Fusarium graminearumcopper amine-oxidases redundantly increase virulence by converting tryptamine from hydrolyzed plant defense compounds into auxin

13 Plant pathogenic fungi have evolved different strategies to interfere with plant defense mechanisms. 14 The well described fungal plant pathogen Fusarium graminearum is not only able to produce 15 trichothecene toxins like deoxynivalenol, but also the plant hormone auxin. Highly elevated levels of 16 auxin and auxin derivatives such as I AA-glucoside or I AA amino-acid conjugates were observed in 17 wheat cultivar Apogee infected with F. graminearum. We report that F. graminearum is able to cleave 18 tryptamine-derived hydroxycinnamic acid amides, e.g. the defense compound coumaroyl-tryptamine. 19 In this study we investigated copper amine -oxidases, candidate genes for auxin biosynthesis 20 converting tryptamine into the IAA precursor indole-3-acetyldehyde. After consecutive knock outs of 21 all seven copper amine oxidases the resulting septuple knock out strain had strongly reduced ability to 22 produce auxin. Virulence of the septuple mutant was significantly impaired while DON production in 23 planta was comparable to the wild type. We conclude that F. graminearum, often presumed to be a 24 simple nectrotroph, has a biotrophic phase and is able to employ plant defense compounds by 25 converting them into defense suppressing auxin. 26 27 .CC-BY-NC-ND 4.0 International licenseperpetuity. It is made available under a preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in The copyright holder for thisthis version posted October 21, 2024. ; https://doi.org/10.1101/2024.10.21.619423doi: bioRxiv preprint

28 Auxin (indole-3-acetic acid, IAA), is a plant hormone involved in several growth related processes as 29 well as abiotic stress response (Gomes and Scortecci 2021; Waadt et al. 2022) . The role of auxin in 30 defense responses of plants against microbes is not completely clear yet , and the literature at first 31 glance contradictory (for reviews see (Robert-Seilaniantz, Grant, and Jones 2011; Kunkel and Johnson 32 2021)). In general, auxin signaling antagonizes salicylic acid (SA) mediated defense signaling (Kunkel 33 and Harper 2018) which is effective against biotrophs and reciprocally, SA inhibits auxin signaling (Du 34 et al. 2013) . On the other hand , there is also an antagoni sm between salicylic acid and jasmonic 35 acid/ethylene signaling, which is effective against necrotrophs. Depending on the plant and pathogen 36 studied different outcomes are observed. Auxin signaling can be necessary for resistance, e.g. impaired 37 auxin signaling in Ara bidopsis auxin signaling mutants axr1, axr2 and axr6 led to increased 38 susceptibility to the necrotrophic fungi Plectosphaerella cucumerina and Botrytis cinerea (Llorente et 39 al. 2008). In contrast many microbes are able to synthesize auxin, thereby promoting virulence (Kunkel 40 and Johnson 2021). Auxin may suppress defense also in salicylic acid independent way s (Mutka et al. 41 2013), for instance in the interaction of Arabidopsis with Fusarium oxysporum (Kidd et al. 2011). 42 43 There is increasing evidence that several fungal effector proteins target the TOPLESS related 44 corepressors for triggering auxin signaling. First described in Ustilago (Bindics et al. 2022; Navarrete et 45 al. 2022) , this is seemingly also the case for F. oxysporum induced wilt diseases in tomato and 46 Arabidopsis, where certain TOPLESS related genes are susceptibility factors (Aalders et al. 2024). 47 Exogenous auxin application has a susceptibility promoting effect upon infe ction with biotrophic and 48 hemibiotrophic pathogens like Magnaporthe grisea (J. Fu et al. 2011) or the oomycete Phytophhora 49 parasitica (Evangelisti et al. 2013). Yet, in case of Fusarium culmorum and wheat it has been reported 50 that pretreatment with IAA increased resistance of wheat (Petti et al. 2012). Especially in susceptible 51 cultivars, after infection with F. graminearum highly elevated levels of auxin were detected in wheat 52 ears (Wang et al. 2018) . Using RNAi-mediated knockdown it has been demonstrated that the wheat 53 auxin receptor (TaTIR1) mediates susceptibility (Su et al. 2021) to F. graminearum. This study reported 54 .CC-BY-NC-ND 4.0 International licenseperpetuity. It is made available under a preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in The copyright holder for thisthis version posted October 21, 2024. ; https://doi.org/10.1101/2024.10.21.619423doi: bioRxiv preprint also, that application of exogenous auxin increased susceptibility, contradicting Wang et. al (Wang et 55 al. 2018). 56 Multiple bacteria and fungi exploit the fact that elevated auxin levels increase susceptibility by 57 producing auxin themselves. In this context tryptophan dependent and tryptophan independent 58 pathways have been described (S.-F. Fu et al. 2015) . In the indole -3-acetaldoxime (IAOx) pathway, 59 auxin is produced from IAOx which is produced from tryptophan by cytochrome P450 60 monooxygenases. In the YUCCA pathway, Trp is first converted to indole-3-pyruvic acid (IPA) by an 61 aminotransferase, and then converted into auxin by flavin monooxygenase (encoded by YUCCA genes). 62 In the IAM pathway Trp is first converted to indole-3-acetamide (IAM) which is further metabolized to 63 auxin by indeole-3-acetamide hydrolase (iaaH, AMI1). The auxin biosynthetic pathway via iaaM iaaH 64 has been reported to be present in certain Fusarium isolates in the Gibberella fujikuroi species complex 65 (Niehaus et al. 2016; Tsavkelova et al. 2012), but is absent in F. graminearum. 66 The pathway we are focusing on in this study is the one via tryptamine (TAM). In the first step Trp is 67 decarboxylated by a tryptophan decarboxylase to TAM. In the consecutive step TAM is oxidized by an 68 amine oxidase (AOX) resulting in indole -3-acetaldehyde which is further oxidized to auxin (Cao et al. 69 2019; Mano and Nemoto 2012; Zhao 2010; Sugawara et al. 2009). 70 Different Fusarium species have been described to be capable of auxin production although different 71 pathways may be used (Tsavkelova et al. 2012; Niehaus et al. 2016). Fusarium graminearum itself has 72 been described to be able to produce auxin from TAM and IPA and also to be able to metabolize auxin 73 (K. Luo et al. 2016). 74 In this study we focus on TAM metabolization by Fusarium graminearum . We determine the 75 mechanism of auxin formation, describe the ability of the fungus to cleave hydroxycinnamic acid 76 amides releasing TAM , and assess the impact on disruption on seven copper amine oxidases in 77 Fusarium graminearum on auxin production and virulence. 78 79

80 ➢ F. graminearum can cleave CouTam 81 .CC-BY-NC-ND 4.0 International licenseperpetuity. It is made available under a preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in The copyright holder for thisthis version posted October 21, 2024. ; https://doi.org/10.1101/2024.10.21.619423doi: bioRxiv preprint We tested whether F. graminearum PH-1 during infection of the model wheat cultivar Apogee 82 (Mackintosh et al. 2006) increases auxin levels. Upon spray inoculation with F. graminearum strain PH-83 1 after 10 days auxin levels of about 73 µM were measured, compared to about 0.6 µM in the mock 84 treatment. The conjugate of auxin with aspartic acid, I AA-Asp, was elevated f rom below limit of 85 detection to 62 µM. Likewise, an about 10-fold increase of oxidized auxin (2-oxindole-3-acetic acid) to 86 about 8.5 µM was observed in infected wheat. Likewise, auxin-glucoside (ester), a rather instable 87 substance for which no which no standard is commercially available , was present in high levels while 88 remaining below detection level in the control. In agreement with previous reports (K. Luo et al. 2016) 89 we conclude the Fusarium graminearum infection increases auxin levels in wheat ears, and the plant 90 tries to inactivate the excess auxin by glycosylation, oxidation (Hayashi et al. 2021), and formation of 91 IAA-Asp, which is often considered to be an irreversible auxin-inactivation product (P. Luo et al. 2023; 92 Rosquete, Barbez, and Kleine-Vehn 2012). 93 We next asked what the source for the elevated auxin might be. Already in the first microarray 94 experiment reporting the transcriptome changes in barley after F. graminearum infection, it was 95 recognized that the barley tryptophan biosynthesis pathway and also trpytophan decarboxylase were 96 upregulated (Boddu et al. 2006) . While (low) increased levels of TAM after Fusarium infection were 97 previously reported for Brachypodium (Pasquet et al. 2014), the main function of TAM seems to serve 98 as precursor for the synthesis of tryptamine derived hydroxycinnamic acid amides (HCAAs) or 99 phenolamids (Liu et al. 2022). In these compounds, a hydroxycinnamic acid (coumaric acid, ferulic acid, 100 caffeic acid … etc.) forms an amide bond with the amino group of tryptamin e. Hydroxycinnamic acid 101 amides (HCAAs) are induced upon infection (Kushalappa, Yogendra, and Karre 2016) and presumably 102 have antifungal and defense properties (Doppler et al. 2019; Gunnaiah et al. 2012) , yet the 103 experimental evidence is scarce . To test whether F. graminearum growth is inhibited we have 104 chemically synthesized coumaroyl -tryptamine (and caffeoyl-tryptamine) and also derivatives with 105 hydroxylated tryptamine (= serotonin ), feruloyl-serotonine, coumaroyl-serotoinin using published 106 procedures (Macoy et al. 2022; Takao et al. 2017). An agar diffusion test of F. graminearum PH-1 with 107 CouTam is shown in Figure 1. While F. graminearum is initially inhibited, the zone of inhibition is 108 .CC-BY-NC-ND 4.0 International licenseperpetuity. It is made available under a preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in The copyright holder for thisthis version posted October 21, 2024. ; https://doi.org/10.1101/2024.10.21.619423doi: bioRxiv preprint decreasing between three and four days of incubation and eventually is overgrown, indicating that the 109 fungus is able to adapt to the plant defense compound and become resistant. In the next experiment, 110 F. graminearum growth on minimal media supplemented with different concentrations of CouTam 111 ranging from 0 to 1000 mg/l was tested. The later concentration is already above the limit of solubility 112 and a milky appearance of the agar is observed. It is shown in Figure 1a that the higher the CouTam 113 concentration, the stronger is the delay of germination of conidia . However, once the fungus 114 overcomes initial inhibition it can grow almost without restraint. When the fungus is growing at a high 115 concentration a clearing zone in the milky-appearance ahead of the fungus was observed (Spörhase 116 2015). 117 To test whether inactivation of the compound by a putative secreted amidohydrolase cleaving 118 the conjugate is responsible for this phenomenon, a feeding assay in liquid culture was performed. As 119 shown in Figure 1b CouTAM decreased over time while TAM was increasing. We also observed that 120 after eight hours of incubation auxin was formed as well. After 18 hours of incubation TAM hardly 121 increased, while CouTAM was still decreasing and auxin increasing, indicating that the fungus utilizes 122 tryptamine which is released by the cleavage of CouTAM for the formation of auxin. 123 124 .CC-BY-NC-ND 4.0 International licenseperpetuity. It is made available under a preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in The copyright holder for thisthis version posted October 21, 2024. ; https://doi.org/10.1101/2024.10.21.619423doi: bioRxiv preprint 125 Figure 1: growth inhibition of Fusarium graminearum by CouTam (a) and degradation of CouTam over 126 time and formation of auxin (b) 127 Once the amidohydrolase is expressed, CouTam is degraded leading to the release of tryptamine. A 128 similar feeding assay with F. graminearum and TAM revealed that within 24 hours in liquid culture 129 TAM in nearly 100% yield was converted into auxin. Likewise, when serotonine (5-hydroxy-tryptamine) 130 was fed to it was converted into 5-hydroxy-indole-3-acetic acid (data not shown) which reportedly has 131 much lower auxin activity in oat (Böttger, Engvild, and Soll 1978). 132 133 • Inactivation of candidate auxin biosynthetic genes 134 Assuming that most of the elevated auxin in planta is derived from TAM, we selected candidate genes 135 for auxin biosynthesis . In principle amine oxidases are either flavine -dependent enzymes ( Pfam: 136 PF01593, EC 1.4.3.4, (Tararina and Allen 2020) ) or copper amine oxidas es (Pfam01179, EC 1.4.3.21, 137 KEGG reaction R01853). They can remove the am ino group from primary amines, generating the 138 corresponding aldehyde, ammonium and hydrogen peroxide: R-CH2-CH2-NH2 + H2O + O2 = R-CH2-CHO 139 + H2O2 +NH3). Based on transcriptome date we selected the copper amine oxidases as candidate genes. 140 Alternatively, auxin biosynthesis theoretically could also be shut down at the consecutive step by 141 .CC-BY-NC-ND 4.0 International licenseperpetuity. It is made available under a preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in The copyright holder for thisthis version posted October 21, 2024. ; https://doi.org/10.1101/2024.10.21.619423doi: bioRxiv preprint disruption of aldehyde dehydrogenases or oxidases where 17 and two genes, respectively, have been 142 annotated (Güldener et al. 2006) . Hence, consecutive knock outs of copper amine oxidases were 143 chosen in the attempt to block fungus-derived auxin biosynthesis. Single knock out strains lacking one 144 amine oxidase were still able to produce auxin, and also double mutants showed only instable reduced 145 ability to produce auxin (data not shown). 146 In the genome of F. graminearum eight amine oxidases have been bioinformatically annotated (Table 147 1). Since one (AOX5) is truncated and nonfunctional, seven remained to be disrupted. RNA-Seq data 148 derived from the susceptible wheat cultivar Remus with the Fhb1 QTL show that amine oxidase s are 149 already expressed six hours post infection, while TRI5 which is responsible for trichothecene 150 production is expressed only 24 hours post inoculation ( https://pgsb.helmholtz-muenchen.de/cgi-151 bin/db2/BOKUnils/index.cgi, accessed 2016-03-20 defunct – Table 1). These data indicate that the 152 fungus attacks the plant on the hormonal level first before trichothecene production is triggered. 153 Table1: Expression of AOX genes and TRI5 of Fusarium graminearum during wheat infection; relative 154 expression levels indicated in FPKM 155 156 157 For the construction of the multiple knock out strains, a resistance cassette with a positive (hph, nptII 158 or natI) selection genes fused to a negative selection marker (HSVtk) flanked by two loxP sites was 159 used (Twaruschek et al., 2018). HSVtk allows negative selection on media supplemented with 5-fluor-160 .CC-BY-NC-ND 4.0 International licenseperpetuity. It is made available under a preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in The copyright holder for thisthis version posted October 21, 2024. ; https://doi.org/10.1101/2024.10.21.619423doi: bioRxiv preprint 2-deoxyuridine (F2DU) which was used for marker recycling. The flanking regions of the candidate 161 genes were cloned in the respective vector flanking the resistance cassette. 162 Construction of the septuple knock out strain was started with disruption of AOX3 since it showed the 163 highest activity in native PAGE with tryptamine upon expression in yeast (data not shown). The second 164 gene to be disrupted was AOX4 in the strain already l acking AOX3 followed by cre-recombination for 165 marker recycling and selection on 250 nM 5-fluoro-2-deoxyuridine (F2DU). In the next step, AOX2 was 166 replaced by the resistance cassette natI-HSVtk in the double knock out strain followed by selection on 167 20 ppm nourseothricin (nat). The fourth gene which was disrupted in the triple knock out strain was 168 AOX6. One PCR confirmed strain which shows a phenotype comparable to the wild type strain was 169 chosen for pop -out of the resistance cassette s that the last three knock outs can be performed in a 170 row. We continued with the fifth knock out where AOX8 was disrupted in the quadruple knock out 171 strain where all resistance cassettes have been popped out. The tryptamine feeding assay which was 172 performed after every single disruption revealed that the quintuple knock-out strain already shows a 173 strongly reduced auxin production compared to the wild type strain. To check whether the amount of 174 auxin can be further reduced by disruption of the remaining two amine oxidase candidate genes, w e 175 proceeded with the disruption of AOX7 in the quintuple knock -out strain and finally AOX1 was 176 disrupted. 177 Figure 2a shows the scheme of the consecutive knock-outs. After disruption of all seven copper amine 178 oxidases, all genes are replaced by a single loxP site. The results of the screening of the AOXΔ 7 knock 179 out strain with primer pairs flanking the insertion sites are shown in Figure 2b. All PCR fragments show 180 the expected size confirming that all knock -outs and cre -recombination were successful and no 181 chromosomal rearrangements were induced. Some of the wild -type gene fragments with these 182 primers were too big to give amplicons. 183 In Supplementary Figure 1 the consecutive knock -outs with the resulting genotypes are shown. 184 185 .CC-BY-NC-ND 4.0 International licenseperpetuity. It is made available under a preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in The copyright holder for thisthis version posted October 21, 2024. ; https://doi.org/10.1101/2024.10.21.619423doi: bioRxiv preprint 186 Figure 2: Knock out scheme for the preparation of the septuple knock out strain (a) and PCR confirmation 187 of the septuple knock out (b) 188 189 A growth test on potato extract agar (PDA) was performed to determine the growth of the septuple 190 knock out strains taking the wild type into account. As shown in Figure 3f, all tested strains exhibit 191 similar growth as the wild-type. 192 193 ➢ TAM metabolization by AOX∆7 strain 194 Once the septuple knock -out strains w ere generated, a TAM feeding assay was performed to 195 determine whether the knock -out strains are still able to produce auxin in vitro. Two independently 196 derived septuple knock out strains as well as PH -1 wild type as control were inoculated in Fusarium 197 minimal media (FMM) and incubated at 20°C for four days. 1 mM tryptamine was added and samples 198 were taken every 24 hours over a total time period of four days. As expected, TAM was almost 199 completely converted to auxin by the wild type strain within 24 hours. In the cultures containing the 200 AOXΔ7 strains, TAM unexpectedly also completely disappeared after 48 hours, however, no auxin was 201 formed at that time. Between 72 and 96 hours about 20% of the initially supplemented tryptamine 202 was released again, indicating that most likely a reversible intermediate was formed, potentially by 203 .CC-BY-NC-ND 4.0 International licenseperpetuity. It is made available under a preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in The copyright holder for thisthis version posted October 21, 2024. ; https://doi.org/10.1101/2024.10.21.619423doi: bioRxiv preprint acetylation or methylation. Low amounts of auxin were detected after 96 hours which is presumably 204 due to the presence of flavin dependent amine oxidases or due to synthesis of auxin via other 205 pathways. 206 207 208 Figure 3: Tests on the septuple knock out strains compared to the wild type strain on TAM consumption 209 (0.5 µM TAM added) (a), and IAA formation in liquid culture (b), progress of infection on the susceptible 210 wheat cultivar Apogee (c), Auxin extracted from infected wheat ears 16 dpi (d), DON formation in liquid 211 culture over time (e), growth on PDA (f) 212 For the virulence tests two florets of 10 ears of the susceptible wheat cultivar Apogee were point 213 inoculated with 10 µl of a 4*104 spores/ml suspension. The progress of infection was documented over 214 a total time period of 16 days. Subsequently, the whole ears were harvested and extracted for 215 determination of the DON and IAA content. 216 .CC-BY-NC-ND 4.0 International licenseperpetuity. It is made available under a preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in The copyright holder for thisthis version posted October 21, 2024. ; https://doi.org/10.1101/2024.10.21.619423doi: bioRxiv preprint It is shown in Figure 3c that both septuple knock out strains show a significantly slower spread 217 compared to the wild type strain, advancing only throughout less than half the ear, while the wild-type 218 eventually infected all spikelets. Figure 3d shows that the auxin levels in the whole ear are significantly 219 higher in the ears treated with the wild type strain, even though there is a high variation among the 220 wild type treated ears. Interestingly, in the whole ground ear the DON content after 2 weeks was 221 higher, despite lower colonized area than in the wildtype infection, indicating that potentially loss of 222 auxin production may be compensated by higher DON produced in planta. 223 224 ➢ DON production in liquid medium 225 To confirm that the lower virulence of the septuple knock out strains is caused by the strongly impaired 226 auxin production, a test on DON production was performed since DON is contributing to virulence as 227 well. The AOXΔ 7 strains as well as the wild type strain were inoculated in liquid medium suitable for 228 DON production in vitro. Therefore, 2SM and incubation for three weeks at 20°C in the dark was done. 229 Samples were taken every week over a total time period of three weeks (Figure 3e). After one week of 230 incubation all strains show comparable DON levels. While the amount of DON in the cultures 231 containing the septuple knock out strains is increasing over time, the DO N concentration in the wild 232 type culture is comparable after one week but slightly decreasing after two weeks. After three weeks 233 of incubation the wild type still shows significantly lower DON levels (p<0.05) leading to the conclusion 234 that the DON production is not impaired in the septuple knock out strains. 235 Aware that the septuple knock out strain produced only low amounts of auxin compared to the wild 236 type strain, we set up an experiment to determine the change of IAA, TAM, TRP and DON levels over 237 time in infected wheat ears. Therefore, two spikelets in the middle of the ear of ten ears per strain and 238 time point were inoculated with 10 ml of a 4*104 spores/ml suspension or 10 µl sterile water as control. 239 After 3, 6, 9 and 12 days, 40 ears, respectively, were harvested and extracted as described in material 240 and methods followed by analysis by LC -MS/MS (Figure 4). As expected, in the ears treated with the 241 wild type strain the auxin levels are significantly higher compared to the ones inoculated with the 242 septuple knock out strains (p<0.05). In contrast, tryptamine levels are significantly lower in the PH -1 243 .CC-BY-NC-ND 4.0 International licenseperpetuity. It is made available under a preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in The copyright holder for thisthis version posted October 21, 2024. ; https://doi.org/10.1101/2024.10.21.619423doi: bioRxiv preprint wild type treated ears which is in line with our hypothesis since the septuple knock out strains can no 244 longer divert tryptamine into auxin production. After six- and nine -days post inoculation the TAM 245 levels are comparable between all strains indicating that auxin is primarily produced when the fungus 246 penetrates the plant. 247 248 Figure 4: Abundance of auxin (a), TAM (b), TRP (c) and DON (d) over time in infected wheat heads 249 250 The tryptophan levels in the ears inoculated with Fusarium are comparable among the strains. Yet, the 251 mock inoculated ears show significantly lower TRP levels 6 dpi , while a strong increase of the 252 tryptophan levels between nine and twelve dpi leads to significantly higher TRP levels compared to the 253 Fusarium treated ears. The DON levels are similar until 6 dpi. While AOXΔ7.1 shows only slightly lower 254 DON levels compared to the wild type strain, AOXΔ 7.2 has significantly lower DON levels nine and 255 twelve dpi (p < 0.01). We already showed that the septuple knock out s trains show a lower virulence 256 compared to the wild type strain. Since the whole ear was ground and extracted, we can assume that 257 the levels in the infected spikelets are similar or slightly higher than in the wild-type. 258 .CC-BY-NC-ND 4.0 International licenseperpetuity. It is made available under a preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in The copyright holder for thisthis version posted October 21, 2024. ; https://doi.org/10.1101/2024.10.21.619423doi: bioRxiv preprint 259 ➢ Complementation of AOX4 260 Since the septuple knock out strain went through multiple transformation procedures, we tested 261 whether auxin biosynthesis can be reconstituted by introducing AOX4. This gene was chosen since it 262 showed the highest enzyme activity with tryptamine when expressed in yeast ( Master thesis Pia 263 Spörhase - data not shown). The confirmation of the complementation was done in triplicates using a 264 feeding assay where TAM was supplemented to the liquid media. 265 266 267 Figure 5: IAA production by complementation strain; wheat infection – fungal spread (a); TAM feeding 268 assay: changes in TAM and auxin levels over time in liquid culture (b) 269 270 The results clearly indicate that the complementation was successful. Both complementation strains 271 metabolize about 100% of the supplemented tryptamine to auxin within one day , like the wild type. 272 The septuple knock out strain forms low amounts of auxin after three days. However, a reversible 273 intermediate must be formed from tryptamine since T AM is close to zero after 2 days of incubation 274 but increases until 4 days that almost 50% of the initially supplemented TAM are released again. 275 .CC-BY-NC-ND 4.0 International licenseperpetuity. It is made available under a preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in The copyright holder for thisthis version posted October 21, 2024. ; https://doi.org/10.1101/2024.10.21.619423doi: bioRxiv preprint An infection experiment was done to determine whether the virulence of the complementation strains 276 was reconstituted. The infection was observed over a total time period of 12 days since at this time 277 point more than 50% of the inoculated ears were completely infected. After 9 days of incubation one 278 of the complementation strains, Comp. 49, and the wild type show a significant ly higher virulence 279 (p<0.05) compared to the septuple knock out strain. After 12 days both complemented septuple knock 280 out strains showed a significantly higher virulence (p<0.05) , similar to the wild type strain (p<0.01) 281 compared to the parental septuple knockout strain (Figure 5a). 282 283

284 F. graminearum is often considered to be a necrotroph (Liao et al. 2022), which, in oversimplification, 285 is assumed to produce trichothecene toxins, killing the host plant and then living on the dead tissue. 286 Yet, there is increasing evidence that also F. graminearum has an early asymptomatic biotrophic phase 287 (Brown et al. 2017) . Our results indicate, that auxin generated early in the interaction is relevant for 288 virulence. We envision a model in which at low fungus density after infection the plants recognize the 289 presence of the invading pathogen, and start to produce hydroxycinnamic acid amides. These 290 compounds have been demonstrated to be antifungal, but also strengthen the cell wall and protect 291 the plant cells against pathogen invasion in this way (Campos et al. 2014) . Even though HCAA 292 accumulation induces the hypersensitive response in the plant (Walters 2003) it has been suggested 293 to have an impact on the resistance of wheat towards Fusarium graminearum (Gunnaiah et al. 2012). 294 A more r ecent study suggested that the timepoint of HCAA formation after infection is crucial for a 295 wheat plant determining its resistance level (Whitney et al. 2022) . We obtained evidence that 296 coumaroyl-tryptamne (and other HCAAs, synthesized, data not shown) are growth inhibitory. Yet, F. 297 graminearum can hydrolyze HCAAs, presumably by secreted amidohydrolases, an area of future 298 research. But it seems reasonabl e to assume that the direct antifu ngal activity of the products, 299 tryptamine and courmaric acid, is lower than that of courmaroyl -tryptamine and this is already a 300 detoxification process. Secondarily. the tryptamine released is a convenient nitrogen source if taken 301 up and metabolized by pero xisomal amine-oxidases. F. graminearum can use it as sole carbon and 302 .CC-BY-NC-ND 4.0 International licenseperpetuity. It is made available under a preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in The copyright holder for thisthis version posted October 21, 2024. ; https://doi.org/10.1101/2024.10.21.619423doi: bioRxiv preprint nitrogen source (Spörhase 2015) , but TAM also gets toxic at high concentrations above 125 mg/L 303 (about 0.8 mM), which is in the highest range observed in planta (Fig 4b). Yet, the fungus is able to 304 convert TAM into the plant growth hormone IAA, that at much lower concentrations is hormonally 305 active and suppresses defense. IAA has been reported to be growth inhibitory for F. graminearum in 306 high concentrations (0.1 -1 mM (~175 mg/ L)) in vitro (K. Luo et al. 2016) , and auxin can also be 307 metabolized. In the infection experiment shown in Figure 4 maximum levels above 60 mg/L IAA have 308 been detected, so the range where the fungus is also negatively affected can be reached. The high 309 auxin wave should diffuse faster than the fungal infection front moves, thereby conditioning a state of 310 susceptibility. The high auxin triggers its inactivation by induction of transcripts encoding enzymes 311 involved in glycosylation, amino-acid conjugation and oxidation. Yet, the production of active enzymes 312 could be blocked or delayed by the trichothecene toxin DON, blocking protein synthesis. 313 The main problem with Fusarium infection is the contamination of grain with the trichothecene 314 mycotoxin deoxynivalenol. One would expect that DON-levels in ears infected by the septuple mutant, 315 should be about half if only half of the ear is colonized, which was not observed. TAM, in contrast to 316 other amines, that are converted into HCAAs, like putrescine and agmatine, does only have (if at all) a 317 small stimulatory effect in DON production in vitro (K. Luo et al. 2016; Gardiner et al. 2010) . Yet, by 318 knocking out all amine oxidases, theoretically DON -inducing other amines may also accumulate to 319 higher levels, which could explain the unchanged or even higher DON levels observed, despite a 320 smaller portion of the ear was colonized. This phenomenon should to be addressed in future research. 321 The loss of the amine oxidases leads to lower virulence, indicating that auxin suppresses 322 defense, supposedly by antagonizing SA -mediated defense (Hao et al. 2018; Makandar et al. 2012) , 323 which is also targeted directly by fungal effectors capable to inactivate SA (Qi et al. 2019). A relevant 324 question is how widespread the hijacking of auxin signaling via amine -oxidase mediated auxin 325 production from TAM is in fungal pathogens. Amine -oxidases are present in many fungi, and the 326 mechanism described her seems to be widespread and redundant. We have observed that for instance 327 many members of the Fusarium oxysporum and Gibberella fujikuroi species complex in vi tro can 328 .CC-BY-NC-ND 4.0 International licenseperpetuity. It is made available under a preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in The copyright holder for thisthis version posted October 21, 2024. ; https://doi.org/10.1101/2024.10.21.619423doi: bioRxiv preprint efficiently produce auxin in tryptamine supplemented medium. In planta, the limiting factor is most 329 likely the ability to hydrolyze the HCAAs. 330 In the septuple aminoxidase deficient mutant still residual a uxin production after extended time in 331 vitro was observed, and also in vivo lower, but still elevated levels compared to mock treated plants 332 were observed (Fig 4a). Potentially also flavine -dependent amine oxidases might contribute to TAM-333 dependent auxin synthesis. Yet, most likely, the fungus can also tap into the high plant tryptophan pool 334 (Fig 4C) and synthesize auxin in other ways – candidate Fusarium YUCCA-like genes exist, that are still 335 uncharacterized. 336 Wheat plants upon Fusarium infection do not only accumulate TAM-containing HCAAs, but also high 337 levels of serotonin-derived metabolites. While serotonin is derived from hydroxylated -tryptamine in 338 animals, TRP is first decarboxylated and then tryptamine can be hydroxylated to generate serotonin in 339 plants. When compounds like feruloyl-serotonin are hydrolyzed, the released serotonin can also be a 340 substrate of amine-oxidases and via aldehyde-dehydrogenase, 5-Hydoxy-IAA is generated in high yield. 341 Yet, when this metabolite is turned against the plant, it has much weaker auxin activity. In oat it has 342 been reported that 5-HIAA has about 1% of the activity of DON. So, a hypothesis to be tested in future 343 work is that plants which have higher ability to shift TAM into SER and the corresponding HCAAs have 344 higher Fusarium resistance. Likewise of im portance is the ability of plants to cope with the highly 345 elevated auxin levels triggered by the fungus . Processes like glycosylation, oxidation and amino -acid 346 conjugation of auxin my therefor be relevant for resistance breeding. In so far unsuccessful attempts 347 to identify the relevant amidohydrolases, we found that one Fusarium effector protein has the ability 348 to hydrolyze the IAA -Asp conjugate ( Manuscript in preparation ). Seemingly auxin inactivation is a n 349 important battleground in the interaction of the pathogen and the host . Another possibility of plants 350 to counteract auxin is the ability to desensitize auxin signaling components (e.g. the main auxin 351 receptor TIR, (Su et al. 2021) by RNA-interference with microRNAs (P. Luo et al. 2022) . Yet, for plant 352 breeders it is no option to trade Fusarium resistance to alter ed grain development and y ield losses. 353 Auxin is highly relevant for developmental processes leading to embryo development and grain filling 354 (Song et al. 2024) . To find the right b alance between growth and resistance remains a difficult task 355 .CC-BY-NC-ND 4.0 International licenseperpetuity. It is made available under a preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in The copyright holder for thisthis version posted October 21, 2024. ; https://doi.org/10.1101/2024.10.21.619423doi: bioRxiv preprint (Denancé et al. 2013), and the insights from this work can hopefully aid the goal to reduce mycotoxin 356 contamination of grain. 357 358 359 Figure 6: Auxin hypothesis 360 361

362 We showed that Fusarium graminearum PH-1 is able to cleave Cou-TAM, an HCAA which is formed by 363 plants upon infection as defense response. Furthermore, we demonstrated that the re leased TAM is 364 metabolized to auxin. We assessed the auxin, TAM, Trp and DON levels in wheat ears infected with the 365 wild type and both septuple knock out strains. Our results lead to the conclusion that on one side auxin 366 produced by the pathogen is indeed promoting virulence but also that Fusa rium is able to cleave the 367 plant defense compound Cou-TAM and use the released TAM as substrate for auxin production. This 368 indicates that the pathogen is not only interfering with plant defense upon infection but also degrading 369 defense compounds of the plant, leading to imbalanced hormone homeostasis and susceptibility. 370 371 372 .CC-BY-NC-ND 4.0 International licenseperpetuity. It is made available under a preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in The copyright holder for thisthis version posted October 21, 2024. ; https://doi.org/10.1101/2024.10.21.619423doi: bioRxiv preprint

373 • Growth test on CouTam 374 For the growth test, spores were generated by inoculation of mycelium scratched from a plate in 50 375 ml Mung Bean Soup (MBS). The samples were incubated at 20°C, 140 rpm for three days. For the agar 376 diffusion test, sterilized filter papers were soaked with 10 µl of a 0.5 mM CouTAM solution (2% DMSO 377 as control). For the growth test, FMM plates containing different amounts of CouTAM ranging from 0 378 mg/l to 1000 mg/l were prepared and the diameter of the mycelium was measured every day over one 379 week. 380 381 • Plasmid preparation for the knock-outs 382 The flanking regions of the respective gene were amplified by PCR followed by cloning in the plasmids 383 as shown in Table 1. 384 Table 1: Cloning strategy of the flanking regions of AOX candidate genes. The vectors used in this experiment have been described by 385 Twaruschek et al., 2018 386 Gene Name Region Cloning sites Primer pairs Vector FGSG_15961 AOX1 5´ BcuI/SfiI 2581 + 2582 pKT247 3´ HindIII/SalI 2583 + 2584 FGSG_03278 AOX2 5´ BcuI/SfiI 2827 + 2828 pKT247 3´ HindIII/SalI 2829 + 2830 FGSG_12129 AOX3 5´ BcuI/SfiI 2779 + 2780 pASB43 3´ HindIII/SalI 2781 + 2782 FGSG_02279 AOX4 5´ BcuI/SfiI 2783 + 2784 pKT245 3´ SplI/SalI 2785 + 2786 FGSG_10587 AOX6 5´ BcuI/SfiI 3003 + 3004 pKT245 3´ HindIII/SalI 3005 + 3006 FGSG_10677 AOX7 5´ BcuI/SfiI 3089 + 3090 pKT245 3´ HindIII/SalI 3091 + 3092 .CC-BY-NC-ND 4.0 International licenseperpetuity. It is made available under a preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in The copyright holder for thisthis version posted October 21, 2024. ; https://doi.org/10.1101/2024.10.21.619423doi: bioRxiv preprint FGSG_13604 AOX8 5´ BcuI/SfiI 2831 + 2832 pKT248 3´ HindIII/SalI 2833 + 2834 387 The transformation and marker recycling were performed as described by Twaruschek et al. (2018). 388 389 • IAA formation – time course 390 To test the knock out strains on their ability to produce auxin, a pre -culture was prepared by 391 inoculating 1*105 spores of PH-1 wild type and PCR confirmed single and multiple knock out strains in 392 50 ml Fusarium minimal media (FMM) which was incubated at 20°C, 180 rpm for 3 days. 1 mM 393 tryptamine (TAM) was added to each culture and samples were taken at time point 0 and then every 394 24 hours over four days. The experiment was carried out in three replicates. 395 For sampling 1 ml of the culture was transferred to a 1.5 ml tube and centrifuged for 1 minute at full 396 speed. 500 µl of the supernatant were transferred to another tube containing 500 µl methanol. The 397 samples were vortexed for 30 seconds and then centrifuged at full speed for five minutes. 50 µl of 398 these samples were transferred to a HPLC vial containing 950 µl methanol resulting in a final dilution 399 of 1:40 for the measurements. The samples were measured by LC-MS. 400 401 • Virulence tests 402 For the virulence tests the susceptible wheat cultivar Apogee was used. The strains to be tested were 403 sporulated in 50 ml MBS followed by incubation at 20°C, 140 rpm for three days. Subsequently, the 404 spores were filtered, counted and diluted to a final concentration of 4*10 4 spores/ml. Four florets of 405 two spikelets in the middle of the ear were inoculated with 10 µl of the spore suspension. The ears 406 were wrapped with a plastic bag which was previously sprayed with water to provide humidity and 407 incubated at 20°C with a day/night cycle 16h/8h. The progress of infection is recorded every two days. 408 409 • AOX4 complementation 410 .CC-BY-NC-ND 4.0 International licenseperpetuity. It is made available under a preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in The copyright holder for thisthis version posted October 21, 2024. ; https://doi.org/10.1101/2024.10.21.619423doi: bioRxiv preprint For the complementation, AOX4 was amplified using primer 5´ - CTTTGACAATGCTGGTAGATG -3´ and 411 5´- ATTGTTATCACATATCGCATTAC -3´ with an annealing temperature of 55°C and an extension time of 412 128 seconds. The final plasmid consists of AOX4 flanked by the 5´- and the 3´-flanking region with nptII 413 adjacent. As prokaryotic selection marker ampicillin was used. Prior transformation of the Fusarium 414 graminearum Δ7 strain, the plasmid was linearized using SalI. Two independent complementation 415 transformants were obtained. The integration of AOX4 was determined by a TAM feeding assay in 416 liquid culture. Therefore, 1*105 spores of selected transformants as well as the s eptuple knock out- 417 and the wild type strain were inoculated in 20 ml FMM. After three days of incubation at 20°C, 180 418 rpm 0.5 mM Tam was supplemented. Samples were taken every 24 hours over a total time period of 419 4 days starting with 0 hours. For the measurements 1:40 dilutions were prepared. 420 421 422 423 424 .CC-BY-NC-ND 4.0 International licenseperpetuity. It is made available under a preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in The copyright holder for thisthis version posted October 21, 2024. ; https://doi.org/10.1101/2024.10.21.619423doi: bioRxiv preprint

425 Aalders, Thomas R., Mara de Sain, Fleur Gawehns, Nina Oudejans, Yoran D. Jak, 426 Henk L. Dekker, Martijn Rep, Harrold A. van den Burg, and Frank L. W. 427 Takken. 2024. “Specific Members of the TOPLESS Family Are Susceptibility 428 Genes for Fusarium Wilt in Tomato and Arabidopsis.” Plant Biotechnology 429 Journal 22 (1): 248–61. https://doi.org/10.1111/pbi.14183. 430 Bindics, Janos, Mamoona Khan, Simon Uhse, Benjamin Kogelmann, Laura Baggely, 431 Daniel Reumann, Kishor D. Ingole, et al. 2022. “Many Ways to TOPLESS - 432 Manipulation of Plant Auxin Signalling by a Cluster of Fungal Effectors.” The 433 New Phytologist 236 (4): 1455–70. https://doi.org/10.1111/nph.18315. 434 Boddu, Jayanand, Seungho Cho, Warren M. Kruger, and Gary J. Muehlbauer. 2006. 435 “Transcriptome Analysis of the Barley-Fusarium Graminearum Interaction.” 436 Molecular Plant-Microbe Interactions: MPMI 19 (4): 407–17. 437 https://doi.org/10.1094/MPMI-19-0407. 438 Böttger, M., K. C. Engvild, and H. Soll. 1978. “Growth of Avena Coleoptiles and pH 439 Drop of Protoplast Suspensions Induced by Chlorinated Indoleacetic Acids.” 440 Planta 140 (1): 89–92. https://doi.org/10.1007/BF00389385. 441 Brown, Neil A., Jess Evans, Andrew Mead, and Kim E. Hammond-Kosack. 2017. “A 442 Spatial Temporal Analysis of the Fusarium Graminearum Transcriptome 443 during Symptomless and Symptomatic Wheat Infection.” Molecular Plant 444 Pathology 18 (9): 1295–1312. https://doi.org/10.1111/mpp.12564. 445 Campos, Laura, Purificación Lisón, María Pilar López-Gresa, Ismael Rodrigo, Laura 446 Zacarés, Vicente Conejero, and José María Bellés. 2014. “Transgenic Tomato 447 Plants Overexpressing Tyramine N-Hydroxycinnamoyltransferase Exhibit 448 Elevated Hydroxycinnamic Acid Amide Levels and Enhanced Resistance to 449 Pseudomonas Syringae.” Molecular Plant-Microbe Interactions: MPMI 27 (10): 450 1159–69. https://doi.org/10.1094/MPMI-04-14-0104-R. 451 Cao, Xu, Honglei Yang, Chunqiong Shang, Sang Ma, Li Liu, and Jialing Cheng. 452 2019. “The Roles of Auxin Biosynthesis YUCCA Gene Family in Plants.” 453 International Journal of Molecular Sciences 20 (24): 6343. 454 https://doi.org/10.3390/ijms20246343. 455 Denancé, Nicolas, Andrea Sánchez-Vallet, Deborah Goffner, and Antonio Molina. 456 2013. “Disease Resistance or Growth: The Role of Plant Hormones in 457 Balancing Immune Responses and Fitness Costs.” Frontiers in Plant Science 458 4:155. https://doi.org/10.3389/fpls.2013.00155. 459 Doppler, Maria, Bernhard Kluger, Christoph Bueschl, Barbara Steiner, Hermann 460 Buerstmayr, Marc Lemmens, Rudolf Krska, Gerhard Adam, and Rainer 461 Schuhmacher. 2019. “Stable Isotope-Assisted Plant Metabolomics: 462 Investigation of Phenylalanine-Related Metabolic Response in Wheat Upon 463 Treatment With the Fusarium Virulence Factor Deoxynivalenol.” Frontiers in 464 Plant Science 10:1137. https://doi.org/10.3389/fpls.2019.01137. 465 Du, Yunlong, Ricardo Tejos, Martina Beck, Ellie Himschoot, Hongjiang Li, Silke 466 Robatzek, Steffen Vanneste, and Jiří Friml. 2013. “Salicylic Acid Interferes 467 with Clathrin-Mediated Endocytic Protein Trafficking.” Proceedings of the 468 National Academy of Sciences 110 (19): 7946–51. 469 https://doi.org/10.1073/pnas.1220205110. 470 Evangelisti, Edouard, Benjamin Govetto, Naïma Minet-Kebdani, Marie-Line Kuhn, 471 Agnès Attard, Michel Ponchet, Franck Panabières, and Mathieu Gourgues. 472 2013. “The Phytophthora Parasitica RXLR Effector Penetration-Specific 473 Effector 1 Favours Arabidopsis Thaliana Infection by Interfering with Auxin 474 .CC-BY-NC-ND 4.0 International licenseperpetuity. It is made available under a preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in The copyright holder for thisthis version posted October 21, 2024. ; https://doi.org/10.1101/2024.10.21.619423doi: bioRxiv preprint Physiology.” The New Phytologist 199 (2): 476–89. 475 https://doi.org/10.1111/nph.12270. 476 Fu, Jing, Hongbo Liu, Yu Li, Huihui Yu, Xianghua Li, Jinghua Xiao, and Shiping 477 Wang. 2011. “Manipulating Broad-Spectrum Disease Resistance by 478 Suppressing Pathogen-Induced Auxin Accumulation in Rice.” Plant Physiology 479 155 (1): 589–602. https://doi.org/10.1104/pp.110.163774. 480 Fu, Shih-Feng, Jyuan-Yu Wei, Hung-Wei Chen, Yen-Yu Liu, Hsueh-Yu Lu, and Jui-481 Yu Chou. 2015. “Indole-3-Acetic Acid: A Widespread Physiological Code in 482 Interactions of Fungi with Other Organisms.” Plant Signaling & Behavior 10 483 (8): e1048052. https://doi.org/10.1080/15592324.2015.1048052. 484 Gardiner, Donald M., Kemal Kazan, Sebastien Praud, Francois J. Torney, Anca 485 Rusu, and John M. Manners. 2010. “Early Activation of Wheat Polyamine 486 Biosynthesis during Fusarium Head Blight Implicates Putrescine as an Inducer 487 of Trichothecene Mycotoxin Production.” BMC Plant Biology 10 488 (December):289. https://doi.org/10.1186/1471-2229-10-289. 489 Gomes, G. L. B., and K. C. Scortecci. 2021. “Auxin and Its Role in Plant 490 Development: Structure, Signalling, Regulation and Response Mechanisms.” 491 Plant Biology (Stuttgart, Germany) 23 (6): 894–904. 492 https://doi.org/10.1111/plb.13303. 493 Güldener, Ulrich, Gertrud Mannhaupt, Martin Münsterkötter, Dirk Haase, Matthias 494 Oesterheld, Volker Stümpflen, Hans-Werner Mewes, and Gerhard Adam. 495 2006. “FGDB: A Comprehensive Fungal Genome Resource on the Plant 496 Pathogen Fusarium Graminearum.” Nucleic Acids Research 34 (Database 497 issue): D456-458. https://doi.org/10.1093/nar/gkj026. 498 Gunnaiah, Raghavendra, Ajjamada C. Kushalappa, Raj Duggavathi, Stephen Fox, 499 and Daryl J. Somers. 2012. “Integrated Metabolo-Proteomic Approach to 500 Decipher the Mechanisms by Which Wheat QTL (Fhb1) Contributes to 501 Resistance against Fusarium Graminearum.” PloS One 7 (7): e40695. 502 https://doi.org/10.1371/journal.pone.0040695. 503 Hao, Qunqun, Wenqiang Wang, Xiuli Han, Jingzheng Wu, Bo Lyu, Fengjuan Chen, 504 Allan Caplan, et al. 2018. “Isochorismate-Based Salicylic Acid Biosynthesis 505 Confers Basal Resistance to Fusarium Graminearum in Barley.” Molecular 506 Plant Pathology 19 (8): 1995–2010. https://doi.org/10.1111/mpp.12675. 507 Hayashi, Ken-Ichiro, Kazushi Arai, Yuki Aoi, Yuka Tanaka, Hayao Hira, Ruipan Guo, 508 Yun Hu, et al. 2021. “The Main Oxidative Inactivation Pathway of the Plant 509 Hormone Auxin.” Nature Communications 12 (1): 6752. 510 https://doi.org/10.1038/s41467-021-27020-1. 511 Kidd, Brendan N., Narendra Y. Kadoo, Bruno Dombrecht, Mücella Tekeoglu, Donald 512 M. Gardiner, Louise F. Thatcher, Elizabeth A. B. Aitken, Peer M. Schenk, John 513 M. Manners, and Kemal Kazan. 2011. “Auxin Signaling and Transport 514 Promote Susceptibility to the Root-Infecting Fungal Pathogen Fusarium 515 Oxysporum in Arabidopsis.” Molecular Plant-Microbe Interactions: MPMI 24 516 (6): 733–48. https://doi.org/10.1094/MPMI-08-10-0194. 517 Kunkel, Barbara N., and Christopher P. Harper. 2018. “The Roles of Auxin during 518 Interactions between Bacterial Plant Pathogens and Their Hosts.” Journal of 519 Experimental Botany 69 (2): 245–54. https://doi.org/10.1093/jxb/erx447. 520 Kunkel, Barbara N., and Joshua M.B. Johnson. 2021. “Auxin Plays Multiple Roles 521 during Plant–Pathogen Interactions.” Cold Spring Harbor Perspectives in 522 Biology 13 (9): a040022. https://doi.org/10.1101/cshperspect.a040022. 523 Kushalappa, Ajjamada C., Kalenahalli N. Yogendra, and Shailesh Karre. 2016. “Plant 524 Innate Immune Response: Qualitative and Quantitative Resistance.” Critical 525 .CC-BY-NC-ND 4.0 International licenseperpetuity. It is made available under a preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in The copyright holder for thisthis version posted October 21, 2024. ; https://doi.org/10.1101/2024.10.21.619423doi: bioRxiv preprint Reviews in Plant Sciences 35 (1): 38–55. 526 https://doi.org/10.1080/07352689.2016.1148980. 527 Liao, Chao-Jan, Sara Hailemariam, Amir Sharon, and Tesfaye Mengiste. 2022. 528 “Pathogenic Strategies and Immune Mechanisms to Necrotrophs: Differences 529 and Similarities to Biotrophs and Hemibiotrophs.” Current Opinion in Plant 530 Biology 69 (October):102291. https://doi.org/10.1016/j.pbi.2022.102291. 531 Liu, Saifei, Jincheng Jiang, Zihui Ma, Muye Xiao, Lan Yang, Binnian Tian, Yang Yu, 532 Chaowei Bi, Anfei Fang, and Yuheng Yang. 2022. “The Role of 533 Hydroxycinnamic Acid Amide Pathway in Plant Immunity.” Frontiers in Plant 534 Science 13:922119. https://doi.org/10.3389/fpls.2022.922119. 535 Luo, Kun, Hélène Rocheleau, Peng-Fei Qi, You-Liang Zheng, Hui-Yan Zhao, and 536 Thérèse Ouellet. 2016. “Indole-3-Acetic Acid in Fusarium Graminearum: 537 Identification of Biosynthetic Pathways and Characterization of Physiological 538 Effects.” Fungal Biology 120 (9): 1135–45. 539 https://doi.org/10.1016/j.funbio.2016.06.002. 540 Luo, Pan, Dongwei Di, Lei Wu, Jiangwei Yang, Yufang Lu, and Weiming Shi. 2022. 541 “MicroRNAs Are Involved in Regulating Plant Development and Stress 542 Response through Fine-Tuning of TIR1/AFB-Dependent Auxin Signaling.” 543 International Journal of Molecular Sciences 23 (1): 510. 544 https://doi.org/10.3390/ijms23010510. 545 Luo, Pan, Ting-Ting Li, Wei-Ming Shi, Qi Ma, and Dong-Wei Di. 2023. “The Roles of 546 GRETCHEN HAGEN3 (GH3)-Dependent Auxin Conjugation in the Regulation 547 of Plant Development and Stress Adaptation.” Plants (Basel, Switzerland) 12 548 (24): 4111. https://doi.org/10.3390/plants12244111. 549 Mackintosh, Caroline A., David F. Garvin, Lorien E. Radmer, Shane J. Heinen, and 550 Gary J. Muehlbauer. 2006. “A Model Wheat Cultivar for Transformation to 551 Improve Resistance to Fusarium Head Blight.” Plant Cell Reports 25 (4): 313–552 19. https://doi.org/10.1007/s00299-005-0059-4. 553 Macoy, Donah Mary J., Shahab Uddin, Gyeongik Ahn, Son Peseth, Gyeong Ryul 554 Ryu, Joon Yung Cha, Jong-Yeol Lee, et al. 2022. “Effect of Hydroxycinnamic 555 Acid Amides, Coumaroyl Tyramine and Coumaroyl Tryptamine on Biotic 556 Stress Response in Arabidopsis.” Journal of Plant Biology 65 (2): 145–55. 557 https://doi.org/10.1007/s12374-021-09341-2. 558 Makandar, Ragiba, Vamsi J. Nalam, Hyeonju Lee, Harold N. Trick, Yanhong Dong, 559 and Jyoti Shah. 2012. “Salicylic Acid Regulates Basal Resistance to Fusarium 560 Head Blight in Wheat.” Molecular Plant-Microbe Interactions: MPMI 25 (3): 561 431–39. https://doi.org/10.1094/MPMI-09-11-0232. 562 Mano, Yoshihiro, and Keiichirou Nemoto. 2012. “The Pathway of Auxin Biosynthesis 563 in Plants.” Journal of Experimental Botany 63 (8): 2853–72. 564 https://doi.org/10.1093/jxb/ers091. 565 Mutka, Andrew M., Stephen Fawley, Tiffany Tsao, and Barbara N. Kunkel. 2013. 566 “Auxin Promotes Susceptibility to Pseudomonas Syringae via a Mechanism 567 Independent of Suppression of Salicylic Acid-Mediated Defenses.” The Plant 568 Journal: For Cell and Molecular Biology 74 (5): 746–54. 569 https://doi.org/10.1111/tpj.12157. 570 Navarrete, Fernando, Michelle Gallei, Aleksandra E. Kornienko, Indira Saado, 571 Mamoona Khan, Khong-Sam Chia, Martin A. Darino, Janos Bindics, and 572 Armin Djamei. 2022. “TOPLESS Promotes Plant Immunity by Repressing 573 Auxin Signaling and Is Targeted by the Fungal Effector Naked1.” Plant 574 Communications 3 (2): 100269. https://doi.org/10.1016/j.xplc.2021.100269. 575 .CC-BY-NC-ND 4.0 International licenseperpetuity. It is made available under a preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in The copyright holder for thisthis version posted October 21, 2024. ; https://doi.org/10.1101/2024.10.21.619423doi: bioRxiv preprint Niehaus, Eva-Maria, Martin Münsterkötter, Robert H. Proctor, Daren W. Brown, Amir 576 Sharon, Yifat Idan, Liat Oren-Young, et al. 2016. “Comparative ‘Omics’ of the 577 Fusarium Fujikuroi Species Complex Highlights Differences in Genetic 578 Potential and Metabolite Synthesis.” Genome Biology and Evolution 8 (11): 579 3574–99. https://doi.org/10.1093/gbe/evw259. 580 Pasquet, Jean-Claude, Séjir Chaouch, Catherine Macadré, Sandrine Balzergue, 581 Stéphanie Huguet, Marie-Laure Martin-Magniette, Floriant Bellvert, et al. 2014. 582 “Differential Gene Expression and Metabolomic Analyses of Brachypodium 583 Distachyon Infected by Deoxynivalenol Producing and Non-Producing Strains 584 of Fusarium Graminearum.” BMC Genomics 15 (1): 629. 585 https://doi.org/10.1186/1471-2164-15-629. 586 Petti, Carloalberto, Kathrin Reiber, Shahin S. Ali, Margaret Berney, and Fiona M. 587 Doohan. 2012. “Auxin as a Player in the Biocontrol of Fusarium Head Blight 588 Disease of Barley and Its Potential as a Disease Control Agent.” BMC Plant 589 Biology 12 (November):224. https://doi.org/10.1186/1471-2229-12-224. 590 Qi, Peng-Fei, Ya-Zhou Zhang, Cai-Hong Liu, Qing Chen, Zhen-Ru Guo, Yan Wang, 591 Bin-Jie Xu, et al. 2019. “Functional Analysis of FgNahG Clarifies the 592 Contribution of Salicylic Acid to Wheat (Triticum Aestivum) Resistance against 593 Fusarium Head Blight.” Toxins 11 (2): 59. 594 https://doi.org/10.3390/toxins11020059. 595 Robert-Seilaniantz, Alexandre, Murray Grant, and Jonathan D. G. Jones. 2011. 596 “Hormone Crosstalk in Plant Disease and Defense: More than Just 597 Jasmonate-Salicylate Antagonism.” Annual Review of Phytopathology 49:317–598 43. https://doi.org/10.1146/annurev-phyto-073009-114447. 599 Rosquete, Michel Ruiz, Elke Barbez, and Jürgen Kleine-Vehn. 2012. “Cellular Auxin 600 Homeostasis: Gatekeeping Is Housekeeping.” Molecular Plant 5 (4): 772–86. 601 https://doi.org/10.1093/mp/ssr109. 602 Song, Teng, Qiang Huo, Chaobin Li, Qun Wang, Lijun Cheng, Weiwei Qi, Zeyang 603 Ma, and Rentao Song. 2024. “The Biosynthesis of Storage Reserves and 604 Auxin Is Coordinated by a Hierarchical Regulatory Network in Maize 605 Endosperm.” The New Phytologist 243 (5): 1855–69. 606 https://doi.org/10.1111/nph.19949. 607 Spörhase, Pia. 2015. “Fusarium Graminearum Can Subvert the Synthesis of 608 Tryptamine-Derived Defense Compounds to Produce Auxin.” Wien. 609 http://zidapp.boku.ac.at/abstracts/search_abstract.php?paID=3&paLIST=0&pa610 SID=13272. 611 Su, Peisen, Lanfei Zhao, Wen Li, Jinxiao Zhao, Jun Yan, Xin Ma, Anfei Li, Hongwei 612 Wang, and Lingrang Kong. 2021. “Integrated Metabolo-Transcriptomics and 613 Functional Characterization Reveals That the Wheat Auxin Receptor TIR1 614 Negatively Regulates Defense against Fusarium Graminearum.” Journal of 615 Integrative Plant Biology 63 (2): 340–52. https://doi.org/10.1111/jipb.12992. 616 Sugawara, Satoko, Shojiro Hishiyama, Yusuke Jikumaru, Atsushi Hanada, Takeshi 617 Nishimura, Tomokazu Koshiba, Yunde Zhao, Yuji Kamiya, and Hiroyuki 618 Kasahara. 2009. “Biochemical Analyses of Indole-3-Acetaldoxime-Dependent 619 Auxin Biosynthesis in Arabidopsis.” Proceedings of the National Academy of 620 Sciences of the United States of America 106 (13): 5430–35. 621 https://doi.org/10.1073/pnas.0811226106. 622 Takao, Koichi, Kazuhiro Toda, Takayuki Saito, and Yoshiaki Sugita. 2017. “Synthesis 623 of Amide and Ester Derivatives of Cinnamic Acid and Its Analogs: Evaluation 624 of Their Free Radical Scavenging and Monoamine Oxidase and 625 .CC-BY-NC-ND 4.0 International licenseperpetuity. It is made available under a preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in The copyright holder for thisthis version posted October 21, 2024. ; https://doi.org/10.1101/2024.10.21.619423doi: bioRxiv preprint Cholinesterase Inhibitory Activities.” Chemical and Pharmaceutical Bulletin 65 626 (11): 1020–27. https://doi.org/10.1248/cpb.c17-00416. 627 Tararina, Margarita A., and Karen N. Allen. 2020. “Bioinformatic Analysis of the 628 Flavin-Dependent Amine Oxidase Superfamily: Adaptations for Substrate 629 Specificity and Catalytic Diversity.” Journal of Molecular Biology 432 (10): 630 3269. https://doi.org/10.1016/j.jmb.2020.03.007. 631 Tsavkelova, Elena, Birgitt Oeser, Liat Oren-Young, Maayan Israeli, Yehezkel Sasson, 632 Bettina Tudzynski, and Amir Sharon. 2012. “Identification and Functional 633 Characterization of Indole-3-Acetamide-Mediated IAA Biosynthesis in Plant-634 Associated Fusarium Species.” Fungal Genetics and Biology: FG & B 49 (1): 635 48–57. https://doi.org/10.1016/j.fgb.2011.10.005. 636 Twaruschek, Krisztian, Pia Spörhase, Herbert Michlmayr, Gerlinde Wiesenberger, 637 and Gerhard Adam. 2018. “New Plasmids for Fusarium Transformation 638 Allowing Positive-Negative Selection and Efficient Cre-loxP Mediated Marker 639 Recycling.” Frontiers in Microbiology 9. 640 https://doi.org/10.3389/fmicb.2018.01954. 641 Waadt, Rainer, Charles A. Seller, Po-Kai Hsu, Yohei Takahashi, Shintaro 642 Munemasa, and Julian I. Schroeder. 2022. “Plant Hormone Regulation of 643 Abiotic Stress Responses.” Nature Reviews. Molecular Cell Biology 23 (10): 644 680–94. https://doi.org/10.1038/s41580-022-00479-6. 645 Walters, Dale R. 2003. “Polyamines and Plant Disease.” Phytochemistry 64 (1): 97–646 107. https://doi.org/10.1016/s0031-9422(03)00329-7. 647 Wang, Lipu, Qiang Li, Ziying Liu, Anu Surendra, Youlian Pan, Yifeng Li, L. Irina 648 Zaharia, Thérèse Ouellet, and Pierre R. Fobert. 2018. “Integrated 649 Transcriptome and Hormone Profiling Highlight the Role of Multiple 650 Phytohormone Pathways in Wheat Resistance against Fusarium Head Blight.” 651 PloS One 13 (11): e0207036. https://doi.org/10.1371/journal.pone.0207036. 652 Whitney, Kristin, Gerardo Gracia-Gomez, James A. Anderson, and Senay Simsek. 653 2022. “Time Course Metabolite Profiling of Fusarium Head Blight-Infected 654 Hard Red Spring Wheat Using Ultra-High-Performance Liquid 655 Chromatography Coupled with Quadrupole Time of Flight/MS.” Journal of 656 Agricultural and Food Chemistry 70 (13): 4152–63. 657 https://doi.org/10.1021/acs.jafc.1c08374. 658 Zhao, Yunde. 2010. “Auxin Biosynthesis and Its Role in Plant Development.” Annual 659 Review of Plant Biology 61:49–64. https://doi.org/10.1146/annurev-arplant-660 042809-112308. 661 662 .CC-BY-NC-ND 4.0 International licenseperpetuity. It is made available under a preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in The copyright holder for thisthis version posted October 21, 2024. ; https://doi.org/10.1101/2024.10.21.619423doi: bioRxiv preprint