GABARAPL2 and Alix mediate reciprocal regulation of autophagy and exosome pathways to facilitate cellular homeostasis | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article GABARAPL2 and Alix mediate reciprocal regulation of autophagy and exosome pathways to facilitate cellular homeostasis Naveen Soni, Megha Chaudhary, Bhawana Bissa This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-8570970/v1 This work is licensed under a CC BY 4.0 License Status: Under Revision Version 1 posted 4 You are reading this latest preprint version Abstract The continuous reliance of cancer cells to acquire energy and communicate their nutrient needs makes them resilient and vulnerable. It provides an opportunity to stifle cancer cells by restricting their energy generation and communication ability. Autophagy and exosome biogenesis pathways are essential in maintaining the robust growth and survival of cancer cells. In this study, we observed that inhibition of one pathway altered the expression of genes in the other pathway. Exosome biogenesis, when blocked, led to an increase in breast cancer cell proliferation, while inhibition of autophagy did not significantly affect cancer cell proliferation. The two pathways, when independently inhibited, did not present any significant effect on restricting cancer cell growth. However, a combined inhibition of both pathways led to substantial reduction in cancer cell proliferation. To evaluate the reciprocal regulation of two pathways, we blocked the autophagy pathway and observed an increase in the release of exosomes from MDA-MB-231 cells, along with decreased expression of Alix and CD63 genes. In contrast, inhibition of exosome biogenesis led to an increase in the expression of ATG5 and ATG16L1, and a significant decrease in expression of GABARAPL2. Interestingly, the knockdown of GABARAPL2 abrogated the decrease in Alix expression upon autophagy inhibition, highlighting the essential role of GABARAPL2 in Alix secretion. Thus, our study highlights for the first time the synergistic effects of autophagy and exosome pathway inhibition in restricting cancer cell growth as well as the involvement of GABARAPL2 in the regulation of exosome secretion via modulating Alix expression. Exosomes Autophagy Breast cancer ATG8 Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Introduction Extracellular vesicles (EVs) are micro/nano-sized lipid bound secretory vesicles that are released by almost all types of cells and are a conserved mechanism for intercellular communication throughout the evolution[ 1 ]. EVs are broadly categorized in three sub-types based on the synthesis and size: Exosomes (endosomal EVs) (30-150nm) formed by inward budding of mature endosome, Microvesicles/ectosomes (non-endosomal EVs) (200-2000nm) formed by outward budding of plasma membrane, and Apoptotic bodies (non-endosomal EVs) (500-4000nm) formed through membrane blebbing during the apoptosis[ 2 ]. Exosomes originate from the endosome, in which the inward budding of the endosome membrane causes the formation of intraluminal vesicles (ILVs), that later mature into multivesicular bodies (MVBs)[ 3 ]. To date, two processes have been identified for exosome biogenesis: an endosomal sorting complex required for transport-dependent (ESCRT) and an ESCRT-independent pathway. The ESCRT machinery operates in a stepwise cascade, in which ESCRT-0 and ESCRT-I first cluster ubiquitylated cargoes onto the microdomains of the MVB membrane. This recruits ESCRT-II and ESCRT-III, which trigger the inward budding of membrane and fission of microdomains, resulting in a flask-shaped bud inside the MVB lumen. Alix, another critical component of exosome machinery, assists budding and ILV formation by binding with the ESCRT-III subunit[ 4 ]. An ATPase-VPS4 finally buds off the vesicle. The ESCRT-independent mechanism can be elaborated as ceramide-dependent and tetraspanin-dependent. In the former, sphingomyelin is hydrolyzed by neutral sphingomyelinases (nSmases) to generate ceramide that may generate membrane subdomains and induce a membrane curvature inside the MVBs[ 5 ]. As such, inhibitors of nSMase such as GW4869 are now frequently used to inhibit exosome biogenesis[ 6 ]. Autophagy is a highly regulated process that is present at the basal level in most of the cells, but may also be crucial to the survival of cancer cells. It has been classified into three types: Macroautophagy, Chaperone-mediated autophagy (CMA), and Microautophagy. The autophagy process includes the initiation of phagophore formation, nucleation, and elongation of the autophagosome, as well as its fusion with and degradation in the lysosome. Briefly, under stress conditions, the mammalian target of rapamycin (mTOR) gets inactivated by AMPK and TP53, which leads to the activation of the ULK complex and ATG13, i.e., initiation of autophagy[ 8 ]. In the nucleation step, another protein, beclin-1, interacts and conjugates with VPS34 and ATG14L at the phagophore membrane to recruit protein turnover and damaged organelles. In the elongation and maturation of the autophagosome membrane, ATG8 plays a crucial role in intracellular trafficking. ATG8 can be subdivided into two protein subfamilies, i.e., microtubule-associated protein light chain-3 (MAP1LC3A-C/LC3A-C) subfamily and γ-aminobutyric acid receptor-associated protein (GABARAP, GABARAPL1, GABARAPL2/GATE-16) subfamily[ 9 ]. While the MAP1LC3 system regulates initial phagophore membrane elongation, GABARAP family proteins are thought to be involved in the final sealing of autophagosome membranes[ 10 ]. These subfamilies are proteolytically processed by two consecutive protein complexes. The first system involves ATG4, ATG7, and ATG3 and the second system is ATG12, ATG7, ATG16L1, and ATG5. These complexes interact and produce lipidated forms of LC3 and GABARAP subfamilies. Later, the autophagosome fuses with the lysosome to form autolysosome, and cargo is degraded. There are some studies that identified GABARAPL2 involvement in the intra-Golgi trafficking and in intracellular uptake and degradation of TNFRSF12A/FN14 via autophagy[ 11 ]. Interestingly, some in vitro studies has shown that both GABARAP and GABARAPL2 induces vesicle growth that leads to spherical structure[ 12 ]. Here, we have used pharmaceutical inhibitors to test the role of autophagy and exosome pathway. Previous studies on the use of CQ in cancers have determined that CQ has the potential to increase radiotherapy and chemotherapy sensitivity in a broad range of cancers[ 13 ]. CQ diffuses in the cells in unprotonated form; since it is a weak base, it gets accumulated and becomes protonated in the lysosomes[ 14 ]. Consequently, it raises intralysosomal pH and disturbs autophagosome-lysosome fusion, thus inhibiting autophagy. Inhibition of autophagy results in a stock of damaged organelles in the cytoplasm and protein turnover in the ER, causing ER stress. Wortmannin was identified as the first phosphatidylinositol-4,5-biphosphate 3-kinase (PI3K) inhibitor[ 15 ]. Later, it was discovered that it interacts with additional PI3K accessory proteins, indicating potential adverse effects if produced as a drug. Some studies has also supported that wortmannin typically reduces the endosome release, hence a reduction in EVs secretion is observed[ 16 ]. In this study, we identified a change in size and quantity of exosomes derived from CQ-treated MDA-MB-231 cells. We also investigated the crosstalk between exosome and autophagy pathways using CQ and GW4869 in breast cancer cell line MDA-MB-231, and HEK293T fibroblast cells. Furthermore, for the first time, we have identified a link between cross-regulation of GABARAPL2 and Alix in mediating the homeostasis between Autophagy and Exosome pathways. Material and methods A. Cell culture: Human breast cancer cell lines MDA-MB-231 (RRID: CVCL_IN16, Mammary gland, Adenocarcinoma) and MCF-7 cells (RRID: CVCL_0031, Mammary gland, Adenocarcinoma) and human embryonic kidney cells (HEK293T/293T -RRID: CVCL_0063, Kidney) were derived from NCCS (National Center for Cell Sciences), Pune, India. These cells are authentic for these experiments and were confirmed for the absence of any mycoplasma contamination before all the experiments. To maintain stabilized cell lines, these cells were grown in DMEM (Dulbecco’s modified Eagle Medium, Himedia), supplemented with 10% FBS (Himedia) and 1% antibiotic (Penicillin and Streptomycin) in 5% CO 2 at 37˚C. These cells were maintained and passaged thrice a week. All the cell experiments were performed at 70% confluency. B. Inhibitor Treatment: Chloroquine diphosphate salt was supplied by Acros Organics, Thermofisher (A0423470). A stock solution of 10mM was made in PBS to make further diluted working concentrations. Wortmannin (19545-26-7) and GW4869 (6823-69-4) were purchased from Sigma. Since both Wortmannin and GW4869 are weekly soluble in water, their stock solution was formed in DMSO (TC185, Himedia). For inhibitor studies, CQ was used in incomplete media (Only DMEM) whereas wortmannin and GW4869 were used in complete media. In the combined CQ and GW4869 treatment, incomplete media was used. C. Cell proliferation assay: Briefly, 2x 10 3 cells were seeded in triplicates in each well of a 96-well plate with 100µL DMEM complete media. Cells were allowed to adhere properly, and after reaching 70% confluency, we treated cells alone or with a combination of the above-listed compounds for 24 hr. The inhibitor GW4869 was added in 2.5µM, 5µM, and 10µM concentrations, while CQ was added in 10µM final concentrations. In the second group, we mixed 10µM CQ with the 10µM GW4869 to evaluate relative cell survival upon inhibiting late-stage autophagy and ESCRT independent pathway, respectively. After 24 hr, the cells were stained with 200 µL crystal violet stain. The absorbance of the captured stain was analyzed by OD at 592nm. D. Exosome Isolation: a) Exosome Isolation by Ultracentrifugation: Ultracentrifugation is the most common method for isolating extracellular vesicles for good yield with high efficiency and minimum cost. Cultured MDA-MB-231 cells were seeded in a 100mm 2 culture dish at an initial density of 2 × 10 6 cells. Once cells reach ~70% confluency, they are treated with 10µM CQ in serum-free DMEM media. After 24 hr, an additional 10µM CQ was added to the dishes. For control, cells were grown in DMEM only. After 48 hr, cell culture media (CCM) of grown cells were isolated and immediately subjected to centrifugation at 12,000 x g, 4 ˚C for 45 minutes to remove cell debris. The supernatant was collected in fresh UC tubes after filtration with 0.22µ filters (Himedia, SF172-50NO) to remove microvesicles and filled with sterile PBS. Ultracentrifugation was done with an MLA-50 (Beckman Coulter) fixed angle rotor at 1,10,000g, 4 ˚C for 2 hours. Obtained pellets were washed with PBS and, ultimately, volume makeup with PBS. A second round of ultracentrifugation was performed at 1,10,000g, 4˚C for 70 minutes to obtain an exosome pellet. The isolated pellet was dissolved in an adequate amount of PBS for further applications and stored at -80˚C. b) Exosome Isolation with ExoQuick kit: CCM collected from MDA-MB-231 cells was centrifuged at 3000 x g for 15 minutes to remove cell debris. The obtained supernatant was collected in a clean tube and mixed with 63µL ExoQuick exosome precipitation solution, inverted the tube to mix well, and incubated this tube straight upright at 4˚C. A centrifuge was done at 1500 x g, 4 ˚C for 30 minutes to get a white exosome pellet. This pellet was washed in PBS and stored at -80 ˚C for downstream applications. E. Exosome characterization Exosomes isolated from MDA-MB-231 cell culture media were diluted in PBS and processed in a particle-size analyzer (ZEN 5600, DLS) to estimate the size and intensity of exosomes. Nanoparticle tracking analysis (Malvern NanoSight NS300) was also performed for the same sample. The stock was diluted 500 times with PBS to get particles in an equal frame, and precise diameter, concentration, and size distribution were measured. A pair of exosome samples were fixed with the2.5% glutaraldehyde, 2% paraformaldehyde, and 0.1M phosphate buffer (pH 7.4) (Fixative solution) at the time of isolation. To get information about morphology and size, exosomes were pelleted down, and a negative stain of phosphotungstic acid was used on the sample. The resultant exosome suspension was applied to the EM grids to promote the distribution of stained exosomes onto the grids. These grids were then washed briefly with PBS to remove excess negative background. The images of purified exosomes were analyzed by TEM (JEM-1400 Flash). F. Protein isolation MDA-MB-231 and HEK293T cells were seeded in 60mm 2 dishes. After reaching 70% confluency, cells were treated with either chloroquine (20µM), GW4869 (2.5µM, 5µM, 10µM), or a combination of both drugs for 48 hr in only DMEM media. Whole-cell protein was isolated by adding 100µL of NP40 lysis buffer (5M NaCl, 10% NP-40, 1M Tris pH 8.0) with a 1% protease inhibitor cocktail. A colorimetric assay was done by BCA protein assay kit (Thermo Fisher Scientific Inc., #23225, Rockford, IL, USA) to quantify the total protein of MDA-MB-231, HEK293T cells, and exosomes. Assessment of the BCA product was analyzed at 562nm wavelength. G. Immunoblot analysis Briefly, 100µg of protein was loaded into a sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). The proteins were transferred onto a PVDF (Immun-Blot, Bio-Rad, # 1620177) membrane at a constant voltage of 65V for 90 minutes. The membranes were blocked for 1 hr using Tris-buffered saline (TBS) with 3% BSA, and then incubated with the primary antibodies against target proteins, such as Alix (mAb, 1:1000, CST), Flotillin-I (mAb, 1:1000, CST), ATG5 (mAb, 1:1000, CST), ATG12 (mAb, 1:1000, CST), ATG7 (mAb, 1:1000, CST), ATG16L1 (mAb, 1:1000, CST), Beclin1 (mAb, 1:1000, CST), LC3B (mAb, 1:1000, CST), GABARAP (mAb, 1:1000, CST), GABARAPL1 (mAb, 1:1000, CST), GABARAPL2 (mAb, 1:1000, CST), GFP-monoclonal (Invitrogen, GF28R), beta-actin (mAb, 1:1000, CST), CD63 (pAb, 1:500, Proteintech), and TSG101 (pAb, 1:1000, Proteintech) for overnight at 4 ˚C on the rocker. After washing with TBS-Tween-20 (0.1%), incubation with HRP-conjugated Anti-mouse (1:3000, CST) and Anti-rabbit secondary antibodies (1:3000, CST) was carried out for 2 hours at room temperature with shaking. Proteins were detected in an enhanced chemiluminescence (ECL) detection kit (Bio-Rad). The obtained data was measured for densitometry graphs using the software ImageJ. H. Real Time PCR MDA-MB-231, MCF-7, and HEK293T cells were seeded at an initial density of 2x10 5 cells in 35mm 2 dishes. Once cells reached 70% confluency, they were treated with 20µM CQ, 10µM GW4869, or 200nM Wortmannin. For cDNA synthesis, the extracted RNA was processed with a Verso cDNA synthesis kit (Thermo Fisher, US). For the quantitative real-time PCR, SYBR Green (Powerup SYBR Green, Thermo Fisher, #A25742) was used and detected with the CFX connect detection system (Bio-Rad). All PCR primers used for this work are listed in Table 1. Table 1: Primer sequences Gene Primer Sequence 18S Forward CGGCGACGACCCATTCGAAC Reverse GAATCGAACCCTGATTCCCCGTC ATG5 Forward GCCATCAATCGGAAACTCAT Reverse TGTGTGCAACTGTCCATCTG ATG7 Forward GAACATGGTGCTGGTTTCCT Reverse CATCCAGGGTACTGGGCTAA ATG16L1 Forward TGGCCCAACTGAGGATTAAG Reverse CTTCCGCTGCATTTGGTTAT ATG3 Forward TGCTATAAGCGGTGCAAACA Reverse CGGCTTCCGTTATTCCTGTA ATG4B Forward CATTCACCAGATAGCGCAAA Reverse CCACGTATCGAAGACAGCAA MAP1LC3A Forward GAACTGAGCTGCCTCTACCG Reverse CCAGAGGGACAACCCTAACA MAP1LC3B Forward AGCGTCTCCACACCAATCTC Reverse CAATTTCATCCCGAACGTCT GABARAP Forward AGAAGAGCATCCGTTCGAGAA Reverse CCAGGTCTCCTATCCGAGCTT GABARAPL1 Forward CCCTCCCTTGGTTATCATCCA Reverse ACTCCCACCCCACAAAATCC GABARAPL2 Forward TCGAGCGAAATATCCCGACA Reverse CCACAAACAGGAAGATCGCC CD63 Forward GGACAGGATGCAGGCAGATT Reverse TTAATGCAGCAGGAGTCGGG Alix Forward CTGGCACAGGCTCAAGAAGT Reverse AAACAATAACTGACCTTGGGGAG Rab11 Forward GGTGTTCGCCATGAAAGGGT Reverse CCTCCTCGTCCTCGGGAAAA Rab27a Forward CGCAGAGAAATATGGAATCCCC Reverse TGATCGCACCACTCCTTCAG I. Transfection To knock down the GABARAP isoforms, we used MDA-MB-231 and HEK293T cells and transfected against three different siRNAs, GABARAP (NM_0072782-AS), GABARAPL1 (NM_0314124-AS), and GABRAPL2 (NM_0072857) at 60-70% confluency by using Lipofectamine-3000 (Thermo Fisher Scientific, L3000008) according to the manufacturer’s protocol. For the non-targeting siRNA, we have used Scrambled control siRNA from GeneX India (SR-CL000-005). Briefly, lipofectamine was used 4µL for a 6-well plate with 20-50nM siRNA. After 24 hours, the media was changed, and the cells were re-transfected with the same siRNA and procedure to get better outcomes. After 24 hours of the second transfection, RNA was isolated and processed into cDNA for further applications. The same protocol was followed for the transfection-based immunoblot studies. For the overexpression studies, control (pcDNA5-EYFP, #47329), GABARAP (pcDNA5/FRT/TO eYFP-GABARAP), GABARAPL1 (pEYFP-GABARAPL1), and GABARAPL2 (pEYFP-GABARAPL2) plasmids were a kind gift by Dr. Silke Hoffmann Julich, Heinrich Heine University, Germany. A GABARAPL2-shRNA was also purchased from Sigma Aldrich (TRCN0000289948) for further analyzing the knockdown effects of GABARAPL2. J. Confocal Fluorescence Analysis MDA-MB-231 cells were plated in 6-well plate with a seeding density of 2 x 10 4 cells/well. After reaching 40-50% confluency, knockdown experiments were performed with Lipofectamine 3000. After 24 hours, cells were co-transfected with the mCherry-LC3B and Alix-mNeonGreen plasmids. After 24 hours, CQ treatments were given for another 24 hours. Then, cells were fixed with the 4% paraformaldehyde, washed thrice with PBS, and mounted coverslips with the 70% glycerol. Fluorescence was measured using confocal microscopy (Leica). Confocal microscopy for the fluorescent-fused proteins was conducted with the Stellaris 8 (Leica) equipped with 63x/1.40 and 100x/1.40 plan achromat objective (oil). For the excitation of DAPI, GFP, mCherry, and mNeonGreen, Argon ion lasers of 405nm, 488nm, 561nm, and 506nm respectively. Smart gain, intensity, and the value of γ were kept optimum throughout the imaging. Images were obtained with LAS-X and later processed and analyzed for colocalization with Fiji[73]. For the counting of mCherry, GFP and Neon-Green puncta, 10 cells per treatment were quantified using the analyze particles plugin in Fiji. Puncta showing double positive were counted as colocalized. All the images were statistically analyzed using an ANOVA test. K. Cell Morphology Analysis by Phase-Contrast Microscopy A total of eight 60 mm2dishes were seeded with MDA-MB-231 and MCF-7 cells at a seeding density of 3×10 5 cells/dish. After reaching 70% confluency, the cells were transfected with GABARAPL2-shRNA using Xfect Transfection reagent (Takara Bio, Cat# 631317) as per the manufacturer’s protocol. After the treatment is complete, the cells were imaged using an objective 40x magnification (Zeiss, Germany). L. Molecular Docking We performed protein-protein docking by taking X-ray crystallographic structures for Alix, GABARAP, GABARAPL1, and GABARAPL2. The PDB structures of each GABARAPs (Ligand) were docked with the Alix (Receptor) using Cluspro and HDOCK. The HDOCK is a highly integrated suite that performs on a hybrid algorithm. Cluspro works on a Fast-Fourier Transform (FFT)-based algorithm, enabling it to dock proteins without prior information about the complexes. The final visualization tool used for the complex of docked PDB files was Pymol. This is a molecular visualization software that enables users to carry out virtual screening, binding site prediction, and molecular-docking analysis. M. Statistical analysis All data analyses were done using GraphPad Prism 8.0. We used multiple tests, such as One-way ANOVA, Two-way ANOVA, and t-tests, depending on variables to estimate the difference between groups. A p-value of <0.05 were considered as significant in whole study (*=p<0.05, **=p<0.01, ***=p<0.001, ****=p<0.0001). All the experiments were performed in triplicates. Results 1. Autophagy inhibition enhances exosome release in breast cancer cells To determine whether inhibiting autophagosome-lysosome fusion can alter the exosome pathway, cells were treated with 20µM CQ and after 24 hrs, the cell-conditioned media (CCM) of MDA-MB-231 and MCF-7 cell lines were collected. EVs were isolated by ultracentrifugation from an equal volume of CCM in the control and CQ-treated MDA-MB-231 and MCF-7 cells. Using differential light scattering (DLS), an increase in EVs size was observed after CQ treatment in both MDA-MB-231 (Supp. Figure 1 A) and MCF-7 cells (Supp. Figure 1 B). As per previous studies, a change in the physical properties of EVs, such as increased exosome diameter (Fig. 1 A) and intensity (Fig. 1 B) from CQ-treated MDA-MB-231 and MCF-7 cells were observed by nanoparticle tracking analysis (NTA) [ 18 ]. The data presented the mean value for the exosomes of control MDA-MB-231 cells to be 149nm ± 58.4 and a concentration of 4.57e007 ± 1.32e007 particles/mL (6.2 ± 1.3 particles per frame and 6.7 ± 1.4 centres per frame) (Fig. 1 C). Meanwhile, EVs from CQ treated MDA-MB-231 cells presented a mean value of 169.5nm ± 95.6 and a concentration of 5.62e007 ± 4.78e006 particles/mL (10.0 ± 1.7 particles/frame and 10.3 ± 1.6 centres per frame). To further characterize EVs, the same set of EVs samples were imaged under Transmission electron microscopy (TEM) with a magnification of 1,00,000x at 100nm scale. A homogeneous population of rounded vesicles with 25-150nm was observed, indicating that the exosomes were homogeneous mixture of cup-shaped and rounded vesicles (Fig. 1 C). As per the previous studies, we further performed SDS-PAGE (Supp. Figure 1 C) and immunoblot assay to detect exosome-specific biomarkers in exosome lysates[ 19 ], [ 20 ], [ 21 ]. The exosomes showed the presence of TSG101, β-actin, and CD63 (Fig. 1 D) with a relatively high levels of β-actin and TSG101 in exosomes isolated from CQ-treated MDA-MB-231 cells (Supp. Figure 1 D). 2. Autophagy inhibition decreased the expression of exosome-specific markers in cells while increased the release in exosomes To evaluate the effect of autophagy inhibition on exosome pathway we treated MDA-MB-231 cells with 20µM CQ for 24 hrs and observed that both CD63 and Alix mRNA expression was downregulated (Fig. 2 A). We further checked the effect on protein levels, and similar to previous studies [ 22 ], we found exosome biomarkers Alix, as well as flotillin, to be decreased in the CQ-treated MDA-MB-231 cell lysates but consequently increased in the exosomes from CQ-treated MDA-MB-231 cells (Fig. 2 B). The decreased expression of flotillin in both CQ and wortmannin suggests that the modulation in exosome protein expression is not limited to the change in endosome pH driven by CQ. A most recent study has shown that tumor exosomes influence nearby and distant cells by remodeling microenvironment and drug resistance[ 23 ], [ 24 ]. We incubated MDA-MB-231 cells with the exosomes derived from control and CQ-treated MDA-MB-231 cells to check how cancer exosomes affect the survival of tumor cells. This result showed a significant cell death in cells treated with CQ exosomes compared with control conditions (Supp. Figure 2 A). In addition, we also detected a decrease in Alix in the CQ treated MDA-MB-231 and HEK293T cells but no such changes were observed in CD63 and TSG101 (Fig. 2 C, 2 D). The decrease in Alix was significant in both MDA-MB-231 and HEK293T cells, so we treated HEK293T cells with CQ in a time-dependent manner and observed a gradual decrease in Alix expression (Supp Fig. 2 C). Previous studies have shown that Rab27a and Rab27b promote exosome secretion in different cancers[ 25 ], [ 26 ]. In another silencing experiment study, Rab11, Rab27a, and Rab27b were confirmed to regulate the exosome secretion[ 20 ], [ 25 ], [ 27 ], [ 28 ]. We observed a higher expression of Rab11 and Rab27a in CQ-treated HEK293T cells (Fig. 2 E), which denotes an up-regulation of exosome secretion upon blocking autophagy flux. 3. Exosome pathway inhibition altered the expression of autophagy-related genes A recent study has shown the role of ATG5 in MVBs acidification[ 29 ] and another study has demonstrated that silencing of ATG5 enhances exosome release[ 30 ], so we wanted to analyze the expression of autophagy genes after inhibiting exosome biogenesis by using an inhibitor of nSmase2, GW4869 treatment in MDA-MB-231 cells. We observed an increase in ATG5 (> 3 fold) and ATG16L1 mRNA expression (> 2 fold) after treatment with 10µM GW4869 in MDA-MB-231 cells for 24 hrs (Fig. 3 A, 3 B)[ 31 ]. This increase in ATG5 mRNA expression was observed both in MDA-MB-231 and MCF-7 cells (Supp. Figure 3 A). Protein expression of ATG5 and ATG16L1 was significantly increased upon GW4869 treatment in MDA-MB-231 cells (Fig. 3 D and HEK293T cells (Fig. 3 E). Interestingly, other autophagy genes such as ATG7, ATG12, Beclin1 and LC3II did not show significant change in expression upon GW4869 treatment, thus highlighting the unique link of ATG5 and ATG16L1 with exosome pathway. Increase in ATG5 protein expression was also observed with different concentrations of GW4869 (Supp. Figure 3 B). GW4869 is an inhibitor of nSmase2 and we observed a negative correlation of SMPD3 gene (nSmase2) with ATG5 and ATG16L1 in Correlation AnalyzerR in both normal and cancer databases, thus supporting the reciprocal relation between nSmase 2 and expression of ATG5 and ATG16L1[ 32 ] (Supp. Figure 3 C). 4. Combined inhibition of autophagy and exosome biogenesis induced cell death in breast cancer cells Previous studies have shown that GW4869 potentially inhibits tumor growth in the mouse 4T1 breast tumor model system[ 33 ]. On the contrary, studies have also shown that nSmase2 (SMPD3) inhibits cell proliferation and stops the growth of drug-resistant tumors[ 34 ]. So, we performed a cell proliferation assay and found that treatment of MDA-MB-231 cells with 10µM GW4869 for 24 hrs significantly enhances their proliferation (Fig. 4 A). In a cell-count assay, we also validated the effect of GW4869 on the MDA-MB-231 proliferation rate. As compared to treatment with CQ and wortmannin, treatment with GW4869 led to an increase in the cell number (Supp. Figure 4 A). Following these results, we treated MDA-MB-231 cells with increasing concentration of GW4869 (2.5µM, 5µM, and 10µM) and a combination treatment of 10µM CQ + 10µM GW4869 for 24 hr (Fig. 4 B). We observed that GW4869 treatment alone gradually increases cell proliferation but combined treatment with 10µM CQ caused significant cell death in MDA-MB-231. Similar results were also obtained when the same concentrations were used for MCF-7 cell line (Supp. Figure 4 B). The sharp decline in cell viability of MDA-MB-231 and MCF-7 cells upon combined inhibition of autophagy flux and exosome biogenesis highlights the crosstalk between autophagy and exosome pathways and their importance for cancer cell survival. Survival analysis for the SMPD3 gene shows that high expression of SMPD3 correlates with high overall survival in breast cancer patients, supporting a tumor suppressive role (Supp. Figure 4 C). Further, to validate the effect of combined treatment on Alix expression, we analyzed the Alix expression in MDA-MB-231 and HEK293T cells. Figures 4 C and 4 D show that the CQ treatment decreases Alix expression. However, a combined treatment of CQ and GW4869 restored the Alix expression. This result indicates that inhibition of autophagy flux by CQ enhances the encapsulation and release of Alix in exosomes, but blocking exosome biogenesis by GW4869 stops the encapsulation of Alix in exosomes and thus rescues the levels of Alix. This conclusion was also correlated with the TCGA sample databases where PDCD6IP (Alix) showed a progressively decreased expression in luminal, HER2 (+), and triple negative breast cancer (TNBC), respectively which might be due to enhanced autophagy perturbation in these tumor types (Supp. Figure 4 D). This result highlights the dynamic crosstalk between autophagy and exosome pathways and potential of restricting cancer cell growth by combined inhibition of the two pathways simultaneously. 5. Inhibition of exosome biogenesis by GW4869 altered the expression of ATG8 family genes Previous studies have identified an autophagy-mediated unconventional protein secretion responsible for release of molecules not secreted through conventional protein secretion[ 35 ]. The unconventional secretion by autophagy may partially be mediated through the exosome pathway. The ATG8s are crucial autophagy genes important for the process of autophagy pathway. However, it is unclear whether ATG8s particularly GABARAP secretion through exosomes is either a by-product of cellular trafficking or a specific event[ 36 ], [ 37 ]. Earlier, we assessed the expression of the MAP1LC3 family in GW4869-treated MDA-MB-231 cells, which did not show any significant changes in both MAP1LC3A and MAP1LC3B in GW4869-treated HEK293T cells (Fig. 5 C). So, we further checked the expression of another class of ATG8 genes, i.e. GABARAP family. We initially assessed the GABARAPs expression profile in the exoRBase database[ 38 ]. We found that GABARAPL2 was highly secreted in different cancer exosomes among other members (Supp. Figure 5 A). Furthermore, the expression of GABARAPL2 showed a significantly higher expression in BRCA than the benign tumors (Supp. Figure 5 B, 5 C). Previous studies on EV proteomics have described the association of GABARAP proteins with EV proxitome[ 37 ], [ 39 ]. A recent study has also demonstrated that lipidated GABARAPs interact with the ESCRT machinery, specifically with Alix[ 40 ]. Since GABARAPL2 showed significantly high expression in BRCA tumors, we performed a real-time PCR for GABARAP genes to check their expression after GW4869 treatment. The results showed that GABARAPL2 expression was significantly decreased after treatment with 10µM GW4869 in MDA-MB-231 (Fig. 5 A) as well as HEK293T cells (Fig. 5 B). However, no significant changes were observed in both GABARAP and GABARAPL1 genes. These changes were retained in their protein levels where GABARAPL2 expression was significantly decreased in GW4869 treated HEK293T cells (Fig. 5 D). This result highlights a potential involvement of GABARAPL2 in exosome pathway 6. GABARAPL2 knockdown reversed the CQ-mediated decrease in Alix expression Previous studies have revealed that ATG12-ATG3 and Alix interact together to regulate endosomal machinery for exosome biogenesis[ 41 ]. To check whether GABARAPs are associated with the exosome pathway, we knocked down GABARAP, GABARAPL1 and GABARAPL2 and checked the effect on Alix expression. Interestingly, we observed that the knockdown of GABARAPL2 rescued the CQ-mediated decrease in Alix expression at mRNA and protein levels (Fig. 6 A, 6 B). However, there was no measurable change in the Alix protein levels after knockdown of GABARAP and GABARAPL1 and CQ treatment (Supp. Figure 6 A). We again transfected MDA-MB-231 cells with GABARAPL2-shRNA to check the knockdown efficiency (Supp. Figure 6 B). We observed that knockdown of GABARAPL2 caused increased cell proliferation in both MDA-MB-231 (Fig. 6 C) and MCF-7 cells (Supp. Figure 6 C) which was much more pronounced in GABARAPL2 knockdown cells treated with CQ. To ascertain the involvement of GABARAPL2 in Alix trafficking in ILVs and subsequent release in exosomes, we analyzed the interaction between Alix and GABARAPL2 using ClusPro, and HDock and visualized by Pymol[ 42 ], [ 43 ], [ 44 ]. To assess this, the following PDB IDs were used to get crystallographic structures: 2OEV- Alix, 4CO7- GABARAPL2. We observed that the HDock Docking score for the Alix-GABARAPL2 complex was − 246.29, and the ClusPro docking score was − 641.4. Also, Alix residues ranging from 232 to 290 show a strong relation with GABARAPL2 residues range 56 to 116 (Fig. 6 D). Further analysis revealed that GABARAPL2 potentially interacts with the BRO domain of Alix. In conclusion, it is suggested that GABARAPL2 interacts with the Alix to facilitate its release in the exosomes. 7. GABARAPL2 knockdown increases colocalization of Alix and LC3B We performed confocal imaging to understand the role of GABARAPL2 in modulating Alix puncta. We knocked down GABARAPL2 in MDA-MB-231 cells and then expressed Alix-mNeonGreen and mCherry-LC3B in control and GABARAPL2 knocked down MDA-MB-231 cells. After 24 hrs of transfection, cells were treated with 20µM CQ for 24 hours. We observed that the average number of colocalized puncta was 140 in control, this decreased after CQ treatment to 108, and was later rescued in combined GABARAPL2 knockdown and CQ treatment to 227 (Fig. 7 A and 7 B). To understand whether the effect of CQ was specific for Alix localization, we checked the puncta of CD63 as well and did not observe any significant change, whereas Alix puncta were significantly altered by CQ treatment and rescued by GABARAPL2 knockdown (Supp Fig. 7 A and 7 B). Additionally, the effect of GABARAPL2 knockdown on the autophagy flux has been analyzed by confocal (Supp. Figure 8A) and western blot experiments (Supp. Figure 8B), which shows a non-significant change after the treatment. This result highlights the crucial role of GABARAPL2 in directing Alix to exosomes and subsequent release. In the absence of GABARAPL2, Alix remains associated with amphisomes, highlighted by colocalization of Alix and LC3 puncta. Thus, GABARAPL2 facilitates the incorporation of Alix in MVBs and its release in exosomes; therefore, we conclude that Alix and GABARAPL2 coordinate the crosstalk between autophagy and exosome pathways, and these molecules can be targeted for future studies and therapeutic applications. Discussion In breast cancer cells, autophagy and exosome biogenesis pathways play an essential role in cellular homeostasis to tolerate hostile conditions in the tumor microenvironment and increase overall survival[ 45 ]. In the present study, we wanted to analyze the crosstalk between autophagy and exosome pathways. Previous studies have reported that impairment in lysosomal integrity alters the secretome of breast cancer cells[ 46 ]. Similar to previous studies, our results have also shown that the exosomes from CQ-treated MDA-MB-231 and MCF-7 cells have increased size and diameter[ 47 ]. We characterized the exosomes and observed that high levels of CD63, TSG101, Alix, Flotillin, and β-actin were present in the exosomes from CQ-treated cells as compared to non-treated cells. We extended our study and checked CD63, Alix, Rab11, and Rab27a expression in the CQ-treated MDA-MB-231 and HEK293 cells. Although both CD63 and Alix decreased in CQ-treated cells, increased expression of Rab11 and Rab27a suggested that more MVBs may be diverted towards exosome release instead of fusing with the lysosome. We further analyzed the same effect on protein levels, and observed that both flotillin and Alix were exported out in the exosomes in CQ-treated cells. We further investigated the effect of the exosome biogenesis inhibitor, GW4869, on autophagy-related genes. We observed a gradual increase in the MDA-MB-231 and MCF-7 cell proliferation with GW4869. Previous studies have shown that the knockdown of SMPD3 enhances p62 and LC3 gene expression[ 48 ]. However, in our study, we observed that SMPD3 inhibition led to an increase in ATG5 and ATG16L1 expression in both MDA-MB-231 and HEK293T cells, but LC3 expression was not altered significantly. Moreover, the increase in ATG5 and ATG16L1 expression after GW4869 treatment might be related to non-canonical functions of autophagy genes and may be important for vesicle trafficking. Previous studies have reported an increased level of ATG8 orthologs in the cell secretome[ 18 ], [ 37 ]. A recent study has also demonstrated the involvement of GABARAPL1 in the EV cargo loading[ 49 ]. In our study, we observed that SMPD3 inhibition led to decreased expression of GABARAPL2. Surprisingly, knockdown of GABARAPL2 rescued the decrease in Alix protein in response to CQ treatment and was present in the cells even in the presence of CQ. This indicated that GABARAPL2 might be directly involved in the secretion of Alix through exosomes. Additionally, we observed that release of Alix in exosomes in the presence of CQ was restricted and perhaps reversed with combined treatment of CQ and GW4869, thus highlighting the coordination between two pathways. Furthermore, the colocalization study of LC3B and Alix has shown that the colocalized puncta were decreased in CQ treatment, which was later rescued once the knockdown of GABARAPL2 was combined with CQ. CQ is recognized as a late-stage autophagy inhibitor, it also exhibits autophagy-independent effects[ 50 ]. Our study emphasizes a new mechanism of treatment in which a combined treatment with CQ and GW4869, along with ongoing radiotherapy and chemotherapy, might strongly suppress cancer cell survival and intracellular signaling in breast cancer cells. In the field of exosome therapy, there are multiple challenges like low targeting, high heterogeneity, short half-life, and very poor efficiency that limit the use of exosomes in therapeutic attributes. Despite some limitations, targeting exosomes and autophagy and the use of exosomes in diagnostic and therapeutic applications can be assessed in upcoming clinical studies. From this study, we unravel the intricate relationship between autophagy and exosome pathways in the cellular homeostasis of breast cancer cells. Abbreviations ATG Autophagy-Related EVs Extracellular Vesicles MVBs Multivesicular Bodies GABARAP γ-aminobutyric acid receptor-associated protein ESCRT Endosomal Sorting Complex Required for Transport CQ Chloroquine Declarations Acknowledgment: We want to acknowledge the Central University of Rajasthan for providing the infrastructure and centralised instrumental facility. This work was funded and supported by the Science and Engineering Research Board (SERB)-Power” Grant (SPG/2021/002833), ICMR “Extra mural research grant” (52/27/2020-BIO/BMS) for providing research funds to Dr. Bhawana Bissa. We also acknowledge University Grant Commission (UGC) for the fellowship to Mr. Naveen Soni. Author contribution declaration: All authors contributed to the conception and design of the study. Conceptualization, manuscript writing, experimental work, and figure preparation were performed by Naveen Soni . Manuscript writing, proofreading, and experimental work were performed by Megha Chaudhary. Conceptualization, manuscript writing, funding acquisition, and supervision by Bhawana Bissa . All authors read and approved the final manuscript. Ethics and Consent to Participate declarations: Not Applicable References D. Bl and C. Bt, “Membrane vesicle release in bacteria, eukaryotes, and archaea: a conserved yet underappreciated aspect of microbial life,” Infection and immunity , vol. 80, no. 6, Jun. 2012, doi: 10.1128/IAI.06014-11. D. G. Robinson, Y. Ding, and L. Jiang, “Unconventional protein secretion in plants: a critical assessment,” Protoplasma , vol. 253, no. 1, pp. 31–43, Jan. 2016, doi: 10.1007/s00709-015-0887-1. J. S. Schorey, Y. Cheng, P. P. Singh, and V. L. Smith, “Exosomes and other extracellular vesicles in host-pathogen interactions,” EMBO Rep , vol. 16, no. 1, pp. 24–43, Jan. 2015, doi: 10.15252/embr.201439363. L. Ribovski, B. Joshi, J. Gao, and I. Zuhorn, “Breaking free: endocytosis and endosomal escape of extracellular vesicles,” evcna , vol. 4, no. 2, pp. 283–305, Jun. 2023, doi: 10.20517/evcna.2023.26. G. Raposo and W. Stoorvogel, “Extracellular vesicles: exosomes, microvesicles, and friends,” J Cell Biol , vol. 200, no. 4, pp. 373–383, Feb. 2013, doi: 10.1083/jcb.201211138. E. Cocucci and J. Meldolesi, “Ectosomes and exosomes: shedding the confusion between extracellular vesicles,” Trends Cell Biol , vol. 25, no. 6, pp. 364–372, Jun. 2015, doi: 10.1016/j.tcb.2015.01.004. Y. Zhang, Y. Liu, H. Liu, and W. H. Tang, “Exosomes: biogenesis, biologic function and clinical potential,” Cell & Bioscience , vol. 9, no. 1, p. 19, Feb. 2019, doi: 10.1186/s13578-019-0282-2. N. A. Garcia, I. Ontoria-Oviedo, H. González-King, A. Diez-Juan, and P. Sepúlveda, “Glucose Starvation in Cardiomyocytes Enhances Exosome Secretion and Promotes Angiogenesis in Endothelial Cells,” PLoS One , vol. 10, no. 9, p. e0138849, 2015, doi: 10.1371/journal.pone.0138849. J. H. Hurley, “ESCRT complexes and the biogenesis of multivesicular bodies,” Curr Opin Cell Biol , vol. 20, no. 1, pp. 4–11, Feb. 2008, doi: 10.1016/j.ceb.2007.12.002. F. Arslan et al. , “Mesenchymal stem cell-derived exosomes increase ATP levels, decrease oxidative stress and activate PI3K/Akt pathway to enhance myocardial viability and prevent adverse remodeling after myocardial ischemia/reperfusion injury,” Stem Cell Res , vol. 10, no. 3, pp. 301–312, May 2013, doi: 10.1016/j.scr.2013.01.002. W. M. Henne, N. J. Buchkovich, and S. D. Emr, “The ESCRT Pathway,” Developmental Cell , vol. 21, no. 1, pp. 77–91, Jul. 2011, doi: 10.1016/j.devcel.2011.05.015. J. Kowal, M. Tkach, and C. Théry, “Biogenesis and secretion of exosomes,” Curr Opin Cell Biol , vol. 29, pp. 116–125, Aug. 2014, doi: 10.1016/j.ceb.2014.05.004. F. Fatima and M. Nawaz, “Stem cell-derived exosomes: roles in stromal remodeling, tumor progression, and cancer immunotherapy,” Chinese Journal of Cancer , vol. 34, no. 3, p. 46, Sep. 2015, doi: 10.1186/s40880-015-0051-5. M. F. Baietti et al. , “Syndecan-syntenin-ALIX regulates the biogenesis of exosomes,” Nat Cell Biol , vol. 14, no. 7, pp. 677–685, Jun. 2012, doi: 10.1038/ncb2502. J. F. Nabhan, R. Hu, R. S. Oh, S. N. Cohen, and Q. Lu, “Formation and release of arrestin domain-containing protein 1-mediated microvesicles (ARMMs) at plasma membrane by recruitment of TSG101 protein,” Proc Natl Acad Sci U S A , vol. 109, no. 11, pp. 4146–4151, Mar. 2012, doi: 10.1073/pnas.1200448109. S. Stuffers, C. Sem Wegner, H. Stenmark, and A. Brech, “Multivesicular endosome biogenesis in the absence of ESCRTs,” Traffic , vol. 10, no. 7, pp. 925–937, Jul. 2009, doi: 10.1111/j.1600-0854.2009.00920.x. K. Trajkovic et al. , “Ceramide triggers budding of exosome vesicles into multivesicular endosomes,” Science , vol. 319, no. 5867, pp. 1244–1247, Feb. 2008, doi: 10.1126/science.1153124. F. M. Goñi and A. Alonso, “Effects of ceramide and other simple sphingolipids on membrane lateral structure,” Biochim Biophys Acta , vol. 1788, no. 1, pp. 169–177, Jan. 2009, doi: 10.1016/j.bbamem.2008.09.002. “Blockade of Exosome Generation with GW4869 Dampens the Sepsis-Induced Inflammation and Cardiac Dysfunction - PMC.” Accessed: Mar. 11, 2025. [Online]. Available: https://pmc.ncbi.nlm.nih.gov/articles/PMC4581992/ G. van Niel et al. , “The tetraspanin CD63 regulates ESCRT-independent and -dependent endosomal sorting during melanogenesis,” Dev Cell , vol. 21, no. 4, pp. 708–721, Oct. 2011, doi: 10.1016/j.devcel.2011.08.019. A. C. Theos et al. , “A lumenal domain-dependent pathway for sorting to intralumenal vesicles of multivesicular endosomes involved in organelle morphogenesis,” Dev Cell , vol. 10, no. 3, pp. 343–354, Mar. 2006, doi: 10.1016/j.devcel.2006.01.012. K.-H. Lim and L. M. Staudt, “Toll-like receptor signaling,” Cold Spring Harb Perspect Biol , vol. 5, no. 1, p. a011247, Jan. 2013, doi: 10.1101/cshperspect.a011247. A. Salminen, K. Kaarniranta, and A. Kauppinen, “Beclin 1 interactome controls the crosstalk between apoptosis, autophagy and inflammasome activation: impact on the aging process,” Ageing Res Rev , vol. 12, no. 2, pp. 520–534, Mar. 2013, doi: 10.1016/j.arr.2012.11.004. X. Li, S. He, and B. Ma, “Autophagy and autophagy-related proteins in cancer,” Molecular Cancer , vol. 19, 2020, doi: 10.1186/s12943-020-1138-4. C. He and D. J. Klionsky, “Regulation mechanisms and signaling pathways of autophagy,” Annu Rev Genet , vol. 43, pp. 67–93, 2009, doi: 10.1146/annurev-genet-102808-114910. A. Kihara, Y. Kabeya, Y. Ohsumi, and T. Yoshimori, “Beclin-phosphatidylinositol 3-kinase complex functions at the trans-Golgi network,” EMBO Rep , vol. 2, no. 4, pp. 330–335, Apr. 2001, doi: 10.1093/embo-reports/kve061. B. Levine, R. Liu, X. Dong, and Q. Zhong, “Beclin orthologs: integrative hubs of cell signaling, membrane trafficking, and physiology,” Trends Cell Biol , vol. 25, no. 9, pp. 533–544, Sep. 2015, doi: 10.1016/j.tcb.2015.05.004. Y. Xin et al. , “Cloning, expression patterns, and chromosome localization of three human and two mouse homologues of GABA(A) receptor-associated protein,” Genomics , vol. 74, no. 3, pp. 408–413, Jun. 2001, doi: 10.1006/geno.2001.6555. H. He et al. , “Post-translational modifications of three members of the human MAP1LC3 family and detection of a novel type of modification for MAP1LC3B,” J Biol Chem , vol. 278, no. 31, pp. 29278–29287, Aug. 2003, doi: 10.1074/jbc.M303800200. H. Weidberg, E. Shvets, T. Shpilka, F. Shimron, V. Shinder, and Z. Elazar, “LC3 and GATE-16/GABARAP subfamilies are both essential yet act differently in autophagosome biogenesis,” EMBO J , vol. 29, no. 11, pp. 1792–1802, Jun. 2010, doi: 10.1038/emboj.2010.74. H. Winer, M. Fraiberg, A. Abada, T. Dadosh, B.-C. Tamim-Yecheskel, and Z. Elazar, “Autophagy differentially regulates TNF receptor Fn14 by distinct mammalian Atg8 proteins,” Nat Commun , vol. 9, no. 1, p. 3744, Sep. 2018, doi: 10.1038/s41467-018-06275-1. A. Landajuela et al. , “Lipid Geometry and Bilayer Curvature Modulate LC3/GABARAP-Mediated Model Autophagosomal Elongation,” Biophys J , vol. 110, no. 2, pp. 411–422, Jan. 2016, doi: 10.1016/j.bpj.2015.11.3524. C. Verbaanderd et al. , “Repurposing Drugs in Oncology (ReDO)-chloroquine and hydroxychloroquine as anti-cancer agents,” Ecancermedicalscience , vol. 11, p. 781, 2017, doi: 10.3332/ecancer.2017.781. V. R. Solomon and H. Lee, “Chloroquine and its analogs: a new promise of an old drug for effective and safe cancer therapies,” Eur J Pharmacol , vol. 625, no. 1–3, pp. 220–233, Dec. 2009, doi: 10.1016/j.ejphar.2009.06.063. R. Marone, V. Cmiljanovic, B. Giese, and M. P. Wymann, “Targeting phosphoinositide 3-kinase: moving towards therapy,” Biochim Biophys Acta , vol. 1784, no. 1, pp. 159–185, Jan. 2008, doi: 10.1016/j.bbapap.2007.10.003. A. G. Batrouni and J. M. Baskin, “A MAP for PI3K activation on endosomes,” Nat Cell Biol , vol. 22, no. 11, pp. 1292–1294, Nov. 2020, doi: 10.1038/s41556-020-00597-3. “Crosstalk between autophagy inhibitors and endosome-related secretory pathways: a challenge for autophagy-based treatment of solid cancers | Molecular Cancer.” Accessed: Mar. 05, 2025. [Online]. Available: https://link.springer.com/article/10.1186/s12943-021-01423-6 J. Xu et al. , “Chloroquine treatment induces secretion of autophagy-related proteins and inclusion of Atg8-family proteins in distinct extracellular vesicle populations,” Autophagy , vol. 18, no. 11, pp. 2547–2560, doi: 10.1080/15548627.2022.2039535. M. Colombo, G. Raposo, and C. Théry, “Biogenesis, secretion, and intercellular interactions of exosomes and other extracellular vesicles,” Annu Rev Cell Dev Biol , vol. 30, pp. 255–289, 2014, doi: 10.1146/annurev-cellbio-101512-122326. C. Théry et al. , “Minimal information for studies of extracellular vesicles 2018 (MISEV2018): a position statement of the International Society for Extracellular Vesicles and update of the MISEV2014 guidelines,” J Extracell Vesicles , vol. 7, no. 1, p. 1535750, 2018, doi: 10.1080/20013078.2018.1535750. F. G. Ortega et al. , “Interfering with endolysosomal trafficking enhances release of bioactive exosomes,” Nanomedicine: Nanotechnology, Biology, and Medicine , vol. 20, Aug. 2019, doi: 10.1016/j.nano.2019.102014. S. S. Panda, R. K. Sahoo, S. K. Patra, S. Biswal, and B. K. Biswal, “Molecular insights to therapeutic in cancer: role of exosomes in tumor microenvironment, metastatic progression and drug resistance,” Drug Discovery Today , vol. 29, no. 8, p. 104061, Aug. 2024, doi: 10.1016/j.drudis.2024.104061. Y. Huang et al. , “Exosome-mediated remodeling of the tumor microenvironment: From local to distant intercellular communication,” Cancer Lett , vol. 543, p. 215796, Sep. 2022, doi: 10.1016/j.canlet.2022.215796. M. Ostrowski et al. , “Rab27a and Rab27b control different steps of the exosome secretion pathway,” Nat Cell Biol , vol. 12, no. 1, pp. 19–30; sup pp 1-13, Jan. 2010, doi: 10.1038/ncb2000. M. S. Ostenfeld et al. , “Cellular disposal of miR23b by RAB27-dependent exosome release is linked to acquisition of metastatic properties,” Cancer Res , vol. 74, no. 20, pp. 5758–5771, Oct. 2014, doi: 10.1158/0008-5472.CAN-13-3512. “Regulation of exosome secretion by Rab35 and its GTPase-activating proteins TBC1D10A-C - PubMed.” Accessed: Mar. 05, 2025. [Online]. Available: https://pubmed.ncbi.nlm.nih.gov/20404108/ H. Peinado et al. , “Melanoma exosomes educate bone marrow progenitor cells toward a pro-metastatic phenotype through MET,” Nat Med , vol. 18, no. 6, pp. 883–891, Jun. 2012, doi: 10.1038/nm.2753. H. Guo et al. , “Atg5 Disassociates the V1V0-ATPase to Promote Exosome Production and Tumor Metastasis Independent of Canonical Macroautophagy,” Developmental Cell , vol. 43, no. 6, pp. 716-730.e7, Dec. 2017, doi: 10.1016/j.devcel.2017.11.018. N. Fussi et al. , “Exosomal secretion of α-synuclein as protective mechanism after upstream blockage of macroautophagy,” Cell Death Dis , vol. 9, no. 7, p. 757, Jul. 2018, doi: 10.1038/s41419-018-0816-2. Y. Peng et al. , “Blockade of exosome generation by GW4869 inhibits the education of M2 macrophages in prostate cancer,” BMC Immunol , vol. 23, p. 37, Aug. 2022, doi: 10.1186/s12865-022-00514-3. H. E. Miller and A. J. R. Bishop, “Correlation AnalyzeR: functional predictions from gene co-expression correlations,” BMC Bioinformatics , vol. 22, no. 1, p. 206, Apr. 2021, doi: 10.1186/s12859-021-04130-7. B. A. Pulaski and S. Ostrand-Rosenberg, “Mouse 4T1 breast tumor model,” Curr Protoc Immunol , vol. Chapter 20, p. Unit 20.2, May 2001, doi: 10.1002/0471142735.im2002s39. C. Tallon et al. , “Nipping disease in the bud: nSMase2 inhibitors as therapeutics in extracellular vesicle-mediated diseases,” Drug Discov Today , vol. 26, no. 7, pp. 1656–1668, Jul. 2021, doi: 10.1016/j.drudis.2021.03.025. B. Ghandour, G. Dbaibo, and N. Darwiche, “The unfolding role of ceramide in coordinating retinoid-based cancer therapy,” Biochem J , vol. 478, no. 19, pp. 3621–3642, Oct. 2021, doi: 10.1042/BCJ20210368. V. Deretic, S. Jiang, and N. Dupont, “Autophagy intersections with conventional and unconventional secretion in tissue development, remodeling and inflammation,” Trends Cell Biol , vol. 22, no. 8, pp. 397–406, Aug. 2012, doi: 10.1016/j.tcb.2012.04.008. S. Asano et al. , “Phospholipase C-related catalytically inactive protein (PRIP) controls KIF5B-mediated insulin secretion,” Biol Open , vol. 3, no. 6, pp. 463–474, May 2014, doi: 10.1242/bio.20147591. J. L. Sanwald, G. Poschmann, K. Stühler, C. Behrends, S. Hoffmann, and D. Willbold, “The GABARAP Co-Secretome Identified by APEX2-GABARAP Proximity Labelling of Extracellular Vesicles,” Cells , vol. 9, no. 6, Jun. 2020, doi: 10.3390/cells9061468. H. Lai et al. , “exoRBase 2.0: an atlas of mRNA, lncRNA and circRNA in extracellular vesicles from human biofluids,” Nucleic Acids Res , vol. 50, no. D1, pp. D118–D128, Jan. 2022, doi: 10.1093/nar/gkab1085. C. Lefebvre, R. Legouis, and E. Culetto, “ESCRT and autophagies: Endosomal functions and beyond,” Semin Cell Dev Biol , vol. 74, pp. 21–28, Feb. 2018, doi: 10.1016/j.semcdb.2017.08.014. M. Ogura et al. , “Microautophagy regulated by STK38 and GABARAPs is essential to repair lysosomes and prevent aging,” EMBO Rep , vol. 24, no. 12, p. e57300, Nov. 2023, doi: 10.15252/embr.202357300. L. Murrow, R. Malhotra, and J. Debnath, “ATG12-ATG3 interacts with Alix to promote basal autophagic flux and late endosome function,” Nat Cell Biol , vol. 17, no. 3, pp. 300–310, Mar. 2015, doi: 10.1038/ncb3112. Y. Yan, D. Zhang, P. Zhou, B. Li, and S.-Y. Huang, “HDOCK: a web server for protein-protein and protein-DNA/RNA docking based on a hybrid strategy,” Nucleic Acids Res , vol. 45, no. W1, pp. W365–W373, Jul. 2017, doi: 10.1093/nar/gkx407. R. E. Rigsby and A. B. Parker, “Using the PyMOL application to reinforce visual understanding of protein structure,” Biochem Mol Biol Educ , vol. 44, no. 5, pp. 433–437, Sep. 2016, doi: 10.1002/bmb.20966. D. Kozakov et al. , “The ClusPro web server for protein-protein docking,” Nat Protoc , vol. 12, no. 2, pp. 255–278, Feb. 2017, doi: 10.1038/nprot.2016.169. M. Colletti, D. Ceglie, A. Di Giannatale, and F. Nazio, “Autophagy and Exosomes Relationship in Cancer: Friends or Foes?,” Frontiers in Cell and Developmental Biology , vol. 8, 2021, Accessed: May 08, 2022. [Online]. Available: https://www.frontiersin.org/article/10.3389/fcell.2020.614178 A. Latifkar et al. , “Loss of Sirtuin 1 Alters the Secretome of Breast Cancer Cells by Impairing Lysosomal Integrity,” Dev Cell , vol. 49, no. 3, pp. 393-408.e7, May 2019, doi: 10.1016/j.devcel.2019.03.011. C. H. Mitchell and W. Lu, “Exosome release from RPE cells increased by lysosomal compromise,” Investigative Ophthalmology & Visual Science , vol. 63, no. 7, pp. 4617-F0409, Jun. 2022. M. J. Back et al. , “Activation of neutral sphingomyelinase 2 by starvation induces cell-protective autophagy via an increase in Golgi-localized ceramide,” Cell Death Dis , vol. 9, no. 6, p. 670, Jun. 2018, doi: 10.1038/s41419-018-0709-4. J. E. J. Beaumont et al. , “GABARAPL1 is essential in extracellular vesicle cargo loading and metastasis development,” Radiotherapy and Oncology , vol. 190, p. 109968, Jan. 2024, doi: 10.1016/j.radonc.2023.109968. P. Maycotte, S. Aryal, C. T. Cummings, J. Thorburn, M. J. Morgan, and A. Thorburn, “Chloroquine sensitizes breast cancer cells to chemotherapy independent of autophagy,” Autophagy , vol. 8, no. 2, pp. 200–212, Feb. 2012, doi: 10.4161/auto.8.2.18554. S. Sadeghi, F. R. Tehrani, S. Tahmasebi, A. Shafiee, and S. M. Hashemi, “Exosome engineering in cell therapy and drug delivery,” Inflammopharmacology , vol. 31, no. 1, pp. 145–169, 2023, doi: 10.1007/s10787-022-01115-7. T. Li et al. , “The Therapeutic Potential and Clinical Significance of Exosomes as Carriers of Drug Delivery System,” Pharmaceutics , vol. 15, no. 1, p. 21, Dec. 2022, doi: 10.3390/pharmaceutics15010021. J. Schindelin et al. , “Fiji: an open-source platform for biological-image analysis,” Nat Methods , vol. 9, no. 7, pp. 676–682, Jun. 2012, doi: 10.1038/nmeth.2019. Additional Declarations No competing interests reported. Supplementary Files Supp.Fig1.jpg Supp. Figure 1: Exosome characterization shows increase in size as well as CD63 marker after CQ treatment (A) Exosomes characterization by DLS for the exosomes from CQ-treated MDA-MB-231 and (B) MCF-7 cells. The size and St Dev values indicates the uniform size distribution throughout the sample. (C) Reversible ponceau stain representing equal loading of exosome lysates. (D) Relative expression of exosome specific biomarker in the cell lysates and exosomes from MDA-MB-231 cells. Supp.Fig2.jpg Supp. Figure 2: (A) MDA-MB-231 cells treated with Control exosomes, CQ exosomes, and only PBS (No exosomes). The fold change was calculated by normalizing datasets with No exosomes. (B) Expression of flotillin in both early-stage (Wortmannin) and late-stage (Chloroquine) autophagy inhibition in MDA-MB-231 cells. (C) Expression of Alix in the time-dependent treatment of CQ in HEK293T cells. One-way ANOVA was used for the statistical analysis. (****: p<0.0001, ***: p<0.001, **: p<0.01, *: p<0.05). Supp.Fig3.jpg Supp. Figure 3: (A) Quantitative PCR analysis for the ATG5 in MDA-MB-231 and MCF-7 cells after GW4869 treatment. (B) A concentration-dependent effect of GW4869 on the levels of ATG5 expression. (C) A negative correlation between ATG5 vs SMPD3 and ATG16L1 vs SMPD3 in cancer shows an interlink between autophagy and exosome genes. A paired t-test and one-way ANOVA were used for the statistical analysis (*: p<0.05). Supp.Fig4.jpg Supp. Figure 4: (A) Cell count assay was performed for the MDA-MB-231 cells after treatment with 10µM GW4869, 20µM CQ, and 200nM. (B) MCF-7 cells treated with gradient of GW4869 and a combined treatment of 10µM GW4869 and 10µM CQ. (C) The survival plot analysis for breast cancer in the GEPIA database reflects a high survival rate for high SMPD3 expression. (D) Box-plots showing decrease in PDCD6IP expression with the increase in tumor grade in the TCGA samples, along with their statistical data. One-way ANOVA and two-way ANOVA were used for the statistical significance analysis. (****: p<0.0001, ***: p<0.001, **: p<0.01, *: p<0.05). Supp.Fig5.jpg Supp. Figure 5: (A) Expression of ATG8 genes was checked in the exoRBase database showing a much higher expression of GABARAPL2 among other members of the same subfamily. (B) An increase in GABARAPL2 expression in the BRCA compared to benign body fluids supports its involvement in tumor progression. (C) A more significant higher expression of GABARAPL2 among all three members of the GABARAPs in BRCA (exoRBase database). Supp.Fig6.jpg Supp. Figure 6: (A) Immunoblot analysis of Alix expression after knockdown of two isoforms, GABARAP and GABARAPL1. (B) Transfection with GABARAPL2-shRNA to confirm the knockdown in MDA-MB-231 cells. (C) Phase-contrast imaging of MCF-7 cells after transfection with GABARAPL2-shRNA and CQ treatment. One-way ANOVA was used for the statistical analysis. (****: p<0.0001, ***: p<0.001, **: p<0.01, ns: non-significant). Supp.Fig7.jpg Supp. Figure 7: (A) Confocal imaging of MDA-MB-231 cells transfected with CD63-EGFP and Alix-mNeonGreen plasmids. (B) Analysis showed the knockdown change was only visible in the Alix puncta in CQ and combined treatment with knockdown of GABARAPL2. One-way ANOVA was used for the statistical analysis. (***: p<0.001, **: p<0.01, ns: non-significant). Supp.Fig8.jpg Supp. Figure 8: (A) Localization of mCherry-LC3 under the GABARAPL2 knockdown conditions. (B) Immunoblot of LC3B in the GABARAPL2 knockdown. The data was normalized with the control value. An unpaired t-test was performed for the statistical analysis. (ns: non-significant) Cite Share Download PDF Status: Under Revision Version 1 posted Editorial decision: Revision requested 13 Jan, 2026 Editor assigned by journal 13 Jan, 2026 Submission checks completed at journal 13 Jan, 2026 First submitted to journal 10 Jan, 2026 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-8570970","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":574142556,"identity":"c9334844-bcfb-4063-acea-08b9e3a8d705","order_by":0,"name":"Naveen Soni","email":"","orcid":"","institution":"Central University of Rajasthan","correspondingAuthor":false,"prefix":"","firstName":"Naveen","middleName":"","lastName":"Soni","suffix":""},{"id":574142557,"identity":"92ce2789-16cc-4080-a439-01dffc1c1d80","order_by":1,"name":"Megha Chaudhary","email":"","orcid":"","institution":"Central University of Rajasthan","correspondingAuthor":false,"prefix":"","firstName":"Megha","middleName":"","lastName":"Chaudhary","suffix":""},{"id":574142558,"identity":"94fce706-6523-4a76-bb9d-7269e1dae1f1","order_by":2,"name":"Bhawana Bissa","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABBklEQVRIiWNgGAWjYBACAwkYgxlEVoDZCSCCh0gtZ0jSAiIY24hwmLl08zOJnzvsGMzZ2R9/+DnPLnF7+4EHDD9qGGTMcWixnHPMTLL3TDKDZTMPkLEtOXHOmYQExp5jDDyWDTgcdiPB7AZvGzODwWEeNgbebQcSZzAkJDDwNjDwGBzApSX9282/bfVALeyPP/6dA9TC/yCB8S9eLTlmt3nbDgO1MBhI8zYAtUgkJDDjs8VyRk75b9m24zwgv0jLHEs2niHxIOGwzDEJnFrMJdI3G75tq5Yz5z/++OObGjvZGfw5iQ/f1NjY49ICA8gRx5MAVCyBSyVWwE7A+FEwCkbBKBhpAACYpFh1tyraCwAAAABJRU5ErkJggg==","orcid":"","institution":"Central University of Rajasthan","correspondingAuthor":true,"prefix":"","firstName":"Bhawana","middleName":"","lastName":"Bissa","suffix":""}],"badges":[],"createdAt":"2026-01-11 02:08:12","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-8570970/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-8570970/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":100901463,"identity":"06b7e80c-1491-48e5-929e-120e4d50cab3","added_by":"auto","created_at":"2026-01-22 14:56:42","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":991451,"visible":true,"origin":"","legend":"\u003cp\u003eAutophagy inhibition enhances exosome size-\u003c/p\u003e\n\u003cp\u003eExosomes pellet isolated by UC was dissolved in PBS and directly applied to NTA. (A) NTA data representing EVs size and quantity (B) intensity of exosomes isolated from control and CQ-treated MD-MB-231 cells. (C) Exosome samples were prepared according to Karvonsky’s fixative (2.5% Glutaraldehyde and 2% Paraformaldehyde in 0.1M PBS, pH 7.4) to minimize vesicle rupture during isolation. TEM analysis of exosomes obtained from MDA-MB-231 conditioned media. The enlarged figures shows the intact boundry and diameter of the particle in nm. (D) Western blot showing exosome biomarkers TSG101 and CD63.\u003c/p\u003e","description":"","filename":"Figure1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8570970/v1/a392a25fda457b8b8b77b611.jpg"},{"id":100901451,"identity":"ddee560f-418d-4c96-95e6-e28d4c574954","added_by":"auto","created_at":"2026-01-22 14:56:40","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":617001,"visible":true,"origin":"","legend":"\u003cp\u003eModulation in exosome biogenesis genes and protein expression after autophagy inhibition-\u003c/p\u003e\n\u003cp\u003e(A) Expression of exosome biogenesis genes was analyzed by semi-quantitative and quantitative PCR. The RTPCR graphs were normalized with the 18s control value. B) Relative protein expression in cell and exosome lysates of MDA-MB-231 cells after treatment with CQ. (C) Expression of Alix, CD63, and TSG101 proteins was examined in cell lysates of MDA-MB-231 as well as (D) HEK293T cells. Beta-actin was used as control for the western data normalization. Beta-actin was used as control for the western data normalization. (E) mRNA expression of Rab11 \u0026amp; Rab27a was analyzed by semi-quantitative and quantitative PCR in CQ treated HEK293T cells. Error bars represent SD. One-way and two-way ANOVA test was used for the significance.\u003c/p\u003e","description":"","filename":"Figure2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8570970/v1/cfdff8c5d492281a4f0cb38b.jpg"},{"id":100950240,"identity":"beb4c155-03ca-4b7e-9fe6-d7f5a0985fa3","added_by":"auto","created_at":"2026-01-23 07:07:19","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":549147,"visible":true,"origin":"","legend":"\u003cp\u003eExosome biogenesis inhibition by GW4869 enhances ATG5 \u0026amp; ATG16L1 gene expression-\u003c/p\u003e\n\u003cp\u003e(A) Quantitative PCR analysis of autophagy genes ATG5, ATG16L1, ATG7, and ATG3 in MDA-MB-231 cells (B) Semi-quantitative PCR analysis of ATG5 and ATG16L1 in MDA-MB-231 cells. (C) Western blotting of autophagy proteins in 10µM GW4869 treated MDA-MB-231 and (D) HEK293T cells. For control, 18s was used for data normalization in RTPCR experiments. Beta-actin was used as control for the western data normalization. Significance was determined by two-way ANOVA.\u003c/p\u003e","description":"","filename":"Figure3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8570970/v1/a6d762fbfa58eeb560230301.jpg"},{"id":100901466,"identity":"b3a9c641-f80f-484f-9de2-2bc0f64b5519","added_by":"auto","created_at":"2026-01-22 14:56:43","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":786193,"visible":true,"origin":"","legend":"\u003cp\u003eAlteration in CQ and GW4869 doses regulates cell proliferation and Alix retention in the cell\u003c/p\u003e\n\u003cp\u003e(A) Cell proliferation assay in MDA-MB-231 after treatment with 10µM GW4869 (B) A dose-dependent effect of GW4869 alone and in combination with CQ on MDA-MB-231 cells proliferation. (C) Alone or a combination of CQ and GW4869 treatment selectively modulates the intracellular Alix protein status in MDA-MB-231 and (D) HEK293T cells. Beta-actin was used as control for the western data normalization. . Unpaired t-test and ANOVA tests were used for the statistical analysis.\u003c/p\u003e","description":"","filename":"Figure4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8570970/v1/f303a374aa07d78f51650eb0.jpg"},{"id":100901445,"identity":"38888a5f-7908-415a-9d80-23a81fe8f586","added_by":"auto","created_at":"2026-01-22 14:56:39","extension":"jpg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":542754,"visible":true,"origin":"","legend":"\u003cp\u003eGW4869 selectively decreases GABARAPL2 among other family members in MDA-MB-231 and HEK293T cells mRNA expression after GW4869 treatment was analyzed by semi-quantitative and quantitative PCR for GABARAP protein family in (A) MDA-MB-231 and (B) HEK293T cells. (C) Semi-quantitative and quantitative PCR analysis of MAP1LC3A and MAP1LC3B genes in HEK293T. The RTPCR graphs were normalized with the 18s control value. (D) Protein expression of GABARAP, GABARAPL1, and GABARAPL2 in GW4869-treated HEK293T cells. Beta-actin was used as control for the western data normalization. A Two-way ANOVA was used to determine significance. (****: p\u0026lt;0.0001, ***: p\u0026lt;0.001, **: p\u0026lt;0.01, *: p\u0026lt;0.05, ns: non-significant).\u003c/p\u003e","description":"","filename":"Figure5.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8570970/v1/5bff13e7f38308fda72b1f4f.jpg"},{"id":100951243,"identity":"818053e9-3a4d-4154-a8fb-76a8b34dc777","added_by":"auto","created_at":"2026-01-23 07:10:18","extension":"jpg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":926360,"visible":true,"origin":"","legend":"\u003cp\u003eGABARAPL2 controls Alix retention and secretion in HEK293T cells. (A) Semi-quantitative and quantitative PCR analysis for the GABARAPL2 and Alix in GABARAPL2 knockdown and CQ treated HEK293T cells. The RTPCR graphs were normalized with the 18s control value. (B) Alix expression was analyzed in the combined GABARAPL2 knockdown and CQ treated groups. Beta-actin was used as control for the western data normalization. (C) Phase-contrast imaging of MDA-MB-231 cells after transfection with GABARAPL2-shRNA and CQ treatment. (D) In-silico study for Alix and GABARAPL2 shows the interactive amino acids and docking scores, which represent a higher prediction of the given PDB complex. Two-way ANOVA was used for the statistical analysis. (****: p\u0026lt;0.0001, ***: p\u0026lt;0.001, **: p\u0026lt;0.01, *: p\u0026lt;0.05).\u003c/p\u003e","description":"","filename":"Figure6.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8570970/v1/e67ae89ce3d6577893020473.jpg"},{"id":100901425,"identity":"b9729b1f-3fe2-4888-abc8-de10fcbc28a8","added_by":"auto","created_at":"2026-01-22 14:56:31","extension":"jpg","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":627795,"visible":true,"origin":"","legend":"\u003cp\u003eGABARAPL2 knockdown exerts changes in the\u003cstrong\u003e \u003c/strong\u003eCo-localization of Alix and LC3B\u003c/p\u003e\n\u003cp\u003e(A) Confocal imaging of MDA-MB-231 cells with mCherry-LC3 and Alix-mNeonGreen plasmids after treatment with CQ alone or combined with GABARAPL2 knockdown. Images were later analyzed with Fiji for puncta count/cell. Later, the analysis was normalized with the control values. One-way ANOVA was used for the statistical analysis (***: p\u0026lt;0.001, *: p\u0026lt;0.05).)\u003c/p\u003e","description":"","filename":"Figure7.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8570970/v1/3f89648a0df2a8cc41f907ec.jpg"},{"id":100953647,"identity":"f13eca24-0d2b-4cee-8084-e6de87b6acf2","added_by":"auto","created_at":"2026-01-23 07:22:13","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":6087907,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8570970/v1/96a50aae-3e32-4a19-88c5-2003978e31b6.pdf"},{"id":100901424,"identity":"d3df456a-8750-40e4-8441-5e2fe2818642","added_by":"auto","created_at":"2026-01-22 14:56:31","extension":"jpg","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":524062,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSupp. Figure 1: \u003c/strong\u003eExosome characterization shows increase in size as well as CD63 marker after CQ treatment\u003c/p\u003e\n\u003cp\u003e(A) Exosomes characterization by DLS for the exosomes from CQ-treated MDA-MB-231 and (B) MCF-7 cells. The size and St Dev values indicates the uniform size distribution throughout the sample. (C) Reversible ponceau stain representing equal loading of exosome lysates. (D) Relative expression of exosome specific biomarker in the cell lysates and exosomes from MDA-MB-231 cells.\u003c/p\u003e","description":"","filename":"Supp.Fig1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8570970/v1/a6ea59f2e90c8a6f0c512ad7.jpg"},{"id":100901448,"identity":"297585d6-866a-4ef4-81ed-c2976d86df38","added_by":"auto","created_at":"2026-01-22 14:56:39","extension":"jpg","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":793740,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSupp. Figure 2: \u003c/strong\u003e(A)\u003cstrong\u003e \u003c/strong\u003eMDA-MB-231 cells treated with Control exosomes, CQ exosomes, and only PBS (No exosomes). The fold change was calculated by normalizing datasets with No exosomes. (B) Expression of flotillin in both early-stage (Wortmannin) and late-stage (Chloroquine) autophagy inhibition in MDA-MB-231 cells. (C) Expression of Alix in the time-dependent treatment of CQ in HEK293T cells. One-way ANOVA was used for the statistical analysis. (****: p\u0026lt;0.0001, ***: p\u0026lt;0.001, **: p\u0026lt;0.01, *: p\u0026lt;0.05).\u003c/p\u003e","description":"","filename":"Supp.Fig2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8570970/v1/7eaf2c34a7b3657ffe0b1dec.jpg"},{"id":100901455,"identity":"4afcfffe-77e1-4bcf-affc-814d0d3ddf10","added_by":"auto","created_at":"2026-01-22 14:56:40","extension":"jpg","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":528501,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSupp. Figure 3: \u003c/strong\u003e(A) Quantitative PCR analysis for the ATG5 in MDA-MB-231 and MCF-7 cells after GW4869 treatment. (B) A concentration-dependent effect of GW4869 on the levels of ATG5 expression. (C) A negative correlation between ATG5 vs SMPD3 and ATG16L1 vs SMPD3 in cancer shows an interlink between autophagy and exosome genes. A paired t-test and one-way ANOVA were used for the statistical analysis (*: p\u0026lt;0.05).\u003c/p\u003e","description":"","filename":"Supp.Fig3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8570970/v1/83adb45436be5b55200e2839.jpg"},{"id":100901454,"identity":"194fab68-9896-4137-964d-69e190d8c1b6","added_by":"auto","created_at":"2026-01-22 14:56:40","extension":"jpg","order_by":4,"title":"","display":"","copyAsset":false,"role":"supplement","size":841525,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSupp. Figure 4: \u003c/strong\u003e(A) Cell count assay was performed for the MDA-MB-231 cells after treatment with 10µM GW4869, 20µM CQ, and 200nM. (B) MCF-7 cells treated with gradient of GW4869 and a combined treatment of 10µM GW4869 and 10µM CQ. (C) The survival plot analysis for breast cancer in the GEPIA database reflects a high survival rate for high SMPD3 expression. (D) Box-plots showing decrease in PDCD6IP expression with the increase in tumor grade in the TCGA samples, along with their statistical data. One-way ANOVA and two-way ANOVA were used for the statistical significance analysis. (****: p\u0026lt;0.0001, ***: p\u0026lt;0.001, **: p\u0026lt;0.01, *: p\u0026lt;0.05).\u003c/p\u003e","description":"","filename":"Supp.Fig4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8570970/v1/07a4280f4a7f85174bc4f528.jpg"},{"id":100950266,"identity":"7cef443c-79ee-43e2-a9e7-6c182d674aeb","added_by":"auto","created_at":"2026-01-23 07:07:26","extension":"jpg","order_by":5,"title":"","display":"","copyAsset":false,"role":"supplement","size":495506,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSupp. Figure 5: \u003c/strong\u003e(A) Expression of ATG8 genes was checked in the exoRBase database showing a much higher expression of GABARAPL2 among other members of the same subfamily. (B) An increase in GABARAPL2 expression in the BRCA compared to benign body fluids supports its involvement in tumor progression. (C) A more significant higher expression of GABARAPL2 among all three members of the GABARAPs in BRCA (exoRBase database).\u003c/p\u003e","description":"","filename":"Supp.Fig5.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8570970/v1/1af8fdd965cc9ee9c10b00e2.jpg"},{"id":100901449,"identity":"04aa963f-124f-44ca-b42e-7541570d1dd8","added_by":"auto","created_at":"2026-01-22 14:56:40","extension":"jpg","order_by":6,"title":"","display":"","copyAsset":false,"role":"supplement","size":790176,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSupp. Figure 6: \u003c/strong\u003e(A) Immunoblot analysis of Alix expression after knockdown of two isoforms, GABARAP and GABARAPL1. (B) Transfection with GABARAPL2-shRNA to confirm the knockdown in MDA-MB-231 cells. (C) Phase-contrast imaging of MCF-7 cells after transfection with GABARAPL2-shRNA and CQ treatment. \u0026nbsp;One-way ANOVA was used for the statistical analysis. (****: p\u0026lt;0.0001, ***: p\u0026lt;0.001, **: p\u0026lt;0.01, ns: non-significant).\u003c/p\u003e","description":"","filename":"Supp.Fig6.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8570970/v1/06bbcd42f6b221e4baf5694b.jpg"},{"id":100901426,"identity":"dd61f426-f381-4872-9c54-181121e8b2a3","added_by":"auto","created_at":"2026-01-22 14:56:31","extension":"jpg","order_by":7,"title":"","display":"","copyAsset":false,"role":"supplement","size":561656,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSupp. Figure 7: \u003c/strong\u003e(A) Confocal imaging of MDA-MB-231 cells transfected with CD63-EGFP and Alix-mNeonGreen plasmids. (B) Analysis showed the knockdown change was only visible in the Alix puncta in CQ and combined treatment with knockdown of GABARAPL2. One-way ANOVA was used for the statistical analysis. (***: p\u0026lt;0.001, **: p\u0026lt;0.01, ns: non-significant).\u003c/p\u003e","description":"","filename":"Supp.Fig7.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8570970/v1/3d1861bdfe06add81277fec8.jpg"},{"id":100901453,"identity":"5f83812f-8d6f-4523-9784-09d11c5fdf22","added_by":"auto","created_at":"2026-01-22 14:56:40","extension":"jpg","order_by":8,"title":"","display":"","copyAsset":false,"role":"supplement","size":365963,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSupp. Figure 8: \u003c/strong\u003e(A) Localization of mCherry-LC3 under the GABARAPL2 knockdown conditions. (B) Immunoblot of LC3B in the GABARAPL2 knockdown. The data was normalized with the control value. An unpaired t-test was performed for the statistical analysis. (ns: non-significant)\u003c/p\u003e","description":"","filename":"Supp.Fig8.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8570970/v1/ef3e8044d9c8bb6a4d1e5173.jpg"}],"financialInterests":"No competing interests reported.","formattedTitle":"GABARAPL2 and Alix mediate reciprocal regulation of autophagy and exosome pathways to facilitate cellular homeostasis","fulltext":[{"header":"Introduction","content":"\u003cp\u003eExtracellular vesicles (EVs) are micro/nano-sized lipid bound secretory vesicles that are released by almost all types of cells and are a conserved mechanism for intercellular communication throughout the evolution[\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. EVs are broadly categorized in three sub-types based on the synthesis and size: Exosomes (endosomal EVs) (30-150nm) formed by inward budding of mature endosome, Microvesicles/ectosomes (non-endosomal EVs) (200-2000nm) formed by outward budding of plasma membrane, and Apoptotic bodies (non-endosomal EVs) (500-4000nm) formed through membrane blebbing during the apoptosis[\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. Exosomes originate from the endosome, in which the inward budding of the endosome membrane causes the formation of intraluminal vesicles (ILVs), that later mature into multivesicular bodies (MVBs)[\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. To date, two processes have been identified for exosome biogenesis: an endosomal sorting complex required for transport-dependent (ESCRT) and an ESCRT-independent pathway. The ESCRT machinery operates in a stepwise cascade, in which ESCRT-0 and ESCRT-I first cluster ubiquitylated cargoes onto the microdomains of the MVB membrane. This recruits ESCRT-II and ESCRT-III, which trigger the inward budding of membrane and fission of microdomains, resulting in a flask-shaped bud inside the MVB lumen. Alix, another critical component of exosome machinery, assists budding and ILV formation by binding with the ESCRT-III subunit[\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. An ATPase-VPS4 finally buds off the vesicle. The ESCRT-independent mechanism can be elaborated as ceramide-dependent and tetraspanin-dependent. In the former, sphingomyelin is hydrolyzed by neutral sphingomyelinases (nSmases) to generate ceramide that may generate membrane subdomains and induce a membrane curvature inside the MVBs[\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. As such, inhibitors of nSMase such as GW4869 are now frequently used to inhibit exosome biogenesis[\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eAutophagy is a highly regulated process that is present at the basal level in most of the cells, but may also be crucial to the survival of cancer cells. It has been classified into three types: Macroautophagy, Chaperone-mediated autophagy (CMA), and Microautophagy. The autophagy process includes the initiation of phagophore formation, nucleation, and elongation of the autophagosome, as well as its fusion with and degradation in the lysosome. Briefly, under stress conditions, the mammalian target of rapamycin (mTOR) gets inactivated by AMPK and TP53, which leads to the activation of the ULK complex and ATG13, i.e., initiation of autophagy[\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. In the nucleation step, another protein, beclin-1, interacts and conjugates with VPS34 and ATG14L at the phagophore membrane to recruit protein turnover and damaged organelles. In the elongation and maturation of the autophagosome membrane, ATG8 plays a crucial role in intracellular trafficking. ATG8 can be subdivided into two protein subfamilies, i.e., microtubule-associated protein light chain-3 (MAP1LC3A-C/LC3A-C) subfamily and γ-aminobutyric acid receptor-associated protein (GABARAP, GABARAPL1, GABARAPL2/GATE-16) subfamily[\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. While the MAP1LC3 system regulates initial phagophore membrane elongation, GABARAP family proteins are thought to be involved in the final sealing of autophagosome membranes[\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. These subfamilies are proteolytically processed by two consecutive protein complexes. The first system involves ATG4, ATG7, and ATG3 and the second system is ATG12, ATG7, ATG16L1, and ATG5. These complexes interact and produce lipidated forms of LC3 and GABARAP subfamilies. Later, the autophagosome fuses with the lysosome to form autolysosome, and cargo is degraded. There are some studies that identified GABARAPL2 involvement in the intra-Golgi trafficking and in intracellular uptake and degradation of TNFRSF12A/FN14 via autophagy[\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. Interestingly, some \u003cem\u003ein vitro\u003c/em\u003e studies has shown that both GABARAP and GABARAPL2 induces vesicle growth that leads to spherical structure[\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eHere, we have used pharmaceutical inhibitors to test the role of autophagy and exosome pathway. Previous studies on the use of CQ in cancers have determined that CQ has the potential to increase radiotherapy and chemotherapy sensitivity in a broad range of cancers[\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. CQ diffuses in the cells in unprotonated form; since it is a weak base, it gets accumulated and becomes protonated in the lysosomes[\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. Consequently, it raises intralysosomal pH and disturbs autophagosome-lysosome fusion, thus inhibiting autophagy. Inhibition of autophagy results in a stock of damaged organelles in the cytoplasm and protein turnover in the ER, causing ER stress. Wortmannin was identified as the first phosphatidylinositol-4,5-biphosphate 3-kinase (PI3K) inhibitor[\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. Later, it was discovered that it interacts with additional PI3K accessory proteins, indicating potential adverse effects if produced as a drug. Some studies has also supported that wortmannin typically reduces the endosome release, hence a reduction in EVs secretion is observed[\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. In this study, we identified a change in size and quantity of exosomes derived from CQ-treated MDA-MB-231 cells. We also investigated the crosstalk between exosome and autophagy pathways using CQ and GW4869 in breast cancer cell line MDA-MB-231, and HEK293T fibroblast cells. Furthermore, for the first time, we have identified a link between cross-regulation of GABARAPL2 and Alix in mediating the homeostasis between Autophagy and Exosome pathways.\u003c/p\u003e"},{"header":"Material and methods","content":"\u003cp\u003e\u003cstrong\u003eA.\u0026nbsp; \u0026nbsp;\u0026nbsp;Cell culture:\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eHuman breast cancer cell lines MDA-MB-231 (RRID: CVCL_IN16, Mammary gland, Adenocarcinoma) and MCF-7 cells (RRID: CVCL_0031, Mammary gland, Adenocarcinoma) and human embryonic kidney cells (HEK293T/293T -RRID: CVCL_0063, Kidney) were derived from NCCS (National Center for Cell Sciences), Pune, India. These cells are authentic for these experiments and were confirmed for the absence of any mycoplasma contamination before all the experiments. \u0026nbsp;To maintain stabilized cell lines, these cells were grown in DMEM (Dulbecco\u0026rsquo;s modified Eagle Medium, Himedia), supplemented with 10% FBS (Himedia) and 1% antibiotic (Penicillin and Streptomycin) in 5% CO\u003csub\u003e2\u003c/sub\u003e at 37˚C. These cells were maintained and passaged thrice a week. All the cell experiments were performed at 70% confluency.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eB.\u0026nbsp; \u0026nbsp;\u0026nbsp;Inhibitor Treatment:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eChloroquine diphosphate salt was supplied by Acros Organics, Thermofisher (A0423470). A stock solution of 10mM was made in PBS to make further diluted working concentrations. Wortmannin (19545-26-7) and GW4869 (6823-69-4) were purchased from Sigma. Since both Wortmannin and GW4869 are weekly soluble in water, their stock solution was formed in DMSO (TC185, Himedia). For inhibitor studies, CQ was used in incomplete media (Only DMEM) whereas wortmannin and GW4869 were used in complete media. In the combined CQ and GW4869 treatment, incomplete media was used.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eC.\u0026nbsp; \u0026nbsp;\u0026nbsp;Cell proliferation assay:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eBriefly, 2x 10\u003csup\u003e3\u0026nbsp;\u003c/sup\u003ecells were seeded in triplicates in each well of a 96-well plate with 100\u0026micro;L DMEM complete media. Cells were allowed to adhere properly, and after reaching 70% confluency, we treated cells alone or with a combination of the above-listed compounds for 24 hr. The inhibitor GW4869 was added in 2.5\u0026micro;M, 5\u0026micro;M, and 10\u0026micro;M concentrations, while CQ was added in 10\u0026micro;M final concentrations. In the second group, we mixed 10\u0026micro;M CQ with the 10\u0026micro;M GW4869 to evaluate relative cell survival upon inhibiting late-stage autophagy and ESCRT independent pathway, respectively. After 24 hr, the cells were stained with 200 \u0026micro;L crystal violet stain. The absorbance of the captured stain was analyzed by OD at 592nm.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eD.\u0026nbsp; \u0026nbsp;\u0026nbsp;Exosome Isolation:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ea)\u0026nbsp; \u0026nbsp;\u0026nbsp;Exosome Isolation by Ultracentrifugation:\u003c/strong\u003e Ultracentrifugation is the most common method for isolating extracellular vesicles for good yield with high efficiency and minimum cost. Cultured MDA-MB-231 cells were seeded in a 100mm\u003csup\u003e2\u0026nbsp;\u003c/sup\u003eculture dish at an initial density of 2 \u0026times; 10\u003csup\u003e6\u0026nbsp;\u003c/sup\u003ecells. Once cells reach ~70% confluency, they are treated with 10\u0026micro;M CQ in serum-free DMEM media. After 24 hr, an additional 10\u0026micro;M CQ was added to the dishes. For control, cells were grown in DMEM only. After 48 hr, cell culture media (CCM) of grown cells were isolated and immediately subjected to centrifugation at 12,000 x g, 4 ˚C for 45 minutes to remove cell debris. The supernatant was collected in fresh UC tubes after filtration with 0.22\u0026micro; filters (Himedia, SF172-50NO) to remove microvesicles and filled with sterile PBS. Ultracentrifugation was done with an MLA-50 (Beckman Coulter) fixed angle rotor at 1,10,000g, 4 ˚C for 2 hours. Obtained pellets were washed with PBS and, ultimately, volume makeup with PBS. A second round of ultracentrifugation was performed at 1,10,000g, 4˚C for 70 minutes to obtain an exosome pellet. The isolated pellet was dissolved in an adequate amount of PBS for further applications and stored at -80˚C.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eb)\u0026nbsp; \u0026nbsp;\u0026nbsp;Exosome Isolation with ExoQuick kit:\u0026nbsp;\u003c/strong\u003eCCM collected from MDA-MB-231 cells was centrifuged at 3000 x g for 15 minutes to remove cell debris. The obtained supernatant was collected in a clean tube and mixed with 63\u0026micro;L ExoQuick exosome precipitation solution, inverted the tube to mix well, and incubated this tube straight upright at 4˚C. A centrifuge was done at 1500 x g, 4 ˚C for 30 minutes to get a white exosome pellet. This pellet was washed in PBS and stored at -80 ˚C for downstream applications.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eE.\u0026nbsp; \u0026nbsp;\u0026nbsp;Exosome characterization\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eExosomes isolated from MDA-MB-231 cell culture media were diluted in PBS and processed in a particle-size analyzer (ZEN 5600, DLS) to estimate the size and intensity of exosomes.\u0026nbsp;Nanoparticle tracking analysis (Malvern NanoSight NS300) was also performed for the same sample. The stock was diluted 500 times with PBS to get particles in an equal frame, and precise diameter, concentration, and size distribution were measured.\u003c/p\u003e\n\u003cp\u003eA pair of exosome samples were fixed with the2.5% glutaraldehyde, 2% paraformaldehyde, and 0.1M phosphate buffer (pH 7.4) (Fixative solution) at the time of isolation. To get information about morphology and size, exosomes were pelleted down, and a negative stain of phosphotungstic acid was used on the sample. The resultant exosome suspension was applied to the EM grids to promote the distribution of stained exosomes onto the grids. These grids were then washed briefly with PBS to remove excess negative background. The images of purified exosomes were analyzed by TEM (JEM-1400 Flash).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eF.\u0026nbsp; \u0026nbsp;\u0026nbsp;Protein isolation\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eMDA-MB-231 and HEK293T cells were seeded in 60mm\u003csup\u003e2\u003c/sup\u003e dishes. After reaching 70% confluency, cells were treated with either chloroquine (20\u0026micro;M), GW4869 (2.5\u0026micro;M, 5\u0026micro;M, 10\u0026micro;M), or a combination of both drugs for 48 hr in only DMEM media. Whole-cell protein was isolated by adding 100\u0026micro;L of NP40 lysis buffer (5M NaCl, 10% NP-40, 1M Tris pH 8.0) with a 1% protease inhibitor cocktail. A colorimetric assay was done by BCA protein assay kit (Thermo Fisher Scientific Inc., #23225, Rockford, IL, USA) to quantify the total protein of MDA-MB-231, HEK293T cells, and exosomes. Assessment of the BCA product was analyzed at 562nm wavelength.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eG.\u0026nbsp; \u0026nbsp;\u0026nbsp;Immunoblot analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eBriefly, 100\u0026micro;g of protein was loaded into a\u0026nbsp;sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). \u0026nbsp;The proteins were transferred onto a PVDF (Immun-Blot, Bio-Rad, # 1620177) membrane at a constant voltage of 65V for 90 minutes. The membranes were blocked for 1 hr using Tris-buffered saline (TBS) with 3% BSA, and then incubated with the primary antibodies against target proteins, such as Alix (mAb, 1:1000, CST), Flotillin-I (mAb, 1:1000, CST), ATG5 (mAb, 1:1000, CST), ATG12 (mAb, 1:1000, CST), ATG7 (mAb, 1:1000, CST), ATG16L1 (mAb, 1:1000, CST), Beclin1 (mAb, 1:1000, CST), LC3B (mAb, 1:1000, CST), GABARAP (mAb, 1:1000, CST), GABARAPL1 (mAb, 1:1000, CST), GABARAPL2 (mAb, 1:1000, CST), GFP-monoclonal (Invitrogen, GF28R), beta-actin (mAb, 1:1000, CST), CD63 (pAb, 1:500, Proteintech), and TSG101 (pAb, 1:1000, Proteintech) for overnight at 4\u0026nbsp;˚C on the rocker. After washing with TBS-Tween-20 (0.1%), incubation with HRP-conjugated Anti-mouse (1:3000, CST) and Anti-rabbit secondary antibodies (1:3000, CST) was carried out for 2 hours at room temperature with shaking. Proteins were detected in an enhanced chemiluminescence (ECL) detection kit (Bio-Rad). The obtained data was measured for densitometry graphs using the software ImageJ.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eH.\u0026nbsp; \u0026nbsp;\u0026nbsp;Real Time PCR\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eMDA-MB-231, MCF-7, and HEK293T cells were seeded at an initial density of 2x10\u003csup\u003e5\u0026nbsp;\u003c/sup\u003ecells in 35mm\u003csup\u003e2\u0026nbsp;\u003c/sup\u003edishes. Once cells reached 70% confluency, they were treated with 20\u0026micro;M CQ, 10\u0026micro;M GW4869, or 200nM Wortmannin. For cDNA synthesis, the extracted RNA was processed with a Verso cDNA synthesis kit (Thermo Fisher, US). For the quantitative real-time PCR, SYBR Green (Powerup SYBR Green, Thermo Fisher, #A25742) was used and detected with the CFX connect detection system (Bio-Rad). All PCR primers used for this work are listed in Table 1.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eTable 1: Primer sequences\u0026nbsp;\u003c/em\u003e\u003c/p\u003e\n\u003cdiv align=\"Left\"\u003e\n \u003ctable border=\"0\" cellspacing=\"0\" cellpadding=\"0\" width=\"537\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eGene\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003ePrimer\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eSequence\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e18S\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eForward\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eCGGCGACGACCCATTCGAAC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eReverse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eGAATCGAACCCTGATTCCCCGTC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eATG5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eForward\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eGCCATCAATCGGAAACTCAT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eReverse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eTGTGTGCAACTGTCCATCTG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eATG7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eForward\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eGAACATGGTGCTGGTTTCCT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eReverse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eCATCCAGGGTACTGGGCTAA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eATG16L1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eForward\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eTGGCCCAACTGAGGATTAAG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eReverse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eCTTCCGCTGCATTTGGTTAT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eATG3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eForward\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eTGCTATAAGCGGTGCAAACA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eReverse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eCGGCTTCCGTTATTCCTGTA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eATG4B\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eForward\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eCATTCACCAGATAGCGCAAA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eReverse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eCCACGTATCGAAGACAGCAA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eMAP1LC3A\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eForward\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eGAACTGAGCTGCCTCTACCG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eReverse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eCCAGAGGGACAACCCTAACA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eMAP1LC3B\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eForward\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eAGCGTCTCCACACCAATCTC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eReverse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eCAATTTCATCCCGAACGTCT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eGABARAP\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eForward\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eAGAAGAGCATCCGTTCGAGAA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eReverse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eCCAGGTCTCCTATCCGAGCTT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eGABARAPL1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eForward\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eCCCTCCCTTGGTTATCATCCA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eReverse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eACTCCCACCCCACAAAATCC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eGABARAPL2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eForward\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eTCGAGCGAAATATCCCGACA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eReverse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eCCACAAACAGGAAGATCGCC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eCD63\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eForward\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eGGACAGGATGCAGGCAGATT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eReverse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eTTAATGCAGCAGGAGTCGGG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eAlix\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eForward\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eCTGGCACAGGCTCAAGAAGT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eReverse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eAAACAATAACTGACCTTGGGGAG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eRab11\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eForward\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eGGTGTTCGCCATGAAAGGGT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eReverse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eCCTCCTCGTCCTCGGGAAAA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eRab27a\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eForward\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eCGCAGAGAAATATGGAATCCCC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eReverse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eTGATCGCACCACTCCTTCAG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n\u003c/div\u003e\n\u003cp\u003e\u003cstrong\u003eI.\u0026nbsp; \u0026nbsp; \u0026nbsp;Transfection\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo knock down the GABARAP isoforms, we used MDA-MB-231 and HEK293T cells and transfected against three different siRNAs, GABARAP (NM_0072782-AS), GABARAPL1 (NM_0314124-AS), and GABRAPL2 (NM_0072857) at 60-70% confluency by using Lipofectamine-3000 (Thermo Fisher Scientific, L3000008) according to the manufacturer\u0026rsquo;s protocol. For the non-targeting siRNA, we have used Scrambled control siRNA from GeneX India (SR-CL000-005). Briefly, lipofectamine was used 4\u0026micro;L for a 6-well plate with 20-50nM siRNA. After 24 hours, the media was changed, and the cells were re-transfected with the same siRNA and procedure to get better outcomes. After 24 hours of the second transfection, RNA was isolated and processed into cDNA for further applications. The same protocol was followed for the transfection-based immunoblot studies. For the overexpression studies, control (pcDNA5-EYFP, #47329), GABARAP (pcDNA5/FRT/TO eYFP-GABARAP), GABARAPL1 (pEYFP-GABARAPL1), and GABARAPL2 (pEYFP-GABARAPL2) plasmids were a kind gift by Dr. Silke Hoffmann Julich, Heinrich Heine University, Germany. A GABARAPL2-shRNA was also purchased from Sigma Aldrich (TRCN0000289948) for further analyzing the knockdown effects of GABARAPL2.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eJ.\u0026nbsp; \u0026nbsp; \u0026nbsp;Confocal Fluorescence Analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eMDA-MB-231 cells were plated in 6-well plate with a seeding density of 2\u0026nbsp;x 10\u003csup\u003e4\u0026nbsp;\u003c/sup\u003ecells/well. After reaching 40-50% confluency, knockdown experiments were performed with Lipofectamine 3000. After 24 hours, cells were co-transfected with the mCherry-LC3B and Alix-mNeonGreen plasmids. After 24 hours, CQ treatments were given for another 24 hours. Then, cells were fixed with the 4% paraformaldehyde, washed thrice with PBS, and mounted coverslips with the 70% glycerol. Fluorescence was measured using confocal microscopy (Leica).\u003c/p\u003e\n\u003cp\u003eConfocal microscopy for the fluorescent-fused proteins was conducted with the Stellaris 8 (Leica) equipped with 63x/1.40 and 100x/1.40 plan achromat objective (oil). For the excitation of DAPI, GFP, mCherry, and mNeonGreen, Argon ion lasers of 405nm, 488nm, 561nm, and 506nm respectively. Smart gain, intensity, and the value of \u0026gamma; were kept optimum throughout the imaging. Images were obtained with LAS-X and later processed and analyzed for colocalization with Fiji[73]. For the counting of mCherry, GFP and Neon-Green puncta, 10 cells per treatment were quantified using the analyze particles plugin in Fiji. Puncta showing double positive were counted as colocalized. All the images were statistically analyzed using an ANOVA test.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eK.\u0026nbsp; \u0026nbsp;\u0026nbsp;Cell Morphology Analysis by Phase-Contrast Microscopy\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eA total of eight 60 mm2dishes were seeded with MDA-MB-231 and MCF-7 cells at a seeding density of 3\u0026times;10\u003csup\u003e5\u0026nbsp;\u003c/sup\u003ecells/dish. After reaching 70% confluency, the cells were transfected with GABARAPL2-shRNA using Xfect Transfection reagent (Takara Bio, Cat# 631317) as per the manufacturer\u0026rsquo;s protocol. After the treatment is complete, the cells were imaged using an objective 40x magnification (Zeiss, Germany).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eL.\u0026nbsp; \u0026nbsp;\u0026nbsp;Molecular Docking\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe performed protein-protein docking by taking X-ray crystallographic structures for Alix, GABARAP, GABARAPL1, and GABARAPL2. The PDB structures of each GABARAPs (Ligand) were docked with the Alix (Receptor) using Cluspro and HDOCK. The HDOCK is a highly integrated suite that performs on a hybrid algorithm. Cluspro works on a Fast-Fourier Transform (FFT)-based algorithm, enabling it to dock proteins without prior information about the complexes. The final visualization tool used for the complex of docked PDB files was Pymol. This is a molecular visualization software that enables users to carry out virtual screening, binding site prediction, and molecular-docking analysis.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eM.\u0026nbsp; \u0026nbsp;Statistical analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll data analyses were done using GraphPad Prism 8.0. We used multiple tests, such as One-way ANOVA, Two-way ANOVA, and t-tests, depending on variables to estimate the difference between groups. A p-value of \u0026lt;0.05 were considered as significant in whole study (*=p\u0026lt;0.05, **=p\u0026lt;0.01, ***=p\u0026lt;0.001, ****=p\u0026lt;0.0001). All the experiments were performed in triplicates.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e \u003cb\u003e1. Autophagy inhibition enhances exosome release in breast cancer cells\u003c/b\u003e \u003c/p\u003e \u003cp\u003eTo determine whether inhibiting autophagosome-lysosome fusion can alter the exosome pathway, cells were treated with 20\u0026micro;M CQ and after 24 hrs, the cell-conditioned media (CCM) of MDA-MB-231 and MCF-7 cell lines were collected. EVs were isolated by ultracentrifugation from an equal volume of CCM in the control and CQ-treated MDA-MB-231 and MCF-7 cells. Using differential light scattering (DLS), an increase in EVs size was observed after CQ treatment in both MDA-MB-231 (Supp. Figure\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA) and MCF-7 cells (Supp. Figure\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB). As per previous studies, a change in the physical properties of EVs, such as increased exosome diameter (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA) and intensity (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB) from CQ-treated MDA-MB-231 and MCF-7 cells were observed by nanoparticle tracking analysis (NTA) [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. The data presented the mean value for the exosomes of control MDA-MB-231 cells to be 149nm\u0026thinsp;\u0026plusmn;\u0026thinsp;58.4 and a concentration of 4.57e007\u0026thinsp;\u0026plusmn;\u0026thinsp;1.32e007 particles/mL (6.2\u0026thinsp;\u0026plusmn;\u0026thinsp;1.3 particles per frame and 6.7\u0026thinsp;\u0026plusmn;\u0026thinsp;1.4 centres per frame) (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC). Meanwhile, EVs from CQ treated MDA-MB-231 cells presented a mean value of 169.5nm\u0026thinsp;\u0026plusmn;\u0026thinsp;95.6 and a concentration of 5.62e007\u0026thinsp;\u0026plusmn;\u0026thinsp;4.78e006 particles/mL (10.0\u0026thinsp;\u0026plusmn;\u0026thinsp;1.7 particles/frame and 10.3\u0026thinsp;\u0026plusmn;\u0026thinsp;1.6 centres per frame). To further characterize EVs, the same set of EVs samples were imaged under Transmission electron microscopy (TEM) with a magnification of 1,00,000x at 100nm scale. A homogeneous population of rounded vesicles with 25-150nm was observed, indicating that the exosomes were homogeneous mixture of cup-shaped and rounded vesicles (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC). As per the previous studies, we further performed SDS-PAGE (Supp. Figure\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC) and immunoblot assay to detect exosome-specific biomarkers in exosome lysates[\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e], [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e], [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. The exosomes showed the presence of TSG101, β-actin, and CD63 (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD) with a relatively high levels of β-actin and TSG101 in exosomes isolated from CQ-treated MDA-MB-231 cells (Supp. Figure\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003e2. Autophagy inhibition decreased the expression of exosome-specific markers in cells while increased the release in exosomes\u003c/b\u003e \u003c/p\u003e \u003cp\u003eTo evaluate the effect of autophagy inhibition on exosome pathway we treated MDA-MB-231 cells with 20\u0026micro;M CQ for 24 hrs and observed that both CD63 and Alix mRNA expression was downregulated (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). We further checked the effect on protein levels, and similar to previous studies [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e], we found exosome biomarkers Alix, as well as flotillin, to be decreased in the CQ-treated MDA-MB-231 cell lysates but consequently increased in the exosomes from CQ-treated MDA-MB-231 cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB). The decreased expression of flotillin in both CQ and wortmannin suggests that the modulation in exosome protein expression is not limited to the change in endosome pH driven by CQ. A most recent study has shown that tumor exosomes influence nearby and distant cells by remodeling microenvironment and drug resistance[\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e], [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. We incubated MDA-MB-231 cells with the exosomes derived from control and CQ-treated MDA-MB-231 cells to check how cancer exosomes affect the survival of tumor cells. This result showed a significant cell death in cells treated with CQ exosomes compared with control conditions (Supp. Figure\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). In addition, we also detected a decrease in Alix in the CQ treated MDA-MB-231 and HEK293T cells but no such changes were observed in CD63 and TSG101 (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC, \u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD). The decrease in Alix was significant in both MDA-MB-231 and HEK293T cells, so we treated HEK293T cells with CQ in a time-dependent manner and observed a gradual decrease in Alix expression (Supp Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC). Previous studies have shown that Rab27a and Rab27b promote exosome secretion in different cancers[\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e], [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. In another silencing experiment study, Rab11, Rab27a, and Rab27b were confirmed to regulate the exosome secretion[\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e], [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e], [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e], [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. We observed a higher expression of Rab11 and Rab27a in CQ-treated HEK293T cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eE), which denotes an up-regulation of exosome secretion upon blocking autophagy flux.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003e3. Exosome pathway inhibition altered the expression of autophagy-related genes\u003c/b\u003e \u003c/p\u003e \u003cp\u003eA recent study has shown the role of ATG5 in MVBs acidification[\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e] and another study has demonstrated that silencing of ATG5 enhances exosome release[\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e], so we wanted to analyze the expression of autophagy genes after inhibiting exosome biogenesis by using an inhibitor of nSmase2, GW4869 treatment in MDA-MB-231 cells. We observed an increase in ATG5 (\u0026gt;\u0026thinsp;3 fold) and ATG16L1 mRNA expression (\u0026gt;\u0026thinsp;2 fold) after treatment with 10\u0026micro;M GW4869 in MDA-MB-231 cells for 24 hrs (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA, \u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB)[\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. This increase in ATG5 mRNA expression was observed both in MDA-MB-231 and MCF-7 cells (Supp. Figure\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA). Protein expression of ATG5 and ATG16L1 was significantly increased upon GW4869 treatment in MDA-MB-231 cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD and HEK293T cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eE). Interestingly, other autophagy genes such as ATG7, ATG12, Beclin1 and LC3II did not show significant change in expression upon GW4869 treatment, thus highlighting the unique link of ATG5 and ATG16L1 with exosome pathway. Increase in ATG5 protein expression was also observed with different concentrations of GW4869 (Supp. Figure\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB). GW4869 is an inhibitor of nSmase2 and we observed a negative correlation of SMPD3 gene (nSmase2) with ATG5 and ATG16L1 in Correlation AnalyzerR in both normal and cancer databases, thus supporting the reciprocal relation between nSmase 2 and expression of ATG5 and ATG16L1[\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e] (Supp. Figure\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003e4. Combined inhibition of autophagy and exosome biogenesis induced cell death in breast cancer cells\u003c/b\u003e \u003c/p\u003e \u003cp\u003ePrevious studies have shown that GW4869 potentially inhibits tumor growth in the mouse 4T1 breast tumor model system[\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]. On the contrary, studies have also shown that nSmase2 (SMPD3) inhibits cell proliferation and stops the growth of drug-resistant tumors[\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. So, we performed a cell proliferation assay and found that treatment of MDA-MB-231 cells with 10\u0026micro;M GW4869 for 24 hrs significantly enhances their proliferation (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA). In a cell-count assay, we also validated the effect of GW4869 on the MDA-MB-231 proliferation rate. As compared to treatment with CQ and wortmannin, treatment with GW4869 led to an increase in the cell number (Supp. Figure\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA). Following these results, we treated MDA-MB-231 cells with increasing concentration of GW4869 (2.5\u0026micro;M, 5\u0026micro;M, and 10\u0026micro;M) and a combination treatment of 10\u0026micro;M CQ\u0026thinsp;+\u0026thinsp;10\u0026micro;M GW4869 for 24 hr (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB). We observed that GW4869 treatment alone gradually increases cell proliferation but combined treatment with 10\u0026micro;M CQ caused significant cell death in MDA-MB-231. Similar results were also obtained when the same concentrations were used for MCF-7 cell line (Supp. Figure\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB). The sharp decline in cell viability of MDA-MB-231 and MCF-7 cells upon combined inhibition of autophagy flux and exosome biogenesis highlights the crosstalk between autophagy and exosome pathways and their importance for cancer cell survival. Survival analysis for the SMPD3 gene shows that high expression of SMPD3 correlates with high overall survival in breast cancer patients, supporting a tumor suppressive role (Supp. Figure\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC). Further, to validate the effect of combined treatment on Alix expression, we analyzed the Alix expression in MDA-MB-231 and HEK293T cells. Figures\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC and \u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD show that the CQ treatment decreases Alix expression. However, a combined treatment of CQ and GW4869 restored the Alix expression. This result indicates that inhibition of autophagy flux by CQ enhances the encapsulation and release of Alix in exosomes, but blocking exosome biogenesis by GW4869 stops the encapsulation of Alix in exosomes and thus rescues the levels of Alix. This conclusion was also correlated with the TCGA sample databases where PDCD6IP (Alix) showed a progressively decreased expression in luminal, HER2 (+), and triple negative breast cancer (TNBC), respectively which might be due to enhanced autophagy perturbation in these tumor types (Supp. Figure\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD). This result highlights the dynamic crosstalk between autophagy and exosome pathways and potential of restricting cancer cell growth by combined inhibition of the two pathways simultaneously.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003e5. Inhibition of exosome biogenesis by GW4869 altered the expression of ATG8 family genes\u003c/b\u003e \u003c/p\u003e \u003cp\u003ePrevious studies have identified an autophagy-mediated unconventional protein secretion responsible for release of molecules not secreted through conventional protein secretion[\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]. The unconventional secretion by autophagy may partially be mediated through the exosome pathway. The ATG8s are crucial autophagy genes important for the process of autophagy pathway. However, it is unclear whether ATG8s particularly GABARAP secretion through exosomes is either a by-product of cellular trafficking or a specific event[\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e], [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]. Earlier, we assessed the expression of the MAP1LC3 family in GW4869-treated MDA-MB-231 cells, which did not show any significant changes in both MAP1LC3A and MAP1LC3B in GW4869-treated HEK293T cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC). So, we further checked the expression of another class of ATG8 genes, i.e. GABARAP family. We initially assessed the GABARAPs expression profile in the exoRBase database[\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e]. We found that GABARAPL2 was highly secreted in different cancer exosomes among other members (Supp. Figure\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA). Furthermore, the expression of GABARAPL2 showed a significantly higher expression in BRCA than the benign tumors (Supp. Figure\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB, \u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC). Previous studies on EV proteomics have described the association of GABARAP proteins with EV proxitome[\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e], [\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e]. A recent study has also demonstrated that lipidated GABARAPs interact with the ESCRT machinery, specifically with Alix[\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e]. Since GABARAPL2 showed significantly high expression in BRCA tumors, we performed a real-time PCR for GABARAP genes to check their expression after GW4869 treatment. The results showed that GABARAPL2 expression was significantly decreased after treatment with 10\u0026micro;M GW4869 in MDA-MB-231 (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA) as well as HEK293T cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB). However, no significant changes were observed in both GABARAP and GABARAPL1 genes. These changes were retained in their protein levels where GABARAPL2 expression was significantly decreased in GW4869 treated HEK293T cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eD). This result highlights a potential involvement of GABARAPL2 in exosome pathway\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003e6. GABARAPL2 knockdown reversed the CQ-mediated decrease in Alix expression\u003c/b\u003e \u003c/p\u003e \u003cp\u003ePrevious studies have revealed that ATG12-ATG3 and Alix interact together to regulate endosomal machinery for exosome biogenesis[\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e]. To check whether GABARAPs are associated with the exosome pathway, we knocked down GABARAP, GABARAPL1 and GABARAPL2 and checked the effect on Alix expression. Interestingly, we observed that the knockdown of GABARAPL2 rescued the CQ-mediated decrease in Alix expression at mRNA and protein levels (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA, \u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eB). However, there was no measurable change in the Alix protein levels after knockdown of GABARAP and GABARAPL1 and CQ treatment (Supp. Figure\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA). We again transfected MDA-MB-231 cells with GABARAPL2-shRNA to check the knockdown efficiency (Supp. Figure\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eB). We observed that knockdown of GABARAPL2 caused increased cell proliferation in both MDA-MB-231 (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eC) and MCF-7 cells (Supp. Figure\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eC) which was much more pronounced in GABARAPL2 knockdown cells treated with CQ. To ascertain the involvement of GABARAPL2 in Alix trafficking in ILVs and subsequent release in exosomes, we analyzed the interaction between Alix and GABARAPL2 using ClusPro, and HDock and visualized by Pymol[\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e], [\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e], [\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e]. To assess this, the following PDB IDs were used to get crystallographic structures: 2OEV- Alix, 4CO7- GABARAPL2. We observed that the HDock Docking score for the Alix-GABARAPL2 complex was \u0026minus;\u0026thinsp;246.29, and the ClusPro docking score was \u0026minus;\u0026thinsp;641.4. Also, Alix residues ranging from 232 to 290 show a strong relation with GABARAPL2 residues range 56 to 116 (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eD). Further analysis revealed that GABARAPL2 potentially interacts with the BRO domain of Alix. In conclusion, it is suggested that GABARAPL2 interacts with the Alix to facilitate its release in the exosomes.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e7. \u003cb\u003eGABARAPL2 knockdown increases colocalization of Alix and LC3B\u003c/b\u003e\u003c/p\u003e \u003cp\u003eWe performed confocal imaging to understand the role of GABARAPL2 in modulating Alix puncta. We knocked down GABARAPL2 in MDA-MB-231 cells and then expressed Alix-mNeonGreen and mCherry-LC3B in control and GABARAPL2 knocked down MDA-MB-231 cells.\u003c/p\u003e \u003cp\u003eAfter 24 hrs of transfection, cells were treated with 20\u0026micro;M CQ for 24 hours. We observed that the average number of colocalized puncta was 140 in control, this decreased after CQ treatment to 108, and was later rescued in combined GABARAPL2 knockdown and CQ treatment to 227 (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eA and \u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eB). To understand whether the effect of CQ was specific for Alix localization, we checked the puncta of CD63 as well and did not observe any significant change, whereas Alix puncta were significantly altered by CQ treatment and rescued by GABARAPL2 knockdown (Supp Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eA and \u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eB). Additionally, the effect of GABARAPL2 knockdown on the autophagy flux has been analyzed by confocal (Supp. Figure\u0026nbsp;8A) and western blot experiments (Supp. Figure\u0026nbsp;8B), which shows a non-significant change after the treatment. This result highlights the crucial role of GABARAPL2 in directing Alix to exosomes and subsequent release. In the absence of GABARAPL2, Alix remains associated with amphisomes, highlighted by colocalization of Alix and LC3 puncta. Thus, GABARAPL2 facilitates the incorporation of Alix in MVBs and its release in exosomes; therefore, we conclude that Alix and GABARAPL2 coordinate the crosstalk between autophagy and exosome pathways, and these molecules can be targeted for future studies and therapeutic applications.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eIn breast cancer cells, autophagy and exosome biogenesis pathways play an essential role in cellular homeostasis to tolerate hostile conditions in the tumor microenvironment and increase overall survival[\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e]. In the present study, we wanted to analyze the crosstalk between autophagy and exosome pathways. Previous studies have reported that impairment in lysosomal integrity alters the secretome of breast cancer cells[\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e]. Similar to previous studies, our results have also shown that the exosomes from CQ-treated MDA-MB-231 and MCF-7 cells have increased size and diameter[\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e]. We characterized the exosomes and observed that high levels of CD63, TSG101, Alix, Flotillin, and β-actin were present in the exosomes from CQ-treated cells as compared to non-treated cells. We extended our study and checked CD63, Alix, Rab11, and Rab27a expression in the CQ-treated MDA-MB-231 and HEK293 cells. Although both CD63 and Alix decreased in CQ-treated cells, increased expression of Rab11 and Rab27a suggested that more MVBs may be diverted towards exosome release instead of fusing with the lysosome. We further analyzed the same effect on protein levels, and observed that both flotillin and Alix were exported out in the exosomes in CQ-treated cells.\u003c/p\u003e \u003cp\u003eWe further investigated the effect of the exosome biogenesis inhibitor, GW4869, on autophagy-related genes. We observed a gradual increase in the MDA-MB-231 and MCF-7 cell proliferation with GW4869. Previous studies have shown that the knockdown of SMPD3 enhances p62 and LC3 gene expression[\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e]. However, in our study, we observed that SMPD3 inhibition led to an increase in ATG5 and ATG16L1 expression in both MDA-MB-231 and HEK293T cells, but LC3 expression was not altered significantly. Moreover, the increase in ATG5 and ATG16L1 expression after GW4869 treatment might be related to non-canonical functions of autophagy genes and may be important for vesicle trafficking. Previous studies have reported an increased level of ATG8 orthologs in the cell secretome[\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e], [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]. A recent study has also demonstrated the involvement of GABARAPL1 in the EV cargo loading[\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e]. In our study, we observed that SMPD3 inhibition led to decreased expression of GABARAPL2. Surprisingly, knockdown of GABARAPL2 rescued the decrease in Alix protein in response to CQ treatment and was present in the cells even in the presence of CQ. This indicated that GABARAPL2 might be directly involved in the secretion of Alix through exosomes. Additionally, we observed that release of Alix in exosomes in the presence of CQ was restricted and perhaps reversed with combined treatment of CQ and GW4869, thus highlighting the coordination between two pathways. Furthermore, the colocalization study of LC3B and Alix has shown that the colocalized puncta were decreased in CQ treatment, which was later rescued once the knockdown of GABARAPL2 was combined with CQ.\u003c/p\u003e \u003cp\u003eCQ is recognized as a late-stage autophagy inhibitor, it also exhibits autophagy-independent effects[\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e]. Our study emphasizes a new mechanism of treatment in which a combined treatment with CQ and GW4869, along with ongoing radiotherapy and chemotherapy, might strongly suppress cancer cell survival and intracellular signaling in breast cancer cells. In the field of exosome therapy, there are multiple challenges like low targeting, high heterogeneity, short half-life, and very poor efficiency that limit the use of exosomes in therapeutic attributes. Despite some limitations, targeting exosomes and autophagy and the use of exosomes in diagnostic and therapeutic applications can be assessed in upcoming clinical studies. From this study, we unravel the intricate relationship between autophagy and exosome pathways in the cellular homeostasis of breast cancer cells.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cdiv class=\"DefinitionList\"\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eATG\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eAutophagy-Related\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eEVs\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eExtracellular Vesicles\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eMVBs\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eMultivesicular Bodies\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eGABARAP\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eγ-aminobutyric acid receptor-associated protein\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eESCRT\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eEndosomal Sorting Complex Required for Transport\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eCQ\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eChloroquine\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003c/div\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgment:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe want to acknowledge the Central University of Rajasthan for providing the infrastructure and centralised instrumental facility. This work was funded and supported by the Science and Engineering Research Board (SERB)-Power” Grant (SPG/2021/002833), ICMR “Extra mural research grant” (52/27/2020-BIO/BMS) for providing research funds to Dr. Bhawana Bissa. We also acknowledge University Grant Commission (UGC) for the fellowship to Mr. Naveen Soni.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor contribution declaration:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll authors contributed to the conception and design of the study. Conceptualization, manuscript writing, experimental work, and figure preparation were performed by\u0026nbsp;\u003cstrong\u003eNaveen Soni\u003c/strong\u003e. Manuscript writing, proofreading, and experimental work were performed by\u0026nbsp;\u003cstrong\u003eMegha Chaudhary.\u0026nbsp;\u003c/strong\u003eConceptualization, manuscript writing, funding acquisition, and supervision by\u0026nbsp;\u003cstrong\u003eBhawana Bissa\u003c/strong\u003e. All authors read and approved the final manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics and Consent to Participate declarations:\u003c/strong\u003e Not Applicable\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eD. Bl and C. Bt, \u0026ldquo;Membrane vesicle release in bacteria, eukaryotes, and archaea: a conserved yet underappreciated aspect of microbial life,\u0026rdquo; \u003cem\u003eInfection and immunity\u003c/em\u003e, vol. 80, no. 6, Jun. 2012, doi: 10.1128/IAI.06014-11.\u003c/li\u003e\n\u003cli\u003eD. G. Robinson, Y. Ding, and L. Jiang, \u0026ldquo;Unconventional protein secretion in plants: a critical assessment,\u0026rdquo; \u003cem\u003eProtoplasma\u003c/em\u003e, vol. 253, no. 1, pp. 31\u0026ndash;43, Jan. 2016, doi: 10.1007/s00709-015-0887-1.\u003c/li\u003e\n\u003cli\u003eJ. S. Schorey, Y. Cheng, P. P. Singh, and V. L. Smith, \u0026ldquo;Exosomes and other extracellular vesicles in host-pathogen interactions,\u0026rdquo; \u003cem\u003eEMBO Rep\u003c/em\u003e, vol. 16, no. 1, pp. 24\u0026ndash;43, Jan. 2015, doi: 10.15252/embr.201439363.\u003c/li\u003e\n\u003cli\u003eL. Ribovski, B. Joshi, J. Gao, and I. Zuhorn, \u0026ldquo;Breaking free: endocytosis and endosomal escape of extracellular vesicles,\u0026rdquo; \u003cem\u003eevcna\u003c/em\u003e, vol. 4, no. 2, pp. 283\u0026ndash;305, Jun. 2023, doi: 10.20517/evcna.2023.26.\u003c/li\u003e\n\u003cli\u003eG. Raposo and W. Stoorvogel, \u0026ldquo;Extracellular vesicles: exosomes, microvesicles, and friends,\u0026rdquo; \u003cem\u003eJ Cell Biol\u003c/em\u003e, vol. 200, no. 4, pp. 373\u0026ndash;383, Feb. 2013, doi: 10.1083/jcb.201211138.\u003c/li\u003e\n\u003cli\u003eE. Cocucci and J. Meldolesi, \u0026ldquo;Ectosomes and exosomes: shedding the confusion between extracellular vesicles,\u0026rdquo; \u003cem\u003eTrends Cell Biol\u003c/em\u003e, vol. 25, no. 6, pp. 364\u0026ndash;372, Jun. 2015, doi: 10.1016/j.tcb.2015.01.004.\u003c/li\u003e\n\u003cli\u003eY. Zhang, Y. Liu, H. Liu, and W. H. Tang, \u0026ldquo;Exosomes: biogenesis, biologic function and clinical potential,\u0026rdquo; \u003cem\u003eCell \u0026amp; Bioscience\u003c/em\u003e, vol. 9, no. 1, p. 19, Feb. 2019, doi: 10.1186/s13578-019-0282-2.\u003c/li\u003e\n\u003cli\u003eN. A. Garcia, I. Ontoria-Oviedo, H. Gonz\u0026aacute;lez-King, A. Diez-Juan, and P. Sep\u0026uacute;lveda, \u0026ldquo;Glucose Starvation in Cardiomyocytes Enhances Exosome Secretion and Promotes Angiogenesis in Endothelial Cells,\u0026rdquo; \u003cem\u003ePLoS One\u003c/em\u003e, vol. 10, no. 9, p. e0138849, 2015, doi: 10.1371/journal.pone.0138849.\u003c/li\u003e\n\u003cli\u003eJ. H. Hurley, \u0026ldquo;ESCRT complexes and the biogenesis of multivesicular bodies,\u0026rdquo; \u003cem\u003eCurr Opin Cell Biol\u003c/em\u003e, vol. 20, no. 1, pp. 4\u0026ndash;11, Feb. 2008, doi: 10.1016/j.ceb.2007.12.002.\u003c/li\u003e\n\u003cli\u003eF. Arslan \u003cem\u003eet al.\u003c/em\u003e, \u0026ldquo;Mesenchymal stem cell-derived exosomes increase ATP levels, decrease oxidative stress and activate PI3K/Akt pathway to enhance myocardial viability and prevent adverse remodeling after myocardial ischemia/reperfusion injury,\u0026rdquo; \u003cem\u003eStem Cell Res\u003c/em\u003e, vol. 10, no. 3, pp. 301\u0026ndash;312, May 2013, doi: 10.1016/j.scr.2013.01.002.\u003c/li\u003e\n\u003cli\u003eW. M. Henne, N. J. Buchkovich, and S. D. Emr, \u0026ldquo;The ESCRT Pathway,\u0026rdquo; \u003cem\u003eDevelopmental Cell\u003c/em\u003e, vol. 21, no. 1, pp. 77\u0026ndash;91, Jul. 2011, doi: 10.1016/j.devcel.2011.05.015.\u003c/li\u003e\n\u003cli\u003eJ. Kowal, M. Tkach, and C. Th\u0026eacute;ry, \u0026ldquo;Biogenesis and secretion of exosomes,\u0026rdquo; \u003cem\u003eCurr Opin Cell Biol\u003c/em\u003e, vol. 29, pp. 116\u0026ndash;125, Aug. 2014, doi: 10.1016/j.ceb.2014.05.004.\u003c/li\u003e\n\u003cli\u003eF. Fatima and M. Nawaz, \u0026ldquo;Stem cell-derived exosomes: roles in stromal remodeling, tumor progression, and cancer immunotherapy,\u0026rdquo; \u003cem\u003eChinese Journal of Cancer\u003c/em\u003e, vol. 34, no. 3, p. 46, Sep. 2015, doi: 10.1186/s40880-015-0051-5.\u003c/li\u003e\n\u003cli\u003eM. F. Baietti \u003cem\u003eet al.\u003c/em\u003e, \u0026ldquo;Syndecan-syntenin-ALIX regulates the biogenesis of exosomes,\u0026rdquo; \u003cem\u003eNat Cell Biol\u003c/em\u003e, vol. 14, no. 7, pp. 677\u0026ndash;685, Jun. 2012, doi: 10.1038/ncb2502.\u003c/li\u003e\n\u003cli\u003eJ. F. Nabhan, R. Hu, R. S. Oh, S. N. Cohen, and Q. Lu, \u0026ldquo;Formation and release of arrestin domain-containing protein 1-mediated microvesicles (ARMMs) at plasma membrane by recruitment of TSG101 protein,\u0026rdquo; \u003cem\u003eProc Natl Acad Sci U S A\u003c/em\u003e, vol. 109, no. 11, pp. 4146\u0026ndash;4151, Mar. 2012, doi: 10.1073/pnas.1200448109.\u003c/li\u003e\n\u003cli\u003eS. Stuffers, C. Sem Wegner, H. Stenmark, and A. Brech, \u0026ldquo;Multivesicular endosome biogenesis in the absence of ESCRTs,\u0026rdquo; \u003cem\u003eTraffic\u003c/em\u003e, vol. 10, no. 7, pp. 925\u0026ndash;937, Jul. 2009, doi: 10.1111/j.1600-0854.2009.00920.x.\u003c/li\u003e\n\u003cli\u003eK. Trajkovic \u003cem\u003eet al.\u003c/em\u003e, \u0026ldquo;Ceramide triggers budding of exosome vesicles into multivesicular endosomes,\u0026rdquo; \u003cem\u003eScience\u003c/em\u003e, vol. 319, no. 5867, pp. 1244\u0026ndash;1247, Feb. 2008, doi: 10.1126/science.1153124.\u003c/li\u003e\n\u003cli\u003eF. M. Go\u0026ntilde;i and A. Alonso, \u0026ldquo;Effects of ceramide and other simple sphingolipids on membrane lateral structure,\u0026rdquo; \u003cem\u003eBiochim Biophys Acta\u003c/em\u003e, vol. 1788, no. 1, pp. 169\u0026ndash;177, Jan. 2009, doi: 10.1016/j.bbamem.2008.09.002.\u003c/li\u003e\n\u003cli\u003e\u0026ldquo;Blockade of Exosome Generation with GW4869 Dampens the Sepsis-Induced Inflammation and Cardiac Dysfunction - PMC.\u0026rdquo; Accessed: Mar. 11, 2025. [Online]. Available: https://pmc.ncbi.nlm.nih.gov/articles/PMC4581992/\u003c/li\u003e\n\u003cli\u003eG. van Niel \u003cem\u003eet al.\u003c/em\u003e, \u0026ldquo;The tetraspanin CD63 regulates ESCRT-independent and -dependent endosomal sorting during melanogenesis,\u0026rdquo; \u003cem\u003eDev Cell\u003c/em\u003e, vol. 21, no. 4, pp. 708\u0026ndash;721, Oct. 2011, doi: 10.1016/j.devcel.2011.08.019.\u003c/li\u003e\n\u003cli\u003eA. C. Theos \u003cem\u003eet al.\u003c/em\u003e, \u0026ldquo;A lumenal domain-dependent pathway for sorting to intralumenal vesicles of multivesicular endosomes involved in organelle morphogenesis,\u0026rdquo; \u003cem\u003eDev Cell\u003c/em\u003e, vol. 10, no. 3, pp. 343\u0026ndash;354, Mar. 2006, doi: 10.1016/j.devcel.2006.01.012.\u003c/li\u003e\n\u003cli\u003eK.-H. Lim and L. M. Staudt, \u0026ldquo;Toll-like receptor signaling,\u0026rdquo; \u003cem\u003eCold Spring Harb Perspect Biol\u003c/em\u003e, vol. 5, no. 1, p. a011247, Jan. 2013, doi: 10.1101/cshperspect.a011247.\u003c/li\u003e\n\u003cli\u003eA. Salminen, K. Kaarniranta, and A. Kauppinen, \u0026ldquo;Beclin 1 interactome controls the crosstalk between apoptosis, autophagy and inflammasome activation: impact on the aging process,\u0026rdquo; \u003cem\u003eAgeing Res Rev\u003c/em\u003e, vol. 12, no. 2, pp. 520\u0026ndash;534, Mar. 2013, doi: 10.1016/j.arr.2012.11.004.\u003c/li\u003e\n\u003cli\u003eX. Li, S. He, and B. Ma, \u0026ldquo;Autophagy and autophagy-related proteins in cancer,\u0026rdquo; \u003cem\u003eMolecular Cancer\u003c/em\u003e, vol. 19, 2020, doi: 10.1186/s12943-020-1138-4.\u003c/li\u003e\n\u003cli\u003eC. He and D. J. Klionsky, \u0026ldquo;Regulation mechanisms and signaling pathways of autophagy,\u0026rdquo; \u003cem\u003eAnnu Rev Genet\u003c/em\u003e, vol. 43, pp. 67\u0026ndash;93, 2009, doi: 10.1146/annurev-genet-102808-114910.\u003c/li\u003e\n\u003cli\u003eA. Kihara, Y. Kabeya, Y. Ohsumi, and T. Yoshimori, \u0026ldquo;Beclin-phosphatidylinositol 3-kinase complex functions at the trans-Golgi network,\u0026rdquo; \u003cem\u003eEMBO Rep\u003c/em\u003e, vol. 2, no. 4, pp. 330\u0026ndash;335, Apr. 2001, doi: 10.1093/embo-reports/kve061.\u003c/li\u003e\n\u003cli\u003eB. Levine, R. Liu, X. Dong, and Q. Zhong, \u0026ldquo;Beclin orthologs: integrative hubs of cell signaling, membrane trafficking, and physiology,\u0026rdquo; \u003cem\u003eTrends Cell Biol\u003c/em\u003e, vol. 25, no. 9, pp. 533\u0026ndash;544, Sep. 2015, doi: 10.1016/j.tcb.2015.05.004.\u003c/li\u003e\n\u003cli\u003eY. Xin \u003cem\u003eet al.\u003c/em\u003e, \u0026ldquo;Cloning, expression patterns, and chromosome localization of three human and two mouse homologues of GABA(A) receptor-associated protein,\u0026rdquo; \u003cem\u003eGenomics\u003c/em\u003e, vol. 74, no. 3, pp. 408\u0026ndash;413, Jun. 2001, doi: 10.1006/geno.2001.6555.\u003c/li\u003e\n\u003cli\u003eH. He \u003cem\u003eet al.\u003c/em\u003e, \u0026ldquo;Post-translational modifications of three members of the human MAP1LC3 family and detection of a novel type of modification for MAP1LC3B,\u0026rdquo; \u003cem\u003eJ Biol Chem\u003c/em\u003e, vol. 278, no. 31, pp. 29278\u0026ndash;29287, Aug. 2003, doi: 10.1074/jbc.M303800200.\u003c/li\u003e\n\u003cli\u003eH. Weidberg, E. Shvets, T. Shpilka, F. Shimron, V. Shinder, and Z. Elazar, \u0026ldquo;LC3 and GATE-16/GABARAP subfamilies are both essential yet act differently in autophagosome biogenesis,\u0026rdquo; \u003cem\u003eEMBO J\u003c/em\u003e, vol. 29, no. 11, pp. 1792\u0026ndash;1802, Jun. 2010, doi: 10.1038/emboj.2010.74.\u003c/li\u003e\n\u003cli\u003eH. Winer, M. Fraiberg, A. Abada, T. Dadosh, B.-C. Tamim-Yecheskel, and Z. Elazar, \u0026ldquo;Autophagy differentially regulates TNF receptor Fn14 by distinct mammalian Atg8 proteins,\u0026rdquo; \u003cem\u003eNat Commun\u003c/em\u003e, vol. 9, no. 1, p. 3744, Sep. 2018, doi: 10.1038/s41467-018-06275-1.\u003c/li\u003e\n\u003cli\u003eA. Landajuela \u003cem\u003eet al.\u003c/em\u003e, \u0026ldquo;Lipid Geometry and Bilayer Curvature Modulate LC3/GABARAP-Mediated Model Autophagosomal Elongation,\u0026rdquo; \u003cem\u003eBiophys J\u003c/em\u003e, vol. 110, no. 2, pp. 411\u0026ndash;422, Jan. 2016, doi: 10.1016/j.bpj.2015.11.3524.\u003c/li\u003e\n\u003cli\u003eC. Verbaanderd \u003cem\u003eet al.\u003c/em\u003e, \u0026ldquo;Repurposing Drugs in Oncology (ReDO)-chloroquine and hydroxychloroquine as anti-cancer agents,\u0026rdquo; \u003cem\u003eEcancermedicalscience\u003c/em\u003e, vol. 11, p. 781, 2017, doi: 10.3332/ecancer.2017.781.\u003c/li\u003e\n\u003cli\u003eV. R. Solomon and H. Lee, \u0026ldquo;Chloroquine and its analogs: a new promise of an old drug for effective and safe cancer therapies,\u0026rdquo; \u003cem\u003eEur J Pharmacol\u003c/em\u003e, vol. 625, no. 1\u0026ndash;3, pp. 220\u0026ndash;233, Dec. 2009, doi: 10.1016/j.ejphar.2009.06.063.\u003c/li\u003e\n\u003cli\u003eR. Marone, V. Cmiljanovic, B. Giese, and M. P. Wymann, \u0026ldquo;Targeting phosphoinositide 3-kinase: moving towards therapy,\u0026rdquo; \u003cem\u003eBiochim Biophys Acta\u003c/em\u003e, vol. 1784, no. 1, pp. 159\u0026ndash;185, Jan. 2008, doi: 10.1016/j.bbapap.2007.10.003.\u003c/li\u003e\n\u003cli\u003eA. G. Batrouni and J. M. Baskin, \u0026ldquo;A MAP for PI3K activation on endosomes,\u0026rdquo; \u003cem\u003eNat Cell Biol\u003c/em\u003e, vol. 22, no. 11, pp. 1292\u0026ndash;1294, Nov. 2020, doi: 10.1038/s41556-020-00597-3.\u003c/li\u003e\n\u003cli\u003e\u0026ldquo;Crosstalk between autophagy inhibitors and endosome-related secretory pathways: a challenge for autophagy-based treatment of solid cancers | Molecular Cancer.\u0026rdquo; Accessed: Mar. 05, 2025. [Online]. Available: https://link.springer.com/article/10.1186/s12943-021-01423-6\u003c/li\u003e\n\u003cli\u003eJ. Xu \u003cem\u003eet al.\u003c/em\u003e, \u0026ldquo;Chloroquine treatment induces secretion of autophagy-related proteins and inclusion of Atg8-family proteins in distinct extracellular vesicle populations,\u0026rdquo; \u003cem\u003eAutophagy\u003c/em\u003e, vol. 18, no. 11, pp. 2547\u0026ndash;2560, doi: 10.1080/15548627.2022.2039535.\u003c/li\u003e\n\u003cli\u003eM. Colombo, G. Raposo, and C. Th\u0026eacute;ry, \u0026ldquo;Biogenesis, secretion, and intercellular interactions of exosomes and other extracellular vesicles,\u0026rdquo; \u003cem\u003eAnnu Rev Cell Dev Biol\u003c/em\u003e, vol. 30, pp. 255\u0026ndash;289, 2014, doi: 10.1146/annurev-cellbio-101512-122326.\u003c/li\u003e\n\u003cli\u003eC. Th\u0026eacute;ry \u003cem\u003eet al.\u003c/em\u003e, \u0026ldquo;Minimal information for studies of extracellular vesicles 2018 (MISEV2018): a position statement of the International Society for Extracellular Vesicles and update of the MISEV2014 guidelines,\u0026rdquo; \u003cem\u003eJ Extracell Vesicles\u003c/em\u003e, vol. 7, no. 1, p. 1535750, 2018, doi: 10.1080/20013078.2018.1535750.\u003c/li\u003e\n\u003cli\u003eF. G. Ortega \u003cem\u003eet al.\u003c/em\u003e, \u0026ldquo;Interfering with endolysosomal trafficking enhances release of bioactive exosomes,\u0026rdquo; \u003cem\u003eNanomedicine: Nanotechnology, Biology, and Medicine\u003c/em\u003e, vol. 20, Aug. 2019, doi: 10.1016/j.nano.2019.102014.\u003c/li\u003e\n\u003cli\u003eS. S. Panda, R. K. Sahoo, S. K. Patra, S. Biswal, and B. K. Biswal, \u0026ldquo;Molecular insights to therapeutic in cancer: role of exosomes in tumor microenvironment, metastatic progression and drug resistance,\u0026rdquo; \u003cem\u003eDrug Discovery Today\u003c/em\u003e, vol. 29, no. 8, p. 104061, Aug. 2024, doi: 10.1016/j.drudis.2024.104061.\u003c/li\u003e\n\u003cli\u003eY. Huang \u003cem\u003eet al.\u003c/em\u003e, \u0026ldquo;Exosome-mediated remodeling of the tumor microenvironment: From local to distant intercellular communication,\u0026rdquo; \u003cem\u003eCancer Lett\u003c/em\u003e, vol. 543, p. 215796, Sep. 2022, doi: 10.1016/j.canlet.2022.215796.\u003c/li\u003e\n\u003cli\u003eM. Ostrowski \u003cem\u003eet al.\u003c/em\u003e, \u0026ldquo;Rab27a and Rab27b control different steps of the exosome secretion pathway,\u0026rdquo; \u003cem\u003eNat Cell Biol\u003c/em\u003e, vol. 12, no. 1, pp. 19\u0026ndash;30; sup pp 1-13, Jan. 2010, doi: 10.1038/ncb2000.\u003c/li\u003e\n\u003cli\u003eM. S. Ostenfeld \u003cem\u003eet al.\u003c/em\u003e, \u0026ldquo;Cellular disposal of miR23b by RAB27-dependent exosome release is linked to acquisition of metastatic properties,\u0026rdquo; \u003cem\u003eCancer Res\u003c/em\u003e, vol. 74, no. 20, pp. 5758\u0026ndash;5771, Oct. 2014, doi: 10.1158/0008-5472.CAN-13-3512.\u003c/li\u003e\n\u003cli\u003e\u0026ldquo;Regulation of exosome secretion by Rab35 and its GTPase-activating proteins TBC1D10A-C - PubMed.\u0026rdquo; Accessed: Mar. 05, 2025. [Online]. Available: https://pubmed.ncbi.nlm.nih.gov/20404108/\u003c/li\u003e\n\u003cli\u003eH. Peinado \u003cem\u003eet al.\u003c/em\u003e, \u0026ldquo;Melanoma exosomes educate bone marrow progenitor cells toward a pro-metastatic phenotype through MET,\u0026rdquo; \u003cem\u003eNat Med\u003c/em\u003e, vol. 18, no. 6, pp. 883\u0026ndash;891, Jun. 2012, doi: 10.1038/nm.2753.\u003c/li\u003e\n\u003cli\u003eH. Guo \u003cem\u003eet al.\u003c/em\u003e, \u0026ldquo;Atg5 Disassociates the V1V0-ATPase to Promote Exosome Production and Tumor Metastasis Independent of Canonical Macroautophagy,\u0026rdquo; \u003cem\u003eDevelopmental Cell\u003c/em\u003e, vol. 43, no. 6, pp. 716-730.e7, Dec. 2017, doi: 10.1016/j.devcel.2017.11.018.\u003c/li\u003e\n\u003cli\u003eN. Fussi \u003cem\u003eet al.\u003c/em\u003e, \u0026ldquo;Exosomal secretion of \u0026alpha;-synuclein as protective mechanism after upstream blockage of macroautophagy,\u0026rdquo; \u003cem\u003eCell Death Dis\u003c/em\u003e, vol. 9, no. 7, p. 757, Jul. 2018, doi: 10.1038/s41419-018-0816-2.\u003c/li\u003e\n\u003cli\u003eY. Peng \u003cem\u003eet al.\u003c/em\u003e, \u0026ldquo;Blockade of exosome generation by GW4869 inhibits the education of M2 macrophages in prostate cancer,\u0026rdquo; \u003cem\u003eBMC Immunol\u003c/em\u003e, vol. 23, p. 37, Aug. 2022, doi: 10.1186/s12865-022-00514-3.\u003c/li\u003e\n\u003cli\u003eH. E. Miller and A. J. R. Bishop, \u0026ldquo;Correlation AnalyzeR: functional predictions from gene co-expression correlations,\u0026rdquo; \u003cem\u003eBMC Bioinformatics\u003c/em\u003e, vol. 22, no. 1, p. 206, Apr. 2021, doi: 10.1186/s12859-021-04130-7.\u003c/li\u003e\n\u003cli\u003eB. A. Pulaski and S. Ostrand-Rosenberg, \u0026ldquo;Mouse 4T1 breast tumor model,\u0026rdquo; \u003cem\u003eCurr Protoc Immunol\u003c/em\u003e, vol. Chapter 20, p. Unit 20.2, May 2001, doi: 10.1002/0471142735.im2002s39.\u003c/li\u003e\n\u003cli\u003eC. Tallon \u003cem\u003eet al.\u003c/em\u003e, \u0026ldquo;Nipping disease in the bud: nSMase2 inhibitors as therapeutics in extracellular vesicle-mediated diseases,\u0026rdquo; \u003cem\u003eDrug Discov Today\u003c/em\u003e, vol. 26, no. 7, pp. 1656\u0026ndash;1668, Jul. 2021, doi: 10.1016/j.drudis.2021.03.025.\u003c/li\u003e\n\u003cli\u003eB. Ghandour, G. Dbaibo, and N. Darwiche, \u0026ldquo;The unfolding role of ceramide in coordinating retinoid-based cancer therapy,\u0026rdquo; \u003cem\u003eBiochem J\u003c/em\u003e, vol. 478, no. 19, pp. 3621\u0026ndash;3642, Oct. 2021, doi: 10.1042/BCJ20210368.\u003c/li\u003e\n\u003cli\u003eV. Deretic, S. Jiang, and N. Dupont, \u0026ldquo;Autophagy intersections with conventional and unconventional secretion in tissue development, remodeling and inflammation,\u0026rdquo; \u003cem\u003eTrends Cell Biol\u003c/em\u003e, vol. 22, no. 8, pp. 397\u0026ndash;406, Aug. 2012, doi: 10.1016/j.tcb.2012.04.008.\u003c/li\u003e\n\u003cli\u003eS. Asano \u003cem\u003eet al.\u003c/em\u003e, \u0026ldquo;Phospholipase C-related catalytically inactive protein (PRIP) controls KIF5B-mediated insulin secretion,\u0026rdquo; \u003cem\u003eBiol Open\u003c/em\u003e, vol. 3, no. 6, pp. 463\u0026ndash;474, May 2014, doi: 10.1242/bio.20147591.\u003c/li\u003e\n\u003cli\u003eJ. L. Sanwald, G. Poschmann, K. St\u0026uuml;hler, C. Behrends, S. Hoffmann, and D. Willbold, \u0026ldquo;The GABARAP Co-Secretome Identified by APEX2-GABARAP Proximity Labelling of Extracellular Vesicles,\u0026rdquo; \u003cem\u003eCells\u003c/em\u003e, vol. 9, no. 6, Jun. 2020, doi: 10.3390/cells9061468.\u003c/li\u003e\n\u003cli\u003eH. Lai \u003cem\u003eet al.\u003c/em\u003e, \u0026ldquo;exoRBase 2.0: an atlas of mRNA, lncRNA and circRNA in extracellular vesicles from human biofluids,\u0026rdquo; \u003cem\u003eNucleic Acids Res\u003c/em\u003e, vol. 50, no. D1, pp. D118\u0026ndash;D128, Jan. 2022, doi: 10.1093/nar/gkab1085.\u003c/li\u003e\n\u003cli\u003eC. Lefebvre, R. Legouis, and E. Culetto, \u0026ldquo;ESCRT and autophagies: Endosomal functions and beyond,\u0026rdquo; \u003cem\u003eSemin Cell Dev Biol\u003c/em\u003e, vol. 74, pp. 21\u0026ndash;28, Feb. 2018, doi: 10.1016/j.semcdb.2017.08.014.\u003c/li\u003e\n\u003cli\u003eM. Ogura \u003cem\u003eet al.\u003c/em\u003e, \u0026ldquo;Microautophagy regulated by STK38 and GABARAPs is essential to repair lysosomes and prevent aging,\u0026rdquo; \u003cem\u003eEMBO Rep\u003c/em\u003e, vol. 24, no. 12, p. e57300, Nov. 2023, doi: 10.15252/embr.202357300.\u003c/li\u003e\n\u003cli\u003eL. Murrow, R. Malhotra, and J. Debnath, \u0026ldquo;ATG12-ATG3 interacts with Alix to promote basal autophagic flux and late endosome function,\u0026rdquo; \u003cem\u003eNat Cell Biol\u003c/em\u003e, vol. 17, no. 3, pp. 300\u0026ndash;310, Mar. 2015, doi: 10.1038/ncb3112.\u003c/li\u003e\n\u003cli\u003eY. Yan, D. Zhang, P. Zhou, B. Li, and S.-Y. Huang, \u0026ldquo;HDOCK: a web server for protein-protein and protein-DNA/RNA docking based on a hybrid strategy,\u0026rdquo; \u003cem\u003eNucleic Acids Res\u003c/em\u003e, vol. 45, no. W1, pp. W365\u0026ndash;W373, Jul. 2017, doi: 10.1093/nar/gkx407.\u003c/li\u003e\n\u003cli\u003eR. E. Rigsby and A. B. Parker, \u0026ldquo;Using the PyMOL application to reinforce visual understanding of protein structure,\u0026rdquo; \u003cem\u003eBiochem Mol Biol Educ\u003c/em\u003e, vol. 44, no. 5, pp. 433\u0026ndash;437, Sep. 2016, doi: 10.1002/bmb.20966.\u003c/li\u003e\n\u003cli\u003eD. Kozakov \u003cem\u003eet al.\u003c/em\u003e, \u0026ldquo;The ClusPro web server for protein-protein docking,\u0026rdquo; \u003cem\u003eNat Protoc\u003c/em\u003e, vol. 12, no. 2, pp. 255\u0026ndash;278, Feb. 2017, doi: 10.1038/nprot.2016.169.\u003c/li\u003e\n\u003cli\u003eM. Colletti, D. Ceglie, A. Di Giannatale, and F. Nazio, \u0026ldquo;Autophagy and Exosomes Relationship in Cancer: Friends or Foes?,\u0026rdquo; \u003cem\u003eFrontiers in Cell and Developmental Biology\u003c/em\u003e, vol. 8, 2021, Accessed: May 08, 2022. [Online]. Available: https://www.frontiersin.org/article/10.3389/fcell.2020.614178\u003c/li\u003e\n\u003cli\u003eA. Latifkar \u003cem\u003eet al.\u003c/em\u003e, \u0026ldquo;Loss of Sirtuin 1 Alters the Secretome of Breast Cancer Cells by Impairing Lysosomal Integrity,\u0026rdquo; \u003cem\u003eDev Cell\u003c/em\u003e, vol. 49, no. 3, pp. 393-408.e7, May 2019, doi: 10.1016/j.devcel.2019.03.011.\u003c/li\u003e\n\u003cli\u003eC. H. Mitchell and W. Lu, \u0026ldquo;Exosome release from RPE cells increased by lysosomal compromise,\u0026rdquo; \u003cem\u003eInvestigative Ophthalmology \u0026amp; Visual Science\u003c/em\u003e, vol. 63, no. 7, pp. 4617-F0409, Jun. 2022.\u003c/li\u003e\n\u003cli\u003eM. J. Back \u003cem\u003eet al.\u003c/em\u003e, \u0026ldquo;Activation of neutral sphingomyelinase 2 by starvation induces cell-protective autophagy via an increase in Golgi-localized ceramide,\u0026rdquo; \u003cem\u003eCell Death Dis\u003c/em\u003e, vol. 9, no. 6, p. 670, Jun. 2018, doi: 10.1038/s41419-018-0709-4.\u003c/li\u003e\n\u003cli\u003eJ. E. J. Beaumont \u003cem\u003eet al.\u003c/em\u003e, \u0026ldquo;GABARAPL1 is essential in extracellular vesicle cargo loading and metastasis development,\u0026rdquo; \u003cem\u003eRadiotherapy and Oncology\u003c/em\u003e, vol. 190, p. 109968, Jan. 2024, doi: 10.1016/j.radonc.2023.109968.\u003c/li\u003e\n\u003cli\u003eP. Maycotte, S. Aryal, C. T. Cummings, J. Thorburn, M. J. Morgan, and A. Thorburn, \u0026ldquo;Chloroquine sensitizes breast cancer cells to chemotherapy independent of autophagy,\u0026rdquo; \u003cem\u003eAutophagy\u003c/em\u003e, vol. 8, no. 2, pp. 200\u0026ndash;212, Feb. 2012, doi: 10.4161/auto.8.2.18554.\u003c/li\u003e\n\u003cli\u003eS. Sadeghi, F. R. Tehrani, S. Tahmasebi, A. Shafiee, and S. M. Hashemi, \u0026ldquo;Exosome engineering in cell therapy and drug delivery,\u0026rdquo; \u003cem\u003eInflammopharmacology\u003c/em\u003e, vol. 31, no. 1, pp. 145\u0026ndash;169, 2023, doi: 10.1007/s10787-022-01115-7.\u003c/li\u003e\n\u003cli\u003eT. Li \u003cem\u003eet al.\u003c/em\u003e, \u0026ldquo;The Therapeutic Potential and Clinical Significance of Exosomes as Carriers of Drug Delivery System,\u0026rdquo; \u003cem\u003ePharmaceutics\u003c/em\u003e, vol. 15, no. 1, p. 21, Dec. 2022, doi: 10.3390/pharmaceutics15010021.\u003c/li\u003e\n\u003cli\u003eJ. Schindelin \u003cem\u003eet al.\u003c/em\u003e, \u0026ldquo;Fiji: an open-source platform for biological-image analysis,\u0026rdquo; \u003cem\u003eNat Methods\u003c/em\u003e, vol. 9, no. 7, pp. 676\u0026ndash;682, Jun. 2012, doi: 10.1038/nmeth.2019.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"molecular-biology-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"mole","sideBox":"Learn more about [Molecular Biology Reports](https://www.springer.com/journal/11033)","snPcode":"11033","submissionUrl":"https://submission.nature.com/new-submission/11033/3","title":"Molecular Biology Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"Exosomes, Autophagy, Breast cancer, ATG8","lastPublishedDoi":"10.21203/rs.3.rs-8570970/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-8570970/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eThe continuous reliance of cancer cells to acquire energy and communicate their nutrient needs makes them resilient and vulnerable. It provides an opportunity to stifle cancer cells by restricting their energy generation and communication ability. Autophagy and exosome biogenesis pathways are essential in maintaining the robust growth and survival of cancer cells. In this study, we observed that inhibition of one pathway altered the expression of genes in the other pathway. Exosome biogenesis, when blocked, led to an increase in breast cancer cell proliferation, while inhibition of autophagy did not significantly affect cancer cell proliferation. The two pathways, when independently inhibited, did not present any significant effect on restricting cancer cell growth. However, a combined inhibition of both pathways led to substantial reduction in cancer cell proliferation. To evaluate the reciprocal regulation of two pathways, we blocked the autophagy pathway and observed an increase in the release of exosomes from MDA-MB-231 cells, along with decreased expression of Alix and CD63 genes. In contrast, inhibition of exosome biogenesis led to an increase in the expression of ATG5 and ATG16L1, and a significant decrease in expression of GABARAPL2. Interestingly, the knockdown of GABARAPL2 abrogated the decrease in Alix expression upon autophagy inhibition, highlighting the essential role of GABARAPL2 in Alix secretion. Thus, our study highlights for the first time the synergistic effects of autophagy and exosome pathway inhibition in restricting cancer cell growth as well as the involvement of GABARAPL2 in the regulation of exosome secretion via modulating Alix expression.\u003c/p\u003e","manuscriptTitle":"GABARAPL2 and Alix mediate reciprocal regulation of autophagy and exosome pathways to facilitate cellular homeostasis","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2026-01-22 14:56:25","doi":"10.21203/rs.3.rs-8570970/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2026-01-13T20:36:12+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2026-01-13T15:41:45+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2026-01-13T15:38:51+00:00","index":"","fulltext":""},{"type":"submitted","content":"Molecular Biology Reports","date":"2026-01-11T02:03:58+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"molecular-biology-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"mole","sideBox":"Learn more about [Molecular Biology Reports](https://www.springer.com/journal/11033)","snPcode":"11033","submissionUrl":"https://submission.nature.com/new-submission/11033/3","title":"Molecular Biology Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"f96bcb4c-d001-48f0-8a4c-e5a257ed3881","owner":[],"postedDate":"January 22nd, 2026","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"in-revision","subjectAreas":[],"tags":[],"updatedAt":"2026-04-08T09:33:55+00:00","versionOfRecord":[],"versionCreatedAt":"2026-01-22 14:56:25","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-8570970","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-8570970","identity":"rs-8570970","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.