Pleurotus ostreatus modulates the intestinal glucose absorption by the Na(+)/glucose cotransporter 1 (SGLT1) in C57BL/6 mice | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Pleurotus ostreatus modulates the intestinal glucose absorption by the Na(+)/glucose cotransporter 1 (SGLT1) in C57BL/6 mice Paola Quevedo Da Costa, Karen Martirena Monks Da Silva, Tais Kopp Silveira, and 6 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7772923/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract The use of medicinal mushrooms for the treatment of glycemic metabolism disorders has been extensively tested as a therapeutic alternative. The aim of this study was to analyze the effect of Pleurotus ostreatus extract on intestinal glucose absorption mediated by Na(+)-glucose cotransporter 1 (SGLT1) in C57BL/6 mice. C57BL/6 mice were administered P. ostreatus extract (2 g/kg) by gavage for three weeks. Blood glucose levels and gene expression of various proteins involved in intestinal glucose uptake were then analyzed. We found that blood glucose levels increased significantly after administration of P. ostreatus , an effect that was abolished by the SGLT1 inhibitor. Although the three-week exposure to the extract did not alter the expression of the Sglt1, Glut2 and Glu5 genes in the proximal intestine of the mice, it increased the expression of the atp1a1 gene. To investigate the possible effects of the extract on SGLT1, a molecular docking analysis was performed. The binding affinity between the six main components of the extract and the SGLT1 receptor was examined. It was found that naringin and rutin had the strongest binding affinity. Our results suggest that repeated ingesture of P. ostreatus extract sensitizes SGLT1 and promotes increased gene expression of atp1a1 without affecting blood glucose metabolism. atp1a1 glucose transporter phlorizin mushroom Na(+)/K(+)-ATPase Figures Figure 1 Figure 2 Figure 3 Figure 4 1. Introduction Carbohydrates make up the largest part of the energy supply for the functioning of the human and animal body. They can be divided according to their complexity into polysaccharides, oligosaccharides, disaccharides and monosaccharides, the latter being the only form in which they can be absorbed in the intestine. While fructose has a specific transporter (GLUT5) in the apical brush border membrane (ABM), glucose and galactose compete for binding to the Na(+)/glucose cotransporter 1 (SGLT1), which is p. transport across the brush border of enterocytes, SGLT1 must transport sodium ions from the extracellular to the intracellular medium in favor of its concentration gradient. Therefore, SGLT1 relies on the sodium concentration gradient generated by the Na(+)/K(+)- ATPase pump in the basement membrane of the brush border (BBM) of enterocytes. It is already known that this pump has several subunits, with ATPase 1α ( atp1a1 ) being highlighted by its catalytic activity, which favors the transport of the Na(+)/K(+) pump due to greater energy availability [ 1 ]. Once transported into the intracellular medium, monosaccharides (glucose, galactose and fructose) are transported into the blood by facilitated diffusion via GLUT2 in the BBM [ 2 ]. The relationship between diet and glucose uptake is of great interest as glycemic metabolism disorders and diabetes mellitus are serious problems strongly associated with an increased risk of mortality [ 3 , 4 ]. It has been shown that the expression of SGLT1 can be influenced by a high-carbohydrate diet and is increased in diseases such as type 2 diabetes mellitus and obesity [ 5 ]. In this context, the use of natural products with potential influence on this glucose transporter may be beneficial as an aid in glycemic metabolism disorders. Among others, mushrooms, particularly the species Pleurotus ostreatus , deserve attention due to their significant potential to reduce the risks associated with these chronic diseases and contribute to improved nutritional status [ 6 , 7 ]. However, their mechanisms of action are not yet fully understood, and to date we are not aware of any studies that have directly investigated the influence of mushrooms on intestinal glucose absorption. In this context, the main objective of this study was to evaluate the effect of P. ostreatus extract on glucose uptake by SGLT1. 2. Material and methods The study was conducted in the Laboratory of Cardiovascular Physiology of the Universidade Federal de Pelotas. All experimental procedures performed in this study were in accordance with national and international laws on animal experimentation and all methodological protocols were approved by the Ethics Committee for Animals (CEUA nº 038180/2022-74). 2.1 Pleurotus ostreatus mushroom extract A strain from the collection of Fungi Brasilis - Biguaçu - SC, identified as #90 of P. ostreatus , was used. The Basidioma were cultured in polypropylene bags containing 3 kg of substrate based on Tifton grass, eucalyptus sawdust, wheat bran, gypsum and CaCO3. First, the grass was moistened overnight and then mixed with the other components in a ratio of 60% Tifton, 20% eucalyptus sawdust, 15% wheat bran, 2% CaCO3 and 3% gypsum. The mixture was placed in polypropylene bags and pasteurized for 8 hours at 85°C in a steam chamber. After cooling, 2% inoculum grown on wheat grains was used. The material was incubated at 25°C for 30 days and opened after colonization to harvest the basidiomas at a relative humidity of 70 to 90%. The entire process was carried out at the Colonial Fungi facilities in Pelotas - RS - Brazil. Mushrooms were dried in a dehydrator (Funkitchen®) for 8 hours at 50°C, ground in a mill (Cadence®) and stored at 4°C. Subsequently, 1 g of basidioma was shaken with 10 mL of boiling water (100°C) for 30 minutes. The resulting suspensions were centrifuged at 3220 g for 15 minutes at 4°C to obtain the extract. Subsequently, the biomass was centrifuged for extraction, freeze-dried and separated for use. The use of this mushroom species was duly registered in the National System of Genetic Heritage (SISGEN – A94EAF1). 2.2 P. ostreatus treatment and phlorizin administration Lyophilized Pleurotus ostreatus extract was diluted in distilled water and administered intragastrically (once daily between 14–16 h) at a dose of 2 g/kg/day for three consecutive weeks [ 8 ]. To inhibit the SGLT1 transporter, phlorizin (Sigma, Washington, DC, USA) was administered subcutaneously in a single dose (0.4 g/kg) [ 9 ]. After 4 hours, the final blood glucose tests were performed. 2.3 Animals and experimental groups Thirty-six C57BL/6 mice (males and females weighing 20 g) were housed in plastic cages under standard laboratory conditions (12 h light/dark cycle, 21°C, 70% humidity, water and food ad libitum). Initially, the animals were allocated to administration of mushroom extract ( P. ostreatus n = 24) or sodium chloride 0.9% (CTRL, n = 12) for three weeks. After this period, the animals that had received mushroom extract were divided proportionally into two groups: P. ostreatus (GPO, n = 12 - mice treated daily with P. ostreatus extract (2g/kg)) and P. ostreatus + phlorizin (GPO + phlorizin, n = 12 - mice treated daily with P. ostreatus extract (2g/kg) and administered phlorizin (0.4 g/kg, s.c.) four hours before the glycemic tests) (Fig. 1 ). 2.4 Food intake and body weight analysis The animals in all groups were fed standard rodent chow (Nuvilab®) ad libitum and their food intake was measured weekly based on the difference between the amount of food offered and the food left over. The weight of the animals was also measured weekly using a digital precision scale. 2.5 P. ostreatus influence on blood glucose concentration At the end of the feeding period, mice were fasted for four hours and blood samples were collected via the tail vein to measure blood glucose concentration using a glucometer (AccuChek Active, Roche Diagnostics®, USA), as previously described by Xiong et al. (2018) P. ostreatus (2 g/kg) was then administered via gavage and blood glucose was measured after 30 and 60 minutes [ 7 ]. 2.6 Influence of P. ostreatus on the oral glucose tolerance test (OGTT) After stabilization of blood glucose concentration, animals were given a D-glucose solution (2 g/kg, oral, Sigma) and blood glucose was measured at time points zero, 30, 60 and 120 as previously described by [ 7 ]. 2.7 Euthanasia At the end of the experimental protocols, the animals were anesthetized with isoflurane and euthanized by exsanguination. Subsequently, samples of the intestine (proximal jejunum) were properly cleaned with physiological saline 0.9% and stored in special tubes for RT-qPCR analysis. 2.8 RT-qPCR Total RNA was extracted from samples of the intestine (proximal jejunum) using Trizol (Invitrogen, Brazil) and then treated with DNAse I (Invitrogen, Brazil). Total RNA was analyzed by agarose gel electrophoresis (1%) and quantified using a Qubit fluorometer (Invitrogen, Brazil). cDNA was synthesized from 1 µg of RNA using the High Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Brazil). Gene expression analysis was performed by real-time quantitative PCR (RT-qPCR) using the PowerUP SYBR Green Master Mix Kit (Applied Systems, Brazil) under the following conditions: 50°C for 120s, 95°C for 120s, followed by 40 cycles of 95°C for 15s and 60°C for 60s. The endogenous normalization gene, B-actin, was used to normalize the gene expression analysis. The results obtained were analyzed using the 2-ΔΔCT method [ 10 ]. All steps followed the manufacturer's protocol and the primers used are described in Table 1 . Table 1 – Sequence of primers used in RT-qPCR amplifications. Each primer is listed along with its corresponding sequence read from the 5' to 3' end. Name Sequence - Forward Sequence - Reverse Access number SGLT1 CCAGTGGGCTGTACCAACAT GAGAGTACTGGCGCTGTTGA KT598255.1 GLUT-2 TGTGCTGCTGGATAAATTCGCCTG AACCATGAACCAAGGGATTGGACC NM_031197.2 GLUT-5 TGCTGATCCAGAAGAAAGATGAAG CGTCTTTCCAGCCTCGGA NM_019741.3 ATP1a1 GGGGTTGGACGAGACAAGTAT CGGCTCAAATCTGTTCCGTAT NM_144900.2 B-actin TGACAGGATGCAGAAGGAGA GTACTTGCGCTCAGGAGGA NM_007393.5 SGLT1: Na(+)-glucose cotransporter 1; GLUT-2: glucose transporter 2 ; GLUT-5: glucose transporter 5; ATP1a1: alpha-1 subunit of the Na(+)/K(+) ATPase; B-actin: beta actin protein 2.9 Molecular Docking The search was performed in the Science Direct database for original research articles published in the last ten years (2014–2024) to identify the main compounds present in Pleurotus ostreatus . The descriptors used as a search strategy were: (“ Pleurotus ostreatus ”) AND (“ Pleurotus ostreatus ” AND “ chemical characterization ”). The inclusion criteria were English-language articles that analyzed the mushroom species P. ostreatus and performed chemical characterization of its ethanolic or aqueous extract. Studies that analyzed other mushroom species, examined P. ostreatus in its raw, cooked, or dried form, or did not perform chemical characterization of the ethanolic or aqueous extract were excluded. Seventy-eight articles were selected and fully reviewed. Of these, seventy were excluded and six were used to identify the major compounds: Ephedrine, epicatechin, kaempferol, naringin, resveratrol, and rutin. Molecular docking simulations were performed using AutoDock 4.2.6. The crystal structure of SLGT1 (PDB ID: 7SLA) was obtained from the Protein Data Bank (PDB: https://www.rcsb.org/ ). The cholesterol molecules present in the crystal structure and the nanobody Nb1 were removed using PyMOL, leaving only the protein chain relevant for the interaction with the ligand (chain A). The structure was prepared for docking by removing water molecules, adding non-polar hydrogen atoms, correcting erroneous amino acids and adjusting the charges as required. The ligand structures were taken from PubChem ( https://pubchem.ncbi.nlm.nih.gov/ ) and converted to PDB format using PyMOL version 3.0. The ligands used were Ephedrine (CID: 9294); epicatechin (CID: 72276); kaempferol (CID: 5280863); naringin (CID: 442428); resveratrol (CID: 445154); rutin (CID: 5280805) and glucose (CID: 5793). Molecular docking was performed using the default parameters of AutoDock 4.2.6 (150 individuals in a population, maximum 2,500,000 energy scores and maximum 27,000 generations) with Lamarck's Genetic Algorithm as the search method over 50 runs of the genetic algorithm (GA). The docking grid was defined with the following parameters: Dimensions of 90 × 90 × 100 Å, coordinates of the central grid point of the maps X = 107.183, Y = 103.683, Z = 101.554, and a grid spacing of 0.375 Å. After the docking simulations, the binding energies of the selected compounds were calculated. After completion of the docking simulations, the results were examined and interpreted using the BIOVIA Discovery Studio Visualizer. 2.10 Statistical Data Analysis Statistical analyses were performed using GraphPad Prism software version 8.0, and results were expressed as mean ± standard error of the mean. For weight variation, food intake and blood glucose levels, results were analyzed using ANOVA followed by Bonferroni post hoc test. For the RT-qPCR results, Student's t-test was used, accepting a significance level of 5%. 3. Results 3.1 Food intake and body weight Food intake and body weight did not differ between the groups throughout the experiment (Table 2 ). Table 2 Body weight and food intake of mice treated with P. ostreatus or NaCl (0.9%) for three weeks. Body weight (g) Food intake (g/animal/week) Week CTRL (n = 12) P.ostreatus (n = 24) CTRL (n = 12) P. ostreatus (n = 24) 1st 19 ± 0.25 20 ± 0.08 27 ± 0.33 28 ± 0.38 2nd 19 ± 0.17 20 ± 0.08 27 ± 0.25 28 ± 0.33 3rd 20 ± 0.25 20 ± 0.08 27 ± 0.75 29 ± 0.21 Values expressed as mean ± SEM. CTRL = animals supplemented with 0.9% NaCl. P. ostreatus = animals supplemented with Pleurotus ostreatus (2g/kg/day) for three weeks. 3.2 Influence of P. ostreatus on blood glucose levels The three-week treatment with P. ostreatus had no effect on the fasting blood glucose levels of the animals (Table 3 ). However, when assessing blood glucose levels after acute administration of P. ostreatus extract (GPO), we observed a significant increase in the CTRL and GPO groups (p = 0.02 and p = 0.013, respectively) after 30 minutes, which partially returned to baseline levels after 60 minutes. By inhibiting SGLT1 (GPO + phlorizin group), acute administration of the extract had no effect on blood glucose, which was significantly lower than in the GPO group after 30 (p < 0.0001) and 60 (p = 0.01) minutes (Table 3 ). Table 3 Blood glucose concentration in different time points after P. ostreatus (2 g/kg) oral administration. Time/Groups CTRL GPO GPO + phlorizin Baseline (fasting) 127 ± 12 121 ± 11 116 ± 23 P. ostreatus 30 min 159 ± 6 * 172 ± 22 * 108 ± 9 a P. ostreatus 60 min 148 ± 29 164 ± 20 * 107 ± 28 b Values expressed as mean ± SEM. CTRL = control group; GPO = P.ostreatus group; GPO + Phlorizin = P. ostreatus + phlorizin group. * significantly different from baseline time (p < 0.05); a significantly different from GPO group at 30 minutes (p < 0.0001). b significantly different from GPO group at 60 minutes (p < 0.01). 3.3 Influence of P. ostreatus on the oral glucose tolerance test (OGTT) The blood glucose concentration increased significantly 30 minutes after administration of D-glucose (2 g/kg, oral) in all groups, although this increase was more pronounced in the GPO group (Fig. 2 a). Thereafter, the blood glucose concentration decreased significantly in all groups up to 60 minutes, while it continued to decrease in the CTRL and GPO groups up to 120 minutes. The GPO + phlorizin group showed significantly lower blood glucose levels compared to the other experimental groups throughout the OGTT, which converged again after 120 minutes (Fig. 2 a). Figure 2 b shows the glycemic fluctuations of the OGTT based on the area under the curve. It can be observed that these were greater in the GPO group than in the CTRL group and were significantly reduced when SGLT1 was inhibited (GPO + phlorizin group). 3.4 RT-qPCR The expression levels of the genes sglt1 , atp1a1 , glut2 and glut5 were analyzed in the group treated with P. ostreatus mushroom extract (2g/kg) compared to the control group (Fig. 3 ). Treatment with the extract increased the expression of the atp1a1 gene by 97% compared to the CTRL group, but did not alter the expression of the sglt1 , glut2 and glut5 genes. 3.5 Molecular Docking To this end, the most important compounds contained in the P. ostreatus extract were first identified on the basis of the literature. Six predominant compounds were selected (ephedrine, epicatechin, kaempferol, naringin, resveratrol and rutin), and glucose was used as a positive control. The binding energies of the selected compounds for SGLT1 are summarized in Table 4 . Among the compounds tested, naringin showed the strongest binding affinity with a binding energy of -11.54 kcal/mol. Rutin also showed a strong affinity with a binding energy of -11.36 kcal/mol and glucose, which was used as a control compound, showed a binding energy of -8.44 kcal/mol. Other compounds such as kaempferol, resveratrol and epicatechin showed moderate binding energies between − 9.10 and − 9.67 kcal/mol. Ephedrine showed the weakest binding with a binding energy of -7.57 kcal/mol. Conventional hydrogen bonding analysis (Fig. 4 ) showed that naringin, rutin and kaempferol may share the same residues (such as SER396, GLN299, ARG300, ALA303, SER396 and ASN399). Resveratrol and epicatechin, on the other hand, interacted with residues SER76 and SER396 via conventional hydrogen bonds. The only major compound that interacted at the same site as glucose was ephedrine, which interacted with residues GLN457 and SER460. Table 4 Binding energies, inhibition constants, and conventional hydrogen bond interactions of compounds with SGLT1 (Sodium-Glucose Cotransporter 1) obtained through molecular docking analysis Compound PubChem CID Binding Energy (kcal/mol) Conventional Hydrogen Bonds Naringin 442428 -11.54 LEU197, GLN299, SER396, ASN399 Rutin 5280805 -11.36 ARG300, ALA303, SER396, SER400 Kaempferol 5280863 -9.67 PRO69, GLN299, ARG300, ALA303, SER396, ASN399 Epicatechin 72276 -9.19 SER73, VAL200, ARG300, SER396 Resveratrol 445154 -9.10 SER73, ASN78, SER392, SER396 Ephedrine 9294 -7.57 GLN457, SER460 Glucose 5793 -8.44 ASN78, GLN457, SER460 4. Discussion and conclusion The main finding of this study was the first demonstration that supplementation with P. ostreatus mushroom extract (2g/kg/day) for three weeks increases glucose absorption capacity via SGLT1 in the first part of the intestine in C57BL/6 mice by increasing the expression of the atp1a1 gene. Mushrooms have long been cultivated for culinary and medicinal use due to their low caloric content and bioactive compounds with significant therapeutic potential for various diseases [ 11 , 12 ]. However, the composition of these mushrooms is directly influenced by environmental factors and the substrate on which they are grown, which can lead to significant differences within the same species [ 13 ]. In this context, the carbohydrate content can vary between 24 and 75%, with polysaccharides being the most abundant [ 13 ]. Among other benefits, mushrooms are often used to control blood glucose levels, particularly in pathological conditions such as diabetes and insulin resistance [ 14 – 17 ]. Wińska et al. (2019) have shown that the mushroom Ganoderma lucidum has a promising blood glucose-lowering effect by inhibiting apoptosis of pancreatic β-cells and reducing intracellular signaling associated with insulin resistance and the deposition of harmful fat in diabetic rats [ 18 ]. There is evidence that mushrooms increase insulin sensitivity by stimulating the secretion of this pancreatic hormone as well as the translocation/expression of GLUTs into the membrane of various cells [ 6 , 14 ]. On the other hand, their influence on the intestinal absorption of saccharides has not been fully characterized and is of paramount importance for nutritional prescription support and adjuvant treatments. In this context, our study is innovative as it also evaluates the direct impact of acute administration of a mushroom extract on some of these parameters. After a three-week administration of the extract, we found no differences in fasting blood glucose concentrations, suggesting that supplementation with P. ostreatus did not affect blood glucose regulation over time. Although the level of saccharides in the extract was not directly measured in this study, the increase in blood glucose levels following acute administration of P. ostreatus in the CTRL and GPO groups appears to be due in part to the presence of saccharides in its composition. In addition, the blood glucose concentration remained elevated in the GPO group 60 minutes after P. ostreatus administration, while it was significantly decreased in the CTRL group. These results are reinforced by the blood glucose curve of the animals that received phlorizin to inhibit SGLT1. The blood glucose concentration in the GPO + phlorizin group was significantly lower compared to the other groups, indirectly demonstrating the presence of glucose in the composition of the extract and suggesting that the P. ostreatus extract had no effect on gluconeogenesis and glycogenolysis under the conditions tested in this study. Our results are consistent with the findings of Hikino et al. (1985), who showed the influence of peptidoglycans isolated from the mushroom G. lucidum on the glycemic metabolism of mice [ 19 ]. When we also investigated whether the mushroom extract could influence the OGTT, a greater increase in blood glucose concentration was observed in the GPO group compared to the other groups after 30 minutes. Among other factors, we cannot exclude a greater glucose absorption capacity in the animals exposed to P. ostreatus extract for three weeks (GPO group). It has been shown that greater exposure of the ABM to saccharides can increase glucose uptake capacity by stimulating gene and protein expression of SGLT1 [ 20 ]. In addition, this exposure may also increase the expression of GLUT2, both in the BBM, where it exerts the known effect of facilitating the absorption of monosaccharides, and in the ABM, where it enhances glucose absorption via an alternative pathway to SGLT1 [ 21 ]. However, in the present study, we did not differentially analyze the gene expression of GLUT2 in BBM and ABM. Despite the similarity in gene expression of this glucose transporter between the groups, we cannot exclude the possibility that it was different between the two intestinal membranes. In addition, it is worth noting that phlorizin acts specifically by inhibiting SGLT1 and has no direct effect on the GLUTs [ 22 ]. To investigate the hypothesis that the P. ostreatus extract could modulate the activity of SGLT1, a molecular docking analysis was performed using six selected major compounds. To validate the docking approach, the interaction between SGLT1 and glucose was first predicted. This revealed a high affinity for residues ASN78, GLN457 and SER460, amino acids previously identified as core components of the glucose binding site in SGLT1. Among the major compounds, naringin and rutin showed the strongest binding affinity, with values higher than those for glucose. The docking results also indicated that the components of the extract may interact with key functional residues of SGLT1. In particular, binding to SER396, a residue involved in sodium coordination, was observed [ 23 ]. Since sodium binding is crucial for the conformational change required to initiate glucose transport Loo et al., 2013, it is conceivable that these compounds influence transporter activity by mimicking or enhancing sodium interactions [ 24 ]. Such an effect could potentially facilitate glucose cotransport, which could explain the experimentally observed increase in glucose uptake despite unchanged gene expression of SGLT1. At the same time, repeated exposure to P. ostreatus for three weeks stimulated greater gene expression of the main subunit of ATPases that performs a catalytic action to provide energy for the Na(+)/K(+) pump in the BBM of enterocytes. Since the Na+-glucose symport promoted by SGLT1 in the ABM depends on the concentration gradient of this cation between the intracellular and extracellular milieu, the P. ostreatus extract may have favored greater glucose uptake by SGLT1 by stimulating the Na(+)/K(+)- ATPase. Similarly, the persistence of elevated blood glucose concentration 60 min after P. ostreatus administration or the highest glycemic peak of the GPO group in the OGTT seems to be related to a higher capacity of glucose transport, which was promoted by the increase in gene expression of atp1a1 . On the other hand, glycemia at the 120-min OGTT and basal blood glucose levels in the fasting state did not differ between the experimental groups, suggesting that blood glucose metabolism was not affected by P. ostreatus supplementation. Our study is groundbreaking as it demonstrates the influence of SGLT1 on the absorption of glucose contained in the mushroom Pleurotus ostreatus and the role of this mushroom on SGLT1. Repeated exposure to a P. ostreatus extract sensitized SGLT1 by stimulating greater gene expression of atp1a1 , the catalytic subunit of Na(+)/K(+)-ATPase. Although it promoted an increase in blood glucose levels, blood glucose metabolism does not appear to have been affected by P. ostreatus supplementation. However, it is important to emphasize that we used healthy animals in the present study, and it is important to evaluate these influences in models with insulin resistance. 5. Limitations Our study has limitations as the selective inhibition of Na(+)/K(+)-ATPase was not evaluated, Na(+) levels between the intracellular and extracellular environment of enterocytes were not measured and the influence of the extract on the fructose transporter was not evaluated. Declarations Funding This work was supported by the Fundação Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES), a Brazilian financial support agency. Competing interest: The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper. CRediT authorship contribution statement: P.C.S. and P.Q.C. Conceptualization; P.C.S. and P.Q.C. Data curation; P.C.S. Formal analysis; P.C.S. Funding acquisition; P.C.S. and P.Q.C. Investigation; P.Q.C., K.M.M.S., T.K.S., F.D.T.M., and S.A.R.M.J. Methodology; P.C.S. Project administration; A.A.B., M.C. Resources; P.C.S., P.Q.C., and D.V.A. Roles/Writing - original draft; and Writing - review & editing. Ethics statement The research does not involve human study, and does not declare ethics. Data availability No data was used for the research described in the article. References Palaniappan B, Arthur S, Sundaram V, Butts M, Sundaram S, Mani K, Singh S, Nepal N, Sundaram U (2019) Inhibition of intestinal villus cell na/k-atpase mediates altered glucose and nacl absorption in obesity-associated diabetes and hypertension. Faseb j 33(8):9323–9333 Satoh T, Igarashi M, Yamada S, Takahashi N, Watanabe K (2015) Inhibitory effect of black tea and its combination with acarbose on small intestinal α-glucosidase activity. J Ethnopharmacol 161:147–155 Mota-ramírez LD, Escobar C (2023) Postweaning cafeteria diet induces a short-term metabolic disfunction and a differential vulnerability to develop anxiety-like and depressive-like behaviors in male but not female rats. Dev psychobiol 65(4):22392 Azeez OH, Alkass SY, Persike DS (2019) Long-term saccharin consumption and increased risk of obesity, diabetes, hepatic dysfunction, and renal impairment in rats. Med (kaunas) 55(10):681 Stearns AT, Balakrishnan A, Rhoads DB, Tavakkolizadeh A (2010) Rapid upregulation of sodium-glucose transporter sglt1 in response to intestinal sweet taste stimulation. Ann Surg 251(5):865–871 Zhang Y, Hu T, Zhou H, Zhang Y, Jin G, Yang Y (2016) Antidiabetic effect of polysaccharides from pleurotus ostreatus in streptozotocin-induced diabetic rats. Int J Biol Macromol 83:126–132 Xiong M, Huang Y, Liu Y, Huang M, Song G, Ming Q, Xinhua Ma, Yang J, Deng S, Wen Y, Shen J, Liu QH, Zhao P, Yang X (2018) Antidiabetic activity of ergosterol from pleurotus ostreatus in kk-a y mice with spontaneous type 2 diabetes mellitus. Mol Nutr Food Res 62(3):1700444 Da Costa PQ, Paim MP, Dos Reis EE, Turck P, Camassola M, Schenkel PC (2021) Beneficial effects of pleurotus albidus supplementation on body weight and food intake in healthy c57bl/6 mice. J future foods 1(1):98–103 Freitas HS, Beatriz DAS, Robinson S, Maristela MO, Maria S, Ubiratan FM (2007) Insulin but not phlorizin treatment induces a transient increase in glut2 gene expression in the kidney of diabetic rats. Nephron Physiol 105(3):42–p51 Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 4:402–408 Chang ST, Wasser SP (2018) Current and future research trends in agricultural and biomedical applications of medicinal mushrooms and mushroom products (review). Int J Med mushrooms 20(12):1121–1133 Campelo MS, Neto JFC, Magalhães HCR, Filho EGA, Zocolo GJ, Leal LMAM, Ribeiro MENP (2024) GC/MS and 2D NMR-based approach to evaluate the chemical profile of hydroalcoholic extract from Agaricus blazei Murill and its anti-inflammatory effect on human neutrophils. J Ethnopharmacol 322:117676 Venturella G, Ferraro V, Cirlincione F, Gargano M (2021) Cogumelos medicinais: compostos bioativos, uso e ensaios clínicos. revista Int de ciências moleculares Mdpi ag 22(2):634 Kanagasabapathy G, Kuppusamy UR, Malek SNA, Abdulla MA, Chua KH, Sabaratnam V (2012) Glucan-rich polysaccharides from pleurotus sajor-caju (fr.) singer prevents glucose intolerance, insulin resistance and inflammation in c57bl/6j mice fed a high-fat diet. BMC complement altern med 12:261 Liu X, Luo D, Guan J, Chen J, Xu X (2022) Mushroom polysaccharides with potential in anti-diabetes: biological mechanisms, extraction, and future perspectives: a review. Frontiers nutrition , 9,1087826 Dubey SK, Chaturvedi VK, Mishra D, Bajpeyee A, Tiwari A, Singh MP (2019) Role of edible mushroom as potent therapeutics for the diabetes and obesity. 3 biotech , 9 (12), 450 Xiao C, Wu Q, Zhang J, Xie Y, Cai W, Tan J (2017) Antidiabetic activity of Ganoderma lucidum polysaccharides F31 down-regulated hepatic glucose regulatory enzymes in diabetic mice. J Ethnopharmacol 196:47–57 Wińska K, Mączka W, Gabryelska K, Grabarczyk M (2019) Mushrooms of the genus ganoderma used to treat diabetes and insulin resistance. Molecules 24(22):4075 Hikino H, Konno C, Mirin Y, Hayashi T (1985) Isolation and hypoglycemic activity of ganoderans a and b, glycans of ganoderma lucidum fruit bodies. Planta med 51:339–340 Nishimura K, Fujita Y, Ida S, Yanagimachi T, Ohashi N, Nishi K, Nishida A, Iwasaki Y, Morino K, Ugi S, Nishi E, Andoh A, Maegawa H (2022) Glycaemia and body weight are regulated by sodium-glucose cotransporter 1 (sglt1) expression via o-glcnacylation in the intestine. Mol metab 59:101458 Araújo J, Martel F (2009) Regulação da absorção intestinal de glicose: uma breve revisão. Arquivos de Med 23:35–43 Ehrenkranz JRL, Norman GL, Kahn CR, Jesse R (2015) Phlorizin: a review. Diabetes/metabolism research and reviews. Curr Opin 21(1):31–38 Bisignano P, Ghezzi C, Jo H, Polizzi NF, Althoff T, Kalyanaraman C, Friemann R, Jacobson MP, Wrigh EM, Grabe M (2018) Inhibitor binding mode and allosteric regulation of Na + -glucose symporters. Nat Communication 9:5245 Loo DDF, Jiang X, Gorraitz E, Hirayama BA, Wright EM (2013) Functional identification and characterization of sodium binding sites in Na symporters. Proc. Natl. Acad. Sci. U.S.A,. 110 (47) E4557-E456 Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7772923","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":531261110,"identity":"b10158ea-f4c8-4547-8b71-49f38945373e","order_by":0,"name":"Paola Quevedo Da Costa","email":"","orcid":"","institution":"Universidade Federal de Pelotas","correspondingAuthor":false,"prefix":"","firstName":"Paola","middleName":"Quevedo Da","lastName":"Costa","suffix":""},{"id":531261112,"identity":"28a9cc25-aef6-4c7b-8334-3548c9e1e0a4","order_by":1,"name":"Karen Martirena Monks Da Silva","email":"","orcid":"","institution":"Universidade Federal de Pelotas","correspondingAuthor":false,"prefix":"","firstName":"Karen","middleName":"Martirena Monks Da","lastName":"Silva","suffix":""},{"id":531261113,"identity":"0f56688a-ae96-4d6b-8218-c37ffbbb2b76","order_by":2,"name":"Tais Kopp Silveira","email":"","orcid":"","institution":"Universidade Federal de Pelotas","correspondingAuthor":false,"prefix":"","firstName":"Tais","middleName":"Kopp","lastName":"Silveira","suffix":""},{"id":531261114,"identity":"3ea6626d-a46f-4304-af47-710fe118bc08","order_by":3,"name":"Fernando Diógenes Teixeira Meyer","email":"","orcid":"","institution":"Universidade Federal de Pelotas","correspondingAuthor":false,"prefix":"","firstName":"Fernando","middleName":"Diógenes Teixeira","lastName":"Meyer","suffix":""},{"id":531261115,"identity":"96ad91cb-8758-45cf-bc39-b7fae5cabba3","order_by":4,"name":"Sérgio Alberto Razera Matos Júnior","email":"","orcid":"","institution":"Universidade Federal de Pelotas","correspondingAuthor":false,"prefix":"","firstName":"Sérgio","middleName":"Alberto Razera Matos","lastName":"Júnior","suffix":""},{"id":531261116,"identity":"4e36cbf1-82af-48f5-bca3-ff58aeb01480","order_by":5,"name":"Alexandre Antunes Brum","email":"","orcid":"","institution":"Universidade Federal de Pelotas","correspondingAuthor":false,"prefix":"","firstName":"Alexandre","middleName":"Antunes","lastName":"Brum","suffix":""},{"id":531261117,"identity":"84865d39-5de9-4df0-8205-ee3a3ba9e443","order_by":6,"name":"Marli Camassola","email":"","orcid":"","institution":"University of Caxias Do Sul","correspondingAuthor":false,"prefix":"","firstName":"Marli","middleName":"","lastName":"Camassola","suffix":""},{"id":531261118,"identity":"3dac40ff-5790-4ceb-a4d5-e5e3fbbee340","order_by":7,"name":"Daniela Volcan Almeida","email":"","orcid":"","institution":"Universidade Federal de Pelotas","correspondingAuthor":false,"prefix":"","firstName":"Daniela","middleName":"Volcan","lastName":"Almeida","suffix":""},{"id":531261119,"identity":"bdc3828c-a6d4-458a-87c8-5ee43df3f3a9","order_by":8,"name":"Paulo Cavalheiro Schenkel","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABIElEQVRIie2RMUvDQBTHXyjU5YHrwV31K0QCUWjpZ7kjkCxBBZcMDoFCukRc+zX8BD4JxOXUNdAlIjgHBBeheim0OCQVN8H7wcG7gx/33vsDWCx/EjSHQKzrGiawl4JDAAMAtlvBdS0hBKT2/gul+Fk5nD/cvZzrCQKfvTKZPKmcz4ggGauUX9VdiqtPA29RhQii9JnUS5WLUhLoSKXi3u1UGPocmwKBSZ+pbKluWeySkxUqZWF3Yws8/sDm0yjRu1EeVc7OGnJW/QpU6A+wIqPE7S9klBjISfsVV8ceRx3gUOiLE6kDz8zikiwjLxNlz8b00RuW04N9Pr+pmmQ6Mht7rpvL8eiaZ92NbRhuU2gL2b7sFuBbcL2hWywWy3/lC7ymYZ+/eUYeAAAAAElFTkSuQmCC","orcid":"","institution":"Universidade Federal de Pelotas","correspondingAuthor":true,"prefix":"","firstName":"Paulo","middleName":"Cavalheiro","lastName":"Schenkel","suffix":""}],"badges":[],"createdAt":"2025-10-03 11:08:34","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7772923/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7772923/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":93919692,"identity":"09778bfe-cf82-4534-953a-d7d2805be53b","added_by":"auto","created_at":"2025-10-20 09:28:03","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":62008,"visible":true,"origin":"","legend":"","description":"","filename":"Manuscript.docx","url":"https://assets-eu.researchsquare.com/files/rs-7772923/v1/83fd48ae8f7aa5f4894867ed.docx"},{"id":93920191,"identity":"8d88fd9d-5528-4616-ad43-a777eb63e5af","added_by":"auto","created_at":"2025-10-20 09:36:04","extension":"jpg","order_by":1,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1461548,"visible":true,"origin":"","legend":"","description":"","filename":"Fig1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7772923/v1/0f41a114330753109fac542c.jpg"},{"id":93919698,"identity":"2837818e-3dce-41a1-bb9f-5bc2a20dacae","added_by":"auto","created_at":"2025-10-20 09:28:04","extension":"tif","order_by":2,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":980568,"visible":true,"origin":"","legend":"","description":"","filename":"Fig2.tif","url":"https://assets-eu.researchsquare.com/files/rs-7772923/v1/42ee06d26da69898648d6e29.tif"},{"id":93919699,"identity":"6568773a-6145-460d-8bf4-7d4b92f0ce1f","added_by":"auto","created_at":"2025-10-20 09:28:04","extension":"tif","order_by":3,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1498874,"visible":true,"origin":"","legend":"","description":"","filename":"Fig3.tif","url":"https://assets-eu.researchsquare.com/files/rs-7772923/v1/153a3e4ce0153aee663bf63b.tif"},{"id":93919711,"identity":"12e81c08-d90a-4a53-821b-50ebc452e71d","added_by":"auto","created_at":"2025-10-20 09:28:04","extension":"tiff","order_by":4,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":19055356,"visible":true,"origin":"","legend":"","description":"","filename":"Fig4.tiff","url":"https://assets-eu.researchsquare.com/files/rs-7772923/v1/26c305523264bb9aa76e1b2d.tiff"},{"id":93919695,"identity":"aa673676-047d-463c-95d9-1bea15306240","added_by":"auto","created_at":"2025-10-20 09:28:04","extension":"jpg","order_by":5,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":69440,"visible":true,"origin":"","legend":"","description":"","filename":"Graphicalabstract.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7772923/v1/8275de0e8f1e85a6b94db37a.jpg"},{"id":93920195,"identity":"e5ffc968-b513-4c46-be6f-866be0c3861d","added_by":"auto","created_at":"2025-10-20 09:36:04","extension":"json","order_by":6,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":9539,"visible":true,"origin":"","legend":"","description":"","filename":"4d2a5fe0708843b0b3c7168b4a1d9f3f.json","url":"https://assets-eu.researchsquare.com/files/rs-7772923/v1/e54e110d794de5da16808c7d.json"},{"id":93919702,"identity":"a3076df0-3c70-4352-98b4-0327b343044f","added_by":"auto","created_at":"2025-10-20 09:28:04","extension":"xml","order_by":7,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":93956,"visible":true,"origin":"","legend":"","description":"","filename":"4d2a5fe0708843b0b3c7168b4a1d9f3f1enriched.xml","url":"https://assets-eu.researchsquare.com/files/rs-7772923/v1/3e814bd644b9564a95073984.xml"},{"id":93921318,"identity":"d898657c-c8af-46b2-a301-af5112c78edc","added_by":"auto","created_at":"2025-10-20 09:44:04","extension":"jpg","order_by":8,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1461548,"visible":true,"origin":"","legend":"","description":"","filename":"Fig1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7772923/v1/2d286b913aa4c5b4b45cbcf9.jpg"},{"id":93920194,"identity":"f2f41f29-6e52-48ad-a9df-b1e393b345dc","added_by":"auto","created_at":"2025-10-20 09:36:04","extension":"tif","order_by":9,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":980568,"visible":true,"origin":"","legend":"","description":"","filename":"Fig2.tif","url":"https://assets-eu.researchsquare.com/files/rs-7772923/v1/46cf20a66a11b452baea9eb5.tif"},{"id":93919714,"identity":"802e6111-0984-4b13-b9ea-5427a2373fa4","added_by":"auto","created_at":"2025-10-20 09:28:04","extension":"tif","order_by":10,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1498874,"visible":true,"origin":"","legend":"","description":"","filename":"Fig3.tif","url":"https://assets-eu.researchsquare.com/files/rs-7772923/v1/62adfd3ff15039b50ddcc8b7.tif"},{"id":93919716,"identity":"502378a0-b70e-4be2-9507-5048835ccc70","added_by":"auto","created_at":"2025-10-20 09:28:04","extension":"tiff","order_by":11,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":19055356,"visible":true,"origin":"","legend":"","description":"","filename":"Fig4.tiff","url":"https://assets-eu.researchsquare.com/files/rs-7772923/v1/aa26e86a9c2a13ffc424e998.tiff"},{"id":93920196,"identity":"398b5c4e-cf4c-480d-8f2d-61b5d54ec545","added_by":"auto","created_at":"2025-10-20 09:36:04","extension":"jpg","order_by":12,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":69440,"visible":true,"origin":"","legend":"","description":"","filename":"Graphicalabstract.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7772923/v1/b2834d7e7ae606c2dc26d7c4.jpg"},{"id":93919712,"identity":"aec5a592-d4e5-4ae9-9a6e-3b826472e42d","added_by":"auto","created_at":"2025-10-20 09:28:04","extension":"png","order_by":13,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":451060,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFig1.png","url":"https://assets-eu.researchsquare.com/files/rs-7772923/v1/3cea4f9d79e3644dfa7a2e33.png"},{"id":93919708,"identity":"0609b529-773a-443f-86ae-92baa8135998","added_by":"auto","created_at":"2025-10-20 09:28:04","extension":"png","order_by":14,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":160118,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFig2.png","url":"https://assets-eu.researchsquare.com/files/rs-7772923/v1/6bfced5ccb72a492d6a17811.png"},{"id":93919710,"identity":"ab03cdc1-24b3-459f-88df-432b46f400b2","added_by":"auto","created_at":"2025-10-20 09:28:04","extension":"png","order_by":15,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":183600,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFig3.png","url":"https://assets-eu.researchsquare.com/files/rs-7772923/v1/f37f75366a6cae48dcde4c45.png"},{"id":93920197,"identity":"ba8bf3e5-4f69-460c-8fe4-647fbf4a1156","added_by":"auto","created_at":"2025-10-20 09:36:04","extension":"png","order_by":16,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":141483,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFig4.png","url":"https://assets-eu.researchsquare.com/files/rs-7772923/v1/2b49f26d97b42a58f577338d.png"},{"id":93919706,"identity":"f39bc3d0-75b7-48e1-b4db-22318eed3aa8","added_by":"auto","created_at":"2025-10-20 09:28:04","extension":"png","order_by":17,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":38374,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineGraphicalabstract.png","url":"https://assets-eu.researchsquare.com/files/rs-7772923/v1/532cbf45cb3520410060cf14.png"},{"id":93919709,"identity":"a506adb2-4a01-479d-b912-eb643fb5b3f8","added_by":"auto","created_at":"2025-10-20 09:28:04","extension":"xml","order_by":18,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":92301,"visible":true,"origin":"","legend":"","description":"","filename":"4d2a5fe0708843b0b3c7168b4a1d9f3f1structuring.xml","url":"https://assets-eu.researchsquare.com/files/rs-7772923/v1/53f3e5e4692b9ab093ad30e1.xml"},{"id":93919713,"identity":"cb352a12-3661-4dcc-a5d8-c727113ce18c","added_by":"auto","created_at":"2025-10-20 09:28:04","extension":"html","order_by":19,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":101946,"visible":true,"origin":"","legend":"","description":"","filename":"earlyproof.html","url":"https://assets-eu.researchsquare.com/files/rs-7772923/v1/d19d208bff4c5fe9ca2b131a.html"},{"id":93919693,"identity":"81af5f72-76fb-425f-96e0-8d7e659190fa","added_by":"auto","created_at":"2025-10-20 09:28:03","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":1461548,"visible":true,"origin":"","legend":"\u003cp\u003eExperimental design and groups.\u003c/p\u003e\n\u003cp\u003eNaCl = sodium chloride; \u003cem\u003eP. ostreatus\u003c/em\u003e = \u003cem\u003ePleurotus ostreatus\u003c/em\u003e extract; CTRL= control group (mice supplemented daily with NaCl 0.9% by gavage); GPO= \u003cem\u003eP.ostreatus \u003c/em\u003egroup (mice supplemented daily with \u003cem\u003eP. ostreatus \u003c/em\u003eextract (2g/kg)\u003cstrong\u003e \u003c/strong\u003eby gavage); GPO+Phlorizin= \u003cem\u003eP. ostreatus\u003c/em\u003e + Phlorizin group (mice supplemented daily with \u003cem\u003eP. ostreatus \u003c/em\u003eextract (2g/kg) and subjected to administration of Phlorizin (0.4 g/kg, s.c.))\u003c/p\u003e","description":"","filename":"Fig1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7772923/v1/0422384f8a554eb7850a1042.jpg"},{"id":93919694,"identity":"d79ed3e7-0499-415d-ad64-6b55c871f579","added_by":"auto","created_at":"2025-10-20 09:28:04","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":332774,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ea.\u003c/strong\u003e \u003cem\u003ePleurotus ostreatus\u003c/em\u003e influence on the oral glucose tolerance test (OGTT). \u003cstrong\u003eb. \u003c/strong\u003eArea under the curve of the blood glucose concentration\u003c/p\u003e\n\u003cp\u003eCTRL= control group; GPO= \u003cem\u003eP.ostreatus \u003c/em\u003egroup; GPO+Phlorizin= \u003cem\u003eP. ostreatus\u003c/em\u003e + Phlorizin group.\u003c/p\u003e\n\u003cp\u003ea – significantly different from the same group in the baseline time (P\u0026lt;0.0001);\u003c/p\u003e\n\u003cp\u003eb - significantly different from the same group at 30 minutes (P\u0026lt;0.0001);\u003c/p\u003e\n\u003cp\u003ec - significantly different from the same group at 60 minutes (P\u0026lt;0.05);\u003c/p\u003e\n\u003cp\u003e* - significantly different from the CTRL and GPO groups (P\u0026lt;0.0001);\u003c/p\u003e\n\u003cp\u003e# - significantly different from the CTRL group (P\u0026lt;0.0001);\u003c/p\u003e\n\u003cp\u003e@ - significantly different from the GPO group (P\u0026lt;0.0001).\u003c/p\u003e","description":"","filename":"Fig2.png","url":"https://assets-eu.researchsquare.com/files/rs-7772923/v1/963f201c38906f511ab7b3bb.png"},{"id":93920192,"identity":"e786dc76-9881-44a8-bfa2-c269471a2995","added_by":"auto","created_at":"2025-10-20 09:36:04","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":403844,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003ePleurotus ostreatus\u003c/em\u003e influence on the expression of genes related with glucose absorption in the intestine. Relative expression of (A) \u003cem\u003eSglt1 \u003c/em\u003e(Na(+)-glucose cotransporter 1), (B) \u003cem\u003eAtp1a1 \u003c/em\u003e(alpha-1 subunit of the Na(+)/K(+)-ATPase), (C) \u003cem\u003eGlut2 \u003c/em\u003e(glucose transporter 2), and (D)\u003cem\u003e Glut5 \u003c/em\u003e(glucose transporter 5) in proximal intestine. The β-actin gene was employed for endogenous normalization. \u0026nbsp;Control (CTRL, n=3) and \u003cem\u003ePleurotus ostreatus\u003c/em\u003e (\u003cem\u003eP. ostreatus\u003c/em\u003e, n=3) groups\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e*\u003c/strong\u003e significantly difference from CTRL group (p\u0026lt;0.05)\u003c/p\u003e","description":"","filename":"Fig3.png","url":"https://assets-eu.researchsquare.com/files/rs-7772923/v1/b79bc8b1cfb0ba7302acd02e.png"},{"id":93919705,"identity":"9ba5fff4-aae9-47c9-9bba-67cf77c39306","added_by":"auto","created_at":"2025-10-20 09:28:04","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":865216,"visible":true,"origin":"","legend":"\u003cp\u003eMolecular docking interactions between different compounds and the glucose transporter protein SGLT1. Two-dimensional interaction diagrams of each ligand with SGLT1, depicting the residues involved in van der Waals interactions (light green), conventional hydrogen bonds (green), carbon hydrogen bonds (gray), and other interactions such as Pi-Alkyl (pink) and Pi-Sigma (purple)\u003c/p\u003e","description":"","filename":"Fig4.png","url":"https://assets-eu.researchsquare.com/files/rs-7772923/v1/b16385f3fde89bc6de3028ef.png"},{"id":95657440,"identity":"88e9f4e4-a7c2-4035-9072-2fa23d0339b9","added_by":"auto","created_at":"2025-11-11 16:20:53","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":3782621,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7772923/v1/e0a5d527-35dc-4663-a022-d83ac61075fa.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"\u003cp\u003ePleurotus ostreatus modulates the intestinal glucose absorption by the Na(+)/glucose cotransporter 1 (SGLT1) in C57BL/6 mice \u003c/p\u003e","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eCarbohydrates make up the largest part of the energy supply for the functioning of the human and animal body. They can be divided according to their complexity into polysaccharides, oligosaccharides, disaccharides and monosaccharides, the latter being the only form in which they can be absorbed in the intestine. While fructose has a specific transporter (GLUT5) in the apical brush border membrane (ABM), glucose and galactose compete for binding to the Na(+)/glucose cotransporter 1 (SGLT1), which is p. transport across the brush border of enterocytes, SGLT1 must transport sodium ions from the extracellular to the intracellular medium in favor of its concentration gradient. Therefore, SGLT1 relies on the sodium concentration gradient generated by the Na(+)/K(+)- ATPase pump in the basement membrane of the brush border (BBM) of enterocytes. It is already known that this pump has several subunits, with ATPase 1α (\u003cem\u003eatp1a1\u003c/em\u003e) being highlighted by its catalytic activity, which favors the transport of the Na(+)/K(+) pump due to greater energy availability [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. Once transported into the intracellular medium, monosaccharides (glucose, galactose and fructose) are transported into the blood by facilitated diffusion via GLUT2 in the BBM [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. The relationship between diet and glucose uptake is of great interest as glycemic metabolism disorders and diabetes mellitus are serious problems strongly associated with an increased risk of mortality [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. It has been shown that the expression of SGLT1 can be influenced by a high-carbohydrate diet and is increased in diseases such as type 2 diabetes mellitus and obesity [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. In this context, the use of natural products with potential influence on this glucose transporter may be beneficial as an aid in glycemic metabolism disorders. Among others, mushrooms, particularly the species \u003cem\u003ePleurotus ostreatus\u003c/em\u003e, deserve attention due to their significant potential to reduce the risks associated with these chronic diseases and contribute to improved nutritional status [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e, \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. However, their mechanisms of action are not yet fully understood, and to date we are not aware of any studies that have directly investigated the influence of mushrooms on intestinal glucose absorption.\u003c/p\u003e\u003cp\u003eIn this context, the main objective of this study was to evaluate the effect of \u003cem\u003eP. ostreatus\u003c/em\u003e extract on glucose uptake by SGLT1.\u003c/p\u003e"},{"header":"2. Material and methods","content":"\u003cp\u003eThe study was conducted in the Laboratory of Cardiovascular Physiology of the Universidade Federal de Pelotas. All experimental procedures performed in this study were in accordance with national and international laws on animal experimentation and all methodological protocols were approved by the Ethics Committee for Animals (CEUA n\u0026ordm; 038180/2022-74).\u003c/p\u003e\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\u003ch2\u003e2.1 \u003cem\u003ePleurotus ostreatus\u003c/em\u003e mushroom extract\u003c/h2\u003e\u003cp\u003eA strain from the collection of Fungi Brasilis - Bigua\u0026ccedil;u - SC, identified as #90 of \u003cem\u003eP. ostreatus\u003c/em\u003e, was used. The Basidioma were cultured in polypropylene bags containing 3 kg of substrate based on Tifton grass, eucalyptus sawdust, wheat bran, gypsum and CaCO3. First, the grass was moistened overnight and then mixed with the other components in a ratio of 60% Tifton, 20% eucalyptus sawdust, 15% wheat bran, 2% CaCO3 and 3% gypsum. The mixture was placed in polypropylene bags and pasteurized for 8 hours at 85\u0026deg;C in a steam chamber. After cooling, 2% inoculum grown on wheat grains was used. The material was incubated at 25\u0026deg;C for 30 days and opened after colonization to harvest the basidiomas at a relative humidity of 70 to 90%. The entire process was carried out at the Colonial Fungi facilities in Pelotas - RS - Brazil.\u003c/p\u003e\u003cp\u003eMushrooms were dried in a dehydrator (Funkitchen\u0026reg;) for 8 hours at 50\u0026deg;C, ground in a mill (Cadence\u0026reg;) and stored at 4\u0026deg;C. Subsequently, 1 g of basidioma was shaken with 10 mL of boiling water (100\u0026deg;C) for 30 minutes. The resulting suspensions were centrifuged at 3220 g for 15 minutes at 4\u0026deg;C to obtain the extract. Subsequently, the biomass was centrifuged for extraction, freeze-dried and separated for use. The use of this mushroom species was duly registered in the National System of Genetic Heritage (SISGEN \u0026ndash; A94EAF1).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec4\" class=\"Section2\"\u003e\u003ch2\u003e2.2 \u003cem\u003eP. ostreatus\u003c/em\u003e treatment and phlorizin administration\u003c/h2\u003e\u003cp\u003eLyophilized \u003cem\u003ePleurotus ostreatus\u003c/em\u003e extract was diluted in distilled water and administered intragastrically (once daily between 14\u0026ndash;16 h) at a dose of 2 g/kg/day for three consecutive weeks [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eTo inhibit the SGLT1 transporter, phlorizin (Sigma, Washington, DC, USA) was administered subcutaneously in a single dose (0.4 g/kg) [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. After 4 hours, the final blood glucose tests were performed.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec5\" class=\"Section2\"\u003e\u003ch2\u003e2.3 Animals and experimental groups\u003c/h2\u003e\u003cp\u003eThirty-six C57BL/6 mice (males and females weighing 20 g) were housed in plastic cages under standard laboratory conditions (12 h light/dark cycle, 21\u0026deg;C, 70% humidity, water and food ad libitum). Initially, the animals were allocated to administration of mushroom extract (\u003cem\u003eP. ostreatus\u003c/em\u003e n\u0026thinsp;=\u0026thinsp;24) or sodium chloride 0.9% (CTRL, n\u0026thinsp;=\u0026thinsp;12) for three weeks. After this period, the animals that had received mushroom extract were divided proportionally into two groups: \u003cem\u003eP. ostreatus\u003c/em\u003e (GPO, n\u0026thinsp;=\u0026thinsp;12 - mice treated daily with \u003cem\u003eP. ostreatus\u003c/em\u003e extract (2g/kg)) and \u003cem\u003eP. ostreatus\u003c/em\u003e\u0026thinsp;+\u0026thinsp;phlorizin (GPO\u0026thinsp;+\u0026thinsp;phlorizin, n\u0026thinsp;=\u0026thinsp;12 - mice treated daily with \u003cem\u003eP. ostreatus\u003c/em\u003e extract (2g/kg) and administered phlorizin (0.4 g/kg, s.c.) four hours before the glycemic tests) (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec6\" class=\"Section2\"\u003e\u003ch2\u003e2.4 Food intake and body weight analysis\u003c/h2\u003e\u003cp\u003eThe animals in all groups were fed standard rodent chow (Nuvilab\u0026reg;) ad libitum and their food intake was measured weekly based on the difference between the amount of food offered and the food left over. The weight of the animals was also measured weekly using a digital precision scale.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec7\" class=\"Section2\"\u003e\u003ch2\u003e2.5 \u003cem\u003eP. ostreatus\u003c/em\u003e influence on blood glucose concentration\u003c/h2\u003e\u003cp\u003eAt the end of the feeding period, mice were fasted for four hours and blood samples were collected via the tail vein to measure blood glucose concentration using a glucometer (AccuChek Active, Roche Diagnostics\u0026reg;, USA), as previously described by Xiong et al. (2018) \u003cem\u003eP. ostreatus\u003c/em\u003e (2 g/kg) was then administered via gavage and blood glucose was measured after 30 and 60 minutes [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e].\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\u003ch2\u003e2.6 Influence of \u003cem\u003eP. ostreatus\u003c/em\u003e on the oral glucose tolerance test (OGTT)\u003c/h2\u003e\u003cp\u003eAfter stabilization of blood glucose concentration, animals were given a D-glucose solution (2 g/kg, oral, Sigma) and blood glucose was measured at time points zero, 30, 60 and 120 as previously described by [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e].\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec9\" class=\"Section2\"\u003e\u003ch2\u003e2.7 Euthanasia\u003c/h2\u003e\u003cp\u003eAt the end of the experimental protocols, the animals were anesthetized with isoflurane and euthanized by exsanguination. Subsequently, samples of the intestine (proximal jejunum) were properly cleaned with physiological saline 0.9% and stored in special tubes for RT-qPCR analysis.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec10\" class=\"Section2\"\u003e\u003ch2\u003e2.8 RT-qPCR\u003c/h2\u003e\u003cp\u003eTotal RNA was extracted from samples of the intestine (proximal jejunum) using Trizol (Invitrogen, Brazil) and then treated with DNAse I (Invitrogen, Brazil). Total RNA was analyzed by agarose gel electrophoresis (1%) and quantified using a Qubit fluorometer (Invitrogen, Brazil). cDNA was synthesized from 1 \u0026micro;g of RNA using the High Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Brazil). Gene expression analysis was performed by real-time quantitative PCR (RT-qPCR) using the PowerUP SYBR Green Master Mix Kit (Applied Systems, Brazil) under the following conditions: 50\u0026deg;C for 120s, 95\u0026deg;C for 120s, followed by 40 cycles of 95\u0026deg;C for 15s and 60\u0026deg;C for 60s. The endogenous normalization gene, B-actin, was used to normalize the gene expression analysis. The results obtained were analyzed using the 2-ΔΔCT method [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. All steps followed the manufacturer's protocol and the primers used are described in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003e\u0026ndash; Sequence of primers used in RT-qPCR amplifications. Each primer is listed along with its corresponding sequence read from the 5' to 3' end.\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"4\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eName\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eSequence - Forward\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eSequence - Reverse\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003eAccess number\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eSGLT1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCCAGTGGGCTGTACCAACAT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eGAGAGTACTGGCGCTGTTGA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eKT598255.1\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eGLUT-2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eTGTGCTGCTGGATAAATTCGCCTG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eAACCATGAACCAAGGGATTGGACC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eNM_031197.2\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eGLUT-5\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eTGCTGATCCAGAAGAAAGATGAAG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCGTCTTTCCAGCCTCGGA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eNM_019741.3\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eATP1a1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGGGGTTGGACGAGACAAGTAT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCGGCTCAAATCTGTTCCGTAT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eNM_144900.2\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eB-actin\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eTGACAGGATGCAGAAGGAGA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eGTACTTGCGCTCAGGAGGA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eNM_007393.5\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003ctfoot\u003e\u003ctr\u003e\u003ctd colspan=\"4\"\u003eSGLT1: Na(+)-glucose cotransporter 1; GLUT-2: glucose transporter 2 ; GLUT-5: glucose transporter 5; ATP1a1: alpha-1 subunit of the Na(+)/K(+) ATPase; B-actin: beta actin protein\u003c/td\u003e\u003c/tr\u003e\u003c/tfoot\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\u003ch2\u003e2.9 Molecular Docking\u003c/h2\u003e\u003cp\u003eThe search was performed in the Science Direct database for original research articles published in the last ten years (2014\u0026ndash;2024) to identify the main compounds present in \u003cem\u003ePleurotus ostreatus\u003c/em\u003e. The descriptors used as a search strategy were: (\u0026ldquo;\u003cem\u003ePleurotus ostreatus\u003c/em\u003e\u0026rdquo;) AND (\u0026ldquo;\u003cem\u003ePleurotus ostreatus\u003c/em\u003e\u0026rdquo; AND \u0026ldquo;\u003cem\u003echemical characterization\u003c/em\u003e\u0026rdquo;). The inclusion criteria were English-language articles that analyzed the mushroom species \u003cem\u003eP. ostreatus\u003c/em\u003e and performed chemical characterization of its ethanolic or aqueous extract. Studies that analyzed other mushroom species, examined \u003cem\u003eP. ostreatus\u003c/em\u003e in its raw, cooked, or dried form, or did not perform chemical characterization of the ethanolic or aqueous extract were excluded. Seventy-eight articles were selected and fully reviewed. Of these, seventy were excluded and six were used to identify the major compounds: Ephedrine, epicatechin, kaempferol, naringin, resveratrol, and rutin.\u003c/p\u003e\u003cp\u003eMolecular docking simulations were performed using AutoDock 4.2.6. The crystal structure of SLGT1 (PDB ID: 7SLA) was obtained from the Protein Data Bank (PDB: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.rcsb.org/\u003c/span\u003e\u003cspan address=\"https://www.rcsb.org/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). The cholesterol molecules present in the crystal structure and the nanobody Nb1 were removed using PyMOL, leaving only the protein chain relevant for the interaction with the ligand (chain A). The structure was prepared for docking by removing water molecules, adding non-polar hydrogen atoms, correcting erroneous amino acids and adjusting the charges as required. The ligand structures were taken from PubChem (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://pubchem.ncbi.nlm.nih.gov/\u003c/span\u003e\u003cspan address=\"https://pubchem.ncbi.nlm.nih.gov/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) and converted to PDB format using PyMOL version 3.0. The ligands used were Ephedrine (CID: 9294); epicatechin (CID: 72276); kaempferol (CID: 5280863); naringin (CID: 442428); resveratrol (CID: 445154); rutin (CID: 5280805) and glucose (CID: 5793). Molecular docking was performed using the default parameters of AutoDock 4.2.6 (150 individuals in a population, maximum 2,500,000 energy scores and maximum 27,000 generations) with Lamarck's Genetic Algorithm as the search method over 50 runs of the genetic algorithm (GA). The docking grid was defined with the following parameters: Dimensions of 90 \u0026times; 90 \u0026times; 100 \u0026Aring;, coordinates of the central grid point of the maps X\u0026thinsp;=\u0026thinsp;107.183, Y\u0026thinsp;=\u0026thinsp;103.683, Z\u0026thinsp;=\u0026thinsp;101.554, and a grid spacing of 0.375 \u0026Aring;. After the docking simulations, the binding energies of the selected compounds were calculated. After completion of the docking simulations, the results were examined and interpreted using the BIOVIA Discovery Studio Visualizer.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\u003ch2\u003e2.10 Statistical Data Analysis\u003c/h2\u003e\u003cp\u003eStatistical analyses were performed using GraphPad Prism software version 8.0, and results were expressed as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard error of the mean. For weight variation, food intake and blood glucose levels, results were analyzed using ANOVA followed by Bonferroni post hoc test. For the RT-qPCR results, Student's t-test was used, accepting a significance level of 5%.\u003c/p\u003e\u003c/div\u003e"},{"header":"3. Results","content":"\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e\u003ch2\u003e3.1 Food intake and body weight\u003c/h2\u003e\u003cp\u003eFood intake and body weight did not differ between the groups throughout the experiment (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eBody weight and food intake of mice treated with \u003cem\u003eP. ostreatus\u003c/em\u003e or NaCl (0.9%) for three weeks.\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"5\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/th\u003e\u003cth align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e\u003cp\u003eBody weight (g)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colspan=\"2\" nameend=\"c5\" namest=\"c4\"\u003e\u003cp\u003eFood intake (g/animal/week)\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eWeek\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCTRL\u003c/p\u003e\u003cp\u003e(n\u0026thinsp;=\u0026thinsp;12)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e\u003cem\u003eP.ostreatus\u003c/em\u003e (n\u0026thinsp;=\u0026thinsp;24)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eCTRL\u003c/p\u003e\u003cp\u003e(n\u0026thinsp;=\u0026thinsp;12)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e\u003cem\u003eP. ostreatus\u003c/em\u003e (n\u0026thinsp;=\u0026thinsp;24)\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e1st\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e19\u0026thinsp;\u0026plusmn;\u0026thinsp;0.25\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e20\u0026thinsp;\u0026plusmn;\u0026thinsp;0.08\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e27\u0026thinsp;\u0026plusmn;\u0026thinsp;0.33\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e28\u0026thinsp;\u0026plusmn;\u0026thinsp;0.38\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e2nd\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e19\u0026thinsp;\u0026plusmn;\u0026thinsp;0.17\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e20\u0026thinsp;\u0026plusmn;\u0026thinsp;0.08\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e27\u0026thinsp;\u0026plusmn;\u0026thinsp;0.25\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e28\u0026thinsp;\u0026plusmn;\u0026thinsp;0.33\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e3rd\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e20\u0026thinsp;\u0026plusmn;\u0026thinsp;0.25\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e20\u0026thinsp;\u0026plusmn;\u0026thinsp;0.08\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e27\u0026thinsp;\u0026plusmn;\u0026thinsp;0.75\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e29\u0026thinsp;\u0026plusmn;\u0026thinsp;0.21\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003ctfoot\u003e\u003ctr\u003e\u003ctd colspan=\"5\"\u003eValues expressed as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SEM. CTRL\u0026thinsp;=\u0026thinsp;animals supplemented with 0.9% NaCl. \u003cem\u003eP. ostreatus\u003c/em\u003e\u0026thinsp;=\u0026thinsp;animals supplemented with \u003cem\u003ePleurotus ostreatus\u003c/em\u003e (2g/kg/day) for three weeks.\u003c/td\u003e\u003c/tr\u003e\u003c/tfoot\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec15\" class=\"Section2\"\u003e\u003ch2\u003e3.2 Influence of \u003cem\u003eP. ostreatus\u003c/em\u003e on blood glucose levels\u003c/h2\u003e\u003cp\u003eThe three-week treatment with \u003cem\u003eP. ostreatus\u003c/em\u003e had no effect on the fasting blood glucose levels of the animals (Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). However, when assessing blood glucose levels after acute administration of \u003cem\u003eP. ostreatus\u003c/em\u003e extract (GPO), we observed a significant increase in the CTRL and GPO groups (p\u0026thinsp;=\u0026thinsp;0.02 and p\u0026thinsp;=\u0026thinsp;0.013, respectively) after 30 minutes, which partially returned to baseline levels after 60 minutes. By inhibiting SGLT1 (GPO\u0026thinsp;+\u0026thinsp;phlorizin group), acute administration of the extract had no effect on blood glucose, which was significantly lower than in the GPO group after 30 (p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001) and 60 (p\u0026thinsp;=\u0026thinsp;0.01) minutes (Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eBlood glucose concentration in different time points after \u003cem\u003eP. ostreatus\u003c/em\u003e (2 g/kg) oral administration.\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"4\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eTime/Groups\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCTRL\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eGPO\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003eGPO\u0026thinsp;+\u0026thinsp;phlorizin\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eBaseline (fasting)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e\u003cp\u003e127\u0026thinsp;\u0026plusmn;\u0026thinsp;12\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e\u003cp\u003e121\u0026thinsp;\u0026plusmn;\u0026thinsp;11\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e116\u0026thinsp;\u0026plusmn;\u0026thinsp;23\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eP. ostreatus\u003c/em\u003e 30 min\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e\u003cp\u003e159\u0026thinsp;\u0026plusmn;\u0026thinsp;6 *\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e\u003cp\u003e172\u0026thinsp;\u0026plusmn;\u0026thinsp;22 *\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e108\u0026thinsp;\u0026plusmn;\u0026thinsp;9 \u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eP. ostreatus\u003c/em\u003e 60 min\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e\u003cp\u003e148\u0026thinsp;\u0026plusmn;\u0026thinsp;29\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e\u003cp\u003e164\u0026thinsp;\u0026plusmn;\u0026thinsp;20 *\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e107\u0026thinsp;\u0026plusmn;\u0026thinsp;28 \u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003ctfoot\u003e\u003ctr\u003e\u003ctd colspan=\"4\"\u003eValues expressed as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SEM. CTRL\u0026thinsp;=\u0026thinsp;control group; GPO\u0026thinsp;=\u0026thinsp;\u003cem\u003eP.ostreatus\u003c/em\u003e group; GPO\u0026thinsp;+\u0026thinsp;Phlorizin\u0026thinsp;=\u0026thinsp;\u003cem\u003eP. ostreatus\u003c/em\u003e\u0026thinsp;+\u0026thinsp;phlorizin group.\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd colspan=\"4\"\u003e* significantly different from baseline time (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05);\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd colspan=\"4\"\u003e\u003csup\u003ea\u003c/sup\u003e significantly different from GPO group at 30 minutes (p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001).\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd colspan=\"4\"\u003e\u003csup\u003eb\u003c/sup\u003e significantly different from GPO group at 60 minutes (p\u0026thinsp;\u0026lt;\u0026thinsp;0.01).\u003c/td\u003e\u003c/tr\u003e\u003c/tfoot\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec16\" class=\"Section2\"\u003e\u003ch2\u003e3.3 Influence of \u003cem\u003eP. ostreatus\u003c/em\u003e on the oral glucose tolerance test (OGTT)\u003c/h2\u003e\u003cp\u003eThe blood glucose concentration increased significantly 30 minutes after administration of D-glucose (2 g/kg, oral) in all groups, although this increase was more pronounced in the GPO group (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ea). Thereafter, the blood glucose concentration decreased significantly in all groups up to 60 minutes, while it continued to decrease in the CTRL and GPO groups up to 120 minutes. The GPO\u0026thinsp;+\u0026thinsp;phlorizin group showed significantly lower blood glucose levels compared to the other experimental groups throughout the OGTT, which converged again after 120 minutes (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ea).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eFigure \u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eb shows the glycemic fluctuations of the OGTT based on the area under the curve. It can be observed that these were greater in the GPO group than in the CTRL group and were significantly reduced when SGLT1 was inhibited (GPO\u0026thinsp;+\u0026thinsp;phlorizin group).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec17\" class=\"Section2\"\u003e\u003ch2\u003e3.4 RT-qPCR\u003c/h2\u003e\u003cp\u003eThe expression levels of the genes \u003cem\u003esglt1\u003c/em\u003e, \u003cem\u003eatp1a1\u003c/em\u003e, \u003cem\u003eglut2\u003c/em\u003e and \u003cem\u003eglut5\u003c/em\u003e were analyzed in the group treated with \u003cem\u003eP. ostreatus\u003c/em\u003e mushroom extract (2g/kg) compared to the control group (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). Treatment with the extract increased the expression of the \u003cem\u003eatp1a1\u003c/em\u003e gene by 97% compared to the CTRL group, but did not alter the expression of the \u003cem\u003esglt1\u003c/em\u003e, \u003cem\u003eglut2\u003c/em\u003e and \u003cem\u003eglut5\u003c/em\u003e genes.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec18\" class=\"Section2\"\u003e\u003ch2\u003e3.5 Molecular Docking\u003c/h2\u003e\u003cp\u003eTo this end, the most important compounds contained in the \u003cem\u003eP. ostreatus\u003c/em\u003e extract were first identified on the basis of the literature. Six predominant compounds were selected (ephedrine, epicatechin, kaempferol, naringin, resveratrol and rutin), and glucose was used as a positive control. The binding energies of the selected compounds for SGLT1 are summarized in Table\u0026nbsp;\u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e4\u003c/span\u003e. Among the compounds tested, naringin showed the strongest binding affinity with a binding energy of -11.54 kcal/mol. Rutin also showed a strong affinity with a binding energy of -11.36 kcal/mol and glucose, which was used as a control compound, showed a binding energy of -8.44 kcal/mol. Other compounds such as kaempferol, resveratrol and epicatechin showed moderate binding energies between \u0026minus;\u0026thinsp;9.10 and \u0026minus;\u0026thinsp;9.67 kcal/mol. Ephedrine showed the weakest binding with a binding energy of -7.57 kcal/mol. Conventional hydrogen bonding analysis (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e) showed that naringin, rutin and kaempferol may share the same residues (such as SER396, GLN299, ARG300, ALA303, SER396 and ASN399). Resveratrol and epicatechin, on the other hand, interacted with residues SER76 and SER396 via conventional hydrogen bonds. The only major compound that interacted at the same site as glucose was ephedrine, which interacted with residues GLN457 and SER460.\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab4\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 4\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eBinding energies, inhibition constants, and conventional hydrogen bond interactions of compounds with SGLT1 (Sodium-Glucose Cotransporter 1) obtained through molecular docking analysis\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"4\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eCompound\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003ePubChem CID\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eBinding Energy\u003c/p\u003e\u003cp\u003e(kcal/mol)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003eConventional Hydrogen Bonds\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eNaringin\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e442428\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e-11.54\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eLEU197, GLN299, SER396, ASN399\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eRutin\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e5280805\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e-11.36\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eARG300, ALA303, SER396, SER400\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eKaempferol\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e5280863\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e-9.67\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003ePRO69, GLN299, ARG300, ALA303, SER396, ASN399\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eEpicatechin\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e72276\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e-9.19\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eSER73, VAL200, ARG300, SER396\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eResveratrol\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e445154\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e-9.10\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eSER73, ASN78, SER392, SER396\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eEphedrine\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e9294\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e-7.57\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eGLN457, SER460\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eGlucose\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e5793\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e-8.44\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eASN78, GLN457, SER460\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e"},{"header":"4. Discussion and conclusion","content":"\u003cp\u003eThe main finding of this study was the first demonstration that supplementation with \u003cem\u003eP. ostreatus\u003c/em\u003e mushroom extract (2g/kg/day) for three weeks increases glucose absorption capacity via SGLT1 in the first part of the intestine in C57BL/6 mice by increasing the expression of the \u003cem\u003eatp1a1\u003c/em\u003e gene.\u003c/p\u003e\u003cp\u003eMushrooms have long been cultivated for culinary and medicinal use due to their low caloric content and bioactive compounds with significant therapeutic potential for various diseases [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. However, the composition of these mushrooms is directly influenced by environmental factors and the substrate on which they are grown, which can lead to significant differences within the same species [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. In this context, the carbohydrate content can vary between 24 and 75%, with polysaccharides being the most abundant [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eAmong other benefits, mushrooms are often used to control blood glucose levels, particularly in pathological conditions such as diabetes and insulin resistance [\u003cspan additionalcitationids=\"CR15 CR16\" citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. Wińska et al. (2019) have shown that the mushroom \u003cem\u003eGanoderma lucidum\u003c/em\u003e has a promising blood glucose-lowering effect by inhibiting apoptosis of pancreatic β-cells and reducing intracellular signaling associated with insulin resistance and the deposition of harmful fat in diabetic rats [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. There is evidence that mushrooms increase insulin sensitivity by stimulating the secretion of this pancreatic hormone as well as the translocation/expression of GLUTs into the membrane of various cells [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. On the other hand, their influence on the intestinal absorption of saccharides has not been fully characterized and is of paramount importance for nutritional prescription support and adjuvant treatments. In this context, our study is innovative as it also evaluates the direct impact of acute administration of a mushroom extract on some of these parameters.\u003c/p\u003e\u003cp\u003eAfter a three-week administration of the extract, we found no differences in fasting blood glucose concentrations, suggesting that supplementation with \u003cem\u003eP. ostreatus\u003c/em\u003e did not affect blood glucose regulation over time. Although the level of saccharides in the extract was not directly measured in this study, the increase in blood glucose levels following acute administration of \u003cem\u003eP. ostreatus\u003c/em\u003e in the CTRL and GPO groups appears to be due in part to the presence of saccharides in its composition. In addition, the blood glucose concentration remained elevated in the GPO group 60 minutes after \u003cem\u003eP. ostreatus\u003c/em\u003e administration, while it was significantly decreased in the CTRL group. These results are reinforced by the blood glucose curve of the animals that received phlorizin to inhibit SGLT1. The blood glucose concentration in the GPO\u0026thinsp;+\u0026thinsp;phlorizin group was significantly lower compared to the other groups, indirectly demonstrating the presence of glucose in the composition of the extract and suggesting that the \u003cem\u003eP. ostreatus\u003c/em\u003e extract had no effect on gluconeogenesis and glycogenolysis under the conditions tested in this study. Our results are consistent with the findings of Hikino et al. (1985), who showed the influence of peptidoglycans isolated from the mushroom \u003cem\u003eG. lucidum\u003c/em\u003e on the glycemic metabolism of mice [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eWhen we also investigated whether the mushroom extract could influence the OGTT, a greater increase in blood glucose concentration was observed in the GPO group compared to the other groups after 30 minutes. Among other factors, we cannot exclude a greater glucose absorption capacity in the animals exposed to \u003cem\u003eP. ostreatus\u003c/em\u003e extract for three weeks (GPO group). It has been shown that greater exposure of the ABM to saccharides can increase glucose uptake capacity by stimulating gene and protein expression of SGLT1 [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. In addition, this exposure may also increase the expression of GLUT2, both in the BBM, where it exerts the known effect of facilitating the absorption of monosaccharides, and in the ABM, where it enhances glucose absorption via an alternative pathway to SGLT1 [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. However, in the present study, we did not differentially analyze the gene expression of GLUT2 in BBM and ABM. Despite the similarity in gene expression of this glucose transporter between the groups, we cannot exclude the possibility that it was different between the two intestinal membranes. In addition, it is worth noting that phlorizin acts specifically by inhibiting SGLT1 and has no direct effect on the GLUTs [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eTo investigate the hypothesis that the \u003cem\u003eP. ostreatus\u003c/em\u003e extract could modulate the activity of SGLT1, a molecular docking analysis was performed using six selected major compounds. To validate the docking approach, the interaction between SGLT1 and glucose was first predicted. This revealed a high affinity for residues ASN78, GLN457 and SER460, amino acids previously identified as core components of the glucose binding site in SGLT1. Among the major compounds, naringin and rutin showed the strongest binding affinity, with values higher than those for glucose. The docking results also indicated that the components of the extract may interact with key functional residues of SGLT1. In particular, binding to SER396, a residue involved in sodium coordination, was observed [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. Since sodium binding is crucial for the conformational change required to initiate glucose transport Loo et al., 2013, it is conceivable that these compounds influence transporter activity by mimicking or enhancing sodium interactions [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. Such an effect could potentially facilitate glucose cotransport, which could explain the experimentally observed increase in glucose uptake despite unchanged gene expression of SGLT1.\u003c/p\u003e\u003cp\u003eAt the same time, repeated exposure to \u003cem\u003eP. ostreatus\u003c/em\u003e for three weeks stimulated greater gene expression of the main subunit of ATPases that performs a catalytic action to provide energy for the Na(+)/K(+) pump in the BBM of enterocytes. Since the Na+-glucose symport promoted by SGLT1 in the ABM depends on the concentration gradient of this cation between the intracellular and extracellular milieu, the \u003cem\u003eP. ostreatus\u003c/em\u003e extract may have favored greater glucose uptake by SGLT1 by stimulating the Na(+)/K(+)- ATPase. Similarly, the persistence of elevated blood glucose concentration 60 min after \u003cem\u003eP. ostreatus\u003c/em\u003e administration or the highest glycemic peak of the GPO group in the OGTT seems to be related to a higher capacity of glucose transport, which was promoted by the increase in gene expression of \u003cem\u003eatp1a1\u003c/em\u003e. On the other hand, glycemia at the 120-min OGTT and basal blood glucose levels in the fasting state did not differ between the experimental groups, suggesting that blood glucose metabolism was not affected by \u003cem\u003eP. ostreatus\u003c/em\u003e supplementation.\u003c/p\u003e\u003cp\u003eOur study is groundbreaking as it demonstrates the influence of SGLT1 on the absorption of glucose contained in the mushroom \u003cem\u003ePleurotus ostreatus\u003c/em\u003e and the role of this mushroom on SGLT1. Repeated exposure to a \u003cem\u003eP. ostreatus\u003c/em\u003e extract sensitized SGLT1 by stimulating greater gene expression of \u003cem\u003eatp1a1\u003c/em\u003e, the catalytic subunit of Na(+)/K(+)-ATPase. Although it promoted an increase in blood glucose levels, blood glucose metabolism does not appear to have been affected by \u003cem\u003eP. ostreatus\u003c/em\u003e supplementation. However, it is important to emphasize that we used healthy animals in the present study, and it is important to evaluate these influences in models with insulin resistance.\u003c/p\u003e"},{"header":"5. Limitations","content":"\u003cp\u003eOur study has limitations as the selective inhibition of Na(+)/K(+)-ATPase was not evaluated, Na(+) levels between the intracellular and extracellular environment of enterocytes were not measured and the influence of the extract on the fructose transporter was not evaluated.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported\u0026nbsp;by the\u0026nbsp;Fundação Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES), a Brazilian financial support agency.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interest:\u0026nbsp;\u003c/strong\u003eThe authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCRediT authorship contribution statement:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eP.C.S. and P.Q.C. Conceptualization; P.C.S. and P.Q.C. Data curation; P.C.S. Formal analysis; P.C.S. Funding acquisition; P.C.S. and P.Q.C. Investigation; P.Q.C., K.M.M.S., T.K.S., F.D.T.M., and S.A.R.M.J. Methodology; P.C.S. Project administration; A.A.B., M.C. Resources; P.C.S., P.Q.C., and D.V.A. Roles/Writing - original draft; and Writing - review \u0026amp; editing.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe research does not involve human study, and does not declare ethics.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNo data was used for the research described in the article.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003ePalaniappan B, Arthur S, Sundaram V, Butts M, Sundaram S, Mani K, Singh S, Nepal N, Sundaram U (2019) Inhibition of intestinal villus cell na/k-atpase mediates altered glucose and nacl absorption in obesity-associated diabetes and hypertension. Faseb j 33(8):9323\u0026ndash;9333\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSatoh T, Igarashi M, Yamada S, Takahashi N, Watanabe K (2015) Inhibitory effect of black tea and its combination with acarbose on small intestinal α-glucosidase activity. J Ethnopharmacol 161:147\u0026ndash;155\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMota-ram\u0026iacute;rez LD, Escobar C (2023) Postweaning cafeteria diet induces a short-term metabolic disfunction and a differential vulnerability to develop anxiety-like and depressive-like behaviors in male but not female rats. Dev psychobiol 65(4):22392\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAzeez OH, Alkass SY, Persike DS (2019) Long-term saccharin consumption and increased risk of obesity, diabetes, hepatic dysfunction, and renal impairment in rats. Med (kaunas) 55(10):681\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eStearns AT, Balakrishnan A, Rhoads DB, Tavakkolizadeh A (2010) Rapid upregulation of sodium-glucose transporter sglt1 in response to intestinal sweet taste stimulation. Ann Surg 251(5):865\u0026ndash;871\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZhang Y, Hu T, Zhou H, Zhang Y, Jin G, Yang Y (2016) Antidiabetic effect of polysaccharides from \u003cem\u003epleurotus\u003c/em\u003e ostreatus in streptozotocin-induced diabetic rats. Int J Biol Macromol 83:126\u0026ndash;132\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eXiong M, Huang Y, Liu Y, Huang M, Song G, Ming Q, Xinhua Ma, Yang J, Deng S, Wen Y, Shen J, Liu QH, Zhao P, Yang X (2018) Antidiabetic activity of ergosterol from \u003cem\u003epleurotus\u003c/em\u003e ostreatus in kk-a y mice with spontaneous type 2 diabetes mellitus. Mol Nutr Food Res 62(3):1700444\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eDa Costa PQ, Paim MP, Dos Reis EE, Turck P, Camassola M, Schenkel PC (2021) Beneficial effects of \u003cem\u003epleurotus\u003c/em\u003e albidus supplementation on body weight and food intake in healthy c57bl/6 mice. J future foods 1(1):98\u0026ndash;103\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eFreitas HS, Beatriz DAS, Robinson S, Maristela MO, Maria S, Ubiratan FM (2007) Insulin but not phlorizin treatment induces a transient increase in glut2 gene expression in the kidney of diabetic rats. Nephron Physiol 105(3):42\u0026ndash;p51\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLivak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 4:402\u0026ndash;408\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eChang ST, Wasser SP (2018) Current and future research trends in agricultural and biomedical applications of medicinal mushrooms and mushroom products (review). Int J Med mushrooms 20(12):1121\u0026ndash;1133\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCampelo MS, Neto JFC, Magalh\u0026atilde;es HCR, Filho EGA, Zocolo GJ, Leal LMAM, Ribeiro MENP (2024) GC/MS and 2D NMR-based approach to evaluate the chemical profile of hydroalcoholic extract from Agaricus blazei Murill and its anti-inflammatory effect on human neutrophils. J Ethnopharmacol 322:117676\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eVenturella G, Ferraro V, Cirlincione F, Gargano M (2021) Cogumelos medicinais: compostos bioativos, uso e ensaios cl\u0026iacute;nicos. revista Int de ci\u0026ecirc;ncias moleculares Mdpi ag 22(2):634\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKanagasabapathy G, Kuppusamy UR, Malek SNA, Abdulla MA, Chua KH, Sabaratnam V (2012) Glucan-rich polysaccharides from \u003cem\u003epleurotus\u003c/em\u003e sajor-caju (fr.) singer prevents glucose intolerance, insulin resistance and inflammation in c57bl/6j mice fed a high-fat diet. BMC complement altern med 12:261\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLiu X, Luo D, Guan J, Chen J, Xu X (2022) Mushroom polysaccharides with potential in anti-diabetes: biological mechanisms, extraction, and future perspectives: a review. \u003cem\u003eFrontiers nutrition\u003c/em\u003e, 9,1087826\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eDubey SK, Chaturvedi VK, Mishra D, Bajpeyee A, Tiwari A, Singh MP (2019) Role of edible mushroom as potent therapeutics for the diabetes and obesity. \u003cem\u003e3 biotech\u003c/em\u003e, 9 (12), 450\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eXiao C, Wu Q, Zhang J, Xie Y, Cai W, Tan J (2017) Antidiabetic activity of Ganoderma lucidum polysaccharides F31 down-regulated hepatic glucose regulatory enzymes in diabetic mice. J Ethnopharmacol 196:47\u0026ndash;57\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWińska K, Mączka W, Gabryelska K, Grabarczyk M (2019) Mushrooms of the genus ganoderma used to treat diabetes and insulin resistance. Molecules 24(22):4075\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHikino H, Konno C, Mirin Y, Hayashi T (1985) Isolation and hypoglycemic activity of ganoderans a and b, glycans of ganoderma lucidum fruit bodies. Planta med 51:339\u0026ndash;340\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eNishimura K, Fujita Y, Ida S, Yanagimachi T, Ohashi N, Nishi K, Nishida A, Iwasaki Y, Morino K, Ugi S, Nishi E, Andoh A, Maegawa H (2022) Glycaemia and body weight are regulated by sodium-glucose cotransporter 1 (sglt1) expression via o-glcnacylation in the intestine. Mol metab 59:101458\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAra\u0026uacute;jo J, Martel F (2009) Regula\u0026ccedil;\u0026atilde;o da absor\u0026ccedil;\u0026atilde;o intestinal de glicose: uma breve revis\u0026atilde;o. Arquivos de Med 23:35\u0026ndash;43\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eEhrenkranz JRL, Norman GL, Kahn CR, Jesse R (2015) Phlorizin: a review. Diabetes/metabolism research and reviews. Curr Opin 21(1):31\u0026ndash;38\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBisignano P, Ghezzi C, Jo H, Polizzi NF, Althoff T, Kalyanaraman C, Friemann R, Jacobson MP, Wrigh EM, Grabe M (2018) Inhibitor binding mode and allosteric regulation of Na\u003csup\u003e+\u003c/sup\u003e-glucose symporters. Nat Communication 9:5245\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLoo DDF, Jiang X, Gorraitz E, Hirayama BA, Wright EM (2013) Functional identification and characterization of sodium binding sites in Na symporters. \u003cem\u003eProc. Natl. Acad. Sci. U.S.A,.\u003c/em\u003e 110 (47) E4557-E456\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"atp1a1, glucose transporter, phlorizin, mushroom, Na(+)/K(+)-ATPase","lastPublishedDoi":"10.21203/rs.3.rs-7772923/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7772923/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eThe use of medicinal mushrooms for the treatment of glycemic metabolism disorders has been extensively tested as a therapeutic alternative. The aim of this study was to analyze the effect of \u003cem\u003ePleurotus ostreatus\u003c/em\u003e extract on intestinal glucose absorption mediated by Na(+)-glucose cotransporter 1 (SGLT1) in C57BL/6 mice. C57BL/6 mice were administered \u003cem\u003eP. ostreatus\u003c/em\u003e extract (2 g/kg) by gavage for three weeks. Blood glucose levels and gene expression of various proteins involved in intestinal glucose uptake were then analyzed. We found that blood glucose levels increased significantly after administration of \u003cem\u003eP. ostreatus\u003c/em\u003e, an effect that was abolished by the SGLT1 inhibitor. Although the three-week exposure to the extract did not alter the expression of the \u003cem\u003eSglt1, Glut2\u003c/em\u003e and \u003cem\u003eGlu5\u003c/em\u003e genes in the proximal intestine of the mice, it increased the expression of the \u003cem\u003eatp1a1\u003c/em\u003e gene. To investigate the possible effects of the extract on SGLT1, a molecular docking analysis was performed. The binding affinity between the six main components of the extract and the SGLT1 receptor was examined. It was found that naringin and rutin had the strongest binding affinity. Our results suggest that repeated ingesture of \u003cem\u003eP. ostreatus\u003c/em\u003e extract sensitizes SGLT1 and promotes increased gene expression of \u003cem\u003eatp1a1\u003c/em\u003e without affecting blood glucose metabolism.\u003c/p\u003e","manuscriptTitle":"Pleurotus ostreatus modulates the intestinal glucose absorption by the Na(+)/glucose cotransporter 1 (SGLT1) in C57BL/6 mice","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-10-20 09:27:59","doi":"10.21203/rs.3.rs-7772923/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"ce621a01-276e-4e7c-a217-43dd3d9b6e07","owner":[],"postedDate":"October 20th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2025-11-11T09:39:01+00:00","versionOfRecord":[],"versionCreatedAt":"2025-10-20 09:27:59","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-7772923","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7772923","identity":"rs-7772923","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.