Microglia-to-Neuron Mitochondrial Transfer Supports Neuronal Metabolism and Protects Against Neurodegeneration

preprint OA: closed CC-BY-4.0
Full text 193,387 characters · extracted from preprint-html · click to expand
Microglia-to-Neuron Mitochondrial Transfer Supports Neuronal Metabolism and Protects Against Neurodegeneration | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Microglia-to-Neuron Mitochondrial Transfer Supports Neuronal Metabolism and Protects Against Neurodegeneration Monara Kaelle Servulo Cruz Angelim, Lincon Felipe Lima Silva, and 13 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-9558181/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 7 You are reading this latest preprint version Abstract Intercellular mitochondrial transfer is an emerging neuroprotective mechanism, yet the pathways governing microglial donation and the functional relevance of distinct extracellular mitochondrial forms remain unclear. Using microglia expressing fluorescently tagged mitochondria, we show that microglia release mitochondria upon direct contact with injured neurons, generating naked mitochondria and mitovesicles. Hypothalamic orexigenic neurons internalize these organelles, a process enhanced by mitochondrial stress. Transfer is contact-dependent, requires ROCK1/2 activity, is independent of exosome biogenesis, and is markedly reduced by neuronal Connexin 43 (Cx43) deficiency, identifying Cx43-enriched contact sites as hubs for mitochondrial acquisition. Functionally, transfer enhances neuronal survival after rotenone exposure and promotes oxidative respiration and nicotinamide nucleotide turnover. However, redox outcomes depend on donor state: mitochondria from naïve microglia reduce oxidative stress, whereas those from LPS-stimulated microglia exacerbate it. In vivo, microglial mitochondria are detected in hypothalamic and dopaminergic neurons, and exogenous delivery modulates feeding behavior and partially rescues rotenone-induced deficits in a Parkinsonian model. Microglia Mitochondria transfer Oxidative Metabolism Neuroprotection Oxidative stress Parkinson’s disease Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Significance Statement Neuroinflammation and mitochondrial dysfunction drive devastating brain disorders such as Parkinson's disease. This study reveals that microglia, the brain's immune cells, can transfer healthy mitochondria to stressed neurons through a specialized contact-dependent mechanism. This donation rescues neuronal metabolism, reduces oxidative damage, and preserves axonal integrity. However, the outcome depends critically on the microglial state since mitochondria from activated microglia can exacerbate injury. We demonstrate this process occurs naturally in the brain and can be harnessed therapeutically to improve motor function in a Parkinson's model. These findings uncover a fundamental immunometabolic communication pathway with broad implications for treating neurodegenerative and metabolic diseases. Introduction Mitochondria dysfunction is a central driver in neuroinflammatory and neurodegenerative diseases such as Parkinson’s and Alzheimer’s. While neurons rely on mitochondrial integrity, neuronal dysfunction is exacerbated by microglia, which can amplify oxidative stress metabolic imbalance and inflammation 1 – 3 . However, beyond their inflammatory role, microglia also exhibited protective functions, including the intercellular transfer of mitochondria 4 , 5 , an emerging mechanism of metabolic support whose full significance for neuronal resilience is still being defined. Emerging evidence indicates that stressed neurons can internalize functional mitochondria released by microglia to support bioenergetics and survival 4 , 6 . However, this process is double-edged as microglia can also release dysfunctional mitochondria, which propagate neurodegeneration by, for example, triggering pathogenic A1 astrocytic responses 5 . The switch between these protective and detrimental outcomes is governed by a complex interplay of cellular metabolic state, cytoskeletal dynamics, and specific vesicular trafficking and uptake pathways 7 , 8 . Deciphering this regulatory network is therefore critical for developing therapeutic strategies that can selectively enhance beneficial mitochondrial transfer or correct metabolic impairments in neuroinflammatory diseases. Critical knowledge gaps remain regarding whether microglial mitochondria transfer operates as a targeted rescue mechanism in vivo , and how its efficacy is influenced by metabolic or neurodegenerative stress. To address this, we tested the hypothesis that this process constitutes a regulated form of intercellular metabolic support. Here, we show that microglia release distinct populations of mitochondria, either as naked organelles or enclosed within membrane-bound vesicles, which are internalized by neurons. This transfer rescues neuronal survival by alleviating oxidative stress, restoring respiration, and modulating neuropeptide expression. Furthermore, using in vivo models of obesity and Parkinson’s disease (PD), we demonstrate that this pathway preserves circuit function and prevents axonal degeneration. Together, our findings define a direct mechanism through which microglia support neuronal integrity via mitochondria donation, revealing a novel target for therapeutic intervention in neuroinflammatory and metabolic disorders. Results Microglia release mitochondria upon direct contact with injured neurons To determine whether microglia can release mitochondria, we employed primary microglia from LysM-CrePhAM floxed mice, in which mitochondria are labelled with the fluorescent protein Dendra2. In this model, Dendra2 is selectively expressed in the mitochondrial matrix 9 of lysozyme-expressing cells, which in the CNS are predominantly microglia (Fig. 1 A). This provides specific, constitutive green fluorescence labelling of the microglial mitochondria network. In monoculture, microglia showed no spontaneous mitochondria release. However, when co-cultured with neuronal cells, including primary neurons or the neuronal cell lines Neuro2a and Clu189, we observed limited extracellular mitochondria release ( Supplementary Figure S1 A) . We selected the Clu189 cell line for subsequent studies due to its relevance to energy metabolism and its capacity for spontaneous neuronal differentiation without exogenous inducers (Figure S1 B ). Clu189 cells are derived from hypothalamic orexigenic neurons and express AgRP neuropeptide 10 . To assess the influence of neuronal injury on microglia mitochondrial release, we exposed Clu189 neurons to rotenone, a mitochondrial complex I inhibitor that induces oxidative stress and neuronal death 11 , 12 . Upon adding primary microglia to injured neuronal culture, time-lapse microscopy over 24 hours revealed that rotenone-induced injury triggered a marked increase in the release of Dendra2 + mitochondria from microglia. This suggests that damaged neurons emit signals which actively recruit microglial mitochondria support. High-resolution imaging reveals two distinct forms of released mitochondria: (i) small, membrane-free naked mitochondria and (ii) larger mitovesicles, which are membrane encapsulated structures containing single or multiple mitochondria; or yet, interconnected organelles (Fig. 1 B-C, video S1C ). This mitochondrial release was a rapid microglial response, detectable within 1 hour of contact with injured neurons and peaking by 6 hours, at which point the extracellular space was populated with abundant Dendra2 + structures of both types. To investigate whether mitochondrial release is a general property or phenotype-dependent, we treated microglia with diverse stimuli (Mdivi-1, a mitochondria fission inhibitor; LPS; palmitate; and IL-4). All conditions triggered the release of both mitochondrial forms (Fig. 1 D-E), indicating that mitochondria release is a conserved microglial response. While the exact extrusion mechanism for mitochondria remains to be captured, their consistent presence and Dendra2 labelling confirm their microglial origin (Fig. 1 F). Orexigenic neurons internalize microglia-derived mitochondria We next investigated whether neurons could internalize the mitochondria released by microglia. After 24 hours of co-culture, immunofluorescence revealed the presence of Dendra2 inside Clu189 neurons, confirming that neurons do uptake microglia-derived mitochondria (Fig. 2 A). This uptake was not a passive process; live-cell imaging captured neurons actively recruiting extracellular mitochondria by extending membrane projections toward mitovesicles ( video S2C ). Importantly, neuronal injury amplified this process; thus, uptake was nearly threefold higher when neurons were pre-treated with rotenone, indicating that metabolic stress potently enhances the internalization of microglial mitochondria (Fig. 2 B). Notably, this enhanced uptake was independent of upstream changes in microglial mitochondria dynamics, since promoting fission with LPS or palmitate and fusion with Mdivi-1 + M1 ( Figure S2A-B ) did not alter the overall capture of mitochondria (Fig. 2 B). Functional analysis of the internalized mitochondria revealed a heterogenous population. While some Dendra2 + mitochondria retained membrane potential, as confirmed by co-localization with MitoTracker Deep Red, indicating they were metabolically competent upon entry (Fig. 2 C), others do not retain membrane potential (Fig. 2 D). To define the mechanisms underlying mitochondrial transfer, we first probed the role of canonical vesicle trafficking in microglia. Inhibition of cytoskeleton-dependent pathways in microglia with the ROCK1/2 inhibitor Y27632 reduced neuronal mitochondrial uptake. In contrast, blocking exosome release via the N-SMase inhibitor GW4869 had no effect (Fig. 2 E), suggesting that mitochondria are not conveyed through conventional exosomes. We next used a targeted CRISPR-Cas9 screen in Clu189 neurons to identify specific molecular mediators ( Figure S2C ). Knockout of Gja1, encoding the gap-junction protein Connexin 43 (Cx43), reduced mitochondrial uptake (Fig. 2 F ) , implicating Cx43 as a critical facilitator. In contrast, deletion of genes involved in alternative transfer pathways, such as Exoc1 (Sec3) for tunnelling nanotubes 13 ; Gm609 (ISEC1), a CD200 homolog that interacts with microglial CD200R 14 ; or Itgb1 (Integrin β1) 15 , had modest or negligible effects. In addition, high-resolution imaging revealed mitochondrial transfer at specialized contact sites between neurons and microglia, which served as hubs for the accumulation of mitochondria (Fig. 2 G). These microglial hubs enriched in mitochondria, formed around neuronal projections, may represent the sites at which Cx43 assembles functional gap junctions, thereby enabling direct mitochondrial transference. Together, our findings delineate a non-canonical intercellular pathway in which microglia release mitochondria via cytoskeleton-driven but exosome-independent mechanism, and neurons internalize them predominantly through Cx43-dedicated intercellular contact sites, regardless of the donor mitochondrial dynamics. Neuronal survival is promoted by microglial mitochondria through metabolic support and ROS mitigation To assess the functional impact of mitochondria transfer, we began by examining neuronal survival. As expected, exposure to rotenone let to increased neuronal death (Fig. 3 A). However, when neurons were co-cultured with microglia, this toxicity was significantly reduced. Notably, blocking mitochondria transfer by culturing microglia on 1 µm pore transwell inserts abolished the protective effect, demonstrating that direct cell-to-cell contact is essential for microglia to confer neuroprotection through mitochondrial transfer. To determine whether microglial mitochondria alone can provide neuroprotection, we supplemented rotenone-injured neurons with purified microglial mitochondria ( Figure S3A ). Although neurons successfully internalized these organelles ( Figure S3B ), neuronal death was not significantly reduced, despite a consistent trend toward protection (Fig. 3 B). This finding suggests that full efficacy may require additional microglial factors or the context of active cell-to-cell transfer. To elucidate the metabolic mechanisms underlying neuronal protection, we assessed glycolytic and mitochondrial function in injured neurons supplemented with microglial mitochondria. Glycolysis remained unchanged following mitochondria transfer, regardless of the prior activation state of the microglia ( Figure S3C ). In contrast, mitochondrial respiration was enhanced by mitochondria derived from naïve or Mdivi-1 + M1-treated microglia, but not by those from LPS-activated microglia (Fig. 3 C). This increase in respiratory capacity was accompanied by accelerated NAD+/NAD(P)H turnover, directly reflecting improved mitochondrial activity (Fig. 3 D). Given that rotenone induces oxidative stress, we next examined the effect of extracellular mitochondria on neuronal ROS levels. Co-culture with naïve microglia effectively attenuated rotenone-induced ROS accumulation, whereas LPS-activated microglia exacerbated it (Fig. 3 E). This effect was intrinsic to the transferred mitochondria: supplementation with mitochondria purified from naïve microglia reduced neuronal ROS, while mitochondria from LPS- or Mdivi-1 + M1-treated microglia had no effect (Fig. 3 F). Importantly, this reduction in ROS occurred without altering the mitochondrial membrane potential of neurons (Fig. 3 G), indicating that the antioxidant effect was not due to mitochondrial depolarization. The therapeutic window for this antioxidant effect proved to be narrow and context-dependent: mitochondrial supplementation failed to protect undifferentiated neuronal precursors ( Figure S3D ), and greater doses of isolated mitochondria increased oxidative stress ( Figure S3E ). These findings underscore the critical importance of both dosage and neuronal differentiation state in determining the efficacy of mitochondrial transfer. Finally, we investigated whether mitochondrial uptake influenced the expression of neurotransmitters and the pro-inflammatory cytokine Tnf . Following rotenone injury, which increased both AgRP and POMC expression, transferred mitochondria selectively potentiated AgRP expression ( Figure S3F ). This was accompanied by induction of Tnf ( Figure S3G ), indicating that exogenous mitochondria can trigger coordinated transcriptional responses involving both metabolic (orexigenic) and inflammatory pathways. Collectively, these data reveal a tripartite mechanism of microglia-mediated support: transferred mitochondria rescue neuronal bioenergetics by enhancing oxidative respiration, mitigate cytotoxicity by limiting ROS accumulation, and remodel neuronal phenotype by modulating neuropeptide and inflammatory gene expression. This multifaceted intervention highlights the complexity of intercellular metabolic support in the injured brain. Mitochondrial transfer occurs in the hypothalamus in vivo To determine whether microglia-to-neuron mitochondria transfer occurs in vivo , we analyzed whole sagittal brain sections from PhAM mice. Dendra2 + mitochondria were widely distributed across several brain regions, including the cortex, hippocampus, cerebellum, thalamus and hypothalamus (Fig. 4 A). Remarkably, within the hypothalamus, we observed a pronounced accumulation of Dendra2 signal inside neuronal cell bodies, particularly in the ventromedial hypothalamus (VMH) (Fig. 4 B ) and arcuate nucleus (Fig. 4 C). Characterization of recipient neurons revealed a specific cellular tropism: a subset of Dendra2 + neurons were identified as orexigenic, co-localizing with AgRP immunoreactivity (Fig. 4 D ) . In contrast, there was no evidence of mitochondrial transfer to anorexigenic POMC + neurons or to astrocytes in this region (Fig. 4 D, S4A). These findings demonstrate that microglial mitochondrial transfer to neurons occurs also in vivo , exhibiting both regional specificity and a selective preference for AgRP-expressing orexigenic neurons within the arcuate nucleus. Given the central role of AgRP neurons in energy homeostasis, we next examined whether their acquisition of microglial mitochondria is regulated by nutritional status. Quantification of Dendra2 + mitochondria in hypothalamic neurons revealed similar levels in mice fed either a standard chow or a high-fat diet ( Figure S4B ), suggesting that basal mitochondria transfer to this neuronal population is maintained independently of nutritional state. To assess whether microglial mitochondria can directly modulate feeding behavior, we injected purified mitochondria into the third ventricle of both lean and obese mice (Fig. 4 E). Interestingly, the effect on feeding behavior was dependent on metabolic state since in lean mice, mitochondria supplementation stimulated food intake, whereas in obese mice, it suppressed feeding (Fig. 4 F). This bidirectional modulation indicates that transferred mitochondria influence central feeding circuits in a state-specific manner, integrating into and altering the activity of these neural pathways. Therapeutic mitochondrial supplementation prevents axonal loss in Parkinson’s disease model Within the substantia nigra, we observed robust transfer of Dendra2 + mitochondria to tyrosine hydroxylase-positive (TH + ) dopaminergic neurons (Fig. 5 A, inset “a” ). Building on this anatomical evidence of mitochondrial transfer to a vulnerable neuronal population, we directly tested the therapeutic potential of this process in a PD model. Motor deficits were induced in mice through systemic, chronic rotenone treatment until animals exhibited at least 50% reduction in baseline motor performance. Following a 24-hour washout period, mitochondria isolated from microglia were unilaterally injected into the substantia nigra pars compacta (SNpc) (Fig. 5 B). The exogenous mitochondria were selectively internalized by ipsilateral SNpc TH + dopaminergic neurons with no detectable uptake in the contralateral hemisphere, conforming targeted local delivery (Fig. 5 C). Intranigral mitochondrial therapy resulted in a partial but significant restoration of locomotor performance (Fig. 5 D). Importantly, this structural and functional rescue was selective, as mitochondrial transfer did not alter rearing behavior (Fig. 5 E), suggesting a compartmentalized therapeutic effect. Consistent with this interpretation, mitochondrial transfer significantly increased the density of TH + axonal projections to the thalamus (Fig. 5 F) without affecting neuronal numbers (Fig. 5 G), indicating that the functional improvement was causally linked to the preservation of dopaminergic axonal integrity rather than to global changes in motor output. Collectively, these findings establish microglial mitochondrial donation as a fundamental neuroprotective mechanism that preserves axonal integrity and motor activity in a PD model. By demonstrating that this pathway can be leveraged therapeutically, we reveal a targeted approach to reinforce neuronal metabolism at its most vulnerable point, the axon, offering a promising avenue to halt circuit-level failure in neurodegenerative diseases. Discussion Intercellular mitochondrial transfer has emerged as a key neuroprotective mechanism in the CNS. Here, we identify a previously unrecognized contact-dependent pathway by which microglia donate mitochondria to neurons following injury. This process involves rapid release of two mitochondrial populations, naked mitochondria and mitovesicles, through a ROCK1/2-dependent mechanism. We further demonstrate that neuronal Cx43-enriched contact sites serve as focal platforms for mitochondrial accumulation and uptake. Functionally, the impact of mitochondrial transfer depends on donor microglial state. Mitochondria from naïve microglia enhance neuronal oxidative phosphorylation, accelerate NAD(P)H turnover, reduce oxidative stress, and improve survival after rotenone injury. In contrast, mitochondria from LPS-activated microglia increase neuronal ROS, revealing a state-dependent duality. Importantly, in vivo evidence of microglial mitochondrial transfer to hypothalamic and nigral neurons confirms this as a physiological and adaptive response to stress. Mechanistically, our data challenge the prevailing notion that mitochondrial fission is a prerequisite for extracellular release. Neither pharmacological promotion of fission nor fusion altered the process of releasing mitochondria, indicating that microglia employ specialized export mechanisms that operate independently of the fission–fusion cycle. Supporting this, Joshi and collaborators 5 found that LPS stimulation altered mitochondrial morphology without changing release quantity, indicating that division is not the limiting factor. Instead, shifts in fission-fusion balance may predominantly dictate the functional quality, rather than the abundance of released mitochondria 16 . For instance, exposure to the metabolic stressor palmitate, which promotes mitochondrial fragmentation, does not reduce mitochondrial release. Instead, palmitate may enhance the functional integrity of released mitochondria, possibly through a lipid-driven shift on microglial oxidative metabolism 7 . Our findings demonstrated that neurons actively internalize mitochondria released from microglia, a process amplified by neuronal metabolic stress. This supports the emerging paradigm of mitochondria as dynamic transcellular communicators. Importantly, the uptake of organelles with preserved membrane potential represents a physiologically meaningful event that can rescue neuronal bioenergetics. Conversely, the transfer of depolarized or fragmented mitochondria may propagate inflammatory signaling 1 , 5 . Together, a fundamental duality appears, the same process can mediate neuroprotection or neurotoxicity depending on donor organelle integrity. Neuronal uptake of microglial mitochondria is mediated through Cx43-enriched contact sites. This extends the established role of Cx43 in astrocyte–neuron coupling to microglial communication 17 – 20 , suggesting a broader model in which Cx43 organizes structural platforms for horizontal mitochondrial exchange. Cx43 has been implicated in several modes of mitochondria transfer, including Cx43-containing TNTs, Cx43 facilitates mitochondrial transfer through gap junctional Ca 2+ signaling and the subsequent internalization of gap junctions into connexosomes, which carry whole mitochondria between neighboring cells 21 – 24 . Mitochondrial export is further supported by ROCK1/2-dependent vesicular trafficking and the formation of mitovesicles, a distinct class of mitochondrial-enriched extracellular structures 25 , 26 . Together with OPA1/SNX9-dependent mitochondria-derived vesicle pathways 27 , these mechanisms likely coordinate mitochondrial quality control with selective intercellular delivery. Transferred mitochondria also influence neuronal inflammatory signaling. Microglial mitochondria increased neuronal TNF-α expression, consistent with the presence of mitochondrial DAMPs such as mtDNA and mtROS within mitovesicles 28 . These signals may activate innate immune pathways and remodel neuronal metabolic programs, linking inflammatory signaling to bioenergetic adaptation 25 . Functionally, microglial mitochondria protect metabolically compromised neurons through dual mechanisms: restoration of oxidative phosphorylation and reduction of oxidative stress. This rescue is strictly donor dependent. While naïve microglial mitochondria enhance respiration and NAD(P)H turnover, likely strengthening antioxidant defenses, mitochondria from LPS-activated microglia fail to confer benefit and may exacerbate stress 5 , 16 , 29 . Importantly, transfer selectively augments oxidative metabolism without altering glycolysis, preserving neuronal metabolic identity. However, excessive mitochondrial supplementation overwhelms quality-control systems, highlighting a narrow therapeutic window. Recipient differentiation state further influences efficacy, with mature oxidative neurons benefiting more than glycolytic precursors. Our in vivo findings establish microglia-to-neuron mitochondrial transfer as an active process within physiologically relevant contexts of metabolic and neurodegenerative stress. In the hypothalamus, AgRP-expressing neurons internalize microglial mitochondria. Exogenous delivery of these organelles to lean mice amplified food intake, consistent with in vitro data showing increased AgRP expression, thereby positioning mitochondrial transfer as a metabolic amplifier for orexigenic neurons circuits 30 . This effect was state dependent, since in obese mice, mitochondria supplementation did not stimulate feeding. While the behavioral impact was clear, robust cellular internalization of exogeneous mitochondria was less pronounced than endogenous transfer, raising intriguing questions about the possible paracrine signaling factors controlling these events effects, particularly within key subregions like the VMH. Similarly, in SNpc, microglial mitochondria were found within dopaminergic neurons. Therapeutically, exogenous mitochondrial administration mitigated motor deficits and preserved axonal integrity in a rotenone-induced Parkinson’s model. This demonstrates the potential of enhancing this endogenous pathway to support circuit resilience under neurodegenerative pressure 4 . Collectively, our findings reposition microglia-to-neuron mitochondrial transfer as a regulated, context-sensitive mechanism of brain homeostasis. The outcome, whether amplifying orexigenic drive, restoring metabolic sensitivity, or preserving axonal function, is determined by the interplay between the quality of donated mitochondria, the state of the donor microglia, and the pathophysiological context of the recipient tissue. This framework highlights both the therapeutic promise and complexity of targeting this pathway. Future studies should address whether full organelle functionality is required for neuroprotection or if specific molecular cargoes suffice, as well as the safety profile of mitochondrial interventions in vivo . Ultimately, our work reveals microglial mitochondrial donation as a sophisticated form of immunometabolic communication that shapes neural circuit function and systemic physiology. Limitations and Future Directions While this study defines a novel pathway for mitochondria transference and support, several limitations merit consideration. First, in our chronic rotenone model, the lack of significant dopaminergic cell body loss, potentially due to dosing or drug penetration, may have constrained the observable therapeutic window for mitochondrial rescue. Second, we did not evaluate the in vivo consequences of delivering dysfunctional mitochondria, a critical gap given our in vitro evidence that damaged mitochondria exacerbate neuroinflammation as also described. The functional ratio of released mitochondria is a key determinant of neuronal fate, highlighting the need to define the safety profile of mitochondrial interventions. Future studies should imply models with more pronounced neuronal loss and directly test the effects of mitochondria from activated microglia in vivo to translate this mechanism into a safe therapeutic strategy. Materials and Methods Animals C57BL/6J (males, 8–10 weeks, 22–25 g) PhAM Floxed and C57BL/6J LysM-Cre transgenic mice were obtained from The Jackson Laboratory and housed at the Multidisciplinary Center for Biological Research (CEMIB), Campinas University (UNICAMP, Brazil). The PhAM Floxed mouse line expresses the photo-convertible fluorescent protein Dendra2, which is specifically localized to mitochondria. To selectively label mitochondria in myeloid cells, PhAM Floxed mice were crossed with LysM-Cre mice, resulting in robust Dendra2 expression in myeloid-derived cells without altering mitochondrial morphology, as previously described 9 . Mice were maintained at 22 ± 1°C, 55 ± 5% humidity, 12-h light/dark cycle, with ad libitum access to food and water, and housed under specific pathogen-free conditions at the Animal Facility of the Institute of Biology, UNICAMP. Procedures were performed under anesthesia using a mixture of ketamine (100 mg/kg) and xylazine (10 mg/kg) applied intraperitoneally and euthanasia was achieved under deep anesthesia (5% isoflurane until no reflex) followed by cervical dislocation. All experimental procedures were carried out according to UNICAMP Animal Ethics Committee (protocol number 6301-1/2023). Unless otherwise stated, each experiment included at least 3 mice per group (when not specified), with 3 independent biological replicates and three technical replicates per assay. Obesity Obesity was induced by feeding mice a high-fat diet (Teklad TD93075; 55% kcal from fat) starting at six weeks of age for 12 weeks as previously described 31 . Age-matched controls received standard chow (Nuvilab® CR-1, Curitiba, Parana, Brazil; 4.9% kcal from fat). Body weight was recorded weekly throughout the feeding period. Food Intake Assessment Baseline food intake was measured daily for three consecutive days (D0–D3) prior to stereotaxic surgery (D5). Following surgery and recovery, mice were fasted for 24 hours on D9 with free access to water. Recombinant leptin (Sigma-Aldrich, Cat. #L4146) was then administered by intracerebroventricular injection into the third ventricle (10 µg in 2 µL), and food intake was recorded at 1, 3, 6, and 24 hours post-injection. In a separate cohort, mice were euthanized 30 minutes after leptin administration by anesthesia overdose, and the hypothalamus was rapidly dissected and collected for downstream protein analysis by western blotting. Experimental Parkinson’s Disease Model A Parkinson’s disease–like phenotype was induced by chronic intraperitoneal administration of rotenone, adapted from Cannon and collaborators 32 . Rotenone was prepared as a 50× stock solution in 100% DMSO and diluted in medium-chain triglyceride oil (98% MCT, 2% DMSO) to a final concentration of 3.0 mg/mL. Fresh solutions were prepared two to three times per week, protected from light, and vortexed before each injection. Rotenone was administered daily at a dose of 3 mg/kg (1 mL/kg injection volume). Control animals received vehicle (MCT-DMSO) alone. All behavioral assessments were performed by an experimenter blinded to treatment conditions. Each experimental group consisted of 5 mice. Behavioral Assessments Mice were monitored weekly for the development of Parkinson-like symptoms using open-field and rearing tests. Animals were considered to display a Parkinsonian phenotype when both distance travelled and number of rears were reduced by more than 50% relative to baseline (D0). Open field test: mice were acclimated to the open-field apparatus (Activity Monitor IR EP149, Equipment Insight) for 1 hour per day on two consecutive days. All behavioral testing was conducted in a quiet, isolated room, free from external interruptions. Locomotor activity (total distance, velocity) was recorded for 3 minutes. Rearing test: Mice were trained for 2 days to minimize anxiety-related artifacts. Rearing behavior was assessed by placing each animal into a clear 1-L glass cylinder for 2 minutes while video recording. A rear was defined as elevation of the forelimbs above shoulder level with simultaneous contact of both forelimbs on the cylinder wall. Forelimb removal from the wall and return to the floor were required before a subsequent rear was counted 33 . The total number of rears per session was quantified for each animal. Stereotaxic Brain Intervention Mice were anesthetized and injected with tramadol (5 mg/kg) subcutaneously ( s.c. ). After loss of reflexes, animals were positioned in a stereotaxic apparatus, and the scalp was shaved and sterilized with an 1% iodine solution. Ophthalmic ointment was applied to prevent corneal drying. A midline incision was made to expose the skull. A stainless-steel guide cannula (26-gauge) was implanted into the lateral ventricle or the substantia nigra pars compacta according to the mouse brain atlas of Paxinos and Franklin 34 . For the lateral ventricle, the following coordinates relative to bregma were used: AP − 0.35 mm, ML − 1.0 mm, DV − 2.2 mm, as previously described 35 . For the substantia nigra, coordinates were AP − 3.0 mm, ML − 1.05 mm, DV − 4.7 mm. After surgery, mice were placed in a warmed recovery cage and continuously monitored until full consciousness. They were then returned to their home cages and observed daily for seven days for potential signs of infection or distress. Tramadol (5 mg/kg, s.c. ) was administered once daily for two consecutive days to minimize postoperative discomfort. After the recovery period, mice were used for experimental procedures. All compounds and vehicles (sterile saline) were infused in a total volume of 1.0–2.0 µl for 1 min post-infusion to prevent reflux. Mitochondria Isolation Intact mitochondria were isolated using the Mitochondria/Cytosol Fractionation Kit (Abcam, Cat. #ab65320). Following isolation, mitochondrial protein content was quantified using the Pierce™ BCA Protein Assay Kit (Thermo Scientific, Cat. #23225) prior to all downstream applications, including stereotaxic injection. Mitochondrial integrity was validated by transmission electron microscopy. For in vivo delivery, 20 µg of mitochondrial protein was resuspended in 2 µL sterile PBS and injected immediately after quantification, with mitochondria maintained on ice throughout the procedure. Control animals received an equivalent volume of vehicle. Primary Microglia Culture Primary microglia were isolated from P1-P5 LysM-CrePhAM floxed neonates. Neonates’ brains were mechanically dissociated in aseptic conditions and cultured in DMEM with 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin (PS) to generate mixed glial cultures. Microglial proliferation was enhanced using L929-conditioned medium at a 1:3 ratio of DMEM. Astrocyte-conditioned medium was collected and filtered for subsequent use. Culture medium was replaced every other day until a confluent astrocytic monolayer with microglia growing on top was established. Microglia were harvested by shaking cultures at 37°C and 180 rpm for 1 hour. The microglia-containing supernatant was passed through a 70 µm cell strainer and centrifuged at 1,000 rpm for 5 minutes. Cells were counted and replated in DMEM supplemented with astrocyte-conditioned medium at a 1:3 ratio. For stimulation experiments, primary microglia were treated with lipopolysaccharide (LPS, strain O111:B4; Sigma-Aldrich, Cat. #L4391) at 100 ng/mL for 24 hours; sodium palmitate (Sigma-Aldrich, Cat. #P9767) at 200 µM or, when not specified, at 400 µM for 6 hours; Mdivi-1 (Cayman Chemical Company, Cat. #15559) at 50 µM for 1 hour; M1 (Sigma-Aldrich, Cat. #SML0629) at 10 µM for 1 hour; GW4869 (Sigma-Aldrich, Cat. #D1692) at 40 µM and Y27632 (Cayman Chemical Company, Cat. #10005583) at 10 µM for 1 hour. Neuronal Cell Culture Clu189, POMC, and Neuro2a neuronal cell lines were obtained from the American Type Culture Collection (ATCC) and maintained in DMEM supplemented with 10% FBS and 1% PS in a humidified incubator at 37°C with 5% CO₂. Cells were allowed to undergo spontaneous differentiation, after which they were reseeded for experimental assays. Neuronal injury was induced by treatment with rotenone (Sigma-Aldrich, Cat. #R8875) at 300 ng/mL for 6 hours or 100 ng/mL for 12 hours, as indicated. Co-Culture Experiments Following stimulation, microglial and neuronal cells were cocultured at a 1:1 ratio in the same well to allow direct cell–cell contact for 24 hours. Cellular interactions and mitochondrial transfer were assessed either by time-lapse microscopy over a 24-hour period or by flow cytometry, enabling quantitative and dynamic analysis of microglia–neuron communication. To assess neuronal mitochondrial uptake in the absence of direct mitochondrial transfer from microglia, coculture experiments were performed using transwell inserts with defined pore sizes. Primary Dendra2-expressing microglia were cocultured with Clu189 neurons using inserts with pore diameters of 0.2 µm or 3.0 µm, which respectively restrict or permit mitochondrial passage while preventing direct cell–cell contact. Microglial cells were seeded onto the transwell inserts and maintained in DMEM, then stimulated according to the experimental protocol. In parallel, Clu189 neurons were treated with rotenone (200 nM) for 6 hours. Following stimulation and washing steps, transwell inserts were placed into wells containing neurons. After 24 hours of coculture, cells were harvested and processed for downstream analyses. Immunofluorescence For tissue immunofluorescence, mice were transcardially perfused with 20 mL of 1× PBS followed by 20 mL of 4% paraformaldehyde (PFA). Brains were dissected, washed in PBS, cryoprotected overnight in 15% sucrose followed by 30% sucrose, embedded in OCT compound, and frozen on dry ice. Coronal or sagittal brain sections (20–40 µm thick) were obtained using a cryostat (Leica CM1950). Sections were permeabilized and blocked for 1 hour at room temperature (RT) in PBS containing 5% bovine serum albumin (BSA) and 0.2% Triton X-100. For NeuN immunostaining, antigen retrieval was performed prior to blocking by incubating sections in citrate buffer (pH 6.0) at 60°C for 20 minutes. Primary antibodies (Table 1 ) were applied overnight at 4°C in PBS containing 0.2% Triton X-100 and 1% BSA. After washing, sections were incubated for 1 hour at RT with Alexa Fluor–conjugated secondary antibodies and DAPI (1:1000) for nuclear counterstaining. Slides were then mounted and prepared for imaging. The same protocol was used for conventional in vitro immunofluorescence. For live-cell mitochondrial labelling, MitoTracker Deep Red was used according to the manufacturer’s instructions. Briefly, cells cultured on glass-bottom chamber slides (Cellvis) were washed with PBS after 24 hours of coculture and incubated with MitoTracker Deep Red (200 nM) for 40 minutes in Krebs medium at 37°C, protected from light and in the absence of CO₂. Cells were then washed with PBS and immediately imaged. For DiI and phalloidin labelling, neurons were stained prior to coculture with microglia or isolated mitochondria following the manufacturers’ protocols. Briefly, cells were incubated with the respective dyes for 30 minutes at 37°C, washed three times with PBS, and subsequently subjected to coculture for 24 hours before analysis. Table 1 List of Antibodies Antibody Company Catalogue Conc. Mouse Anti-MAP2 (Mt-01) Novus Biologicals NB500-415 1:500 Phalloidin-Ifluor 647 Reagent Abcam ab176759 1:1000 Rabbit Anti-POMC Phoenix Pharmaceuticals H-029-30 1:200 Mouse Anti-AgRP R&D Systems AF634 1:1000 Mouse Anti-NeuN Chemicon MAB377 1:1000 GFAP Monoclonal Antibody (2.2b10), Alexa Fluor™ 647 Invitrogen 51-9792-82 1:500 Rabbit Anti-Tyrosine Hydroxylase Sigma-Aldrich AB152 1:500 DAPI Sigma-Aldrich D9542 1:1000 Mitotracker Deep Red FM Thermo Fisher Scientific M22426 200nM Mitotracker Red CMXRos Thermo Fisher Scientific M7512 200nM Dil Stain Thermo Fisher Scientific D282 1:1000 Donkey Anti-Rabbit IgG Alexa Fluor 594 Jackson ImmunoResearch 711-585-152 1:1000 Donkey Anti-Rabbit IgG Alexa Fluor 647 BioLegend 406414 1:500 Donkey Anti-Goat IgG (H + L) Alexa Fluor 647 Jackson ImmunoResearch 705-605-003 1:500 Donkey Anti Mouse IgG (H + L) Alexa Fluor 647 Invitrogen A-31571 1:500 Rabbit Anti-NDUFS1 [Epr11521(B)] Abcam ab169540 1:1000 Rabbit Anti-UQCRC2 [Epr13051] Abcam ab203832 1:1000 Rabbit Anti-TOMM20 Thermo Fisher Scientific PA5-52843 1:1000 Rabbit Anti-Phospho-STAT3 (Tyr705) Cell Signaling Technology 9131S 1:1000 Rabbit Anti-beta-Actin (13e5) Cell Signaling Technology 4970S 1:1000 Peroxidase (HRP) Anti-Rabbit IgG Cell Signaling Technology 7074S 1:10.000 Peroxidase (HRP) Anti-Mouse IgG Cell Signaling Technology 7074S 1:10.000 Zombie Violet BioLegend 423114 1:1000 CD11b BB660 BioLegend 101228 1:100 Mitosox Thermo Fisher Scientific M36008 5µm Image Acquisition All microscopy experiments were performed at the Institute of Advanced Studies on Photonics Applied to Cell Biology (INFABiC), UNICAMP, São Paulo, Brazil. High-resolution confocal images were acquired using a Zeiss LSM 880 confocal microscope equipped with an Airyscan super-resolution detector (Carl Zeiss AG, Germany). DAPI was excited using a 405 nm diode laser (5% power), while green, red, and far-red fluorophores were excited using 488 nm, 561 nm, and 633 nm lasers, respectively. Laser power and detector gain were adjusted according to staining conditions, and fluorescence signals were typically detected using photomultiplier tube (PMT) detectors. Images were acquired with a frame size of 1024 × 1024 pixels, line step of 0.5 µm, scan speed of 4 to 8, bidirectional scanning, and either 8- or 16-bit depth. For tissue sections, z-stacks spanning 10–20 µm were acquired in 8-bit mode. During automated Airyscan acquisitions, a zoom factor of 1.8 was applied, and the detector was positioned at the center of the Airyscan disk to ensure optimal signal quality. Airyscan super-resolution reconstruction was performed in ZEN software. For whole sagittal mouse brain sections, mosaic images were acquired using an inverted Zeiss Axio Observer.Z1 microscope equipped with a Yokogawa CSU-X1 spinning disk confocal unit, an iXon3 camera, and iQ3 software (Andor). Images were acquired in 16-bit mode using 488, 561, and 640 nm lasers with corresponding emission filters (525/30, 607/36, and 685/40 nm), a zoom factor of 1.0, and a 40×/1.4 NA oil-immersion objective. Z-stacks were collected at 4 µm intervals with a resolution of 512 × 512 pixels. Mosaic reconstruction was performed using the MosaicJ plugin in FIJI/ImageJ software. Fluorescence Lifetime Imaging Microscopy Fluorescence lifetime imaging microscopy (FLIM) based on two-photon excitation fluorescence (TPEF) was performed on Clu189 neurons using an inverted Zeiss LSM780 NLO Axio Observer confocal microscope (Carl Zeiss AG, Germany). The system was equipped with a time-correlated single-photon counting (TCSPC) module (Becker & Hickl) and a femtosecond pulsed laser (100 fs pulse duration, 80 MHz repetition rate; Chameleon Discovery Nx, Coherent Inc., USA). Cells were maintained at 37°C in a humidified atmosphere containing 5% CO₂ throughout acquisition to preserve physiological conditions. Endogenous NAD(P)H and FAD autofluorescence were simultaneously excited at 760 nm with a mean laser power of 10 mW at the objective back aperture and focused using an EC Plan-Neofluar 40×/1.3 NA oil-immersion objective. Emission signals were detected by two single-photon counting PMTs (Becker & Hickl, SPC-830) after passing through 445/45 nm (NAD(P)H) and 535/22 nm (FAD) band-pass filters. A 690 nm short-pass filter was used to block excitation light at the detector entrance. Images were acquired with a field of view of 512 × 512 pixels (212.55 × 212.55 µm), and fluorescence decay curves were collected for 120 seconds per field. FLIM data were processed using SPCImage software (version 2.9; Becker & Hickl). A bi-exponential decay model was applied to fit fluorescence decay curves at each pixel, generating pseudocolor lifetime maps. Mean lifetime (τm), short (τ1) and long (τ2) lifetime components, and the relative amplitudes of free (a1) and protein-bound (a2) fluorophore fractions were extracted for downstream analysis. Time-Lapse Imaging Time-lapse imaging of primary microglia isolated from LysM-CrePhAM floxed mice and microglia–neuron coculture systems was performed using a Zeiss LSM 880 confocal microscope equipped with an Airyscan detector. Cells were plated in four-well chamber slides with glass coverslips (500 µL completed DMEM/well) and maintained at 37°C in a humidified atmosphere with 5% CO₂ throughout imaging. Images were acquired using either a Plan-Apochromat 40×/1.3 NA or a Plan-Neofluar 63×/1.4 NA oil-immersion objective. For high-resolution visualization of mitochondrial morphology and subcellular structures, images were acquired with two-frame averaging, a z-step size of 0.5 µm, 16-bit depth, 1024 × 1024-pixel resolution, a zoom factor of 1.8×, and pinhole size set to 1 Airy unit (13.65 pixel/µm). For three-dimensional visualization of Dendra2-expressing cells, excitation was performed using a 488 nm laser (5% power), and z-stacks were acquired at 1 µm intervals (5–10 optical sections per acquisition). Time-lapse series were acquired for up to 24 hours, with acquisition intervals optimized for each experiment; in most cases, images were captured every 300 seconds for a total of 40 frames. Neurons and microglia were identified using brightfield imaging or fluorescent markers, including MitoTracker Deep Red, phalloidin, or Dil. Airyscan processing was applied post-acquisition to enhance spatial resolution of Dendra2-positive mitochondria and cellular interactions. Image Analysis All image processing and quantitative analyses were performed using FIJI/ImageJ software (NIH). For three-dimensional analyses, image stacks were pre-processed to reduce noise and enhance signal quality. Preprocessing steps included application of a Gaussian blur filter, background subtraction using the “Subtract Background” function, and thresholding to generate binary masks. Thresholded images were analyzed using the Mitochondrial Analyzer plugin 36 (version 2.0.2) to quantify mitochondrial morphology parameters in microglia. Colocalization between fluorescent signals was assessed either by visual inspection of orthogonal views or by fluorescence intensity–based colocalization analysis, as appropriate for each experiment. Quantification of TH⁺ neuronal cell bodies and Dendra2⁺ neurons within the VMH was performed manually using the Cell Counter plugin. TH⁺ neuronal fiber density was quantified by measuring integrated density (IntDen) of the TH immunoreactive signal. Neuronal survival was quantified by counting DAPI⁺ nuclei per well, which served as a proxy for total neuron number under the indicated experimental conditions. For three-dimensional representations, it was used Imaris software (Bitplane/Oxford Instruments). Flow Cytometry Analysis Cells were stained with Zombie Violet viability dye and with anti-CD11b–PerCP (Table 1 ) to identify microglial populations. Following surface staining, cells were fixed and permeabilized using Cytofix/Cytoperm solution (BD Biosciences, Cat. #554722) according to the manufacturer’s instructions. Neuronal populations were identified by intracellular staining with an anti-NeuN primary antibody diluted in Perm/Wash buffer, followed by incubation with an Alexa Fluor 647–conjugated secondary antibody. Flow cytometry was performed on a FACSymphony A5 SE cytometer (BD Biosciences) following the gating strategy: FSC/SSC → singlets → live cells → CD11b⁻ → NeuN⁺ neurons. A minimum of 10,000 events per sample was collected. Compensation was performed using BD compensation beads. Mitochondrial content and membrane potential were assessed using MitoTracker Deep Red (APC channel), while PhAM-derived mitochondrial fluorescence was detected in the FITC/BB515 channel. Data were analyzed using FlowJo software (BD Biosciences). For all analyses, fluorescence-minus-one (FMO) controls were included to define gating thresholds, and parameters were quantified as either mean fluorescence intensity (MFI) or percentage of positive cells, as indicated. Assessment of Neuronal ROS Production Reactive oxygen species (ROS) production in Clu189 neuronal cells was evaluated using complementary Amplex Red–based assays to measure total ROS and flow cytometry–based detection of mitochondrial superoxide. For Amplex Red assays, Clu189 neurons were plated at varying densities (10,000–100,000 cells per well) to assess the influence of cell number on ROS signal. Based on these preliminary analyses, a density of 25,000 cells per well was selected for all quantitative comparisons to minimize confluency- and density-dependent bias. Cells were stimulated with rotenone at the indicated concentrations and exposure times, including acute (10 or 30 minutes) and prolonged (6 or 24 hours) treatments. In selected conditions, neurons were cocultured with microglia or exposed to microglia-derived mitochondrial preparations. Amplex Red assays were performed according to the manufacturer’s instructions (Thermo Fisher Scientific, Cat. #A12222). Briefly, freshly prepared reagents, including superoxide dismutase (SOD; 1 U/mL), horseradish peroxidase (0.1 U/mL), and digitonin (5 µg/mL), were prepared in Krebs buffer, with pH verified prior to measurement. Cells were washed with PBS, after which 100 µL of Krebs buffer containing Amplex Red (50 µM), SOD, peroxidase, and digitonin was added to each well. Fluorescence was measured using a plate reader at 37°C with kinetic acquisition over 1 h 30 min at 10-minute intervals (excitation 540/35 nm; emission 600/40 nm). Fluorescence signals were normalized to nuclear staining (DAPI) to account for differences in cell numbers. For flow cytometric assessment of mitochondrial ROS, Clu189 neurons were stained with MitoSOX Red (5 µM) for 10 minutes at 37°C in serum-free DMEM, followed by washing with PBS prior to acquisition. Seahorse Metabolic Analysis Clu189 neurons were plated at 15,000 cells per well and exposed to microglia-derived mitochondria for 24 hours. Real-time measurements of oxygen consumption rate (OCR) and extracellular acidification rate (ECAR) were measured using an XFe96 Extracellular Flux Analyzer (Agilent Seahorse Bioscience), according to the manufacturer’s instructions. Each condition was analyzed in three technical replicates. For each assay, three consecutive baseline measurements were obtained, followed by sequential injections of metabolic inhibitors or activators specific to each test. In the mitochondrial stress test, oligomycin (1 µM), FCCP (1 µM), and a combination of rotenone (100 nM) and antimycin A (1 µM) were injected sequentially (all reagents from Sigma-Aldrich). In the glycolytic stress test, glucose (25 mM), oligomycin (1.5 µM), and 2-deoxyglucose (2-DG; 50 mM) were sequentially added. Seahorse assay medium was supplemented with 10mM glucose, 1mM pyruvate, and 2mM glutamine. Metabolic parameters were calculated using Seahorse Wave software and normalized to total protein content per well to account for differences in cell number. CRISPR-Cas9 experiments A second-generation lentiviral system was used for CRISPR–Cas9–mediated gene perturbation. Lentiviral particles were produced using the packaging plasmid psPAX2 and the envelope plasmid pMD2.G, together with the sgRNA expression vector LentiGuide-Puro. Single-guide RNA (sgRNA) sequences complementary to the target genes were cloned into the LentiGuide-Puro backbone according to standard protocols. For virus production, HEK293T packaging cells were plated at a density of 7 × 10⁵ cells per well in six-well plates and incubated for 18–24 hours. Cells were transfected with a mixture of the three lentiviral plasmids using polyethyleneimine (PEI). After 18–24 hours, the medium was replaced with fresh culture medium. Viral supernatants were collected at 48, 72, and 96 hours post-transfection, centrifuged at 500 × g for 5 minutes to remove cellular debris, and filtered through a 0.45-µm PES filter. Filtered viral supernatants were snap-frozen in liquid nitrogen and stored at − 80°C until use. For neuronal transduction, Clu189 neuronal cells expressing Cas9 were infected after 6 days in culture with lentiviral particles carrying sgRNAs targeting Gja1 (TCGCTGATCCACGATAGCTA), Itgb1 (GAAAATAGCAAATTGCCAGACGG), Exoc1 (GTCCGAGATAGAGTTCCTCGTGG), or Gm609 (sgRNA: AGGGTAAACGGAGATTCCAGGGG), with sgGFP used as a non-targeting control. Cells were incubated with lentivirus for 24 hours, after which viral media was replaced with fresh medium containing puromycin (1 µg/mL) for selection of sgRNA-expressing cells. Medium containing puromycin was refreshed as needed to maintain selection. For mitochondrial transfer assays, Clu189 Cas9 cells were expanded in complete DMEM without ciprofloxacin and plated at a density of 3.5 × 10⁵ cells per well in six-well plates, in triplicate for each sgRNA condition. Cells were transduced with 200 µL of lentiviral particles per well and maintained for 48 hours. Viral media was removed, and antibiotic selection was initiated using blasticidin to maintain Cas9 expression and puromycin to select for sgRNA integration. Antibiotic concentrations were adjusted as needed to ensure effective selection. Knockout efficiency was assessed by quantitative PCR prior to coculture experiments. Neuronal uptake of microglia-derived mitochondria was subsequently evaluated by flow cytometry. Transmission Electron Microscopy Mitochondria were isolated from microglia as previously described, centrifuged at 12,000 g during 30 min and then, fixed in 2.5% glutaraldehyde prepared in 0.1 M sodium cacodylate buffer containing 3 mM CaCl₂ for 5 minutes at RT, followed by incubation on ice for 2 hours. After fixation, samples were washed three times for 2 minutes each in 0.1 M sodium cacodylate buffer containing 3 mM CaCl₂ and post-fixed for 1 hour in 1% osmium tetroxide supplemented with 0.8% potassium ferrocyanide, diluted in 0.1 M sodium cacodylate buffer. Samples were then washed three times for 2 minutes each in Milli-Q water and stained en bloc overnight on ice with 2% uranyl acetate. Following staining, samples were washed three times for 2 minutes each in Milli-Q water and dehydrated through a graded ethanol series (30%, 50%, 70%, and 90% for 10 minutes each, followed by 100% ethanol three times for 10 minutes each). After dehydration, samples were incubated in a 1:1 mixture of EMbed 812 resin and 100% ethanol for 30 minutes, followed by infiltration in pure EMbed 812 resin for at least 1 hour per step (five changes). Samples were then polymerized at 60°C for 72 hours. Ultrathin sections (63 nm) were obtained using an ultramicrotome (Leica UCT) and sequentially stained with 2% uranyl acetate and Reynolds’ lead citrate. Electron micrographs were acquired using a Tecnai G2 Spirit BioTWIN transmission electron microscope (FEI Company, Hillsboro, OR, USA) operated at an accelerating voltage of 80 kV. Reverse Transcription Quantitative PCR Total RNA was isolated from neuronal cells using TRI Reagent (Sigma-Aldrich, Cat. #T9424) according to the manufacturer’s instructions. RNA concentration and purity were assessed by spectrophotometry, and for cDNA synthesis, 2 µg of total RNA was reverse-transcribed using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems), following the manufacturer’s protocol. Quantitative real-time PCR was performed using the QuantiNova® SYBR® Green PCR Kit (Qiagen, Cat. #208056). Each reaction contained 60 ng of cDNA template and 200 nM of gene-specific forward and reverse primers (Table 2 ). Amplification was carried out on a CFX384 Touch Real-Time PCR Detection System (Bio-Rad) under standard cycling conditions recommended by the manufacturer. All samples were run in technical triplicates, and no-template controls were included to assess potential contamination. Gene expression levels were quantified using CFX Manager Software v2.0 (Bio-Rad) and calculated using the 2^−ΔΔCt method. Expression values were normalized to mouse 18S rRNA as the reference gene and expressed relative to the appropriate experimental control group (unstimulated cells). For AgRP expression analysis, neurons were incubated for 24 hours with microglia-derived mitochondria in glucose-free DMEM. Cells were then washed with PBS and harvested for RNA isolation. For all other target genes, neurons were cultured in high-glucose DMEM prior to RNA extraction. Table 2 List of Primers Primers F R Tnfα 5'-AGATAGCAAATCGGCTGACG-3' 5'-ACGGCATGGATCTCAAAGAC-3' Agrp 5'-CTTTGGCGGAGGTGCTAGAT-3' 5'-AGGACTCGTGCAGCCTTACAC-3' Pomc 5'-CGAGATTCTGCTACAGTCGCT-3' 5'-GACGTACTTCCGGGGGTTTT-3' Exoc1 5′-TGCCATCAAAGAGAGCCCTG-3′ 5′-CCAGGTGCAGGAGATGAAGG-3′ Gja1 (cnx43) 5′-TCC​TTT​GAC​TTC​AGC​CTC​CA-3′ 5′-CCA​TGT​CTG​GGC​ACC​TCT-3′ Gm609/isec1 5′-CTTTCAGTTCAGCTAGGAAACAC-3′ 5′-CTTACCTTTTCTTTTGGAAATAAAT-3′ Itgb1 1 5′- GTCGTGTGTGTGAGTGCAAC-3′ 5′- GCTGGGGTAATTTGTCCCGA-3′ Itgb1 2 5"-GCAGGGCCAAATTGTGGGTGGT-3" 5"-GGCCGGAGCTTCTCTGCCAT-3" Western Blot Analysis Cells were lysed in RIPA buffer supplemented with protease and phosphatase inhibitor cocktails (Thermo Scientific, Cat. #78440 and #78420). Protein concentration was determined using the Pierce™ BCA Protein Assay Kit (Thermo Scientific, Cat. #23225), according to the manufacturer’s instructions. For isolated mitochondria obtained from microglia or culture supernatants, samples were prepared using the mitochondrial extraction buffer provided in the cell fractionation kit (Abcam, Cat. #ab65320). Equal amounts of protein (20 µg per lane) were separated on 10% SDS–PAGE gels and electrophoresed for approximately 2 hours, followed by transfer onto PVDF membranes (Immobilon-P, Millipore, Cat. #IPVH00010) for 1.5 hours. Membranes were blocked with 5% non-fat dry milk prepared in Tris-buffered saline containing 0.1% Tween-20 (TBS-T) for 1 hour at RT. Membranes were then washed three times with TBS-T and incubated overnight at 4°C with primary antibodies (Table 1 ) diluted in the blocking buffer. After washing, membranes were incubated for 1 hour at RT with horseradish peroxidase (HRP)–conjugated secondary antibodies. Protein bands were visualized using the Pierce™ Fast Western Blot Kit (Thermo Scientific, Cat. #35050) in combination with SuperSignal™ West Femto Maximum Sensitivity Substrate (Thermo Scientific, Cat. #34095). Chemiluminescent signals were detected using a ChemiDoc™ Imaging System (Bio-Rad). Band intensities were quantified using ImageJ software after normalization to β-actin. Statistical Analysis Data are presented as mean ± SD or SEM, as indicated. All datasets were tested for normality using the Shapiro-Wilk test prior to parametric analysis, and outliers were identified and removed using the Grubbs’ test (alpha = 0.05). Comparisons between two groups were performed using unpaired two-tailed Student’s t tests, and comparisons among multiple groups were analyzed using one-way ANOVA with Bonferroni post hoc correction. Statistical analyses were conducted using GraphPad Prism version 6.0 (GraphPad Software). Statistical significance was defined as p < 0.05. Declarations Competing Interests The authors declare no competing interests. Acknowledgements The authors thank INFABIC (Imaging Facility of the University of Campinas) for technical assistance and access to microscopy infrastructure. Funding Declaration This work was supported by the São Paulo Research Foundation (FAPESP: grant no. 2020/16030-0, 2023/17089-6, 2022/04576-3, 2019/25973-8 and fellowship no. 2020/08744-2 and2022/05429-4); the Brazilian National Council for Scientific and Technological Development – CNPq (Grant number 434538/2018-3, 407429/2025-5); and the Coordenação de Aperfeiçoamento de Pessoal de Nível Superior – Brazil (CAPES) (Finance Code 001. Authors Contribution M.K.S.C.A. conceived the study, performed experiments, analyzed the data and wrote the original draft of the manuscript. L.F.L.S., G.C., W.S.S.G., R.D.R., G.A.S.N., A.T.P.C., W.L.G.C., M.B. and F.B.S.T. contributed to experimental investigations. C.B. managed resources, including laboratory organization and procurement. A.T.P.C. and M.O.B. assisted with image acquisition protocols. H.C. provided technical support for image acquisition at INFABIC. L.A.V. provided cell lines and contributed to scientific discussion of in vitro methodologies. P.M.M.M.V. conceived and supervised the study, reviewed and edited the manuscript, funding acquisition. All authors read and approved the final version of the manuscript. References Sarkar S, et al. Mitochondrial impairment in microglia amplifies NLRP3 inflammasome proinflammatory signaling in cell culture and animal models of Parkinson’s disease. npj Parkinson’s Disease. 2017;3:30. Li Y, Xia X, Wang Y, Zheng JC. Mitochondrial dysfunction in microglia: a novel perspective for pathogenesis of Alzheimer’s disease. J Neuroinflammation. 2022;19:248. Wang Y et al. The role of mitochondrial dynamics in disease. MedComm 4, e462 (2023). Scheiblich H, et al. Microglia rescue neurons from aggregate-induced neuronal dysfunction and death through tunneling nanotubes. Neuron. 2024;112:3106–e31258. Joshi AU, et al. Fragmented mitochondria released from microglia trigger A1 astrocytic response and propagate inflammatory neurodegeneration. Nat Neurosci. 2019;22:1635–48. Liu D, et al. Intercellular mitochondrial transfer as a means of tissue revitalization. Signal Transduct Target Ther. 2021;6:65. Orihuela R, McPherson CA, Harry GJ. Microglial M1/M2 polarization and metabolic states. Br J Pharmacol. 2016;173:649–65. Zhong G, et al. Autologous transplantation of mitochondria/rAAV IGF-I platforms in human osteoarthritic articular chondrocytes to treat osteoarthritis. Mol Ther. 2025;33:2900–12. Pham AH, McCaffery JM, Chan DC. Mouse lines with photo-activatable mitochondria (PhAM) to study mitochondrial dynamics. Genesis. 2012;50:833–43. Belsham DD, et al. Ciliary neurotrophic factor recruitment of glucagon-like peptide-1 mediates neurogenesis, allowing immortalization of adult murine hypothalamic neurons. FASEB J. 2009;23:4256–65. Li N, et al. Mitochondrial complex I inhibitor rotenone induces apoptosis through enhancing mitochondrial reactive oxygen species production. J Biol Chem. 2003;278:8516–25. Xiong N, et al. Mitochondrial complex I inhibitor rotenone-induced toxicity and its potential mechanisms in Parkinson’s disease models. Crit Rev Toxicol. 2012;42:613–32. Dash C, Saha T, Sengupta S, Jang HL. Inhibition of Tunneling Nanotubes between Cancer Cell and the Endothelium Alters the Metastatic Phenotype. Int J Mol Sci. 2021;22:6161. van der Vlist M, et al. Macrophages transfer mitochondria to sensory neurons to resolve inflammatory pain. Neuron. 2022;110:613–e6269. Werner E, Werb Z. Integrins engage mitochondrial function for signal transduction by a mechanism dependent on Rho GTPases. J Cell Biol. 2002;158:357–68. Nair S, et al. Lipopolysaccharide-induced alteration of mitochondrial morphology induces a metabolic shift in microglia modulating the inflammatory response in vitro and in vivo. Glia. 2019;67:1047–61. Du Y, Brennan FH, Popovich PG, Zhou M. Microglia maintain the normal structure and function of the hippocampal astrocyte network. Glia. 2022;70:1359–79. Abudara V, et al. Activated microglia impairs neuroglial interaction by opening Cx43 hemichannels in hippocampal astrocytes. Glia. 2015;63:795–811. Yin X, et al. Roles of astrocytic connexin-43, hemichannels, and gap junctions in oxygen-glucose deprivation/reperfusion injury induced neuroinflammation and the possible regulatory mechanisms of salvianolic acid B and carbenoxolone. J Neuroinflammation. 2018;15:97. Batsuuri K, Toychiev AH, Viswanathan S, Wohl SG, Srinivas M. Targeting Connexin 43 in Retinal Astrocytes Promotes Neuronal Survival in Glaucomatous Injury. Glia. 2025;73:1398–419. Iorio R, Petricca S, Di Emidio G, Falone S, Tatone C. Mitochondrial Extracellular Vesicles (mitoEVs): Emerging mediators of cell-to-cell communication in health, aging and age-related diseases. Ageing Res Rev. 2024;101:102522. Paliwal S, Chaudhuri R, Agrawal A, Mohanty S. Regenerative abilities of mesenchymal stem cells through mitochondrial transfer. J Biomed Sci. 2018;25:31. Shanmughapriya S, Langford D, Natarajaseenivasan K. Inter and Intracellular mitochondrial trafficking in health and disease. Ageing Res Rev. 2020;62:101128. Zampieri LX, Silva-Almeida C, Rondeau JD, Sonveaux P. Mitochondrial Transfer in Cancer: A Comprehensive Review. Int J Mol Sci. 2021;22:3245. Li X, et al. Accumulation of Damaging Lipids in the Arf1-Ablated Neurons Promotes Neurodegeneration through Releasing mtDNA and Activating Inflammatory Pathways in Microglia. Adv Sci. 2025;12:2414260. Todkar K, et al. Selective packaging of mitochondrial proteins into extracellular vesicles prevents the release of mitochondrial DAMPs. Nat Commun. 2021;12:1971. Ikeda G, et al. Mitochondria-Rich Extracellular Vesicles From Autologous Stem Cell–Derived Cardiomyocytes Restore Energetics of Ischemic Myocardium. JACC. 2021;77:1073–88. Lu Y, et al. Protective role of mitophagy on microglia-mediated neuroinflammatory injury through mtDNA-STING signaling in manganese-induced parkinsonism. J Neuroinflammation. 2025;22:55. Zhu J, et al. ATF5 Attenuates the Secretion of Pro-Inflammatory Cytokines in Activated Microglia. Int J Mol Sci. 2023;24:3322. Kim J-H, Lee Y, Suh GY, Lee Y-S. Mul1 suppresses Nlrp3 inflammasome activation through ubiquitination and degradation of Asc. bioRxiv. 2019;830380. 10.1101/830380 . Moraes-Vieira PM, et al. Antigen Presentation and T-Cell Activation Are Critical for RBP4-Induced Insulin Resistance. Diabetes. 2016;65:1317–27. Cannon JR, et al. A highly reproducible rotenone model of Parkinson’s disease. Neurobiol Dis. 2009;34:279–90. Fleming SM, et al. Early and Progressive Sensorimotor Anomalies in Mice Overexpressing Wild-Type Human α-Synuclein. J Neurosci. 2004;24:9434–40. Paxinos and Franklin’s the Mouse Brain in Stereotaxic Coordinates . (2022). Maness LM, Kastin AJ, Farrell CL, Banks WA. Fate of leptin after intracerebroventricular injection into the mouse brain. Endocrinology. 1998;139:4556–62. Chaudhry A, Shi R, Luciani DS. A pipeline for multidimensional confocal analysis of mitochondrial morphology, function, and dynamics in pancreatic β-cells. Am J Physiol Endocrinol Metab. 2020;318:E87–101. Additional Declarations No competing interests reported. Supplementary Files SupplementaryMaterial.docx Cite Share Download PDF Status: Under Review Version 1 posted Reviews received at journal 18 May, 2026 Reviewers agreed at journal 07 May, 2026 Reviewers agreed at journal 05 May, 2026 Reviewers invited by journal 05 May, 2026 Editor assigned by journal 04 May, 2026 Submission checks completed at journal 03 May, 2026 First submitted to journal 28 Apr, 2026 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-9558181","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":639228790,"identity":"2b5ede97-8212-4fc3-948e-d2b5263316ff","order_by":0,"name":"Monara Kaelle Servulo Cruz Angelim","email":"","orcid":"","institution":"State University of Campinas","correspondingAuthor":false,"prefix":"","firstName":"Monara","middleName":"Kaelle Servulo Cruz","lastName":"Angelim","suffix":""},{"id":639228792,"identity":"57722917-fd07-4e42-b730-fe922882093e","order_by":1,"name":"Lincon Felipe Lima Silva","email":"","orcid":"","institution":"State University of Campinas","correspondingAuthor":false,"prefix":"","firstName":"Lincon","middleName":"Felipe Lima","lastName":"Silva","suffix":""},{"id":639228793,"identity":"af6adaac-b136-4640-8a18-c2bb03e999e0","order_by":2,"name":"Gisele Castro","email":"","orcid":"","institution":"State University of Campinas","correspondingAuthor":false,"prefix":"","firstName":"Gisele","middleName":"","lastName":"Castro","suffix":""},{"id":639228794,"identity":"3a895f9c-3069-4065-a119-7f802ac96289","order_by":3,"name":"Wilias Silva Santos Greison","email":"","orcid":"","institution":"State University of Campinas","correspondingAuthor":false,"prefix":"","firstName":"Wilias","middleName":"Silva Santos","lastName":"Greison","suffix":""},{"id":639228800,"identity":"c816c8ac-14dc-4e63-8fd2-f1c6202a9ab5","order_by":4,"name":"Rodrigo Dias Requião","email":"","orcid":"","institution":"State University of Campinas","correspondingAuthor":false,"prefix":"","firstName":"Rodrigo","middleName":"Dias","lastName":"Requião","suffix":""},{"id":639228801,"identity":"4d4a27f6-fe23-4d41-b0cb-e74c53ec4cd7","order_by":5,"name":"Guilherme Augusto da Silva Nogueira","email":"","orcid":"","institution":"State University of Campinas","correspondingAuthor":false,"prefix":"","firstName":"Guilherme","middleName":"Augusto da Silva","lastName":"Nogueira","suffix":""},{"id":639228802,"identity":"cd6dbe08-c269-4a9c-b766-62ad1ddec7cf","order_by":6,"name":"Thiago Pereira Campos","email":"","orcid":"","institution":"Universidade Federal do Ceará","correspondingAuthor":false,"prefix":"","firstName":"Thiago","middleName":"Pereira","lastName":"Campos","suffix":""},{"id":639228803,"identity":"7a9f00be-7d8c-4cc0-84f6-ba1473765b6e","order_by":7,"name":"Celia Bresil","email":"","orcid":"","institution":"State University of Campinas","correspondingAuthor":false,"prefix":"","firstName":"Celia","middleName":"","lastName":"Bresil","suffix":""},{"id":639228804,"identity":"a8debd66-9562-4e59-a590-644615705efa","order_by":8,"name":"Mariana Ozello Baratti","email":"","orcid":"","institution":"State University of Campinas","correspondingAuthor":false,"prefix":"","firstName":"Mariana","middleName":"Ozello","lastName":"Baratti","suffix":""},{"id":639228805,"identity":"7908fab1-9fef-420e-bb05-d3dc100f7390","order_by":9,"name":"Webster Leonardo Guimarães da Costa","email":"","orcid":"","institution":"State University of Campinas","correspondingAuthor":false,"prefix":"","firstName":"Webster","middleName":"Leonardo Guimarães da","lastName":"Costa","suffix":""},{"id":639228806,"identity":"94cafe86-1fa0-42a6-ad90-56739202e952","order_by":10,"name":"Matheus Barbosa","email":"","orcid":"","institution":"State University of Campinas","correspondingAuthor":false,"prefix":"","firstName":"Matheus","middleName":"","lastName":"Barbosa","suffix":""},{"id":639228807,"identity":"b5cc91de-4c37-4545-a6a0-0b352b5d9c7b","order_by":11,"name":"Francisco Breno Silva Teofilo","email":"","orcid":"","institution":"State University of Campinas","correspondingAuthor":false,"prefix":"","firstName":"Francisco","middleName":"Breno Silva","lastName":"Teofilo","suffix":""},{"id":639228808,"identity":"7410309a-f6b7-4168-a3a3-f587c9f4e381","order_by":12,"name":"Hernandes F Carvalho","email":"","orcid":"","institution":"State University of Campinas","correspondingAuthor":false,"prefix":"","firstName":"Hernandes","middleName":"F","lastName":"Carvalho","suffix":""},{"id":639228809,"identity":"f0db9044-e240-4b35-9cb5-1a82f4374c38","order_by":13,"name":"Licio A Velloso","email":"","orcid":"","institution":"State University of Campinas","correspondingAuthor":false,"prefix":"","firstName":"Licio","middleName":"A","lastName":"Velloso","suffix":""},{"id":639228810,"identity":"5b4b04d0-193d-4c6c-8a24-55e92f87a55f","order_by":14,"name":"Pedro M Moraes Vieira","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA1ElEQVRIiWNgGAWjYJCCAwwGDAz8YAYISBCrRbKBFC1gYHAAxiKkxVzsjOGBDwX35I1v5B488KNmWx6DdO8DvFosZ+cYHJxhUGy47UZewsGeY7eLGWSOG+B3z+20hMM8BgmM227kGBxmYLud2CCRRsALIC1/DBLsN88AaflHlJbkA4cZDBISN0gAtTC2EaHFcnbygYM9BgnJM868MTjY23e7mE3mGH4t5tKJzR9+/Emw7W/PMf7w49vtPH7pNgIOQxdIYMOvAZsWQjpGwSgYBaNg5AEAIU5NyS7PaJAAAAAASUVORK5CYII=","orcid":"","institution":"State University of Campinas","correspondingAuthor":true,"prefix":"","firstName":"Pedro","middleName":"M Moraes","lastName":"Vieira","suffix":""}],"badges":[],"createdAt":"2026-04-28 20:53:12","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-9558181/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-9558181/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":109156156,"identity":"1bd9adad-5aa7-48f3-bda9-f20181c12271","added_by":"auto","created_at":"2026-05-13 06:45:05","extension":"jpeg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":1412926,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eMicroglia release mitochondria into the extracellular space in vitro.\u003c/strong\u003e\u003cbr\u003e\n\u003cstrong\u003e(A)\u003c/strong\u003e Schematic representation of the experimental design. Primary microglia were isolated from \u003cem\u003eLyzM-CrePham\u003c/em\u003e\u003csup\u003e\u003cem\u003efloxed\u003c/em\u003e\u003c/sup\u003e mice expressing Dendra2-labeled mitochondria and stimulated as indicated prior to co-culture with the neuronal cell line Clu189. Extracellular mitochondrial release was analyzed by live imaging.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(B)\u003c/strong\u003e Representative image of co-culture between Clu189 cells (brightfield) and primary microglia (Dendra2\u003csup\u003e+\u003c/sup\u003e, green). Extracellular Dendra2\u003csup\u003e+\u003c/sup\u003e mitochondria were detected in two forms: naked mitochondria (inset a) and mitochondria enclosed within vesicular structures (mitovesicles; inset b).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(C)\u003c/strong\u003e Quantification of the area of microglia-derived extracellular mitochondria, comparing naked mitochondria and mitovesicles. N = 12-15 images.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(D)\u003c/strong\u003e Quantification of extracellular mitochondria released by microglia following stimulation with the indicated treatments prior to co-culture. N = 6 images.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(E)\u003c/strong\u003e Representative images of microglia co-cultured with Clu189 cells, showing extracellular mitochondria released after microglia were pre-treated with the indicated stimuli. Arrows indicate extracellular mitochondria.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(F)\u003c/strong\u003e Time-lapse sequence showing mitovesicle release from a microglial cell after approximately 2 h of co-culture with Clu189 cells. Dashed outline indicates the released mitovesicle.\u003c/p\u003e\n\u003cp\u003eData are expressed as mean ± SEM.\u003c/p\u003e","description":"","filename":"floatimage1.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-9558181/v1/a32325a5699feb01be097a44.jpeg"},{"id":109156140,"identity":"2d72154e-51c1-48b9-9eea-d3d9bad06e11","added_by":"auto","created_at":"2026-05-13 06:44:52","extension":"jpeg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":1441549,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eNeurons internalize microglia-derived mitochondria\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(A) \u003c/strong\u003eRepresentative confocal image of co-culture between primary microglia expressing Dendra2-labeled mitochondria (green) and Clu189 neurons (MAP2\u003csup\u003e+\u003c/sup\u003e, magenta; nuclei stained with DAPI, blue). Inset (a) shows a neuronal soma containing internalized Dendra2\u003csup\u003e+\u003c/sup\u003e mitochondria derived from microglia. Orthogonal (x–z and y–z) views confirm intracellular localization. Three-dimensional (3D) reconstructions of the inset region further demonstrate mitochondrial internalization within neurons.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(B) \u003c/strong\u003eQuantification of Dendra2\u003csup\u003e+ \u003c/sup\u003eneurons by flow cytometry following co-culture. Neurons were treated with vehicle (Veh) or rotenone (Rot) and microglia were pre-treated with the indicated stimuli, before co-culture. Data represent the percentage of Pham\u003csup\u003e+\u003c/sup\u003e neurons.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(C) \u003c/strong\u003eRepresentative image showing co-localization between microglia-derived Dendra2\u003csup\u003e+\u003c/sup\u003e mitochondria (green) and MitoTracker Deep Red (red). Line-scan fluorescence intensity analysis (white line) demonstrates signal overlap between channels. The same mitochondrion is shown in 3D (z-stack reconstruction, inset c), confirming co-localization.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(D) \u003c/strong\u003eRepresentative image showing naked mitochondria that display minimal or no co-localization with MitoTracker Deep Red.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(E) \u003c/strong\u003eSchematic illustration of the inhibitory pathways targeted by Y-27632 (ROCK1/2 inhibitor) and GW4869 (neutral sphingomyelinase inhibitor), together with quantification of Dendra2\u003csup\u003e+\u003c/sup\u003e neurons by flow cytometry. Neurons were treated with rotenone and co-cultured with microglia pre-treated with the indicated inhibitors. Data are presented as fold change relative to rotenone-treated controls.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(F) \u003c/strong\u003eCRISPR-Cas9-mediated gene knockdown in Clu189 neurons targeting candidate genes involved in mitochondrial transfer. Following gene editing, neurons were treated with rotenone and co-cultured with microglia. Mitochondrial uptake was quantified by flow cytometry and expressed as fold change relative to control.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(G) \u003c/strong\u003eRepresentative image of co-culture showing mitochondrial-enriched microglial processes (“hubs”) in close contact with Clu189 neurons. Insets (arrows) highlight contacts sites. Dashed lines indicate cell boundaries.\u003c/p\u003e\n\u003cp\u003eStatistical analysis: Data are expressed as mean ± SEM. One-way ANOVA followed by Tukey’s post hoc test for multiple comparisons, or unpaired t-test for two-group comparisons; *\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05.\u003c/p\u003e","description":"","filename":"floatimage2.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-9558181/v1/c70ef6cd1e505920be4d91d2.jpeg"},{"id":109156138,"identity":"737bbf15-2acc-4d59-82fe-71682f5c8f5a","added_by":"auto","created_at":"2026-05-13 06:44:50","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":4691109,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eMicroglia-derived mitochondria rescue neurons from rotenone-induced damage.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(A) \u003c/strong\u003eQuantification of Zombie\u003csup\u003e+\u003c/sup\u003e Clu189 neurons by flow cytometry following rotenone treatment and co-culture with microglia pre-treated with the indicated stimuli. In parallel experiments, microglia were cultured in 1-µm transwell inserts to prevent direct contact and mitochondrial transfer to Clu189 neurons.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(B) \u003c/strong\u003eQuantification of DAPI\u003csup\u003e+\u003c/sup\u003e nuclei of Clu189 neurons after 24 h treatment with mitochondria isolated from microglia previously stimulated as indicated. The first bar represents untreated control neurons; subsequent groups were treated with rotenone prior to mitochondrial supplementation.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(C) \u003c/strong\u003eSeahorse mitochondrial stress test analysis of OCR in Clu189 neurons treated with rotenone and supplemented with mitochondria isolated from microglia exposed to the indicated stimuli. Data were normalized to neuronal protein content and expressed as fold change relative to vehicle-treated Clu189 neurons not receiving mitochondria.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(D) \u003c/strong\u003eFluorescence lifetime imaging microscopy (FLIM) analysis of NAD\u003csup\u003e+\u003c/sup\u003e and NAD(P)H lifetimes in Clu189 neurons treated with vehicle or rotenone, followed by supplementation with mitochondria isolated from naïve microglia.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(E) \u003c/strong\u003eFlow cytometry analysis of mitochondrial reactive oxygen species (ROS) in Clu189 neurons using MitoSOX mean fluorescence intensity (MFI). Neurons were treated with rotenone and co-cultured with microglia previously stimulated with the indicated drugs.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(F) \u003c/strong\u003eAmplex Red assay measuring H₂O₂-derived resorufin fluorescence in Clu189 neurons after treatment with microglia-derived mitochondria. Results were normalized to DAPI\u003csup\u003e+\u003c/sup\u003e neuronal fluorescence. Microglia were pre-treated with the indicated stimuli prior to mitochondrial isolation. Microglia-to-neuron ratio: 1:1.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(G) \u003c/strong\u003eFlow cytometry analysis of mitochondrial membrane potential in Clu189 neurons using MitoTracker Deep Red MFI. Neurons were treated with rotenone and subsequently supplemented with mitochondria isolated from microglia pre-treated as indicated. Results are expressed as fold change relative to control (vehicle-treated Clu189 neurons not receiving mitochondria).\u003c/p\u003e\n\u003cp\u003eStatistical analysis: Data are expressed as mean ± SEM. One-way ANOVA followed by Tukey’s post hoc test for multiple comparisons, or unpaired t-test for two-group comparisons; *\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05.\u003c/p\u003e","description":"","filename":"floatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-9558181/v1/d76a00df5d482d66fee60d40.png"},{"id":109156154,"identity":"ae36c0fc-7300-48d6-b12b-bf8977a5ba01","added_by":"auto","created_at":"2026-05-13 06:45:01","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":44540090,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eMicroglia-to-neuron mitochondrial transfer occurs in vivo.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(A) \u003c/strong\u003eMosaic microscope image of a sagittal brain section from LyzM-CrePham\u003csup\u003efloxed\u003c/sup\u003e mice showing Dendra2\u003csup\u003e+\u003c/sup\u003e mitochondria (grey) within microglia and distributed in the extracellular space across multiple brain regions. Abbreviations: Cx, cortex; Hi, hippocampus; Cb, cerebellum; CPu, caudate-putamen; Dst, dorsal striatum; Th, thalamus; Hypoth, hypothalamus; SN, substantia nigra; AM, amygdala; PO, pons; MO, medulla oblongata.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(B) \u003c/strong\u003eHigh-magnification image of the hypothalamus from a chow-fed mouse showing AgRP\u003csup\u003e+\u003c/sup\u003e neurons (red), Dendra2\u003csup\u003e+\u003c/sup\u003e mitochondria (green), and nuclei (DAPI, blue). The ventromedial hypothalamus (VMH) is outlined (dashed line). Dendra2\u003csup\u003e+\u003c/sup\u003e mitochondrial signal is detected within neurons in this region.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(C) \u003c/strong\u003eHigher magnification of the VMH showing NeuN\u003csup\u003e+\u003c/sup\u003e neurons (magenta) containing internalized Dendra2\u003csup\u003e+\u003c/sup\u003e mitochondria (green) derived from microglia. 3D reconstruction (inset c) with top-down and orthogonal views confirms intracellular localization within neuronal somata.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(D) \u003c/strong\u003eImages of arcuate nucleus neurons stained for POMC (upper panels) or AgRP (lower panels). Dendra2\u003csup\u003e+\u003c/sup\u003e mitochondria (green) are detected within AgRP\u003csup\u003e+\u003c/sup\u003e neurons (arrowheads), whereas limited signal is observed in POMC\u003csup\u003e+\u003c/sup\u003e neurons. 3D reconstruction of the highlighted AgRP\u003csup\u003e+\u003c/sup\u003e neurons (inset d) confirms intracellular mitochondrial localization.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(E) \u003c/strong\u003eExperimental design for stereotaxic injection of isolated mitochondria. Mice were maintained on chow or high-fat diet (HFD) for 12 weeks. Purified mitochondria were stereotaxically i.c.v injected. After 7 days of post-surgical recovery, food intake was measured at 1 h, 3 h, 6 h, and 24 h after 7 days following mitochondrial injection.\u003c/p\u003e\n\u003cp\u003eStatistical analysis: Two-way ANOVA followed by Tukey’s post hoc test, or unpaired t-test for unpaired two-group comparisons. Data are presented as mean ± SEM; *\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05.\u003c/p\u003e","description":"","filename":"floatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-9558181/v1/b7b66e9dca04afe9279eb12a.png"},{"id":109156139,"identity":"27e8bbb1-d335-4278-ae65-2e5a6cb44fdf","added_by":"auto","created_at":"2026-05-13 06:44:51","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":43383630,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eDopaminergic neurons internalize microglia-derived mitochondria in vivo and mitochondrial supplementation improves motor deficits in a rotenone model.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(A) \u003c/strong\u003eRepresentative confocal image of the substantia nigra pars compacta (SNpc) from LyzM-CrePham\u003csup\u003efloxed\u003c/sup\u003e mice showing tyrosine hydroxylase–positive (TH\u003csup\u003e+\u003c/sup\u003e) dopaminergic neurons (magenta), Dendra2\u003csup\u003e+\u003c/sup\u003e microglia-derived mitochondria (green), and nuclei (DAPI, blue). Inset (a) shows a higher magnification of the highlighted region, and 3D reconstruction confirms intracellular localization of Dendra2\u003csup\u003e+\u003c/sup\u003e mitochondria within TH\u003csup\u003e+\u003c/sup\u003e neurons.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(B) \u003c/strong\u003eExperimental design of the Parkinsonian model induced by repeated intraperitoneal rotenone injections (3mg/mL). Behavioral tests (open field, cylinder/rearing test) and body weight monitoring were performed during treatment. Mice exhibiting ≥50% reduction in locomotor activity were selected for stereotaxic injection of purified mitochondria into the SNpc. A 24-h washout period was allowed between the final rotenone injection and mitochondrial administration. Behavioral assessments were repeated post-injection, followed by transcardial perfusion and brain collection for histological analysis. N = 3-6 mice.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(C) \u003c/strong\u003eCoronal brain section showing the site of stereotaxic mitochondrial injection (30 µg mitochondrial protein) into the SNpc (green arrow) in the ipsilateral hemisphere. The contralateral hemisphere displays minimal Dendra2\u003csup\u003e+\u003c/sup\u003e signal outside microglia. Inset (c) shows TH\u003csup\u003e+\u003c/sup\u003e neurons containing internalized Dendra2\u003csup\u003e+\u003c/sup\u003e mitochondria in the SNpc.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(D) \u003c/strong\u003eOpen field test quantification showing total distance traveled before (D0), during rotenone treatment (P1) and after (P8) mitochondrial or vehicle injection in control (Veh), rotenone-treated (Rot), and rotenone plus mitochondrial supplementation (Rot + Mitoch) groups.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(E) \u003c/strong\u003eRearing behavior (mean rears per 2 min) assessed before rotenone treatment (D0), during symptom manifestation (P1), and after intracerebral injection of mitochondria or vehicle (P8).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(F) \u003c/strong\u003eQuantification of TH\u003csup\u003e+\u003c/sup\u003e dopaminergic fiber integrated density (IntDen) relative to vehicle in rotenone-treated mice receiving vehicle or mitochondrial supplementation. Fibers were quantified in the striatal projection area. Images, mice: N = 3-6 mice.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(G) \u003c/strong\u003eQuantification of TH\u003csup\u003e+\u003c/sup\u003e neuronal cell bodies in the SNpc following rotenone treatment and mitochondrial supplementation. N = 3-6 mice.\u003c/p\u003e\n\u003cp\u003eStatistical analysis: Two-way ANOVA followed by Tukey’s post hoc test for multiple comparisons, or unpaired t-test for unpaired two-group comparisons. Data are presented as mean ± SEM; *\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05.\u003c/p\u003e","description":"","filename":"floatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-9558181/v1/7c3364fd98b4281c1e11ad82.png"},{"id":109206169,"identity":"b58eeb6b-625a-4edd-bf0c-d6aeb417b741","added_by":"auto","created_at":"2026-05-13 15:11:21","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":120442934,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-9558181/v1/a8931815-5153-4e77-8673-66f058c81101.pdf"},{"id":109156141,"identity":"b578b3d6-8cf3-4131-81eb-20e9e969d42b","added_by":"auto","created_at":"2026-05-13 06:44:52","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"supplement","size":47227620,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryMaterial.docx","url":"https://assets-eu.researchsquare.com/files/rs-9558181/v1/07097458e7db07c9241e5dfc.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Microglia-to-Neuron Mitochondrial Transfer Supports Neuronal Metabolism and Protects Against Neurodegeneration","fulltext":[{"header":"Significance Statement","content":"\u003cp\u003eNeuroinflammation and mitochondrial dysfunction drive devastating brain disorders such as Parkinson\u0026apos;s disease. This study reveals that microglia, the brain\u0026apos;s immune cells, can transfer healthy mitochondria to stressed neurons through a specialized contact-dependent mechanism. This donation rescues neuronal metabolism, reduces oxidative damage, and preserves axonal integrity. However, the outcome depends critically on the microglial state since mitochondria from activated microglia can exacerbate injury. We demonstrate this process occurs naturally in the brain and can be harnessed therapeutically to improve motor function in a Parkinson\u0026apos;s model. These findings uncover a fundamental immunometabolic communication pathway with broad implications for treating neurodegenerative and metabolic diseases.\u003c/p\u003e"},{"header":"Introduction","content":"\u003cp\u003eMitochondria dysfunction is a central driver in neuroinflammatory and neurodegenerative diseases such as Parkinson\u0026rsquo;s and Alzheimer\u0026rsquo;s. While neurons rely on mitochondrial integrity, neuronal dysfunction is exacerbated by microglia, which can amplify oxidative stress metabolic imbalance and inflammation\u003csup\u003e\u003cspan additionalcitationids=\"CR2\" citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e\u003c/sup\u003e. However, beyond their inflammatory role, microglia also exhibited protective functions, including the intercellular transfer of mitochondria\u003csup\u003e\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e,\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u003c/sup\u003e, an emerging mechanism of metabolic support whose full significance for neuronal resilience is still being defined.\u003c/p\u003e \u003cp\u003eEmerging evidence indicates that stressed neurons can internalize functional mitochondria released by microglia to support bioenergetics and survival\u003csup\u003e\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e,\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e\u003c/sup\u003e. However, this process is double-edged as microglia can also release dysfunctional mitochondria, which propagate neurodegeneration by, for example, triggering pathogenic A1 astrocytic responses\u003csup\u003e\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u003c/sup\u003e. The switch between these protective and detrimental outcomes is governed by a complex interplay of cellular metabolic state, cytoskeletal dynamics, and specific vesicular trafficking and uptake pathways\u003csup\u003e\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e,\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u003c/sup\u003e. Deciphering this regulatory network is therefore critical for developing therapeutic strategies that can selectively enhance beneficial mitochondrial transfer or correct metabolic impairments in neuroinflammatory diseases.\u003c/p\u003e \u003cp\u003eCritical knowledge gaps remain regarding whether microglial mitochondria transfer operates as a targeted rescue mechanism \u003cem\u003ein vivo\u003c/em\u003e, and how its efficacy is influenced by metabolic or neurodegenerative stress. To address this, we tested the hypothesis that this process constitutes a regulated form of intercellular metabolic support. Here, we show that microglia release distinct populations of mitochondria, either as naked organelles or enclosed within membrane-bound vesicles, which are internalized by neurons. This transfer rescues neuronal survival by alleviating oxidative stress, restoring respiration, and modulating neuropeptide expression. Furthermore, using \u003cem\u003ein vivo\u003c/em\u003e models of obesity and Parkinson\u0026rsquo;s disease (PD), we demonstrate that this pathway preserves circuit function and prevents axonal degeneration. Together, our findings define a direct mechanism through which microglia support neuronal integrity via mitochondria donation, revealing a novel target for therapeutic intervention in neuroinflammatory and metabolic disorders.\u003c/p\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eMicroglia release mitochondria upon direct contact with injured neurons\u003c/h2\u003e \u003cp\u003eTo determine whether microglia can release mitochondria, we employed primary microglia from LysM-CrePhAM\u003csup\u003efloxed\u003c/sup\u003e mice, in which mitochondria are labelled with the fluorescent protein Dendra2. In this model, Dendra2 is selectively expressed in the mitochondrial matrix\u003csup\u003e\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e\u003c/sup\u003e of lysozyme-expressing cells, which in the CNS are predominantly microglia (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). This provides specific, constitutive green fluorescence labelling of the microglial mitochondria network. In monoculture, microglia showed no spontaneous mitochondria release. However, when co-cultured with neuronal cells, including primary neurons or the neuronal cell lines Neuro2a and Clu189, we observed limited extracellular mitochondria release (\u003cb\u003eSupplementary Figure \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003eA)\u003c/b\u003e. We selected the Clu189 cell line for subsequent studies due to its relevance to energy metabolism and its capacity for spontaneous neuronal differentiation without exogenous inducers \u003cb\u003e(Figure \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003eB\u003c/b\u003e). Clu189 cells are derived from hypothalamic orexigenic neurons and express AgRP neuropeptide\u003csup\u003e\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eTo assess the influence of neuronal injury on microglia mitochondrial release, we exposed Clu189 neurons to rotenone, a mitochondrial complex I inhibitor that induces oxidative stress and neuronal death\u003csup\u003e\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e,\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e\u003c/sup\u003e. Upon adding primary microglia to injured neuronal culture, time-lapse microscopy over 24 hours revealed that rotenone-induced injury triggered a marked increase in the release of Dendra2\u003csup\u003e+\u003c/sup\u003e mitochondria from microglia. This suggests that damaged neurons emit signals which actively recruit microglial mitochondria support. High-resolution imaging reveals two distinct forms of released mitochondria: (i) small, membrane-free naked mitochondria and (ii) larger mitovesicles, which are membrane encapsulated structures containing single or multiple mitochondria; or yet, interconnected organelles (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB-C, \u003cb\u003evideo S1C\u003c/b\u003e).\u003c/p\u003e \u003cp\u003eThis mitochondrial release was a rapid microglial response, detectable within 1 hour of contact with injured neurons and peaking by 6 hours, at which point the extracellular space was populated with abundant Dendra2\u003csup\u003e+\u003c/sup\u003e structures of both types. To investigate whether mitochondrial release is a general property or phenotype-dependent, we treated microglia with diverse stimuli (Mdivi-1, a mitochondria fission inhibitor; LPS; palmitate; and IL-4). All conditions triggered the release of both mitochondrial forms (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD-E), indicating that mitochondria release is a conserved microglial response. While the exact extrusion mechanism for mitochondria remains to be captured, their consistent presence and Dendra2 labelling confirm their microglial origin (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eF).\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eOrexigenic neurons internalize microglia-derived mitochondria\u003c/h3\u003e\n\u003cp\u003eWe next investigated whether neurons could internalize the mitochondria released by microglia. After 24 hours of co-culture, immunofluorescence revealed the presence of Dendra2 inside Clu189 neurons, confirming that neurons do uptake microglia-derived mitochondria (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). This uptake was not a passive process; live-cell imaging captured neurons actively recruiting extracellular mitochondria by extending membrane projections toward mitovesicles (\u003cb\u003evideo S2C\u003c/b\u003e). Importantly, neuronal injury amplified this process; thus, uptake was nearly threefold higher when neurons were pre-treated with rotenone, indicating that metabolic stress potently enhances the internalization of microglial mitochondria (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB). Notably, this enhanced uptake was independent of upstream changes in microglial mitochondria dynamics, since promoting fission with LPS or palmitate and fusion with Mdivi-1\u0026thinsp;+\u0026thinsp;M1 (\u003cb\u003eFigure S2A-B\u003c/b\u003e) did not alter the overall capture of mitochondria (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB). Functional analysis of the internalized mitochondria revealed a heterogenous population. While some Dendra2\u003csup\u003e+\u003c/sup\u003e mitochondria retained membrane potential, as confirmed by co-localization with MitoTracker Deep Red, indicating they were metabolically competent upon entry (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC), others do not retain membrane potential (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eTo define the mechanisms underlying mitochondrial transfer, we first probed the role of canonical vesicle trafficking in microglia. Inhibition of cytoskeleton-dependent pathways in microglia with the ROCK1/2 inhibitor Y27632 reduced neuronal mitochondrial uptake. In contrast, blocking exosome release via the N-SMase inhibitor GW4869 had no effect (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eE), suggesting that mitochondria are not conveyed through conventional exosomes. We next used a targeted CRISPR-Cas9 screen in Clu189 neurons to identify specific molecular mediators (\u003cb\u003eFigure S2C\u003c/b\u003e). Knockout of Gja1, encoding the gap-junction protein Connexin 43 (Cx43), reduced mitochondrial uptake (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eF\u003cb\u003e)\u003c/b\u003e, implicating Cx43 as a critical facilitator. In contrast, deletion of genes involved in alternative transfer pathways, such as \u003cem\u003eExoc1\u003c/em\u003e (Sec3) for tunnelling nanotubes\u003csup\u003e\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u003c/sup\u003e; \u003cem\u003eGm609\u003c/em\u003e (ISEC1), a CD200 homolog that interacts with microglial CD200R\u003csup\u003e\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e\u003c/sup\u003e; or \u003cem\u003eItgb1\u003c/em\u003e (Integrin β1)\u003csup\u003e15\u003c/sup\u003e, had modest or negligible effects. In addition, high-resolution imaging revealed mitochondrial transfer at specialized contact sites between neurons and microglia, which served as hubs for the accumulation of mitochondria (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eG). These microglial hubs enriched in mitochondria, formed around neuronal projections, may represent the sites at which Cx43 assembles functional gap junctions, thereby enabling direct mitochondrial transference. Together, our findings delineate a non-canonical intercellular pathway in which microglia release mitochondria via cytoskeleton-driven but exosome-independent mechanism, and neurons internalize them predominantly through Cx43-dedicated intercellular contact sites, regardless of the donor mitochondrial dynamics.\u003c/p\u003e\n\u003ch3\u003eNeuronal survival is promoted by microglial mitochondria through metabolic support and ROS mitigation\u003c/h3\u003e\n\u003cp\u003eTo assess the functional impact of mitochondria transfer, we began by examining neuronal survival. As expected, exposure to rotenone let to increased neuronal death (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA). However, when neurons were co-cultured with microglia, this toxicity was significantly reduced. Notably, blocking mitochondria transfer by culturing microglia on 1 \u0026micro;m pore transwell inserts abolished the protective effect, demonstrating that direct cell-to-cell contact is essential for microglia to confer neuroprotection through mitochondrial transfer.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eTo determine whether microglial mitochondria alone can provide neuroprotection, we supplemented rotenone-injured neurons with purified microglial mitochondria (\u003cb\u003eFigure S3A\u003c/b\u003e). Although neurons successfully internalized these organelles (\u003cb\u003eFigure S3B\u003c/b\u003e), neuronal death was not significantly reduced, despite a consistent trend toward protection (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB). This finding suggests that full efficacy may require additional microglial factors or the context of active cell-to-cell transfer.\u003c/p\u003e \u003cp\u003eTo elucidate the metabolic mechanisms underlying neuronal protection, we assessed glycolytic and mitochondrial function in injured neurons supplemented with microglial mitochondria. Glycolysis remained unchanged following mitochondria transfer, regardless of the prior activation state of the microglia (\u003cb\u003eFigure S3C\u003c/b\u003e). In contrast, mitochondrial respiration was enhanced by mitochondria derived from na\u0026iuml;ve or Mdivi-1\u0026thinsp;+\u0026thinsp;M1-treated microglia, but not by those from LPS-activated microglia (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC). This increase in respiratory capacity was accompanied by accelerated NAD+/NAD(P)H turnover, directly reflecting improved mitochondrial activity (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD).\u003c/p\u003e \u003cp\u003eGiven that rotenone induces oxidative stress, we next examined the effect of extracellular mitochondria on neuronal ROS levels. Co-culture with na\u0026iuml;ve microglia effectively attenuated rotenone-induced ROS accumulation, whereas LPS-activated microglia exacerbated it (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eE).\u003c/p\u003e \u003cp\u003eThis effect was intrinsic to the transferred mitochondria: supplementation with mitochondria purified from na\u0026iuml;ve microglia reduced neuronal ROS, while mitochondria from LPS- or Mdivi-1\u0026thinsp;+\u0026thinsp;M1-treated microglia had no effect (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eF). Importantly, this reduction in ROS occurred without altering the mitochondrial membrane potential of neurons (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eG), indicating that the antioxidant effect was not due to mitochondrial depolarization. The therapeutic window for this antioxidant effect proved to be narrow and context-dependent: mitochondrial supplementation failed to protect undifferentiated neuronal precursors (\u003cb\u003eFigure S3D\u003c/b\u003e), and greater doses of isolated mitochondria increased oxidative stress (\u003cb\u003eFigure S3E\u003c/b\u003e). These findings underscore the critical importance of both dosage and neuronal differentiation state in determining the efficacy of mitochondrial transfer.\u003c/p\u003e \u003cp\u003eFinally, we investigated whether mitochondrial uptake influenced the expression of neurotransmitters and the pro-inflammatory cytokine \u003cem\u003eTnf\u003c/em\u003e. Following rotenone injury, which increased both \u003cem\u003eAgRP\u003c/em\u003e and \u003cem\u003ePOMC\u003c/em\u003e expression, transferred mitochondria selectively potentiated AgRP expression (\u003cb\u003eFigure S3F\u003c/b\u003e). This was accompanied by induction of \u003cem\u003eTnf\u003c/em\u003e (\u003cb\u003eFigure S3G\u003c/b\u003e), indicating that exogenous mitochondria can trigger coordinated transcriptional responses involving both metabolic (orexigenic) and inflammatory pathways. Collectively, these data reveal a tripartite mechanism of microglia-mediated support: transferred mitochondria rescue neuronal bioenergetics by enhancing oxidative respiration, mitigate cytotoxicity by limiting ROS accumulation, and remodel neuronal phenotype by modulating neuropeptide and inflammatory gene expression. This multifaceted intervention highlights the complexity of intercellular metabolic support in the injured brain.\u003c/p\u003e \u003cp\u003e \u003cb\u003eMitochondrial transfer occurs in the hypothalamus\u003c/b\u003e \u003cb\u003ein vivo\u003c/b\u003e\u003c/p\u003e \u003cp\u003eTo determine whether microglia-to-neuron mitochondria transfer occurs \u003cem\u003ein vivo\u003c/em\u003e, we analyzed whole sagittal brain sections from PhAM mice. Dendra2\u003csup\u003e+\u003c/sup\u003e mitochondria were widely distributed across several brain regions, including the cortex, hippocampus, cerebellum, thalamus and hypothalamus (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA). Remarkably, within the hypothalamus, we observed a pronounced accumulation of Dendra2 signal inside neuronal cell bodies, particularly in the ventromedial hypothalamus (VMH) (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB\u003cb\u003e)\u003c/b\u003e and arcuate nucleus (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC). Characterization of recipient neurons revealed a specific cellular tropism: a subset of Dendra2\u003csup\u003e+\u003c/sup\u003e neurons were identified as orexigenic, co-localizing with AgRP immunoreactivity (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD\u003cb\u003e)\u003c/b\u003e. In contrast, there was no evidence of mitochondrial transfer to anorexigenic POMC\u003csup\u003e+\u003c/sup\u003e neurons or to astrocytes in this region (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD, S4A). These findings demonstrate that microglial mitochondrial transfer to neurons occurs also \u003cem\u003ein vivo\u003c/em\u003e, exhibiting both regional specificity and a selective preference for AgRP-expressing orexigenic neurons within the arcuate nucleus.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eGiven the central role of AgRP neurons in energy homeostasis, we next examined whether their acquisition of microglial mitochondria is regulated by nutritional status. Quantification of Dendra2\u003csup\u003e+\u003c/sup\u003e mitochondria in hypothalamic neurons revealed similar levels in mice fed either a standard chow or a high-fat diet (\u003cb\u003eFigure S4B\u003c/b\u003e), suggesting that basal mitochondria transfer to this neuronal population is maintained independently of nutritional state.\u003c/p\u003e \u003cp\u003eTo assess whether microglial mitochondria can directly modulate feeding behavior, we injected purified mitochondria into the third ventricle of both lean and obese mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eE). Interestingly, the effect on feeding behavior was dependent on metabolic state since in lean mice, mitochondria supplementation stimulated food intake, whereas in obese mice, it suppressed feeding (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eF). This bidirectional modulation indicates that transferred mitochondria influence central feeding circuits in a state-specific manner, integrating into and altering the activity of these neural pathways.\u003c/p\u003e\n\u003ch3\u003eTherapeutic mitochondrial supplementation prevents axonal loss in Parkinson’s disease model\u003c/h3\u003e\n\u003cp\u003eWithin the substantia nigra, we observed robust transfer of Dendra2\u003csup\u003e+\u003c/sup\u003e mitochondria to tyrosine hydroxylase-positive (TH\u003csup\u003e+\u003c/sup\u003e) dopaminergic neurons (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA, \u003cb\u003einset \u0026ldquo;a\u0026rdquo;\u003c/b\u003e). Building on this anatomical evidence of mitochondrial transfer to a vulnerable neuronal population, we directly tested the therapeutic potential of this process in a PD model. Motor deficits were induced in mice through systemic, chronic rotenone treatment until animals exhibited at least 50% reduction in baseline motor performance. Following a 24-hour washout period, mitochondria isolated from microglia were unilaterally injected into the substantia nigra \u003cem\u003epars compacta\u003c/em\u003e (SNpc) (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB). The exogenous mitochondria were selectively internalized by ipsilateral SNpc TH\u003csup\u003e+\u003c/sup\u003e dopaminergic neurons with no detectable uptake in the contralateral hemisphere, conforming targeted local delivery (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC). Intranigral mitochondrial therapy resulted in a partial but significant restoration of locomotor performance (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eD). Importantly, this structural and functional rescue was selective, as mitochondrial transfer did not alter rearing behavior (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eE), suggesting a compartmentalized therapeutic effect. Consistent with this interpretation, mitochondrial transfer significantly increased the density of TH\u003csup\u003e+\u003c/sup\u003e axonal projections to the thalamus (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eF) without affecting neuronal numbers (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eG), indicating that the functional improvement was causally linked to the preservation of dopaminergic axonal integrity rather than to global changes in motor output. Collectively, these findings establish microglial mitochondrial donation as a fundamental neuroprotective mechanism that preserves axonal integrity and motor activity in a PD model. By demonstrating that this pathway can be leveraged therapeutically, we reveal a targeted approach to reinforce neuronal metabolism at its most vulnerable point, the axon, offering a promising avenue to halt circuit-level failure in neurodegenerative diseases.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eIntercellular mitochondrial transfer has emerged as a key neuroprotective mechanism in the CNS. Here, we identify a previously unrecognized contact-dependent pathway by which microglia donate mitochondria to neurons following injury. This process involves rapid release of two mitochondrial populations, naked mitochondria and mitovesicles, through a ROCK1/2-dependent mechanism. We further demonstrate that neuronal Cx43-enriched contact sites serve as focal platforms for mitochondrial accumulation and uptake. Functionally, the impact of mitochondrial transfer depends on donor microglial state. Mitochondria from na\u0026iuml;ve microglia enhance neuronal oxidative phosphorylation, accelerate NAD(P)H turnover, reduce oxidative stress, and improve survival after rotenone injury. In contrast, mitochondria from LPS-activated microglia increase neuronal ROS, revealing a state-dependent duality. Importantly, \u003cem\u003ein vivo\u003c/em\u003e evidence of microglial mitochondrial transfer to hypothalamic and nigral neurons confirms this as a physiological and adaptive response to stress.\u003c/p\u003e \u003cp\u003eMechanistically, our data challenge the prevailing notion that mitochondrial fission is a prerequisite for extracellular release. Neither pharmacological promotion of fission nor fusion altered the process of releasing mitochondria, indicating that microglia employ specialized export mechanisms that operate independently of the fission\u0026ndash;fusion cycle. Supporting this, Joshi and collaborators\u003csup\u003e\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u003c/sup\u003e found that LPS stimulation altered mitochondrial morphology without changing release quantity, indicating that division is not the limiting factor. Instead, shifts in fission-fusion balance may predominantly dictate the functional quality, rather than the abundance of released mitochondria\u003csup\u003e\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e\u003c/sup\u003e. For instance, exposure to the metabolic stressor palmitate, which promotes mitochondrial fragmentation, does not reduce mitochondrial release. Instead, palmitate may enhance the functional integrity of released mitochondria, possibly through a lipid-driven shift on microglial oxidative metabolism\u003csup\u003e\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eOur findings demonstrated that neurons actively internalize mitochondria released from microglia, a process amplified by neuronal metabolic stress. This supports the emerging paradigm of mitochondria as dynamic transcellular communicators. Importantly, the uptake of organelles with preserved membrane potential represents a physiologically meaningful event that can rescue neuronal bioenergetics. Conversely, the transfer of depolarized or fragmented mitochondria may propagate inflammatory signaling\u003csup\u003e\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e,\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u003c/sup\u003e. Together, a fundamental duality appears, the same process can mediate neuroprotection or neurotoxicity depending on donor organelle integrity. Neuronal uptake of microglial mitochondria is mediated through Cx43-enriched contact sites. This extends the established role of Cx43 in astrocyte\u0026ndash;neuron coupling to microglial communication\u003csup\u003e\u003cspan additionalcitationids=\"CR18 CR19\" citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e\u003c/sup\u003e, suggesting a broader model in which Cx43 organizes structural platforms for horizontal mitochondrial exchange. Cx43 has been implicated in several modes of mitochondria transfer, including Cx43-containing TNTs, Cx43 facilitates mitochondrial transfer through gap junctional Ca\u003csup\u003e2+\u003c/sup\u003e signaling and the subsequent internalization of gap junctions into connexosomes, which carry whole mitochondria between neighboring cells\u003csup\u003e\u003cspan additionalcitationids=\"CR22 CR23\" citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e\u003c/sup\u003e. Mitochondrial export is further supported by ROCK1/2-dependent vesicular trafficking and the formation of mitovesicles, a distinct class of mitochondrial-enriched extracellular structures\u003csup\u003e\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e,\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e\u003c/sup\u003e. Together with OPA1/SNX9-dependent mitochondria-derived vesicle pathways\u003csup\u003e\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e\u003c/sup\u003e, these mechanisms likely coordinate mitochondrial quality control with selective intercellular delivery.\u003c/p\u003e \u003cp\u003eTransferred mitochondria also influence neuronal inflammatory signaling. Microglial mitochondria increased neuronal TNF-α expression, consistent with the presence of mitochondrial DAMPs such as mtDNA and mtROS within mitovesicles\u003csup\u003e\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e\u003c/sup\u003e. These signals may activate innate immune pathways and remodel neuronal metabolic programs, linking inflammatory signaling to bioenergetic adaptation\u003csup\u003e\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eFunctionally, microglial mitochondria protect metabolically compromised neurons through dual mechanisms: restoration of oxidative phosphorylation and reduction of oxidative stress. This rescue is strictly donor dependent. While na\u0026iuml;ve microglial mitochondria enhance respiration and NAD(P)H turnover, likely strengthening antioxidant defenses, mitochondria from LPS-activated microglia fail to confer benefit and may exacerbate stress\u003csup\u003e\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e,\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e,\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e\u003c/sup\u003e. Importantly, transfer selectively augments oxidative metabolism without altering glycolysis, preserving neuronal metabolic identity. However, excessive mitochondrial supplementation overwhelms quality-control systems, highlighting a narrow therapeutic window. Recipient differentiation state further influences efficacy, with mature oxidative neurons benefiting more than glycolytic precursors.\u003c/p\u003e \u003cp\u003eOur \u003cem\u003ein vivo\u003c/em\u003e findings establish microglia-to-neuron mitochondrial transfer as an active process within physiologically relevant contexts of metabolic and neurodegenerative stress. In the hypothalamus, AgRP-expressing neurons internalize microglial mitochondria. Exogenous delivery of these organelles to lean mice amplified food intake, consistent with \u003cem\u003ein vitro\u003c/em\u003e data showing increased AgRP expression, thereby positioning mitochondrial transfer as a metabolic amplifier for orexigenic neurons circuits\u003csup\u003e\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e\u003c/sup\u003e. This effect was state dependent, since in obese mice, mitochondria supplementation did not stimulate feeding. While the behavioral impact was clear, robust cellular internalization of exogeneous mitochondria was less pronounced than endogenous transfer, raising intriguing questions about the possible paracrine signaling factors controlling these events effects, particularly within key subregions like the VMH. Similarly, in SNpc, microglial mitochondria were found within dopaminergic neurons. Therapeutically, exogenous mitochondrial administration mitigated motor deficits and preserved axonal integrity in a rotenone-induced Parkinson\u0026rsquo;s model. This demonstrates the potential of enhancing this endogenous pathway to support circuit resilience under neurodegenerative pressure\u003csup\u003e\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eCollectively, our findings reposition microglia-to-neuron mitochondrial transfer as a regulated, context-sensitive mechanism of brain homeostasis. The outcome, whether amplifying orexigenic drive, restoring metabolic sensitivity, or preserving axonal function, is determined by the interplay between the quality of donated mitochondria, the state of the donor microglia, and the pathophysiological context of the recipient tissue. This framework highlights both the therapeutic promise and complexity of targeting this pathway. Future studies should address whether full organelle functionality is required for neuroprotection or if specific molecular cargoes suffice, as well as the safety profile of mitochondrial interventions \u003cem\u003ein vivo\u003c/em\u003e. Ultimately, our work reveals microglial mitochondrial donation as a sophisticated form of immunometabolic communication that shapes neural circuit function and systemic physiology.\u003c/p\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eLimitations and Future Directions\u003c/h2\u003e \u003cp\u003eWhile this study defines a novel pathway for mitochondria transference and support, several limitations merit consideration. First, in our chronic rotenone model, the lack of significant dopaminergic cell body loss, potentially due to dosing or drug penetration, may have constrained the observable therapeutic window for mitochondrial rescue. Second, we did not evaluate the \u003cem\u003ein vivo\u003c/em\u003e consequences of delivering dysfunctional mitochondria, a critical gap given our \u003cem\u003ein vitro\u003c/em\u003e evidence that damaged mitochondria exacerbate neuroinflammation as also described. The functional ratio of released mitochondria is a key determinant of neuronal fate, highlighting the need to define the safety profile of mitochondrial interventions. Future studies should imply models with more pronounced neuronal loss and directly test the effects of mitochondria from activated microglia \u003cem\u003ein vivo\u003c/em\u003e to translate this mechanism into a safe therapeutic strategy.\u003c/p\u003e \u003c/div\u003e"},{"header":"Materials and Methods","content":"\u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003eAnimals\u003c/h2\u003e \u003cp\u003eC57BL/6J (males, 8\u0026ndash;10 weeks, 22\u0026ndash;25 g) PhAM\u003csup\u003eFloxed\u003c/sup\u003e and C57BL/6J LysM-Cre transgenic mice were obtained from The Jackson Laboratory and housed at the Multidisciplinary Center for Biological Research (CEMIB), Campinas University (UNICAMP, Brazil). The PhAM\u003csup\u003eFloxed\u003c/sup\u003e mouse line expresses the photo-convertible fluorescent protein Dendra2, which is specifically localized to mitochondria. To selectively label mitochondria in myeloid cells, PhAM\u003csup\u003eFloxed\u003c/sup\u003e mice were crossed with LysM-Cre mice, resulting in robust Dendra2 expression in myeloid-derived cells without altering mitochondrial morphology, as previously described\u003csup\u003e\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e\u003c/sup\u003e. Mice were maintained at 22\u0026thinsp;\u0026plusmn;\u0026thinsp;1\u0026deg;C, 55\u0026thinsp;\u0026plusmn;\u0026thinsp;5% humidity, 12-h light/dark cycle, with \u003cem\u003ead libitum\u003c/em\u003e access to food and water, and housed under specific pathogen-free conditions at the Animal Facility of the Institute of Biology, UNICAMP. Procedures were performed under anesthesia using a mixture of ketamine (100 mg/kg) and xylazine (10 mg/kg) applied intraperitoneally and euthanasia was achieved under deep anesthesia (5% isoflurane until no reflex) followed by cervical dislocation. All experimental procedures were carried out according to UNICAMP Animal Ethics Committee (protocol number 6301-1/2023). Unless otherwise stated, each experiment included at least 3 mice per group (when not specified), with 3 independent biological replicates and three technical replicates per assay.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eObesity\u003c/h2\u003e \u003cp\u003eObesity was induced by feeding mice a high-fat diet (Teklad TD93075; 55% kcal from fat) starting at six weeks of age for 12 weeks as previously described\u003csup\u003e\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e\u003c/sup\u003e. Age-matched controls received standard chow (Nuvilab\u0026reg; CR-1, Curitiba, Parana, Brazil; 4.9% kcal from fat). Body weight was recorded weekly throughout the feeding period.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eFood Intake Assessment\u003c/h2\u003e \u003cp\u003eBaseline food intake was measured daily for three consecutive days (D0\u0026ndash;D3) prior to stereotaxic surgery (D5). Following surgery and recovery, mice were fasted for 24 hours on D9 with free access to water. Recombinant leptin (Sigma-Aldrich, Cat. #L4146) was then administered by intracerebroventricular injection into the third ventricle (10 \u0026micro;g in 2 \u0026micro;L), and food intake was recorded at 1, 3, 6, and 24 hours post-injection. In a separate cohort, mice were euthanized 30 minutes after leptin administration by anesthesia overdose, and the hypothalamus was rapidly dissected and collected for downstream protein analysis by western blotting.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eExperimental Parkinson\u0026rsquo;s Disease Model\u003c/h2\u003e \u003cp\u003eA Parkinson\u0026rsquo;s disease\u0026ndash;like phenotype was induced by chronic intraperitoneal administration of rotenone, adapted from Cannon and collaborators\u003csup\u003e\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e\u003c/sup\u003e. Rotenone was prepared as a 50\u0026times; stock solution in 100% DMSO and diluted in medium-chain triglyceride oil (98% MCT, 2% DMSO) to a final concentration of 3.0 mg/mL. Fresh solutions were prepared two to three times per week, protected from light, and vortexed before each injection. Rotenone was administered daily at a dose of 3 mg/kg (1 mL/kg injection volume). Control animals received vehicle (MCT-DMSO) alone. All behavioral assessments were performed by an experimenter blinded to treatment conditions. Each experimental group consisted of 5 mice.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eBehavioral Assessments\u003c/h2\u003e \u003cp\u003eMice were monitored weekly for the development of Parkinson-like symptoms using open-field and rearing tests. Animals were considered to display a Parkinsonian phenotype when both distance travelled and number of rears were reduced by more than 50% relative to baseline (D0). Open field test: mice were acclimated to the open-field apparatus (Activity Monitor IR EP149, Equipment Insight) for 1 hour per day on two consecutive days. All behavioral testing was conducted in a quiet, isolated room, free from external interruptions. Locomotor activity (total distance, velocity) was recorded for 3 minutes. Rearing test: Mice were trained for 2 days to minimize anxiety-related artifacts. Rearing behavior was assessed by placing each animal into a clear 1-L glass cylinder for 2 minutes while video recording. A rear was defined as elevation of the forelimbs above shoulder level with simultaneous contact of both forelimbs on the cylinder wall. Forelimb removal from the wall and return to the floor were required before a subsequent rear was counted\u003csup\u003e\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e\u003c/sup\u003e. The total number of rears per session was quantified for each animal.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eStereotaxic Brain Intervention\u003c/h2\u003e \u003cp\u003eMice were anesthetized and injected with tramadol (5 mg/kg) subcutaneously (\u003cem\u003es.c.\u003c/em\u003e). After loss of reflexes, animals were positioned in a stereotaxic apparatus, and the scalp was shaved and sterilized with an 1% iodine solution. Ophthalmic ointment was applied to prevent corneal drying. A midline incision was made to expose the skull. A stainless-steel guide cannula (26-gauge) was implanted into the lateral ventricle or the substantia nigra \u003cem\u003epars compacta\u003c/em\u003e according to the mouse brain atlas of Paxinos and Franklin\u003csup\u003e\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e\u003c/sup\u003e. For the lateral ventricle, the following coordinates relative to bregma were used: AP\u0026thinsp;\u0026minus;\u0026thinsp;0.35 mm, ML\u0026thinsp;\u0026minus;\u0026thinsp;1.0 mm, DV\u0026thinsp;\u0026minus;\u0026thinsp;2.2 mm, as previously described\u003csup\u003e\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e\u003c/sup\u003e. For the substantia nigra, coordinates were AP\u0026thinsp;\u0026minus;\u0026thinsp;3.0 mm, ML\u0026thinsp;\u0026minus;\u0026thinsp;1.05 mm, DV\u0026thinsp;\u0026minus;\u0026thinsp;4.7 mm. After surgery, mice were placed in a warmed recovery cage and continuously monitored until full consciousness. They were then returned to their home cages and observed daily for seven days for potential signs of infection or distress. Tramadol (5 mg/kg, \u003cem\u003es.c.\u003c/em\u003e) was administered once daily for two consecutive days to minimize postoperative discomfort. After the recovery period, mice were used for experimental procedures. All compounds and vehicles (sterile saline) were infused in a total volume of 1.0\u0026ndash;2.0 \u0026micro;l for 1 min post-infusion to prevent reflux.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003eMitochondria Isolation\u003c/h2\u003e \u003cp\u003eIntact mitochondria were isolated using the Mitochondria/Cytosol Fractionation Kit (Abcam, Cat. #ab65320). Following isolation, mitochondrial protein content was quantified using the Pierce\u0026trade; BCA Protein Assay Kit (Thermo Scientific, Cat. #23225) prior to all downstream applications, including stereotaxic injection. Mitochondrial integrity was validated by transmission electron microscopy. For \u003cem\u003ein vivo\u003c/em\u003e delivery, 20 \u0026micro;g of mitochondrial protein was resuspended in 2 \u0026micro;L sterile PBS and injected immediately after quantification, with mitochondria maintained on ice throughout the procedure. Control animals received an equivalent volume of vehicle.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003ePrimary Microglia Culture\u003c/h2\u003e \u003cp\u003ePrimary microglia were isolated from P1-P5 LysM-CrePhAM\u003csup\u003efloxed\u003c/sup\u003e neonates. Neonates\u0026rsquo; brains were mechanically dissociated in aseptic conditions and cultured in DMEM with 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin (PS) to generate mixed glial cultures. Microglial proliferation was enhanced using L929-conditioned medium at a 1:3 ratio of DMEM. Astrocyte-conditioned medium was collected and filtered for subsequent use. Culture medium was replaced every other day until a confluent astrocytic monolayer with microglia growing on top was established. Microglia were harvested by shaking cultures at 37\u0026deg;C and 180 rpm for 1 hour. The microglia-containing supernatant was passed through a 70 \u0026micro;m cell strainer and centrifuged at 1,000 rpm for 5 minutes. Cells were counted and replated in DMEM supplemented with astrocyte-conditioned medium at a 1:3 ratio. For stimulation experiments, primary microglia were treated with lipopolysaccharide (LPS, strain O111:B4; Sigma-Aldrich, Cat. #L4391) at 100 ng/mL for 24 hours; sodium palmitate (Sigma-Aldrich, Cat. #P9767) at 200 \u0026micro;M or, when not specified, at 400 \u0026micro;M for 6 hours; Mdivi-1 (Cayman Chemical Company, Cat. #15559) at 50 \u0026micro;M for 1 hour; M1 (Sigma-Aldrich, Cat. #SML0629) at 10 \u0026micro;M for 1 hour; GW4869 (Sigma-Aldrich, Cat. #D1692) at 40 \u0026micro;M and Y27632 (Cayman Chemical Company, Cat. #10005583) at 10 \u0026micro;M for 1 hour.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003eNeuronal Cell Culture\u003c/h2\u003e \u003cp\u003eClu189, POMC, and Neuro2a neuronal cell lines were obtained from the American Type Culture Collection (ATCC) and maintained in DMEM supplemented with 10% FBS and 1% PS in a humidified incubator at 37\u0026deg;C with 5% CO₂. Cells were allowed to undergo spontaneous differentiation, after which they were reseeded for experimental assays. Neuronal injury was induced by treatment with rotenone (Sigma-Aldrich, Cat. #R8875) at 300 ng/mL for 6 hours or 100 ng/mL for 12 hours, as indicated.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003eCo-Culture Experiments\u003c/h2\u003e \u003cp\u003eFollowing stimulation, microglial and neuronal cells were cocultured at a 1:1 ratio in the same well to allow direct cell\u0026ndash;cell contact for 24 hours. Cellular interactions and mitochondrial transfer were assessed either by time-lapse microscopy over a 24-hour period or by flow cytometry, enabling quantitative and dynamic analysis of microglia\u0026ndash;neuron communication. To assess neuronal mitochondrial uptake in the absence of direct mitochondrial transfer from microglia, coculture experiments were performed using transwell inserts with defined pore sizes. Primary Dendra2-expressing microglia were cocultured with Clu189 neurons using inserts with pore diameters of 0.2 \u0026micro;m or 3.0 \u0026micro;m, which respectively restrict or permit mitochondrial passage while preventing direct cell\u0026ndash;cell contact. Microglial cells were seeded onto the transwell inserts and maintained in DMEM, then stimulated according to the experimental protocol. In parallel, Clu189 neurons were treated with rotenone (200 nM) for 6 hours. Following stimulation and washing steps, transwell inserts were placed into wells containing neurons. After 24 hours of coculture, cells were harvested and processed for downstream analyses.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003eImmunofluorescence\u003c/h2\u003e \u003cp\u003eFor tissue immunofluorescence, mice were transcardially perfused with 20 mL of 1\u0026times; PBS followed by 20 mL of 4% paraformaldehyde (PFA). Brains were dissected, washed in PBS, cryoprotected overnight in 15% sucrose followed by 30% sucrose, embedded in OCT compound, and frozen on dry ice. Coronal or sagittal brain sections (20\u0026ndash;40 \u0026micro;m thick) were obtained using a cryostat (Leica CM1950). Sections were permeabilized and blocked for 1 hour at room temperature (RT) in PBS containing 5% bovine serum albumin (BSA) and 0.2% Triton X-100. For NeuN immunostaining, antigen retrieval was performed prior to blocking by incubating sections in citrate buffer (pH 6.0) at 60\u0026deg;C for 20 minutes. Primary antibodies (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e) were applied overnight at 4\u0026deg;C in PBS containing 0.2% Triton X-100 and 1% BSA. After washing, sections were incubated for 1 hour at RT with Alexa Fluor\u0026ndash;conjugated secondary antibodies and DAPI (1:1000) for nuclear counterstaining. Slides were then mounted and prepared for imaging. The same protocol was used for conventional in vitro immunofluorescence. For live-cell mitochondrial labelling, MitoTracker Deep Red was used according to the manufacturer\u0026rsquo;s instructions. Briefly, cells cultured on glass-bottom chamber slides (Cellvis) were washed with PBS after 24 hours of coculture and incubated with MitoTracker Deep Red (200 nM) for 40 minutes in Krebs medium at 37\u0026deg;C, protected from light and in the absence of CO₂. Cells were then washed with PBS and immediately imaged. For DiI and phalloidin labelling, neurons were stained prior to coculture with microglia or isolated mitochondria following the manufacturers\u0026rsquo; protocols. Briefly, cells were incubated with the respective dyes for 30 minutes at 37\u0026deg;C, washed three times with PBS, and subsequently subjected to coculture for 24 hours before analysis.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eList of Antibodies\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAntibody\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCompany\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCatalogue\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eConc.\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMouse Anti-MAP2 (Mt-01)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNovus Biologicals\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eNB500-415\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1:500\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePhalloidin-Ifluor 647 Reagent\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAbcam\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eab176759\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1:1000\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRabbit Anti-POMC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePhoenix Pharmaceuticals\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eH-029-30\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1:200\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMouse Anti-AgRP\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR\u0026amp;D Systems\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAF634\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1:1000\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMouse Anti-NeuN\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eChemicon\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eMAB377\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1:1000\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGFAP Monoclonal Antibody (2.2b10), Alexa Fluor\u0026trade; 647\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eInvitrogen\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e51-9792-82\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1:500\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRabbit Anti-Tyrosine Hydroxylase\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSigma-Aldrich\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAB152\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1:500\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eDAPI\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSigma-Aldrich\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eD9542\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1:1000\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMitotracker Deep Red FM\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eThermo Fisher Scientific\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eM22426\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e200nM\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMitotracker Red CMXRos\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eThermo Fisher Scientific\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eM7512\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e200nM\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eDil Stain\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eThermo Fisher Scientific\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eD282\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1:1000\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eDonkey Anti-Rabbit IgG Alexa Fluor 594\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eJackson ImmunoResearch\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e711-585-152\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1:1000\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eDonkey Anti-Rabbit IgG Alexa Fluor 647\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eBioLegend\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e406414\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1:500\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eDonkey Anti-Goat IgG (H\u0026thinsp;+\u0026thinsp;L) Alexa Fluor 647\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eJackson ImmunoResearch\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e705-605-003\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1:500\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eDonkey Anti Mouse IgG (H\u0026thinsp;+\u0026thinsp;L) Alexa Fluor 647\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eInvitrogen\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eA-31571\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1:500\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRabbit Anti-NDUFS1 [Epr11521(B)]\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAbcam\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eab169540\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1:1000\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRabbit Anti-UQCRC2 [Epr13051]\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAbcam\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eab203832\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1:1000\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRabbit Anti-TOMM20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eThermo Fisher Scientific\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003ePA5-52843\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1:1000\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRabbit Anti-Phospho-STAT3 (Tyr705)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCell Signaling Technology\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e9131S\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1:1000\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRabbit Anti-beta-Actin (13e5)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCell Signaling Technology\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e4970S\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1:1000\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePeroxidase (HRP) Anti-Rabbit IgG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCell Signaling Technology\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e7074S\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1:10.000\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePeroxidase (HRP) Anti-Mouse IgG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCell Signaling Technology\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e7074S\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1:10.000\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eZombie Violet\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eBioLegend\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e423114\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1:1000\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCD11b BB660\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eBioLegend\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e101228\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1:100\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMitosox\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eThermo Fisher Scientific\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eM36008\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e5\u0026micro;m\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec21\" class=\"Section2\"\u003e \u003ch2\u003eImage Acquisition\u003c/h2\u003e \u003cp\u003eAll microscopy experiments were performed at the Institute of Advanced Studies on Photonics Applied to Cell Biology (INFABiC), UNICAMP, S\u0026atilde;o Paulo, Brazil. High-resolution confocal images were acquired using a Zeiss LSM 880 confocal microscope equipped with an Airyscan super-resolution detector (Carl Zeiss AG, Germany). DAPI was excited using a 405 nm diode laser (5% power), while green, red, and far-red fluorophores were excited using 488 nm, 561 nm, and 633 nm lasers, respectively. Laser power and detector gain were adjusted according to staining conditions, and fluorescence signals were typically detected using photomultiplier tube (PMT) detectors. Images were acquired with a frame size of 1024 \u0026times; 1024 pixels, line step of 0.5 \u0026micro;m, scan speed of 4 to 8, bidirectional scanning, and either 8- or 16-bit depth. For tissue sections, z-stacks spanning 10\u0026ndash;20 \u0026micro;m were acquired in 8-bit mode. During automated Airyscan acquisitions, a zoom factor of 1.8 was applied, and the detector was positioned at the center of the Airyscan disk to ensure optimal signal quality. Airyscan super-resolution reconstruction was performed in ZEN software. For whole sagittal mouse brain sections, mosaic images were acquired using an inverted Zeiss Axio Observer.Z1 microscope equipped with a Yokogawa CSU-X1 spinning disk confocal unit, an iXon3 camera, and iQ3 software (Andor). Images were acquired in 16-bit mode using 488, 561, and 640 nm lasers with corresponding emission filters (525/30, 607/36, and 685/40 nm), a zoom factor of 1.0, and a 40\u0026times;/1.4 NA oil-immersion objective. Z-stacks were collected at 4 \u0026micro;m intervals with a resolution of 512 \u0026times; 512 pixels. Mosaic reconstruction was performed using the MosaicJ plugin in FIJI/ImageJ software.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec22\" class=\"Section2\"\u003e \u003ch2\u003eFluorescence Lifetime Imaging Microscopy\u003c/h2\u003e \u003cp\u003eFluorescence lifetime imaging microscopy (FLIM) based on two-photon excitation fluorescence (TPEF) was performed on Clu189 neurons using an inverted Zeiss LSM780 NLO Axio Observer confocal microscope (Carl Zeiss AG, Germany). The system was equipped with a time-correlated single-photon counting (TCSPC) module (Becker \u0026amp; Hickl) and a femtosecond pulsed laser (100 fs pulse duration, 80 MHz repetition rate; Chameleon Discovery Nx, Coherent Inc., USA). Cells were maintained at 37\u0026deg;C in a humidified atmosphere containing 5% CO₂ throughout acquisition to preserve physiological conditions. Endogenous NAD(P)H and FAD autofluorescence were simultaneously excited at 760 nm with a mean laser power of 10 mW at the objective back aperture and focused using an EC Plan-Neofluar 40\u0026times;/1.3 NA oil-immersion objective. Emission signals were detected by two single-photon counting PMTs (Becker \u0026amp; Hickl, SPC-830) after passing through 445/45 nm (NAD(P)H) and 535/22 nm (FAD) band-pass filters. A 690 nm short-pass filter was used to block excitation light at the detector entrance. Images were acquired with a field of view of 512 \u0026times; 512 pixels (212.55 \u0026times; 212.55 \u0026micro;m), and fluorescence decay curves were collected for 120 seconds per field. FLIM data were processed using SPCImage software (version 2.9; Becker \u0026amp; Hickl). A bi-exponential decay model was applied to fit fluorescence decay curves at each pixel, generating pseudocolor lifetime maps. Mean lifetime (τm), short (τ1) and long (τ2) lifetime components, and the relative amplitudes of free (a1) and protein-bound (a2) fluorophore fractions were extracted for downstream analysis.\u003c/p\u003e \u003cdiv id=\"Sec23\" class=\"Section3\"\u003e \u003ch2\u003eTime-Lapse Imaging\u003c/h2\u003e \u003cp\u003eTime-lapse imaging of primary microglia isolated from LysM-CrePhAM\u003csup\u003efloxed\u003c/sup\u003e mice and microglia\u0026ndash;neuron coculture systems was performed using a Zeiss LSM 880 confocal microscope equipped with an Airyscan detector. Cells were plated in four-well chamber slides with glass coverslips (500 \u0026micro;L completed DMEM/well) and maintained at 37\u0026deg;C in a humidified atmosphere with 5% CO₂ throughout imaging. Images were acquired using either a Plan-Apochromat 40\u0026times;/1.3 NA or a Plan-Neofluar 63\u0026times;/1.4 NA oil-immersion objective. For high-resolution visualization of mitochondrial morphology and subcellular structures, images were acquired with two-frame averaging, a z-step size of 0.5 \u0026micro;m, 16-bit depth, 1024 \u0026times; 1024-pixel resolution, a zoom factor of 1.8\u0026times;, and pinhole size set to 1 Airy unit (13.65 pixel/\u0026micro;m). For three-dimensional visualization of Dendra2-expressing cells, excitation was performed using a 488 nm laser (5% power), and z-stacks were acquired at 1 \u0026micro;m intervals (5\u0026ndash;10 optical sections per acquisition). Time-lapse series were acquired for up to 24 hours, with acquisition intervals optimized for each experiment; in most cases, images were captured every 300 seconds for a total of 40 frames. Neurons and microglia were identified using brightfield imaging or fluorescent markers, including MitoTracker Deep Red, phalloidin, or Dil. Airyscan processing was applied post-acquisition to enhance spatial resolution of Dendra2-positive mitochondria and cellular interactions.\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec24\" class=\"Section2\"\u003e \u003ch2\u003eImage Analysis\u003c/h2\u003e \u003cp\u003eAll image processing and quantitative analyses were performed using FIJI/ImageJ software (NIH). For three-dimensional analyses, image stacks were pre-processed to reduce noise and enhance signal quality. Preprocessing steps included application of a Gaussian blur filter, background subtraction using the \u0026ldquo;Subtract Background\u0026rdquo; function, and thresholding to generate binary masks. Thresholded images were analyzed using the Mitochondrial Analyzer plugin\u003csup\u003e\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e\u003c/sup\u003e (version 2.0.2) to quantify mitochondrial morphology parameters in microglia. Colocalization between fluorescent signals was assessed either by visual inspection of orthogonal views or by fluorescence intensity\u0026ndash;based colocalization analysis, as appropriate for each experiment. Quantification of TH⁺ neuronal cell bodies and Dendra2⁺ neurons within the VMH was performed manually using the Cell Counter plugin. TH⁺ neuronal fiber density was quantified by measuring integrated density (IntDen) of the TH immunoreactive signal. Neuronal survival was quantified by counting DAPI⁺ nuclei per well, which served as a proxy for total neuron number under the indicated experimental conditions. For three-dimensional representations, it was used Imaris software (Bitplane/Oxford Instruments).\u003c/p\u003e \u003cdiv id=\"Sec25\" class=\"Section3\"\u003e \u003ch2\u003eFlow Cytometry Analysis\u003c/h2\u003e \u003cp\u003eCells were stained with Zombie Violet viability dye and with anti-CD11b\u0026ndash;PerCP (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e) to identify microglial populations. Following surface staining, cells were fixed and permeabilized using Cytofix/Cytoperm solution (BD Biosciences, Cat. #554722) according to the manufacturer\u0026rsquo;s instructions. Neuronal populations were identified by intracellular staining with an anti-NeuN primary antibody diluted in Perm/Wash buffer, followed by incubation with an Alexa Fluor 647\u0026ndash;conjugated secondary antibody.\u003c/p\u003e \u003cp\u003eFlow cytometry was performed on a FACSymphony A5 SE cytometer (BD Biosciences) following the gating strategy: FSC/SSC \u0026rarr; singlets \u0026rarr; live cells \u0026rarr; CD11b⁻ \u0026rarr; NeuN⁺ neurons. A minimum of 10,000 events per sample was collected. Compensation was performed using BD compensation beads. Mitochondrial content and membrane potential were assessed using MitoTracker Deep Red (APC channel), while PhAM-derived mitochondrial fluorescence was detected in the FITC/BB515 channel. Data were analyzed using FlowJo software (BD Biosciences). For all analyses, fluorescence-minus-one (FMO) controls were included to define gating thresholds, and parameters were quantified as either mean fluorescence intensity (MFI) or percentage of positive cells, as indicated.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec26\" class=\"Section3\"\u003e \u003ch2\u003eAssessment of Neuronal ROS Production\u003c/h2\u003e \u003cp\u003eReactive oxygen species (ROS) production in Clu189 neuronal cells was evaluated using complementary Amplex Red\u0026ndash;based assays to measure total ROS and flow cytometry\u0026ndash;based detection of mitochondrial superoxide. For Amplex Red assays, Clu189 neurons were plated at varying densities (10,000\u0026ndash;100,000 cells per well) to assess the influence of cell number on ROS signal. Based on these preliminary analyses, a density of 25,000 cells per well was selected for all quantitative comparisons to minimize confluency- and density-dependent bias. Cells were stimulated with rotenone at the indicated concentrations and exposure times, including acute (10 or 30 minutes) and prolonged (6 or 24 hours) treatments. In selected conditions, neurons were cocultured with microglia or exposed to microglia-derived mitochondrial preparations. Amplex Red assays were performed according to the manufacturer\u0026rsquo;s instructions (Thermo Fisher Scientific, Cat. #A12222). Briefly, freshly prepared reagents, including superoxide dismutase (SOD; 1 U/mL), horseradish peroxidase (0.1 U/mL), and digitonin (5 \u0026micro;g/mL), were prepared in Krebs buffer, with pH verified prior to measurement. Cells were washed with PBS, after which 100 \u0026micro;L of Krebs buffer containing Amplex Red (50 \u0026micro;M), SOD, peroxidase, and digitonin was added to each well. Fluorescence was measured using a plate reader at 37\u0026deg;C with kinetic acquisition over 1 h 30 min at 10-minute intervals (excitation 540/35 nm; emission 600/40 nm). Fluorescence signals were normalized to nuclear staining (DAPI) to account for differences in cell numbers. For flow cytometric assessment of mitochondrial ROS, Clu189 neurons were stained with MitoSOX Red (5 \u0026micro;M) for 10 minutes at 37\u0026deg;C in serum-free DMEM, followed by washing with PBS prior to acquisition.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec27\" class=\"Section3\"\u003e \u003ch2\u003eSeahorse Metabolic Analysis\u003c/h2\u003e \u003cp\u003eClu189 neurons were plated at 15,000 cells per well and exposed to microglia-derived mitochondria for 24 hours. Real-time measurements of oxygen consumption rate (OCR) and extracellular acidification rate (ECAR) were measured using an XFe96 Extracellular Flux Analyzer (Agilent Seahorse Bioscience), according to the manufacturer\u0026rsquo;s instructions. Each condition was analyzed in three technical replicates. For each assay, three consecutive baseline measurements were obtained, followed by sequential injections of metabolic inhibitors or activators specific to each test. In the mitochondrial stress test, oligomycin (1 \u0026micro;M), FCCP (1 \u0026micro;M), and a combination of rotenone (100 nM) and antimycin A (1 \u0026micro;M) were injected sequentially (all reagents from Sigma-Aldrich). In the glycolytic stress test, glucose (25 mM), oligomycin (1.5 \u0026micro;M), and 2-deoxyglucose (2-DG; 50 mM) were sequentially added. Seahorse assay medium was supplemented with 10mM glucose, 1mM pyruvate, and 2mM glutamine. Metabolic parameters were calculated using Seahorse Wave software and normalized to total protein content per well to account for differences in cell number.\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec28\" class=\"Section2\"\u003e \u003ch2\u003eCRISPR-Cas9 experiments\u003c/h2\u003e \u003cp\u003eA second-generation lentiviral system was used for CRISPR\u0026ndash;Cas9\u0026ndash;mediated gene perturbation. Lentiviral particles were produced using the packaging plasmid psPAX2 and the envelope plasmid pMD2.G, together with the sgRNA expression vector LentiGuide-Puro. Single-guide RNA (sgRNA) sequences complementary to the target genes were cloned into the LentiGuide-Puro backbone according to standard protocols. For virus production, HEK293T packaging cells were plated at a density of 7 \u0026times; 10⁵ cells per well in six-well plates and incubated for 18\u0026ndash;24 hours. Cells were transfected with a mixture of the three lentiviral plasmids using polyethyleneimine (PEI). After 18\u0026ndash;24 hours, the medium was replaced with fresh culture medium. Viral supernatants were collected at 48, 72, and 96 hours post-transfection, centrifuged at 500 \u0026times; g for 5 minutes to remove cellular debris, and filtered through a 0.45-\u0026micro;m PES filter. Filtered viral supernatants were snap-frozen in liquid nitrogen and stored at \u0026minus;\u0026thinsp;80\u0026deg;C until use. For neuronal transduction, Clu189 neuronal cells expressing Cas9 were infected after 6 days in culture with lentiviral particles carrying sgRNAs targeting Gja1 (TCGCTGATCCACGATAGCTA), Itgb1 (GAAAATAGCAAATTGCCAGACGG), Exoc1 (GTCCGAGATAGAGTTCCTCGTGG), or Gm609 (sgRNA: AGGGTAAACGGAGATTCCAGGGG), with sgGFP used as a non-targeting control. Cells were incubated with lentivirus for 24 hours, after which viral media was replaced with fresh medium containing puromycin (1 \u0026micro;g/mL) for selection of sgRNA-expressing cells. Medium containing puromycin was refreshed as needed to maintain selection. For mitochondrial transfer assays, Clu189 Cas9 cells were expanded in complete DMEM without ciprofloxacin and plated at a density of 3.5 \u0026times; 10⁵ cells per well in six-well plates, in triplicate for each sgRNA condition. Cells were transduced with 200 \u0026micro;L of lentiviral particles per well and maintained for 48 hours. Viral media was removed, and antibiotic selection was initiated using blasticidin to maintain Cas9 expression and puromycin to select for sgRNA integration. Antibiotic concentrations were adjusted as needed to ensure effective selection. Knockout efficiency was assessed by quantitative PCR prior to coculture experiments. Neuronal uptake of microglia-derived mitochondria was subsequently evaluated by flow cytometry.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec29\" class=\"Section2\"\u003e \u003ch2\u003eTransmission Electron Microscopy\u003c/h2\u003e \u003cp\u003eMitochondria were isolated from microglia as previously described, centrifuged at 12,000 g during 30 min and then, fixed in 2.5% glutaraldehyde prepared in 0.1 M sodium cacodylate buffer containing 3 mM CaCl₂ for 5 minutes at RT, followed by incubation on ice for 2 hours. After fixation, samples were washed three times for 2 minutes each in 0.1 M sodium cacodylate buffer containing 3 mM CaCl₂ and post-fixed for 1 hour in 1% osmium tetroxide supplemented with 0.8% potassium ferrocyanide, diluted in 0.1 M sodium cacodylate buffer. Samples were then washed three times for 2 minutes each in Milli-Q water and stained en bloc overnight on ice with 2% uranyl acetate. Following staining, samples were washed three times for 2 minutes each in Milli-Q water and dehydrated through a graded ethanol series (30%, 50%, 70%, and 90% for 10 minutes each, followed by 100% ethanol three times for 10 minutes each). After dehydration, samples were incubated in a 1:1 mixture of EMbed 812 resin and 100% ethanol for 30 minutes, followed by infiltration in pure EMbed 812 resin for at least 1 hour per step (five changes). Samples were then polymerized at 60\u0026deg;C for 72 hours. Ultrathin sections (63 nm) were obtained using an ultramicrotome (Leica UCT) and sequentially stained with 2% uranyl acetate and Reynolds\u0026rsquo; lead citrate. Electron micrographs were acquired using a Tecnai G2 Spirit BioTWIN transmission electron microscope (FEI Company, Hillsboro, OR, USA) operated at an accelerating voltage of 80 kV.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eReverse Transcription Quantitative PCR\u003c/h3\u003e\n\u003cp\u003eTotal RNA was isolated from neuronal cells using TRI Reagent (Sigma-Aldrich, Cat. #T9424) according to the manufacturer\u0026rsquo;s instructions. RNA concentration and purity were assessed by spectrophotometry, and for cDNA synthesis, 2 \u0026micro;g of total RNA was reverse-transcribed using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems), following the manufacturer\u0026rsquo;s protocol. Quantitative real-time PCR was performed using the QuantiNova\u0026reg; SYBR\u0026reg; Green PCR Kit (Qiagen, Cat. #208056). Each reaction contained 60 ng of cDNA template and 200 nM of gene-specific forward and reverse primers (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). Amplification was carried out on a CFX384 Touch Real-Time PCR Detection System (Bio-Rad) under standard cycling conditions recommended by the manufacturer. All samples were run in technical triplicates, and no-template controls were included to assess potential contamination. Gene expression levels were quantified using CFX Manager Software v2.0 (Bio-Rad) and calculated using the 2^\u0026minus;ΔΔCt method. Expression values were normalized to mouse 18S rRNA as the reference gene and expressed relative to the appropriate experimental control group (unstimulated cells). For AgRP expression analysis, neurons were incubated for 24 hours with microglia-derived mitochondria in glucose-free DMEM. Cells were then washed with PBS and harvested for RNA isolation. For all other target genes, neurons were cultured in high-glucose DMEM prior to RNA extraction.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eList of Primers\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePrimers\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTnfα\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5'-AGATAGCAAATCGGCTGACG-3'\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e5'-ACGGCATGGATCTCAAAGAC-3'\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAgrp\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5'-CTTTGGCGGAGGTGCTAGAT-3'\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e5'-AGGACTCGTGCAGCCTTACAC-3'\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePomc\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5'-CGAGATTCTGCTACAGTCGCT-3'\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e5'-GACGTACTTCCGGGGGTTTT-3'\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eExoc1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5\u0026prime;-TGCCATCAAAGAGAGCCCTG-3\u0026prime;\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e5\u0026prime;-CCAGGTGCAGGAGATGAAGG-3\u0026prime;\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGja1 (cnx43)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5\u0026prime;-TCC​TTT​GAC​TTC​AGC​CTC​CA-3\u0026prime;\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e5\u0026prime;-CCA​TGT​CTG​GGC​ACC​TCT-3\u0026prime;\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGm609/isec1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5\u0026prime;-CTTTCAGTTCAGCTAGGAAACAC-3\u0026prime;\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e5\u0026prime;-CTTACCTTTTCTTTTGGAAATAAAT-3\u0026prime;\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eItgb1 1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5\u0026prime;- GTCGTGTGTGTGAGTGCAAC-3\u0026prime;\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e5\u0026prime;- GCTGGGGTAATTTGTCCCGA-3\u0026prime;\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eItgb1 2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5\"-GCAGGGCCAAATTGTGGGTGGT-3\"\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e5\"-GGCCGGAGCTTCTCTGCCAT-3\"\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cdiv id=\"Sec31\" class=\"Section2\"\u003e \u003ch2\u003eWestern Blot Analysis\u003c/h2\u003e \u003cp\u003eCells were lysed in RIPA buffer supplemented with protease and phosphatase inhibitor cocktails (Thermo Scientific, Cat. #78440 and #78420). Protein concentration was determined using the Pierce\u0026trade; BCA Protein Assay Kit (Thermo Scientific, Cat. #23225), according to the manufacturer\u0026rsquo;s instructions. For isolated mitochondria obtained from microglia or culture supernatants, samples were prepared using the mitochondrial extraction buffer provided in the cell fractionation kit (Abcam, Cat. #ab65320). Equal amounts of protein (20 \u0026micro;g per lane) were separated on 10% SDS\u0026ndash;PAGE gels and electrophoresed for approximately 2 hours, followed by transfer onto PVDF membranes (Immobilon-P, Millipore, Cat. #IPVH00010) for 1.5 hours. Membranes were blocked with 5% non-fat dry milk prepared in Tris-buffered saline containing 0.1% Tween-20 (TBS-T) for 1 hour at RT. Membranes were then washed three times with TBS-T and incubated overnight at 4\u0026deg;C with primary antibodies (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e) diluted in the blocking buffer. After washing, membranes were incubated for 1 hour at RT with horseradish peroxidase (HRP)\u0026ndash;conjugated secondary antibodies. Protein bands were visualized using the Pierce\u0026trade; Fast Western Blot Kit (Thermo Scientific, Cat. #35050) in combination with SuperSignal\u0026trade; West Femto Maximum Sensitivity Substrate (Thermo Scientific, Cat. #34095). Chemiluminescent signals were detected using a ChemiDoc\u0026trade; Imaging System (Bio-Rad). Band intensities were quantified using ImageJ software after normalization to β-actin.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec32\" class=\"Section2\"\u003e \u003ch2\u003eStatistical Analysis\u003c/h2\u003e \u003cp\u003eData are presented as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD or SEM, as indicated. All datasets were tested for normality using the Shapiro-Wilk test prior to parametric analysis, and outliers were identified and removed using the Grubbs\u0026rsquo; test (alpha\u0026thinsp;=\u0026thinsp;0.05). Comparisons between two groups were performed using unpaired two-tailed Student\u0026rsquo;s \u003cem\u003et\u003c/em\u003e tests, and comparisons among multiple groups were analyzed using one-way ANOVA with Bonferroni post hoc correction. Statistical analyses were conducted using GraphPad Prism version 6.0 (GraphPad Software). Statistical significance was defined as \u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05.\u003c/p\u003e \u003c/div\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eCompeting Interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors thank INFABIC (Imaging Facility of the University of Campinas) for technical assistance and access to microscopy infrastructure.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding Declaration\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by the São Paulo Research Foundation (FAPESP: grant no. 2020/16030-0, 2023/17089-6, 2022/04576-3, 2019/25973-8 and fellowship no. 2020/08744-2 and2022/05429-4); the Brazilian National Council for Scientific and Technological Development – CNPq (Grant number 434538/2018-3, 407429/2025-5); and the Coordenação de Aperfeiçoamento de Pessoal de Nível Superior – Brazil (CAPES) (Finance Code 001.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors Contribution\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eM.K.S.C.A. conceived the study, performed experiments, analyzed the data and wrote the original draft of the manuscript. L.F.L.S., G.C., W.S.S.G., R.D.R., G.A.S.N., A.T.P.C., W.L.G.C., M.B. and F.B.S.T. contributed to experimental investigations. C.B. managed resources, including laboratory organization and procurement. A.T.P.C. and M.O.B. assisted with image acquisition protocols. H.C. provided technical support for image acquisition at INFABIC. L.A.V. provided cell lines and contributed to scientific discussion of in vitro methodologies. P.M.M.M.V. conceived and supervised the study, reviewed and edited the manuscript, funding acquisition. All authors read and approved the final version of the manuscript.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eSarkar S, et al. Mitochondrial impairment in microglia amplifies NLRP3 inflammasome proinflammatory signaling in cell culture and animal models of Parkinson\u0026rsquo;s disease. npj Parkinson\u0026rsquo;s Disease. 2017;3:30.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi Y, Xia X, Wang Y, Zheng JC. Mitochondrial dysfunction in microglia: a novel perspective for pathogenesis of Alzheimer\u0026rsquo;s disease. J Neuroinflammation. 2022;19:248.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang Y et al. The role of mitochondrial dynamics in disease. \u003cem\u003eMedComm\u003c/em\u003e 4, e462 (2023).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eScheiblich H, et al. Microglia rescue neurons from aggregate-induced neuronal dysfunction and death through tunneling nanotubes. Neuron. 2024;112:3106\u0026ndash;e31258.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJoshi AU, et al. Fragmented mitochondria released from microglia trigger A1 astrocytic response and propagate inflammatory neurodegeneration. Nat Neurosci. 2019;22:1635\u0026ndash;48.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu D, et al. Intercellular mitochondrial transfer as a means of tissue revitalization. Signal Transduct Target Ther. 2021;6:65.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOrihuela R, McPherson CA, Harry GJ. Microglial M1/M2 polarization and metabolic states. Br J Pharmacol. 2016;173:649\u0026ndash;65.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhong G, et al. Autologous transplantation of mitochondria/rAAV IGF-I platforms in human osteoarthritic articular chondrocytes to treat osteoarthritis. Mol Ther. 2025;33:2900\u0026ndash;12.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePham AH, McCaffery JM, Chan DC. Mouse lines with photo-activatable mitochondria (PhAM) to study mitochondrial dynamics. Genesis. 2012;50:833\u0026ndash;43.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBelsham DD, et al. Ciliary neurotrophic factor recruitment of glucagon-like peptide-1 mediates neurogenesis, allowing immortalization of adult murine hypothalamic neurons. FASEB J. 2009;23:4256\u0026ndash;65.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi N, et al. Mitochondrial complex I inhibitor rotenone induces apoptosis through enhancing mitochondrial reactive oxygen species production. J Biol Chem. 2003;278:8516\u0026ndash;25.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXiong N, et al. Mitochondrial complex I inhibitor rotenone-induced toxicity and its potential mechanisms in Parkinson\u0026rsquo;s disease models. Crit Rev Toxicol. 2012;42:613\u0026ndash;32.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDash C, Saha T, Sengupta S, Jang HL. Inhibition of Tunneling Nanotubes between Cancer Cell and the Endothelium Alters the Metastatic Phenotype. Int J Mol Sci. 2021;22:6161.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003evan der Vlist M, et al. Macrophages transfer mitochondria to sensory neurons to resolve inflammatory pain. Neuron. 2022;110:613\u0026ndash;e6269.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWerner E, Werb Z. Integrins engage mitochondrial function for signal transduction by a mechanism dependent on Rho GTPases. J Cell Biol. 2002;158:357\u0026ndash;68.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNair S, et al. Lipopolysaccharide-induced alteration of mitochondrial morphology induces a metabolic shift in microglia modulating the inflammatory response in vitro and in vivo. Glia. 2019;67:1047\u0026ndash;61.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDu Y, Brennan FH, Popovich PG, Zhou M. Microglia maintain the normal structure and function of the hippocampal astrocyte network. Glia. 2022;70:1359\u0026ndash;79.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAbudara V, et al. Activated microglia impairs neuroglial interaction by opening Cx43 hemichannels in hippocampal astrocytes. Glia. 2015;63:795\u0026ndash;811.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYin X, et al. Roles of astrocytic connexin-43, hemichannels, and gap junctions in oxygen-glucose deprivation/reperfusion injury induced neuroinflammation and the possible regulatory mechanisms of salvianolic acid B and carbenoxolone. J Neuroinflammation. 2018;15:97.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBatsuuri K, Toychiev AH, Viswanathan S, Wohl SG, Srinivas M. Targeting Connexin 43 in Retinal Astrocytes Promotes Neuronal Survival in Glaucomatous Injury. Glia. 2025;73:1398\u0026ndash;419.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eIorio R, Petricca S, Di Emidio G, Falone S, Tatone C. Mitochondrial Extracellular Vesicles (mitoEVs): Emerging mediators of cell-to-cell communication in health, aging and age-related diseases. Ageing Res Rev. 2024;101:102522.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePaliwal S, Chaudhuri R, Agrawal A, Mohanty S. Regenerative abilities of mesenchymal stem cells through mitochondrial transfer. J Biomed Sci. 2018;25:31.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShanmughapriya S, Langford D, Natarajaseenivasan K. Inter and Intracellular mitochondrial trafficking in health and disease. Ageing Res Rev. 2020;62:101128.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZampieri LX, Silva-Almeida C, Rondeau JD, Sonveaux P. Mitochondrial Transfer in Cancer: A Comprehensive Review. Int J Mol Sci. 2021;22:3245.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi X, et al. Accumulation of Damaging Lipids in the Arf1-Ablated Neurons Promotes Neurodegeneration through Releasing mtDNA and Activating Inflammatory Pathways in Microglia. Adv Sci. 2025;12:2414260.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTodkar K, et al. Selective packaging of mitochondrial proteins into extracellular vesicles prevents the release of mitochondrial DAMPs. Nat Commun. 2021;12:1971.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eIkeda G, et al. Mitochondria-Rich Extracellular Vesicles From Autologous Stem Cell\u0026ndash;Derived Cardiomyocytes Restore Energetics of Ischemic Myocardium. JACC. 2021;77:1073\u0026ndash;88.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLu Y, et al. Protective role of mitophagy on microglia-mediated neuroinflammatory injury through mtDNA-STING signaling in manganese-induced parkinsonism. J Neuroinflammation. 2025;22:55.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhu J, et al. ATF5 Attenuates the Secretion of Pro-Inflammatory Cytokines in Activated Microglia. Int J Mol Sci. 2023;24:3322.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKim J-H, Lee Y, Suh GY, Lee Y-S. Mul1 suppresses Nlrp3 inflammasome activation through ubiquitination and degradation of Asc. bioRxiv. 2019;830380. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1101/830380\u003c/span\u003e\u003cspan address=\"10.1101/830380\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMoraes-Vieira PM, et al. Antigen Presentation and T-Cell Activation Are Critical for RBP4-Induced Insulin Resistance. Diabetes. 2016;65:1317\u0026ndash;27.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCannon JR, et al. A highly reproducible rotenone model of Parkinson\u0026rsquo;s disease. Neurobiol Dis. 2009;34:279\u0026ndash;90.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFleming SM, et al. Early and Progressive Sensorimotor Anomalies in Mice Overexpressing Wild-Type Human α-Synuclein. J Neurosci. 2004;24:9434\u0026ndash;40.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e\u003cem\u003ePaxinos and Franklin\u0026rsquo;s the Mouse Brain in Stereotaxic Coordinates\u003c/em\u003e. (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eManess LM, Kastin AJ, Farrell CL, Banks WA. Fate of leptin after intracerebroventricular injection into the mouse brain. Endocrinology. 1998;139:4556\u0026ndash;62.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChaudhry A, Shi R, Luciani DS. A pipeline for multidimensional confocal analysis of mitochondrial morphology, function, and dynamics in pancreatic β-cells. Am J Physiol Endocrinol Metab. 2020;318:E87\u0026ndash;101.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"journal-of-neuroinflammation","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"jneu","sideBox":"Learn more about [Journal of Neuroinflammation](http://jneuroinflammation.biomedcentral.com)","snPcode":"12974","submissionUrl":"https://submission.nature.com/new-submission/12974/3","title":"Journal of Neuroinflammation","twitterHandle":"@bmc","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Microglia, Mitochondria transfer, Oxidative Metabolism, Neuroprotection, Oxidative stress, Parkinson’s disease","lastPublishedDoi":"10.21203/rs.3.rs-9558181/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-9558181/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eIntercellular mitochondrial transfer is an emerging neuroprotective mechanism, yet the pathways governing microglial donation and the functional relevance of distinct extracellular mitochondrial forms remain unclear. Using microglia expressing fluorescently tagged mitochondria, we show that microglia release mitochondria upon direct contact with injured neurons, generating naked mitochondria and mitovesicles. Hypothalamic orexigenic neurons internalize these organelles, a process enhanced by mitochondrial stress. Transfer is contact-dependent, requires ROCK1/2 activity, is independent of exosome biogenesis, and is markedly reduced by neuronal Connexin 43 (Cx43) deficiency, identifying Cx43-enriched contact sites as hubs for mitochondrial acquisition. Functionally, transfer enhances neuronal survival after rotenone exposure and promotes oxidative respiration and nicotinamide nucleotide turnover. However, redox outcomes depend on donor state: mitochondria from na\u0026iuml;ve microglia reduce oxidative stress, whereas those from LPS-stimulated microglia exacerbate it. In vivo, microglial mitochondria are detected in hypothalamic and dopaminergic neurons, and exogenous delivery modulates feeding behavior and partially rescues rotenone-induced deficits in a Parkinsonian model.\u003c/p\u003e","manuscriptTitle":"Microglia-to-Neuron Mitochondrial Transfer Supports Neuronal Metabolism and Protects Against Neurodegeneration","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2026-05-13 06:44:04","doi":"10.21203/rs.3.rs-9558181/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"editorInvitedReview","content":"","date":"2026-05-18T17:41:12+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"55814680855612150298680875756869883107","date":"2026-05-07T10:53:30+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"145661259656173168734985927266922087145","date":"2026-05-05T18:45:55+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2026-05-05T09:53:26+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2026-05-04T05:25:40+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2026-05-04T03:13:12+00:00","index":"","fulltext":""},{"type":"submitted","content":"Journal of Neuroinflammation","date":"2026-04-28T20:37:09+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"journal-of-neuroinflammation","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"jneu","sideBox":"Learn more about [Journal of Neuroinflammation](http://jneuroinflammation.biomedcentral.com)","snPcode":"12974","submissionUrl":"https://submission.nature.com/new-submission/12974/3","title":"Journal of Neuroinflammation","twitterHandle":"@bmc","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"0a5d7373-3c31-4ae5-9c08-4d1cdacc16a0","owner":[],"postedDate":"May 13th, 2026","published":true,"recentEditorialEvents":[{"type":"editorInvitedReview","content":"","date":"2026-05-18T17:41:12+00:00","index":29,"fulltext":""},{"type":"reviewerAgreed","content":"55814680855612150298680875756869883107","date":"2026-05-07T10:53:30+00:00","index":26,"fulltext":""},{"type":"reviewerAgreed","content":"145661259656173168734985927266922087145","date":"2026-05-05T18:45:55+00:00","index":25,"fulltext":""},{"type":"reviewersInvited","content":"14","date":"2026-05-05T09:53:26+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2026-05-04T05:25:40+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2026-05-04T03:13:12+00:00","index":"","fulltext":""}],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[],"tags":[],"updatedAt":"2026-05-13T06:44:05+00:00","versionOfRecord":[],"versionCreatedAt":"2026-05-13 06:44:04","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-9558181","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-9558181","identity":"rs-9558181","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2026) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00
unpaywall
last seen: 2026-05-23T02:00:01.238055+00:00
License: CC-BY-4.0