cell Biology (25478) Clinical Trials (138) Developmental Biology (13366) Ecology (19885) Epidemiology (2067) Evolutionary Biology (24299) Genetics (15597) Genomics (22482) Immunology (17725) Microbiology (40356) Molecular Biology (17160) Neuroscience (88523) Paleontology (666) Pathology (2830) Pharmacology and Toxicology (4820) Physiology (7636) Plant Biology (15123) Scientific Communication and Education (2044) Synthetic Biology (4290) Systems Biology (9817) Zoology (2269)

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2025) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00
unpaywall
last seen: 2026-05-23T02:00:01.238055+00:00
License: CC-BY-ND-4.0