First identification of Sarcocystis medusiformis in Chinese sheep (Ovis aries): Morphological and molecular characterization

preprint OA: closed CC-BY-4.0
📄 Open PDF Full text JSON View at publisher
Full text 102,080 characters · extracted from preprint-html · click to expand
First identification of Sarcocystis medusiformis in Chinese sheep (Ovis aries): Morphological and molecular characterization | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article First identification of Sarcocystis medusiformis in Chinese sheep (Ovis aries): Morphological and molecular characterization Danqu Lamu, Luyao Qian, Zhun Hu, Lu Xu, Shuangsheng Deng, Jianping Tao, and 2 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-8423378/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 18 Mar, 2026 Read the published version in Parasitology Research → Version 1 posted 9 You are reading this latest preprint version Abstract This study reports the first detection of Sarcocysits medusiformis in sheep ( Ovis aries ) in China through integrated morphological and molecular analysis. Macroscopically visible S. medusiformis sarcocysts were found in 4 of 92 examined sheep (4.3%), measuring 2490–4796 × 248–405 µm and exhibiting thin, striated walls (1–2 µm thick). Ultrastructural examination revealed trapezoidal villar protrusions covering the cysts, each lined with an electron-dense layer, with scattered microtubes extending from the apex to the base. Molecular characterization was performed by amplifying and sequencing four genetic markers (18S rRNA, 28S rRNA, ITS-1, and mitochondrial cox1 ). The newly obtained 18S rRNA, 28S rRNA and cox1 sequences exhibited 100% identify with previously published S . medusiformis sequences in GenBank. Phylogenetic analysis based on these sequences consistently grouped S. medusiformis , S. gigantea , and S. moulei within a distinct clade. To date, S. medusiformis sarcocysts have been documented primarily in sheep, with a single known case in an addax ( Addax nasomaculatus ). Further investigations involving expanded sampling of wild and domestic bovid ruminants are needed to clarify the epidemiology, host specificity, and phylogenetic relationships of S. medusiformis and morphologically similar species. Sarcocysits medusiformis Ovis aries Morphology Phylogeny China Figures Figure 1 Figure 2 Introduction Sarcocystis spp. are cyst-forming, intracellular protozoan parasites with an obligate two-host life cycle based on a prey-predator relationship. Sexual reproduction occurs in the intestinal epithelial cells of carnivorous definitive hosts, leading to the excretion of oocysts or sporocysts. In herbivorous intermediate hosts, asexual replication results in the formation of intramuscular sarcocysts (Dubey et al. 2016 ). Sheep ( Ovis aries ) are intermediate hosts for at least nine Sarcocystis species, including S. tenella (Moulé 1886 ), S. gigantea (Ashford 1977), S. medusiformis (Collins et al. 1979 ), S. arieticanis (Heydorn 1985 ), S. microps (Wang et al. 1988 ), S. cystiformis (Wang et al. 1989 ). S. mihoensis (Saito et al. 1997 ), S. gracilis -like (Giannetto et al. 2005 )d mihoensis -like (Gjerde et al. 2020 ), which are primarily differentiated by their sarcocyst wall ultrastructure. Notably, only S. gigantea and S. medusiformis develop macroscopically visible sarcocysts, informally categorized by their gross morphology as "fat" and "thin" cysts, respectively (Collins et al. 1979 ). Natural Sarcocystis infections in sheep can induce significant clinical pathology, including weight loss, abortion, myocarditis, encephalitis, and in severe cases, acute mortality (Railliet 1886 ; Dubey et al. 1989 ; Scott and Sargison 2001 ; Yaziroglu and Beyazit 2005 ). Moreover, the presence of macrocysts formed by S. gigantea and S. medusiformis , along with associated eosinophilic myositis, frequently leads to partial or complete carcass condemnation, incurring substantial economic losses in both lamb and adult sheep production (Collins 1980 ; Ezzi et al. 1992 ). Among the Sarcocystis species infecting sheep, S. tenella , S. arieticanis , and S. gigantea are globally distributed (Dubey et al. 2016 ; Feng et al. 2023 ). In contrast, reports of S. medusiformis have been more geographically restricted, with confirmations limited to New Zealand (Collins et al. 1979 ), Australia (O'Donoghue and Ford 1986 ; Obendorf and Munday 1987 ), Iran (Farhang-Pajuh et al. 2014 ), Iraq (Nawshirwan et al. 2023 ), Italy (Pipia et al. 2016 ), Egypt (El-Morsey et al. 2021 ), and Spain (Gjerde et al. 2020 ; Peris et al. 2024 ). This study reports the first detection of S. medusiformis in Chinese sheep, confirmed through comprehensive morphological analysis. To further characterize this isolate and clarify its phylogenetic position among ruminant-infecting Sarcocystis species, we performed molecular characterization by sequencing and analyzing four genetic markers: the 18S rRNA , 28S rRNA , and mitochondrial cox1 genes, and the ITS-1 region. Materials and methods Morphological observation of sarcocysts Muscle tissues were collected from 92 sheep between July and December 2024 at three abattoirs in southwestern China (two in Lhasa city and one in Kunming city). From each animal, fresh specimens of diaphragm, skeletal muscle, and cardiac tissue were obtained and examined for the presence of sarcocysts. In the laboratory, small sections of muscle were compressed between glass slides. Sarcocysts were initially detected using a stereomicroscopy (Leica MZ6). Individual sarcocysts were then meticulously isolated from muscle tissue under magnification using dissecting needles for subsequently light microscopy (LM), transmission electron microscopy (TEM), and DNA extraction. LM observation was performed using an Olympus BX51 microscope. For TEM examination, isolated sarcocysts were initially fixed in 2.5% glutaraldehyde dissolved in 0.1 M cacodylate buffer (pH 7.4) at 4°C, followed by post-fixed in 1.0% osmium tetroxide using the same buffer. Samples were then dehydrated through a graded ethanol series (30–100%) and embedded in Epon-Araldite resin. Ultrathin sections (70–90 nm) were double-stained with uranyl acetate (35 mg/ml) and lead citrate (35 mg/ml), and examined using a JEM100-CX TEM (JEOL Ltd., Tokyo, Japan) operating at 80 kV. DNA extraction and molecular characterization Individual cysts preserved in sterile distilled water at − 20°C were used for genetic DNA extraction. DNA was extracted from three sarcocysts (each from a different sheep) using the TIANamp Genomic DNA Kit (Tiangen Biotech Ltd., Beijing, China) according to the manufacturer’s instructions. Four genetic markers– 18S rRNA , 28S rRNA , ITS-1, and mitochondrial cox1– were amplified from each sarcocyst using the primers specified in Table 1 . PCR was performed in a 25-µL reaction mixture containing: 1X PCR buffer, 0.15 mM MgCl₂, 0.25 mM dNTPs, 1 U of Taq DNA polymerase (TaKaRa, Dalian, China), 50–100 ng of template DNA, and 25 pmol of each primer. Amplification was carried out in a Bio-Rad T100 thermal cycler with the following program: initial denaturation at 95°C for 5 min; 35 cycles of 94°C for 1 min, 53–57°C (primer-specific) for 1 min, and 72°C for 1 min; followed by a final extension at 72°C for 10 min. PCR products were purified using the E.Z.N.A.® Gel Extraction Kit (Omega Bio-Tek, Inc., USA), ligated into the pCE2 TA/Blunt-Zero vector (5 min TA/Blunt-Zero Cloning Kit, Vazyme Biotech Co., Ltd., Nanjing, China), and transformed into Trelief™ 5α Chemically Competent Cells (Tsingke Biotechnology Co., Ltd., Beijing, China). Positive clones were sequenced bidirectionally on an ABI PRISM™ 3730 XL DNA Analyzer (Applied Biosystems, USA). Table 1 Primers used for the amplification of the four DNA regions DNA region Primer name Primer sequences (5′–3′) References 18S rRNA ERIB1 a ACC TGG TTG ATC CTG CCA G Barta et al.1997 PrimerB b GATCCTTCTGCAGGTTCACCTAC Fenger et al. 1995 28S rRNA KL1 a TACCCGCTGAACTTAAGC Mugridge et al. 2000 KL3 b CCACCAAGATCTGCACTAG KL4 a AGCAGGACGGTGGTCATG- KL5 b CTCAAGCTCAACAGGGTC KL6 a GGATTGGCTCTGAGGG KL2 b ACTTAGAGGCGTTCAGTC ITS-1 SU1F a GATTGAGTGTTCCGGTGAATTATT Gjerde 2014a 5.8SR2 b AAGGTGCCATTTGCGTTCAGAA cox1 SF1 a ATGGCGTACAACAATCATAAAGAA Gjerde 2013 SR9 b ATATCCATACCRCCATTGCCCAT Gjerde 2013 b a forward primer; b reverse primer The obtained sequences were assembled using the SeqMan II program (DNASTAR, USA) based on multiple overlapping regions. Sequence identity and similarity analyses were performed using BioEdit software (Hall 1999 ). Initial characterization was conducted by comparing the sequences against the GenBank database using the online BLASTn tool (National Center for Biotechnology Information, NIH, USA). Phylogenetic analysis Phylogenetic analyses were conducted separately on the nucleotide sequences of the 18S rRNA , 28S rRNA , and mitochondrial cox1 using MEGA 11 software (Tamura et al. 2021 ). Reference sequences of Sarcocystis spp. for each gene were retrieved from GenBank. The 18S rRNA and 28S rRNA sequences were aligned using the “R-Coffee” web server, which integrates predicted secondary RNA structure to enhance alignment accuracy (Di Tommaso et al. 2011 ). The mitochondrial cox1 sequences were aligned using the MUSCLE algorithm embedded in the MEGA 11. All alignments were manually inspected and trimmed at both ends to guarantee uniform start and stop positions across all sequences. The final aligned datasets were as follows: the aligned 18S rRNA nucleotide sequences (24 sequences from 23 species) comprised 1944 positions, ranging from position 60 to 1853 of S. gigantea (MK420020); the aligned 28S rRNA nucleotide sequences (21 sequences from 20 species) consisted of 1831 positions, ranging from position 1 to 1641 of S. gigantea (U85706); and the aligned cox 1 nucleotide sequences (22 sequences from 20 species) consisted of 1020 positions, ranging from position 1 to 1020 of S. gigantea (MK420012) without any gaps. Maximum likelihood (ML) phylogenetic trees were constructed for the 18S rRNA , 28S rRNA , and mitochondrial cox 1 sequences using the Tamura 3-parameter, Hasegawa-Kishino-Yano, and Kimura 2-parameter models, respectively. These models were selected based on the lowest BIC (Bayesian Information Criterion) and AICc (Akaike information Criterion, corrected) values determined through ML analysis implemented in MEGA11. All positions containing gaps and missing data were removed using the complete deletion option. The final datasets consisted of 1560 positions for 18S rRNA , 1440 positions for 28S rRNA , and 1020 positions for mitochondrial cox1 . The reliability of the ML phylograms was assessed using the bootstrap method with 1000 replications. Toxoplasma gondii and Hammondia spp. were selected as outgroups to root the phylogenetic trees. Results Morphological characterization of S. medusiformis sarcocysts Macroscopically visible sarcocysts (Fig. 1 a) were detected in 4 out of 92 sheep (4.3%), exclusively localized in skeletal muscles and diaphragms, with no observed infection in cardiac tissue. Under LM, the sarcocysts measured 2490–4796 µm in length and 248–405 µm in width, exhibiting a thin (1–2 µm thick), striated cyst wall (Fig. 1 b). Internally, septa subdivided the sarcocyst into compartments densely packed with banana-shaped bradyzoites measuring 15.3–18.6 × 3.4–4.2 µm (Fig. 1 c). Ultrastructural analysis further revealed that the cyst wall was covered with trapezoidal villar protrusions (VPs), each lined by a distinct electron-dense layer (Fig. 1 d, e). These VPs measured 0.8–1.3 µm in length and contained scattered microtubes extending from the apex to the base, without penetrating the underlying ground substance layer (GSL) (Fig. 1 e). The GSL was 2.0–2.3 µm thick. Additionally, coiled serpentine filaments were observed originating both the surfaces of the VPs and the intervening areas between them. These ultrastructure characteristics correspond to the type 20 cyst wall as defined by Dubey et al. ( 2016 ), confirming the identification of the parasite as S. medusiformis . Molecular characteristics of S. medusiformis Sequencing of three S. medusiformis sarcocysts isolates from different sheep yielded complete sequences for 18S rRNA (1928 bp), 28S rRNA (3468 bp), ITS-1 (602 bp) and partial cox1 (1085 bp). All 18S and 28S rRNA sequences showed 100% identity among isolates, while ITS-1 and cox1 exhibited near-identity, with sequences similarities of 99.7–100% and 99.0-100%, respectively. Representative nucleotide sequences have been deposited in GenBank database under the following accession numbers: PV460240 ( 18S rRNA ), PV460246 ( 28S rRNA ), PV470857 and PV470858 (ITS-1), PV468778 and PV468779 ( cox1 ). Comparison with existing sequences in GenBank (Table 2 ) revealed that the newly obtained 18S rRNA , 28S rRNA , and cox1 sequences showed the highest similarity (up to 100% identity) to S. medusiformis . The next closest matches were S. gigantea from sheep and S. moulei from goats. In contrast, BLAST analysis of the newly generated ITS-1 sequences showed no significant similarity to any entries currently available in GenBank. Table 2 Similarities of nucleotide sequences between newly sequenced Sarcocystis medusiformis and those previously provided in GenBank DNA regions Similarity with those previously deposited in GenBank Sarcocystis sp. Accession numbers % Coverage % Similarity (on average) 18S rRNA S. medusiformis MK420021, MT705985 100 99.6–100 (99.8) S. gigantea MK420020, OP550293, MT705975, KC209733, L24384 96–100 95.8–96.7 (96.5) S. moulei L76473, OP430827, OP430830, OP430832, OP430834, OP430835 96 96.1–96.9 (96.5) 28S rRNA S. medusiformis MK420026, MT706454 100 99.6–100 (99.8) S. gigantea U85706 100 96.0 S. moulei AF012884, OP429586, OP430799–OP430803 99–100 95.5–95.7 (95.6) cox1 S. medusiformis MK420014, MK420015, MT722971, MT722972 95 99.0–100 (99.5) S. gigantea MK420011–MK420013, MT722969, MT722970, KC209601, MK120979 89–95 87.6–88.1 (88.0) Phylogenetic analysis Phylogenetic analysis based on 18S rRNA (Fig. 2 a), 28S rRNA (Fig. 2 a) and mitochondrial cox1 (Fig. 2 c) revealed revealed that the newly sequenced S. medusiformis isolates formed a well-supported clade with S. gigantea and S. moulei . These species infect sheep or goats, produce macroscopically visible cysts, and share felids as their definitive hosts. In the trees inferred from 18S rRNA and cox1 sequences, this S. medusiformis clade grouped with other macrocyst-forming, felid-definitive Sarcocystis species from large ruminants, including S. hirsute from cattle ( Bos taurus ) and S. buffalonis and S. fusiformis from water buffalo ( Bubalus bubalis ). In contrast, the topology of the 28S rRNA -based tree differed. Here, the S. medusiformis clade was placed within a larger group comprising Sarcocystis species that form microcysts and utilize canids as definitive hosts. This group included S. tenella and S. arieticanis in sheep, S. capracanis and S. hircicanis in goats, S. cruzi in cattle, and S. poephagicanis in yaks. Notably, the felid-associated, macrocyst-forming species from cattle and water buffalo ( S. hirsuta , S. buffalonis , S. fusiformis ) formed a basal group to this larger cluster in this particular phylogenetic reconstruction. Discussion Railliet ( 1886 ) first described large, ovoid sarcocysts in sheep esophagi, naming them Sarcocystis ( Balbiania ) gigantea . Later, Mehlhorn and Scholtyseck ( 1973 ) provided the ultrastructural description of these sarcocysts, characterized by a thick, double-layered wall with numerous "cauliflower-like" protrusions. Nearly a century after the initial description, Collins et al. ( 1979 ) identified a distinct macroscopic sarcocyst in sheep skeletal muscle, distinguished by a thin primary cyst wall (< 2 µm) bearing "snake-like" projections on both the villar and inter-villar surface. Based on these unique morphological traits, it was designated S. medusiformis . In the present study, all observed macroscopic sarcocysts exhibited thin, striated primary cyst walls consistent with the ultrastructure of S. medusiformis originally described in New Zealand sheep (Collins et al. 1979 ). According to the classification system of Dubey et al. ( 2016 ), the cyst wall conforms to type 20. Sarcocystis species in sheep exhibit a global distribution, with microcyst-forming species (utilizing canids as definitive hosts) being more prevalent than macrocyst-forming species (transmitted via felids) (Dubey et al. 2016 ; Feng et al. 2023 ). In China, both microcysts and macrocysts have been detected. Reported prevalence rates for microcysts range from 33.85% to 91.9% (Hu et al. 2017 ; Dong et al. 2018 ; Kang et al. 2024 ), while macrocysts have been reported at 29.1% (Sun et al. 2021 ). Previous morphological and molecular analyses in Chinese sheep have identified three species: S. tenella , S. arieticanis , and S. gigantea . Our team has previously characterized the microcyst-forming species in detail (Hu et al. 2017 ); the present study focused on the first identification of S. medusiformis in China. Among the 92 sheep examined, 4 (4.3%) harbored macroscopic cysts of S. medusiformis , marking the first record of this parasite in the country. This prevalence is lower than rates reported in Egypt (5.7%) (El-Morsey et al. 2021 ), Iran (7.52%) (Farhang-Pajuh et al. 2014 ), and Italy (12.3%) (Pipia et al. 2016 ), but higher than that in Australia (3.1%) (Obendorf and Munday 1987 ). Experimental transmission studies confirm that the domestic cat ( Felis catus ) is the definitive host for S. medusiformis (Collins 1979; Obendorf and Munday 1987 ). However, the parasite exhibits relatively low infectivity in cats. Notably, no oocyst or sporocyst shedding was detected in cats fed cystozoites from experimentally infected lambs at 260, 300, and 487 days post-infection (Obendorf and Munday 1987 ). This reduced infectivity may contribute to the overall low prevalence of S. medusiformis in sheep observed in the current study and in previous reports. Molecular analysis provides a more sensitive and reliable approach for identifying Sarcocystis species than traditional morphology, particularly given the developmental changes sarcocysts undergo and the existence of morphologically similar cysts in closely related intermediate hosts (Gjerde 2013 ; Dubey et al. 2016 ). In this study, we successfully sequenced and submitted 18S rRNA , 28S rRNA , cox1 , and ITS-1 sequences of S. medusiformis to GenBank. Notably, the ITS-1 sequences represent the first entry of this genetic marker for the species. BLASTn analysis confirmed up to 100% identity between our sequences and existing S. medusiformis references at the 18S rRNA , 28S rRNA , and cox1 loci, providing robust molecular support for our morphological identification. Phylogenetic analysis consistently placed S. medusiformis within a well-supported clade that includes S. gigantea and S. moulei ; however, S. gigantea and S. moulei were more closely related to each other than to S. medusiformis . This phylogenetic pattern reflects the morphological parallels often observed among Sarcocystis species infecting related ruminant hosts. For instance, in sheep, S. tenella , S. arieticanis , and S. gigantea have their morphological counterparts in goats: S. capracanis , S. hircicanis , and S. moulei , respectively (Dubey et al. 2016 ). Interestingly, while this host-associated pattern is common, sarcocysts morphologically similar to S. medusiformis have not been documented in goats. The sole exception is an unusual finding of similar sarcocysts in an addax ( Addax nasomaculatus ) in a European zoo (Stolte et al. 1996 ). Conclusion To date, reports on S. medusiformis infections in sheep remain extremely limited, both in case number and geographic distribution. This study provides the first documented evidence of natural S. medusiformis infection in Chinese sheep, significantly expanding the known geographic range of this parasite. Remarkably, sarcocysts morphologically similar to S. medusiformis have been identified only once in a wild bovid species, the addax. The scarcity of available data highlights the need for more extensive sampling of wild and domestic bovid ruminants. Focusing on S. medusiformis and morphologically similar species will enable a deeper understanding of their prevalence, distribution, host specificity, and interspecies relationships within this host group. Declarations Author contributions DL: Resources, investigation and data collec­tion. LQ, ZH, LX and SD: Resources, investigation and formal analysis. JT and YY: Data curation, review, and editing. JH: Conceptualization, editing, correction, supervision. Funding This work was supported by the National Natural Science Foundation of China [No. 32260119], the Research Project of Tibet Autonomous Region [No. XZ202301ZY0006N], and the Henan Province modern agricultural industrial technology system [mutton sheep: No. HARS-22-15-G1]. Data availability All data generated or analyzed during this study are included in this published article. The molecular sequence data are already available in GenBank under accession numbers PV460240, PV460246, PV470857, PV470858, and PV468778, PV468779. Ethics The animal study protocol was approved by the Animal Ethics Committee of Yunnan University (permission number YNU20230466, received date: 3 March 2023). Conflicts of interest The authors declare no competing interests. References Ashford RW (1997). The fox, Vulpes vulpes , as a final host for Sarcocystis of sheep. Ann Trop Med Parasitol 71: 29–34. https://doi.org/10.1080/00034983.1977.11687158 Barta JR, Martin DS, Liberator PA, Dashkevicz M et al (1997) Phylogenetic relationships among eight Eimeria species infecting domestic fowl inferred using complete small subunit ribosomal DNA sequences. J Parasitol 83(2): 262–271. Collins GH, Atkinson E, Charleston WA (1979) Studies on Sarcocystis species III: The macrocystic species of sheep. N Z Vet J27(10): 204–206. https://doi.org/10.1080/00480169.1979.34651 Collins GH (1980) Sarcocystis and the meat industry. Monograph Massey University, New Zealand, pp. 1–15 Di Tommaso P, Moretti S, Xenarios I et al (2011) T-Coffee: A web server for the multiple sequence alignment of protein and RNA sequences using structural information and homology extension. Nucleic Acids Res 39(Web Server issue): W13–W17. https://doi.org/10.1093/nar/gkr245 Dong H, Su R, Wang Y et al (2018) Sarcocystis species in wild and domestic sheep ( Ovis ammon and Ovis aries ) from China. BMC Vet Res14(1): 377. https://doi.org/10.1186/s12917-018-1712-9 Dubey JP, Speer CA, Munday BL et al (1989) Ovine sporozoan encephalomyelitis linked to Sarcocystis infection. Vet Parasitol 34: 159–163 https://doi.org/10.1016/0304-4017(89)90178-7. Dubey JP, Calero-Bernal R, Rosenthal BM et al (2016) Sarcocystosis of animals and humans, 2nd ed. CRC Press, Boca Raton, FL, USA. El-Morsey A, Abdo W, Zaid AAA et al. (2021) Morphologic and molecular identification of three macroscopic Sarcocystis species infecting domestic sheep ( Ovis aries ) and cattle ( Bos taurus ) in Egypt. Parasitol Res 120(2): 637–654. https://doi.org/10.1007/s00436-020-07002-w Ezzi A, Gholami MR, Ahourai P (1992) Eosinophilic myositis associated with Sarcocystis in sheep. Arch Inst RAZI42/43: 65–68 Farhang-Pajuh F, Yakhchali M, Mardani K (2014) Molecular determination of abundance of infection with Sarcocystis species in slaughtered sheep of Urmia, Iran. Vet Res Forum 5(3):181–186. Feng Y, Guo R, Sang X et al (2023) A systematic meta-analysis of global Sarcocystis infection in sheep and goats. Pathogens 12(7): 902. https://doi.org/10.3390/ pathogens12070902. Fenger CK, Granstrom DE, Langemeier JL et al (1995) Identification of opossums ( Didelphis virginiana ) as the putative definitive host of Sarcocystis neurona . J Parasitol 81(6): 916–919 Giannetto S, Poglayen G, Brianti E et al (2005) Sarcocystis gracilis -like sarcocysts in a sheep. Vet Rec 156(10): 322–323. https://doi.org/ 10.1136/vr.156.10.322 Gjerde B (2013) Phylogenetic relationships among Sarcocystis species in cervids, cattle and sheep inferred from the mitochondrial cytochrome c oxidase subunit I gene. Int J Parasitol 43,579–591. https://doi.org/10.1016/j.ijpara.2013.02.004 Gjerde B (2014a) Molecular characterisation of Sarcocystis rileyi from a common eider ( Somateria mollissima ) in Norway. Parasitol Res 113: 3501–3509. https://doi.org/10.1007/s00436-014-4062-y Gjerde B (2014b) Sarcocystis species in red deer revisited: with a re-description of two known species as Sarcocystis elongata n. sp. and Sarcocystis truncata n. Sp. based on mitochondrial cox1 sequences. Parasitology 141: 441–452. https://doi.org/10.1017/S0031182013001819 Gjerde B, de la Fuente C, Alunda JM et al (2020) Molecular characterisation of five Sarcocystis species in domestic sheep ( Ovis aries ) from Spain. Parasitol Res 119: 215–231. https://doi.org/10.1007/s00436-019-06504-6 Hall TA, 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucl Acids Symp Ser 41: 95–98 Heydorn AO (1985) The development of Sarcocystis arieticanis n. sp Berl Münch Tierärztl Wochenschr 98(7): 231–241 Hu JJ, Huang S, Wen T et al (2017) Sarcocystis spp. in domestic sheep in Kunming City, China: Prevalence, morphology, and molecular characteristics. Parasite 24: 30. https://doi.org/10.1051/parasite/2017025 Kang Y, Lu XS, He YH, Wang C et al (2024) First molecular identification and prevalence of Sarcocystis spp. in sheep intended for human consumption in Shanxi province, China. Vet Sci 11(10): 504. https://doi.org/10.3390/vetsci11100504 Mehlhorn H, Scholtyseck E (1973) The fine structure of the cyst stages of Sarcocystis tenella . Z Parasitenkd 41(4): 291–310 Moulé ML (1886). Sur la psorospermose des bovides. Bull Soc Cent Méd Vét (Parsis) 40 (n. s. 4): 694–696 Mugridge NB, Morrison DA, Jäkel T et al (2000) Effects of sequence alignment and structural domains of ribosomal DNA on phylogeny reconstruction for the protozoan family Sarcocystidae . Mol Biol Evol 17(12): 1842–1853. https://doi.org/10.1093/oxfordjournals.molbev.a026285 Nawshirwan S, Heucken N, Piekarek N et al (2023) Morphological, ultrastructural, genetic characteristics and remarkably low prevalence of macroscopic Sarcocystis species isolated from sheep and goats in Kurdistan region, Iraq. Front Vet Sci 10: 1225796. https://doi.org/10.3389/fvets.2023.1225796 Obendorf DL, Munday BL (1987) Experimental infection with Sarcocystis medusiformis in sheep. Vet Parasitol 24(1-2): 59–65. https://doi.org/10.1016/0304-4017(87)90130-0 O'Donoghue PJ, Ford GE (1986) The prevalence and intensity of Sarcocystis spp. infections in sheep. Aust Vet J 63(9): 273–278. https://doi.org/10.1111/j.1751-0813.1986.tb08065.x Peris MP, Gracia MJ, Moreno B et al (2024) Identification of Sarcocystis spp. in slaughtered sheep from Spain and evaluation of bradyzoite viability after freezing. Vet Sci 11(3): 103. https://doi.org/10.3390/vetsci11030103 Pipia AP, Varcasia A, Zidda A et al (2016) Cross-sectional investigation on sheep sarcosporidiosis in Sardinia, Italy. Vet Parasitol Reg Stud Reports 3-4: 13–17. https://doi.org/10.1016/j.vprsr.2016.05.004 Railliet A (1886). Psorospermies geanles dans L'oesophage et les muscles du mouton. Bull Acad Vét Fr 40: 130–134 Saito M, Shibata Y, Kubo M et al (1997) Sarcocystis mihoensis n. sp. from sheep in Japan. J Vet Med Sci 59(2):103–106. https://doi.org/10.1292/jvms.59.103 Scott PR, Sargison ND (2001) Extensive ascites associated with vegetative endocarditis and Sarcocystis myositis in a shearling ram. Vet Rec 149(8): 240–241. https://doi.org/10.1136/vr.149.8.240 Stolte M, Odening K, Bockhardt I (1996) Antelopes (Bovidae) kept in European zoological gardens as intermediate hosts of Sarcocystis species. Parassitologia,38(3): 565–570 Sun Y, Ju J, Su X et al (2021) Infection survey and morphological characteristics of Sarcocystis spp. in naturally infected Tibetan sheep from Qinghai in northwestern China. Parasitol Int 80: 102219. https://doi.org/10.1016/j.parint.2020.102219 Tamura K, Stecher G, Kumar S (2021) MEGA11: Molecular evolutionary genetics analysis version 11. Mol Biol Evol 38(7): 3022–3027. https://doi.org/10.1093/molbev/msab120. Wang G, Wei T, Wang X et al (1988) Morphology and life cycle of S arcocystis microps n. sp. in sheep of Qinghai in China. China Vet Technol 6: 9–11 (In Chinese) Wang G, Wei T, Wang Xet al (1989) Morphological characterization and life cycle of Sarcocystis cystiformis n. sp. in sheep. Xinjiang Agric Sci. 1: 37–40 (In Chinese) Yaziroglu O, Beyazit A. 2005. Encephalomyelitis associated with a Sarcocystis -like protozoan in a ten-month-old ewe lamb. Turk J Vet Anim Sci 29: 1209–1212 Additional Declarations No competing interests reported. Cite Share Download PDF Status: Published Journal Publication published 18 Mar, 2026 Read the published version in Parasitology Research → Version 1 posted Editorial decision: Revision requested 08 Feb, 2026 Reviews received at journal 08 Feb, 2026 Reviewers agreed at journal 06 Feb, 2026 Reviews received at journal 26 Jan, 2026 Reviewers agreed at journal 06 Jan, 2026 Reviewers invited by journal 05 Jan, 2026 Editor assigned by journal 29 Dec, 2025 Submission checks completed at journal 29 Dec, 2025 First submitted to journal 22 Dec, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-8423378","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":570344516,"identity":"68a40560-a678-4651-abff-c3f61018b4f3","order_by":0,"name":"Danqu Lamu","email":"","orcid":"","institution":"Tibet Academy of Agricultural and Animal Husbandry Sciences","correspondingAuthor":false,"prefix":"","firstName":"Danqu","middleName":"","lastName":"Lamu","suffix":""},{"id":570344517,"identity":"83ec3b6e-5c69-4700-8f7a-1fad2ac455a4","order_by":1,"name":"Luyao Qian","email":"","orcid":"","institution":"Yunnan University","correspondingAuthor":false,"prefix":"","firstName":"Luyao","middleName":"","lastName":"Qian","suffix":""},{"id":570344518,"identity":"ec740c4d-b336-415b-9db0-e80114448c6f","order_by":2,"name":"Zhun Hu","email":"","orcid":"","institution":"Yunnan University","correspondingAuthor":false,"prefix":"","firstName":"Zhun","middleName":"","lastName":"Hu","suffix":""},{"id":570344519,"identity":"4c043601-b2c6-4f83-9e0b-27f6a809ad26","order_by":3,"name":"Lu Xu","email":"","orcid":"","institution":"Yunnan University","correspondingAuthor":false,"prefix":"","firstName":"Lu","middleName":"","lastName":"Xu","suffix":""},{"id":570344520,"identity":"743ef678-8368-4c99-9914-5feb0bf851aa","order_by":4,"name":"Shuangsheng Deng","email":"","orcid":"","institution":"Yunnan University","correspondingAuthor":false,"prefix":"","firstName":"Shuangsheng","middleName":"","lastName":"Deng","suffix":""},{"id":570344521,"identity":"0c4090e8-c720-4a10-ad61-ea18b082c3b3","order_by":5,"name":"Jianping Tao","email":"","orcid":"","institution":"Yangzhou University","correspondingAuthor":false,"prefix":"","firstName":"Jianping","middleName":"","lastName":"Tao","suffix":""},{"id":570344522,"identity":"5a06a9d2-2296-47ac-bbf5-5802a76940e9","order_by":6,"name":"Yurong Yang","email":"","orcid":"","institution":"Henan Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Yurong","middleName":"","lastName":"Yang","suffix":""},{"id":570344523,"identity":"19353482-c2f0-4569-8d53-63f44a2f0d8f","order_by":7,"name":"Junjie Hu","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAr0lEQVRIiWNgGAWjYBACxoYzDAwfIGwD4rUwziBJCwMDDwMzD0lamBvPHpO2bbuT2MDevE2CoeYOMQ47lyad2/YssYHnWJkEw7FnxGg5YwbUcjixQSLHTIKx4TCRWixBWuTfkKKFEWwLD/FajC17zh02buNJK7ZIOEaEFsMZZwxv/Cg7LNvPfnjjjQ81RGk5ALSKjYGBDcRLIKyBgUGevwFI/iFG6SgYBaNgFIxYAAAm6DthKpyu/gAAAABJRU5ErkJggg==","orcid":"","institution":"Yunnan University","correspondingAuthor":true,"prefix":"","firstName":"Junjie","middleName":"","lastName":"Hu","suffix":""}],"badges":[],"createdAt":"2025-12-22 09:38:25","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-8423378/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-8423378/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1007/s00436-026-08663-9","type":"published","date":"2026-03-18T15:58:26+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":99814812,"identity":"e48b5d6e-b477-4aad-8ba1-9ba7d3ee061c","added_by":"auto","created_at":"2026-01-08 14:42:55","extension":"tif","order_by":0,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":9408316,"visible":true,"origin":"","legend":"","description":"","filename":"Figure2.tif","url":"https://assets-eu.researchsquare.com/files/rs-8423378/v1/8265d8a0a3de51f8391289f1.tif"},{"id":99815010,"identity":"3e710af0-76e9-4ef0-88cc-9642bfb99b07","added_by":"auto","created_at":"2026-01-08 14:43:19","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":629374,"visible":true,"origin":"","legend":"","description":"","filename":"forPR.docx","url":"https://assets-eu.researchsquare.com/files/rs-8423378/v1/cc7e26948c54c42b4d27f2db.docx"},{"id":99814998,"identity":"60486907-c329-47c9-b896-5f54bdc870c2","added_by":"auto","created_at":"2026-01-08 14:43:18","extension":"tif","order_by":2,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":7753028,"visible":true,"origin":"","legend":"","description":"","filename":"figuer1.tif","url":"https://assets-eu.researchsquare.com/files/rs-8423378/v1/5a698e77f23af39b788b7322.tif"},{"id":99814882,"identity":"bcb2f3a4-b427-4616-be3a-287782f0597c","added_by":"auto","created_at":"2026-01-08 14:43:03","extension":"docx","order_by":3,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":15082,"visible":true,"origin":"","legend":"","description":"","filename":"Table1.docx","url":"https://assets-eu.researchsquare.com/files/rs-8423378/v1/694686eac9694200813eb446.docx"},{"id":99815026,"identity":"0053bc22-a2f8-4625-8e5a-5a23a255b4a7","added_by":"auto","created_at":"2026-01-08 14:43:21","extension":"docx","order_by":4,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":14509,"visible":true,"origin":"","legend":"","description":"","filename":"Table2.docx","url":"https://assets-eu.researchsquare.com/files/rs-8423378/v1/80cafca932e0f2ed796f608d.docx"},{"id":99814719,"identity":"4ac28561-bfa1-4522-89cd-afc51227d19c","added_by":"auto","created_at":"2026-01-08 14:42:39","extension":"json","order_by":5,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":8641,"visible":true,"origin":"","legend":"","description":"","filename":"e41c4be9705144efbfd59d575ca63419.json","url":"https://assets-eu.researchsquare.com/files/rs-8423378/v1/63b3ce9a84443eec6a1cba8c.json"},{"id":99814974,"identity":"d53866cc-b195-4384-9ec0-8fef18bc609c","added_by":"auto","created_at":"2026-01-08 14:43:14","extension":"xml","order_by":6,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":108674,"visible":true,"origin":"","legend":"","description":"","filename":"e41c4be9705144efbfd59d575ca634191enriched.xml","url":"https://assets-eu.researchsquare.com/files/rs-8423378/v1/ad19d603ec8a8ff6e62a6d24.xml"},{"id":99814811,"identity":"dc1a5ce0-716f-4477-b516-3e9ec657b03f","added_by":"auto","created_at":"2026-01-08 14:42:55","extension":"tif","order_by":7,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":9408316,"visible":true,"origin":"","legend":"","description":"","filename":"Figure2.tif","url":"https://assets-eu.researchsquare.com/files/rs-8423378/v1/b8d0957de297126aa3f7cb8c.tif"},{"id":99814797,"identity":"f895c460-ea98-45d5-93ab-27d77939a732","added_by":"auto","created_at":"2026-01-08 14:42:51","extension":"tif","order_by":8,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":7753028,"visible":true,"origin":"","legend":"","description":"","filename":"figuer1.tif","url":"https://assets-eu.researchsquare.com/files/rs-8423378/v1/4865d852247c3f438c129ab0.tif"},{"id":99815209,"identity":"1486747d-5ecb-45c5-9aab-fcd3f364ccbb","added_by":"auto","created_at":"2026-01-08 14:43:36","extension":"jpeg","order_by":9,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":424033,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage1.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8423378/v1/ca9e4ca34b03f35f38fd7e9b.jpeg"},{"id":99815213,"identity":"6dc8fde9-3e81-4436-8f80-fbcd019e2c77","added_by":"auto","created_at":"2026-01-08 14:43:36","extension":"jpeg","order_by":10,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":168558,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage2.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8423378/v1/c70839d6faa8800fa9f20026.jpeg"},{"id":99814749,"identity":"0facf2a9-0aa7-4b4f-b1ba-abd5ec24be74","added_by":"auto","created_at":"2026-01-08 14:42:42","extension":"png","order_by":11,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":145408,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFigure2.png","url":"https://assets-eu.researchsquare.com/files/rs-8423378/v1/c4700f1cc074df7546f83c29.png"},{"id":99814617,"identity":"a6f44808-92d8-4324-b474-f262d8b21a5c","added_by":"auto","created_at":"2026-01-08 14:42:20","extension":"png","order_by":12,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":340414,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefiguer1.png","url":"https://assets-eu.researchsquare.com/files/rs-8423378/v1/00ae3263dfbf6ccadc5c132a.png"},{"id":99814681,"identity":"d697fa49-1a38-451c-8378-049294e29431","added_by":"auto","created_at":"2026-01-08 14:42:34","extension":"png","order_by":13,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":236038,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-8423378/v1/57e4e9e8dd3e6301567d35b7.png"},{"id":99814973,"identity":"e28f73fa-4307-4acf-8081-da63094471c0","added_by":"auto","created_at":"2026-01-08 14:43:13","extension":"png","order_by":14,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":41619,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-8423378/v1/ac0cedbd62e690be13608524.png"},{"id":99814764,"identity":"93fcd7a2-4935-4c77-b330-c12b44b48b98","added_by":"auto","created_at":"2026-01-08 14:42:46","extension":"xml","order_by":15,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":107082,"visible":true,"origin":"","legend":"","description":"","filename":"e41c4be9705144efbfd59d575ca634191structuring.xml","url":"https://assets-eu.researchsquare.com/files/rs-8423378/v1/4cb3e470d39fb234aeef08e6.xml"},{"id":99814769,"identity":"7a12a385-43a3-409c-a69f-f64f2369c9ec","added_by":"auto","created_at":"2026-01-08 14:42:46","extension":"html","order_by":16,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":121621,"visible":true,"origin":"","legend":"","description":"","filename":"earlyproof.html","url":"https://assets-eu.researchsquare.com/files/rs-8423378/v1/021b5463472a94008ce11705.html"},{"id":99814716,"identity":"3542c846-aad1-416c-8517-d01d08cd6942","added_by":"auto","created_at":"2026-01-08 14:42:38","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":4210475,"visible":true,"origin":"","legend":"\u003cp\u003eMorphological characteristics of\u003cem\u003e S.\u003c/em\u003e \u003cem\u003emedusiformis\u003c/em\u003esarcocysts in sheep under stereomicroscopy (a), light microscopy (LM, b and c) and transmission electron microscope (TEM, d and e). \u003cem\u003e\u003cstrong\u003ea, \u003c/strong\u003e\u003c/em\u003eMacroscopically visible sarcocyst (S) in fresh muscle tissue. \u003cem\u003e\u003cstrong\u003eb\u003c/strong\u003e\u003c/em\u003e, A detached sarcocyst separated from a myocyte. Note the thin, striated cyst wall (SCW, unstained). \u003cem\u003e\u003cstrong\u003ec,\u003c/strong\u003e\u003c/em\u003e Banana-shaped bradyzoites spilled from a sarcocyst. \u003cem\u003e\u003cstrong\u003ed,\u003c/strong\u003e\u003c/em\u003e Longitudinal section of a sarcocyst. Note trapezoidal villar protrusions (VP) on the cyst wall surface, the ground substance layer (GSL) beneath the cyst wall, and the densely packed bradyzoites (BZ) within the sarcocyst. \u003cem\u003e\u003cstrong\u003ee,\u003c/strong\u003e\u003c/em\u003e Diagonal section of a sarcocyst. Note the surrounding host cell (HC), scattered microtubes (MT) within the VP, serpentine filaments (F) on the VP surface, and the GSL.\u003c/p\u003e","description":"","filename":"figuer1.png","url":"https://assets-eu.researchsquare.com/files/rs-8423378/v1/44d24fb59b675768b43ab48e.png"},{"id":99814883,"identity":"3980eaee-3af0-4824-b4ae-c1f1580417a9","added_by":"auto","created_at":"2026-01-08 14:43:04","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":1140554,"visible":true,"origin":"","legend":"\u003cp\u003ePhylogenetic trees based on \u003cem\u003e18S rRNA\u003c/em\u003e (\u003cstrong\u003ea\u003c/strong\u003e), \u003cem\u003e28S rRNA\u003c/em\u003e(\u003cstrong\u003eb\u003c/strong\u003e) and \u003cem\u003ecox1\u003c/em\u003e (\u003cstrong\u003ec\u003c/strong\u003e) sequences. The trees were constructed using the Tamura 3-parameter (\u003cem\u003e18S rRNA\u003c/em\u003e), Hasegawa-Kishino-Yano (\u003cem\u003e28S rRNA\u003c/em\u003e), and Kimura 2-parameter model (\u003cem\u003ecox1\u003c/em\u003e) The values between the branches represent bootstrap values per 1000 replicates, and values below 50% are not shown. The newly sequenced \u003cem\u003eSarcocystis\u003c/em\u003e \u003cem\u003emedusiformis\u003c/em\u003e (shown in boldface) clusters with \u003cem\u003eS. gigantea\u003c/em\u003e and \u003cem\u003eS. moulei\u003c/em\u003e in a distinct clade.\u003c/p\u003e","description":"","filename":"Figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-8423378/v1/3da758c3b09788a921424acb.png"},{"id":105223304,"identity":"27a18b88-1095-4eb6-9ef4-d2b6d860ced5","added_by":"auto","created_at":"2026-03-23 16:03:17","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":6195094,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8423378/v1/04c14ecc-86e2-40be-a97e-ac4c75f6670a.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"First identification of Sarcocystis medusiformis in Chinese sheep (Ovis aries): Morphological and molecular characterization","fulltext":[{"header":"Introduction","content":"\u003cp\u003e \u003cem\u003eSarcocystis\u003c/em\u003e spp. are cyst-forming, intracellular protozoan parasites with an obligate two-host life cycle based on a prey-predator relationship. Sexual reproduction occurs in the intestinal epithelial cells of carnivorous definitive hosts, leading to the excretion of oocysts or sporocysts. In herbivorous intermediate hosts, asexual replication results in the formation of intramuscular sarcocysts (Dubey et al. \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). Sheep (\u003cem\u003eOvis aries\u003c/em\u003e) are intermediate hosts for at least nine \u003cem\u003eSarcocystis\u003c/em\u003e species, including \u003cem\u003eS. tenella\u003c/em\u003e (Moul\u0026eacute; \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e1886\u003c/span\u003e), \u003cem\u003eS. gigantea\u003c/em\u003e (Ashford 1977), \u003cem\u003eS. medusiformis\u003c/em\u003e (Collins et al. \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e1979\u003c/span\u003e), S. \u003cem\u003earieticanis\u003c/em\u003e (Heydorn \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e1985\u003c/span\u003e), \u003cem\u003eS. microps\u003c/em\u003e (Wang et al. \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e1988\u003c/span\u003e), S. \u003cem\u003ecystiformis\u003c/em\u003e (Wang et al. \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e1989\u003c/span\u003e). \u003cem\u003eS. mihoensis\u003c/em\u003e (Saito et al. \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e1997\u003c/span\u003e), S. \u003cem\u003egracilis\u003c/em\u003e-like (Giannetto et al. \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2005\u003c/span\u003e)d \u003cem\u003emihoensis\u003c/em\u003e-like (Gjerde et al. \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2020\u003c/span\u003e), which are primarily differentiated by their sarcocyst wall ultrastructure. Notably, only \u003cem\u003eS. gigantea\u003c/em\u003e and \u003cem\u003eS. medusiformis\u003c/em\u003e develop macroscopically visible sarcocysts, informally categorized by their gross morphology as \"fat\" and \"thin\" cysts, respectively (Collins et al. \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e1979\u003c/span\u003e). Natural \u003cem\u003eSarcocystis\u003c/em\u003e infections in sheep can induce significant clinical pathology, including weight loss, abortion, myocarditis, encephalitis, and in severe cases, acute mortality (Railliet \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e1886\u003c/span\u003e; Dubey et al. \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e1989\u003c/span\u003e; Scott and Sargison \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2001\u003c/span\u003e; Yaziroglu and Beyazit \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e2005\u003c/span\u003e). Moreover, the presence of macrocysts formed by \u003cem\u003eS. gigantea\u003c/em\u003e and \u003cem\u003eS. medusiformis\u003c/em\u003e, along with associated eosinophilic myositis, frequently leads to partial or complete carcass condemnation, incurring substantial economic losses in both lamb and adult sheep production (Collins \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e1980\u003c/span\u003e; Ezzi et al. \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e1992\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eAmong the \u003cem\u003eSarcocystis\u003c/em\u003e species infecting sheep, \u003cem\u003eS. tenella\u003c/em\u003e, \u003cem\u003eS. arieticanis\u003c/em\u003e, and \u003cem\u003eS. gigantea\u003c/em\u003e are globally distributed (Dubey et al. \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2016\u003c/span\u003e; Feng et al. \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). In contrast, reports of \u003cem\u003eS. medusiformis\u003c/em\u003e have been more geographically restricted, with confirmations limited to New Zealand (Collins et al. \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e1979\u003c/span\u003e), Australia (O'Donoghue and Ford \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e1986\u003c/span\u003e; Obendorf and Munday \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e1987\u003c/span\u003e), Iran (Farhang-Pajuh et al. \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2014\u003c/span\u003e), Iraq (Nawshirwan et al. \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2023\u003c/span\u003e), Italy (Pipia et al. \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2016\u003c/span\u003e), Egypt (El-Morsey et al. \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2021\u003c/span\u003e), and Spain (Gjerde et al. \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Peris et al. \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). This study reports the first detection of \u003cem\u003eS. medusiformis\u003c/em\u003e in Chinese sheep, confirmed through comprehensive morphological analysis. To further characterize this isolate and clarify its phylogenetic position among ruminant-infecting \u003cem\u003eSarcocystis\u003c/em\u003e species, we performed molecular characterization by sequencing and analyzing four genetic markers: the \u003cem\u003e18S rRNA\u003c/em\u003e, \u003cem\u003e28S rRNA\u003c/em\u003e, and mitochondrial \u003cem\u003ecox1\u003c/em\u003e genes, and the ITS-1 region.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eMorphological observation of sarcocysts\u003c/h2\u003e \u003cp\u003eMuscle tissues were collected from 92 sheep between July and December 2024 at three abattoirs in southwestern China (two in Lhasa city and one in Kunming city). From each animal, fresh specimens of diaphragm, skeletal muscle, and cardiac tissue were obtained and examined for the presence of sarcocysts. In the laboratory, small sections of muscle were compressed between glass slides. Sarcocysts were initially detected using a stereomicroscopy (Leica MZ6). Individual sarcocysts were then meticulously isolated from muscle tissue under magnification using dissecting needles for subsequently light microscopy (LM), transmission electron microscopy (TEM), and DNA extraction.\u003c/p\u003e \u003cp\u003eLM observation was performed using an Olympus BX51 microscope. For TEM examination, isolated sarcocysts were initially fixed in 2.5% glutaraldehyde dissolved in 0.1 M cacodylate buffer (pH 7.4) at 4\u0026deg;C, followed by post-fixed in 1.0% osmium tetroxide using the same buffer. Samples were then dehydrated through a graded ethanol series (30\u0026ndash;100%) and embedded in Epon-Araldite resin. Ultrathin sections (70\u0026ndash;90 nm) were double-stained with uranyl acetate (35 mg/ml) and lead citrate (35 mg/ml), and examined using a JEM100-CX TEM (JEOL Ltd., Tokyo, Japan) operating at 80 kV.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eDNA extraction and molecular characterization\u003c/h3\u003e\n\u003cp\u003eIndividual cysts preserved in sterile distilled water at \u0026minus;\u0026thinsp;20\u0026deg;C were used for genetic DNA extraction. DNA was extracted from three sarcocysts (each from a different sheep) using the TIANamp Genomic DNA Kit (Tiangen Biotech Ltd., Beijing, China) according to the manufacturer\u0026rsquo;s instructions. Four genetic markers\u0026ndash;\u003cem\u003e18S rRNA\u003c/em\u003e, \u003cem\u003e28S rRNA\u003c/em\u003e, ITS-1, and mitochondrial \u003cem\u003ecox1\u0026ndash;\u003c/em\u003e were amplified from each sarcocyst using the primers specified in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e \u003cp\u003ePCR was performed in a 25-\u0026micro;L reaction mixture containing: 1X PCR buffer, 0.15 mM MgCl₂, 0.25 mM dNTPs, 1 U of Taq DNA polymerase (TaKaRa, Dalian, China), 50\u0026ndash;100 ng of template DNA, and 25 pmol of each primer. Amplification was carried out in a Bio-Rad T100 thermal cycler with the following program: initial denaturation at 95\u0026deg;C for 5 min; 35 cycles of 94\u0026deg;C for 1 min, 53\u0026ndash;57\u0026deg;C (primer-specific) for 1 min, and 72\u0026deg;C for 1 min; followed by a final extension at 72\u0026deg;C for 10 min. PCR products were purified using the E.Z.N.A.\u0026reg; Gel Extraction Kit (Omega Bio-Tek, Inc., USA), ligated into the pCE2 TA/Blunt-Zero vector (5 min TA/Blunt-Zero Cloning Kit, Vazyme Biotech Co., Ltd., Nanjing, China), and transformed into Trelief\u0026trade; 5α Chemically Competent Cells (Tsingke Biotechnology Co., Ltd., Beijing, China). Positive clones were sequenced bidirectionally on an ABI PRISM\u0026trade; 3730 XL DNA Analyzer (Applied Biosystems, USA).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimers used for the amplification of the four DNA regions\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eDNA region\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePrimer name\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003ePrimer sequences (5\u0026prime;\u0026ndash;3\u0026prime;)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eReferences\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003e18S rRNA\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eERIB1\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eACC TGG TTG ATC CTG CCA G\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eBarta et al.1997\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePrimerB\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGATCCTTCTGCAGGTTCACCTAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eFenger et al. \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e1995\u003c/span\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"5\" rowspan=\"6\"\u003e \u003cp\u003e\u003cem\u003e28S rRNA\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eKL1\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTACCCGCTGAACTTAAGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"5\" rowspan=\"6\"\u003e \u003cp\u003eMugridge et al. \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2000\u003c/span\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eKL3\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCCACCAAGATCTGCACTAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eKL4 \u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAGCAGGACGGTGGTCATG-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eKL5\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCTCAAGCTCAACAGGGTC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eKL6\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGGATTGGCTCTGAGGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eKL2\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eACTTAGAGGCGTTCAGTC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eITS-1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSU1F\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGATTGAGTGTTCCGGTGAATTATT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eGjerde \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2014a\u003c/span\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5.8SR2\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAAGGTGCCATTTGCGTTCAGAA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003ecox1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSF1\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eATGGCGTACAACAATCATAAAGAA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eGjerde \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2013\u003c/span\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSR9\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eATATCCATACCRCCATTGCCCAT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eGjerde \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2013\u003c/span\u003eb\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003csup\u003ea\u003c/sup\u003eforward primer; \u003csup\u003eb\u003c/sup\u003ereverse primer\u003c/p\u003e \u003cp\u003eThe obtained sequences were assembled using the SeqMan II program (DNASTAR, USA) based on multiple overlapping regions. Sequence identity and similarity analyses were performed using BioEdit software (Hall \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e1999\u003c/span\u003e). Initial characterization was conducted by comparing the sequences against the GenBank database using the online BLASTn tool (National Center for Biotechnology Information, NIH, USA).\u003c/p\u003e\n\u003ch3\u003ePhylogenetic analysis\u003c/h3\u003e\n\u003cp\u003ePhylogenetic analyses were conducted separately on the nucleotide sequences of the \u003cem\u003e18S rRNA\u003c/em\u003e, \u003cem\u003e28S rRNA\u003c/em\u003e, and mitochondrial \u003cem\u003ecox1\u003c/em\u003e using MEGA 11 software (Tamura et al. \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Reference sequences of \u003cem\u003eSarcocystis\u003c/em\u003e spp. for each gene were retrieved from GenBank. The \u003cem\u003e18S rRNA\u003c/em\u003e and \u003cem\u003e28S rRNA\u003c/em\u003e sequences were aligned using the \u0026ldquo;R-Coffee\u0026rdquo; web server, which integrates predicted secondary \u003cem\u003eRNA\u003c/em\u003e structure to enhance alignment accuracy (Di Tommaso et al. \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2011\u003c/span\u003e). The mitochondrial \u003cem\u003ecox1\u003c/em\u003e sequences were aligned using the MUSCLE algorithm embedded in the MEGA 11. All alignments were manually inspected and trimmed at both ends to guarantee uniform start and stop positions across all sequences. The final aligned datasets were as follows: the aligned \u003cem\u003e18S rRNA\u003c/em\u003e nucleotide sequences (24 sequences from 23 species) comprised 1944 positions, ranging from position 60 to 1853 of \u003cem\u003eS. gigantea\u003c/em\u003e (MK420020); the aligned \u003cem\u003e28S rRNA\u003c/em\u003e nucleotide sequences (21 sequences from 20 species) consisted of 1831 positions, ranging from position 1 to 1641 of \u003cem\u003eS. gigantea\u003c/em\u003e (U85706); and the aligned \u003cem\u003ecox\u003c/em\u003e1 nucleotide sequences (22 sequences from 20 species) consisted of 1020 positions, ranging from position 1 to 1020 of \u003cem\u003eS. gigantea\u003c/em\u003e (MK420012) without any gaps.\u003c/p\u003e \u003cp\u003eMaximum likelihood (ML) phylogenetic trees were constructed for the 18S \u003cem\u003erRNA\u003c/em\u003e, 28S \u003cem\u003erRNA\u003c/em\u003e, and mitochondrial \u003cem\u003ecox\u003c/em\u003e1 sequences using the Tamura 3-parameter, Hasegawa-Kishino-Yano, and Kimura 2-parameter models, respectively. These models were selected based on the lowest BIC (Bayesian Information Criterion) and AICc (Akaike information Criterion, corrected) values determined through ML analysis implemented in MEGA11. All positions containing gaps and missing data were removed using the complete deletion option. The final datasets consisted of 1560 positions for \u003cem\u003e18S rRNA\u003c/em\u003e, 1440 positions for \u003cem\u003e28S rRNA\u003c/em\u003e, and 1020 positions for mitochondrial \u003cem\u003ecox1\u003c/em\u003e. The reliability of the ML phylograms was assessed using the bootstrap method with 1000 replications. \u003cem\u003eToxoplasma gondii\u003c/em\u003e and \u003cem\u003eHammondia\u003c/em\u003e spp. were selected as outgroups to root the phylogenetic trees.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e \u003cb\u003eMorphological characterization of\u003c/b\u003e \u003cb\u003eS. medusiformis\u003c/b\u003e \u003cb\u003esarcocysts\u003c/b\u003e\u003c/p\u003e \u003cp\u003eMacroscopically visible sarcocysts (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ea) were detected in 4 out of 92 sheep (4.3%), exclusively localized in skeletal muscles and diaphragms, with no observed infection in cardiac tissue. Under LM, the sarcocysts measured 2490\u0026ndash;4796 \u0026micro;m in length and 248\u0026ndash;405 \u0026micro;m in width, exhibiting a thin (1\u0026ndash;2 \u0026micro;m thick), striated cyst wall (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eb). Internally, septa subdivided the sarcocyst into compartments densely packed with banana-shaped bradyzoites measuring 15.3\u0026ndash;18.6 \u0026times; 3.4\u0026ndash;4.2 \u0026micro;m (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ec).\u003c/p\u003e \u003cp\u003eUltrastructural analysis further revealed that the cyst wall was covered with trapezoidal villar protrusions (VPs), each lined by a distinct electron-dense layer (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ed, e). These VPs measured 0.8\u0026ndash;1.3 \u0026micro;m in length and contained scattered microtubes extending from the apex to the base, without penetrating the underlying ground substance layer (GSL) (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ee). The GSL was 2.0\u0026ndash;2.3 \u0026micro;m thick. Additionally, coiled serpentine filaments were observed originating both the surfaces of the VPs and the intervening areas between them. These ultrastructure characteristics correspond to the type 20 cyst wall as defined by Dubey et al. (\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2016\u003c/span\u003e), confirming the identification of the parasite as \u003cem\u003eS. medusiformis\u003c/em\u003e.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eMolecular characteristics of\u003c/b\u003e \u003cb\u003eS. medusiformis\u003c/b\u003e\u003c/p\u003e \u003cp\u003eSequencing of three \u003cem\u003eS. medusiformis\u003c/em\u003e sarcocysts isolates from different sheep yielded complete sequences for \u003cem\u003e18S rRNA\u003c/em\u003e (1928 bp), \u003cem\u003e28S rRNA\u003c/em\u003e (3468 bp), ITS-1 (602 bp) and partial \u003cem\u003ecox1\u003c/em\u003e (1085 bp). All \u003cem\u003e18S\u003c/em\u003e and \u003cem\u003e28S rRNA\u003c/em\u003e sequences showed 100% identity among isolates, while ITS-1 and \u003cem\u003ecox1\u003c/em\u003e exhibited near-identity, with sequences similarities of 99.7\u0026ndash;100% and 99.0-100%, respectively. Representative nucleotide sequences have been deposited in GenBank database under the following accession numbers: PV460240 (\u003cem\u003e18S rRNA\u003c/em\u003e), PV460246 (\u003cem\u003e28S rRNA\u003c/em\u003e), PV470857 and PV470858 (ITS-1), PV468778 and PV468779 (\u003cem\u003ecox1\u003c/em\u003e).\u003c/p\u003e \u003cp\u003eComparison with existing sequences in GenBank (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e) revealed that the newly obtained \u003cem\u003e18S rRNA\u003c/em\u003e, \u003cem\u003e28S rRNA\u003c/em\u003e, and \u003cem\u003ecox1\u003c/em\u003e sequences showed the highest similarity (up to 100% identity) to \u003cem\u003eS. medusiformis\u003c/em\u003e. The next closest matches were \u003cem\u003eS. gigantea\u003c/em\u003e from sheep and \u003cem\u003eS. moulei\u003c/em\u003e from goats. In contrast, BLAST analysis of the newly generated ITS-1 sequences showed no significant similarity to any entries currently available in GenBank.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eSimilarities of nucleotide sequences between newly sequenced \u003cem\u003eSarcocystis medusiformis\u003c/em\u003e and those previously provided in GenBank\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"5\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eDNA regions\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colspan=\"3\" nameend=\"c5\" namest=\"c3\"\u003e \u003cp\u003eSimilarity with those previously deposited in GenBank\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eSarcocystis\u003c/em\u003e sp.\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAccession numbers\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e% Coverage\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e% Similarity (on average)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003e\u003cem\u003e18S rRNA\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eS. medusiformis\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eMK420021, MT705985\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e99.6\u0026ndash;100 (99.8)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eS. gigantea\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eMK420020, OP550293, MT705975, KC209733, L24384\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e96\u0026ndash;100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e95.8\u0026ndash;96.7 (96.5)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eS. moulei\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eL76473, OP430827, OP430830, OP430832, OP430834, OP430835\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e96\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e96.1\u0026ndash;96.9 (96.5)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003e\u003cem\u003e28S rRNA\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eS. medusiformis\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eMK420026, MT706454\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e99.6\u0026ndash;100 (99.8)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eS. gigantea\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eU85706\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e96.0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eS. moulei\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAF012884, OP429586, OP430799\u0026ndash;OP430803\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e99\u0026ndash;100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e95.5\u0026ndash;95.7 (95.6)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003ecox1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eS. medusiformis\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eMK420014, MK420015, MT722971, MT722972\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e95\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e99.0\u0026ndash;100 (99.5)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eS. gigantea\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eMK420011\u0026ndash;MK420013, MT722969, MT722970, KC209601, MK120979\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e89\u0026ndash;95\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e87.6\u0026ndash;88.1 (88.0)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e\n\u003ch3\u003ePhylogenetic analysis\u003c/h3\u003e\n\u003cp\u003ePhylogenetic analysis based on \u003cem\u003e18S rRNA\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ea), \u003cem\u003e28S rRNA\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ea) and mitochondrial \u003cem\u003ecox1\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ec) revealed revealed that the newly sequenced \u003cem\u003eS. medusiformis\u003c/em\u003e isolates formed a well-supported clade with \u003cem\u003eS. gigantea\u003c/em\u003e and \u003cem\u003eS. moulei\u003c/em\u003e. These species infect sheep or goats, produce macroscopically visible cysts, and share felids as their definitive hosts. In the trees inferred from \u003cem\u003e18S rRNA\u003c/em\u003e and \u003cem\u003ecox1\u003c/em\u003e sequences, this \u003cem\u003eS. medusiformis\u003c/em\u003e clade grouped with other macrocyst-forming, felid-definitive \u003cem\u003eSarcocystis\u003c/em\u003e species from large ruminants, including \u003cem\u003eS. hirsute\u003c/em\u003e from cattle (\u003cem\u003eBos taurus\u003c/em\u003e) and \u003cem\u003eS. buffalonis\u003c/em\u003e and \u003cem\u003eS. fusiformis\u003c/em\u003e from water buffalo (\u003cem\u003eBubalus bubalis\u003c/em\u003e). In contrast, the topology of the \u003cem\u003e28S rRNA\u003c/em\u003e-based tree differed. Here, the \u003cem\u003eS. medusiformis\u003c/em\u003e clade was placed within a larger group comprising \u003cem\u003eSarcocystis\u003c/em\u003e species that form microcysts and utilize canids as definitive hosts. This group included \u003cem\u003eS. tenella\u003c/em\u003e and \u003cem\u003eS. arieticanis\u003c/em\u003e in sheep, \u003cem\u003eS. capracanis\u003c/em\u003e and \u003cem\u003eS. hircicanis\u003c/em\u003e in goats, \u003cem\u003eS. cruzi\u003c/em\u003e in cattle, and \u003cem\u003eS. poephagicanis\u003c/em\u003e in yaks. Notably, the felid-associated, macrocyst-forming species from cattle and water buffalo (\u003cem\u003eS. hirsuta\u003c/em\u003e, \u003cem\u003eS. buffalonis\u003c/em\u003e, \u003cem\u003eS. fusiformis\u003c/em\u003e) formed a basal group to this larger cluster in this particular phylogenetic reconstruction.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eRailliet (\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e1886\u003c/span\u003e) first described large, ovoid sarcocysts in sheep esophagi, naming them \u003cem\u003eSarcocystis\u003c/em\u003e (\u003cem\u003eBalbiania\u003c/em\u003e) \u003cem\u003egigantea\u003c/em\u003e. Later, Mehlhorn and Scholtyseck (\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e1973\u003c/span\u003e) provided the ultrastructural description of these sarcocysts, characterized by a thick, double-layered wall with numerous \"cauliflower-like\" protrusions. Nearly a century after the initial description, Collins et al. (\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e1979\u003c/span\u003e) identified a distinct macroscopic sarcocyst in sheep skeletal muscle, distinguished by a thin primary cyst wall (\u0026lt;\u0026thinsp;2 \u0026micro;m) bearing \"snake-like\" projections on both the villar and inter-villar surface. Based on these unique morphological traits, it was designated \u003cem\u003eS. medusiformis\u003c/em\u003e. In the present study, all observed macroscopic sarcocysts exhibited thin, striated primary cyst walls consistent with the ultrastructure of \u003cem\u003eS. medusiformis\u003c/em\u003e originally described in New Zealand sheep (Collins et al. \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e1979\u003c/span\u003e). According to the classification system of Dubey et al. (\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2016\u003c/span\u003e), the cyst wall conforms to type 20.\u003c/p\u003e \u003cp\u003e \u003cem\u003eSarcocystis\u003c/em\u003e species in sheep exhibit a global distribution, with microcyst-forming species (utilizing canids as definitive hosts) being more prevalent than macrocyst-forming species (transmitted via felids) (Dubey et al. \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2016\u003c/span\u003e; Feng et al. \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). In China, both microcysts and macrocysts have been detected. Reported prevalence rates for microcysts range from 33.85% to 91.9% (Hu et al. \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2017\u003c/span\u003e; Dong et al. \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; Kang et al. \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2024\u003c/span\u003e), while macrocysts have been reported at 29.1% (Sun et al. \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Previous morphological and molecular analyses in Chinese sheep have identified three species: \u003cem\u003eS. tenella\u003c/em\u003e, \u003cem\u003eS. arieticanis\u003c/em\u003e, and \u003cem\u003eS. gigantea\u003c/em\u003e. Our team has previously characterized the microcyst-forming species in detail (Hu et al. \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2017\u003c/span\u003e); the present study focused on the first identification of \u003cem\u003eS. medusiformis\u003c/em\u003e in China. Among the 92 sheep examined, 4 (4.3%) harbored macroscopic cysts of \u003cem\u003eS. medusiformis\u003c/em\u003e, marking the first record of this parasite in the country. This prevalence is lower than rates reported in Egypt (5.7%) (El-Morsey et al. \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2021\u003c/span\u003e), Iran (7.52%) (Farhang-Pajuh et al. \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2014\u003c/span\u003e), and Italy (12.3%) (Pipia et al. \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2016\u003c/span\u003e), but higher than that in Australia (3.1%) (Obendorf and Munday \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e1987\u003c/span\u003e). Experimental transmission studies confirm that the domestic cat (\u003cem\u003eFelis catus\u003c/em\u003e) is the definitive host for \u003cem\u003eS. medusiformis\u003c/em\u003e (Collins 1979; Obendorf and Munday \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e1987\u003c/span\u003e). However, the parasite exhibits relatively low infectivity in cats. Notably, no oocyst or sporocyst shedding was detected in cats fed cystozoites from experimentally infected lambs at 260, 300, and 487 days post-infection (Obendorf and Munday \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e1987\u003c/span\u003e). This reduced infectivity may contribute to the overall low prevalence of \u003cem\u003eS. medusiformis\u003c/em\u003e in sheep observed in the current study and in previous reports.\u003c/p\u003e \u003cp\u003eMolecular analysis provides a more sensitive and reliable approach for identifying \u003cem\u003eSarcocystis\u003c/em\u003e species than traditional morphology, particularly given the developmental changes sarcocysts undergo and the existence of morphologically similar cysts in closely related intermediate hosts (Gjerde \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2013\u003c/span\u003e; Dubey et al. \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). In this study, we successfully sequenced and submitted \u003cem\u003e18S rRNA\u003c/em\u003e, \u003cem\u003e28S rRNA\u003c/em\u003e, \u003cem\u003ecox1\u003c/em\u003e, and \u003cem\u003eITS-1\u003c/em\u003e sequences of \u003cem\u003eS. medusiformis\u003c/em\u003e to GenBank. Notably, the ITS-1 sequences represent the first entry of this genetic marker for the species. BLASTn analysis confirmed up to 100% identity between our sequences and existing \u003cem\u003eS. medusiformis\u003c/em\u003e references at the \u003cem\u003e18S rRNA\u003c/em\u003e, \u003cem\u003e28S rRNA\u003c/em\u003e, and \u003cem\u003ecox1\u003c/em\u003e loci, providing robust molecular support for our morphological identification. Phylogenetic analysis consistently placed \u003cem\u003eS. medusiformis\u003c/em\u003e within a well-supported clade that includes \u003cem\u003eS. gigantea\u003c/em\u003e and \u003cem\u003eS. moulei\u003c/em\u003e; however, \u003cem\u003eS. gigantea\u003c/em\u003e and \u003cem\u003eS. moulei\u003c/em\u003e were more closely related to each other than to \u003cem\u003eS. medusiformis\u003c/em\u003e. This phylogenetic pattern reflects the morphological parallels often observed among \u003cem\u003eSarcocystis\u003c/em\u003e species infecting related ruminant hosts. For instance, in sheep, \u003cem\u003eS. tenella\u003c/em\u003e, \u003cem\u003eS. arieticanis\u003c/em\u003e, and \u003cem\u003eS. gigantea\u003c/em\u003e have their morphological counterparts in goats: \u003cem\u003eS. capracanis\u003c/em\u003e, \u003cem\u003eS. hircicanis\u003c/em\u003e, and \u003cem\u003eS. moulei\u003c/em\u003e, respectively (Dubey et al. \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). Interestingly, while this host-associated pattern is common, sarcocysts morphologically similar to \u003cem\u003eS. medusiformis\u003c/em\u003e have not been documented in goats. The sole exception is an unusual finding of similar sarcocysts in an addax (\u003cem\u003eAddax nasomaculatus\u003c/em\u003e) in a European zoo (Stolte et al. \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e1996\u003c/span\u003e).\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eTo date, reports on \u003cem\u003eS. medusiformis\u003c/em\u003e infections in sheep remain extremely limited, both in case number and geographic distribution. This study provides the first documented evidence of natural \u003cem\u003eS. medusiformis\u003c/em\u003e infection in Chinese sheep, significantly expanding the known geographic range of this parasite. Remarkably, sarcocysts morphologically similar to \u003cem\u003eS. medusiformis\u003c/em\u003e have been identified only once in a wild bovid species, the addax. The scarcity of available data highlights the need for more extensive sampling of wild and domestic bovid ruminants. Focusing on S. medusiformis and morphologically similar species will enable a deeper understanding of their prevalence, distribution, host specificity, and interspecies relationships within this host group.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAuthor contributions\u0026nbsp;\u003c/strong\u003eDL: Resources, investigation and data collec\u0026shy;tion. LQ, ZH, LX and SD: Resources, investigation and formal analysis. JT and YY: Data curation, review, and editing. JH: Conceptualization, editing, correction, supervision.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u0026nbsp;\u003c/strong\u003eThis work was supported by the National Natural Science Foundation of China [No. 32260119], the Research Project of Tibet Autonomous Region [No. XZ202301ZY0006N], and the Henan Province modern agricultural industrial technology system [mutton sheep: No. HARS-22-15-G1].\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability\u003c/strong\u003e All data generated or analyzed during this study are included in this published article. The molecular sequence data are already available in GenBank under accession numbers PV460240, PV460246, PV470857, PV470858, and PV468778, PV468779.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics\u0026nbsp;\u003c/strong\u003eThe animal study protocol was approved by the Animal Ethics Committee of Yunnan University (permission number YNU20230466, received date: 3 March 2023).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflicts of interest\u0026nbsp;\u003c/strong\u003eThe authors declare no competing interests.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eAshford RW (1997). The fox, \u003cem\u003eVulpes vulpes\u003c/em\u003e, as a final host for \u003cem\u003eSarcocystis\u003c/em\u003e of sheep. Ann Trop Med Parasitol 71: 29\u0026ndash;34. https://doi.org/10.1080/00034983.1977.11687158\u003c/li\u003e\n\u003cli\u003eBarta JR, Martin DS, Liberator PA, Dashkevicz M et al (1997) Phylogenetic relationships among eight \u003cem\u003eEimeria \u003c/em\u003especies infecting domestic fowl inferred using complete small subunit ribosomal DNA sequences. J Parasitol 83(2): 262\u0026ndash;271. \u003c/li\u003e\n\u003cli\u003eCollins GH, Atkinson E, Charleston WA (1979) Studies on \u003cem\u003eSarcocystis\u003c/em\u003e species III: The macrocystic species of sheep. N Z Vet J27(10): 204\u0026ndash;206. https://doi.org/10.1080/00480169.1979.34651\u003c/li\u003e\n\u003cli\u003eCollins GH (1980) \u003cem\u003eSarcocystis\u003c/em\u003e and the meat industry. Monograph Massey University, New Zealand, pp. 1\u0026ndash;15\u003c/li\u003e\n\u003cli\u003eDi Tommaso P, Moretti S, Xenarios I et al (2011) T-Coffee: A web server for the multiple sequence alignment of protein and RNA sequences using structural information and homology extension. Nucleic Acids Res 39(Web Server issue): W13\u0026ndash;W17. https://doi.org/10.1093/nar/gkr245\u003c/li\u003e\n\u003cli\u003eDong H, Su R, Wang Y et al (2018) \u003cem\u003eSarcocystis \u003c/em\u003especies in wild and domestic sheep (\u003cem\u003eOvis ammon\u003c/em\u003e and \u003cem\u003eOvis aries\u003c/em\u003e) from China. BMC Vet Res14(1): 377. https://doi.org/10.1186/s12917-018-1712-9\u003c/li\u003e\n\u003cli\u003eDubey JP, Speer CA, Munday BL et al (1989) Ovine sporozoan encephalomyelitis linked to \u003cem\u003eSarcocystis \u003c/em\u003einfection. Vet Parasitol 34: 159\u0026ndash;163 https://doi.org/10.1016/0304-4017(89)90178-7.\u003c/li\u003e\n\u003cli\u003eDubey JP, Calero-Bernal R, Rosenthal BM et al (2016) Sarcocystosis of animals and humans, 2nd ed. CRC Press, Boca Raton, FL, USA.\u003c/li\u003e\n\u003cli\u003eEl-Morsey A, Abdo W, Zaid AAA et al. (2021) Morphologic and molecular identification of three macroscopic \u003cem\u003eSarcocystis \u003c/em\u003especies infecting domestic sheep (\u003cem\u003eOvis aries\u003c/em\u003e) and cattle (\u003cem\u003eBos taurus\u003c/em\u003e) in Egypt. Parasitol Res 120(2): 637\u0026ndash;654. https://doi.org/10.1007/s00436-020-07002-w\u003c/li\u003e\n\u003cli\u003eEzzi A, Gholami MR, Ahourai P (1992) Eosinophilic myositis associated with \u003cem\u003eSarcocystis \u003c/em\u003ein sheep. Arch Inst RAZI42/43: 65\u0026ndash;68\u003c/li\u003e\n\u003cli\u003eFarhang-Pajuh F, Yakhchali M, Mardani K (2014) Molecular determination of abundance of infection with \u003cem\u003eSarcocystis\u003c/em\u003e species in slaughtered sheep of Urmia, Iran. Vet Res Forum 5(3):181\u0026ndash;186.\u003c/li\u003e\n\u003cli\u003eFeng Y, Guo R, Sang X et al (2023) A systematic meta-analysis of global\u003cem\u003e Sarcocystis \u003c/em\u003einfection in sheep and goats. Pathogens 12(7): 902. https://doi.org/10.3390/ pathogens12070902.\u003c/li\u003e\n\u003cli\u003eFenger CK, Granstrom DE, Langemeier JL et al (1995) Identification of opossums (\u003cem\u003eDidelphis virginiana\u003c/em\u003e) as the putative definitive host of \u003cem\u003eSarcocystis neurona\u003c/em\u003e. J Parasitol 81(6): 916\u0026ndash;919\u003c/li\u003e\n\u003cli\u003eGiannetto S, Poglayen G, Brianti E et al (2005) \u003cem\u003eSarcocystis gracilis\u003c/em\u003e-like sarcocysts in a sheep. Vet Rec 156(10): 322\u0026ndash;323. https://doi.org/ 10.1136/vr.156.10.322\u003c/li\u003e\n\u003cli\u003eGjerde B (2013) Phylogenetic relationships among \u003cem\u003eSarcocystis\u003c/em\u003e species in cervids, cattle and sheep inferred from the mitochondrial cytochrome c oxidase subunit I gene. Int J Parasitol 43,579\u0026ndash;591. https://doi.org/10.1016/j.ijpara.2013.02.004\u003c/li\u003e\n\u003cli\u003eGjerde B (2014a) Molecular characterisation of \u003cem\u003eSarcocystis rileyi\u003c/em\u003e from a common eider (\u003cem\u003eSomateria mollissima\u003c/em\u003e) in Norway. Parasitol Res 113: 3501\u0026ndash;3509. https://doi.org/10.1007/s00436-014-4062-y\u003c/li\u003e\n\u003cli\u003eGjerde B (2014b) \u003cem\u003eSarcocystis\u003c/em\u003e species in red deer revisited: with a re-description of two known species as \u003cem\u003eSarcocystis elongata\u003c/em\u003e n. sp. and \u003cem\u003eSarcocystis truncata\u003c/em\u003e n. Sp. based on mitochondrial cox1 sequences. Parasitology 141: 441\u0026ndash;452. https://doi.org/10.1017/S0031182013001819\u003c/li\u003e\n\u003cli\u003eGjerde B, de la Fuente C, Alunda JM et al (2020) Molecular characterisation of five \u003cem\u003eSarcocystis\u003c/em\u003e species in domestic sheep (\u003cem\u003eOvis aries\u003c/em\u003e) from Spain. Parasitol Res 119: 215\u0026ndash;231. https://doi.org/10.1007/s00436-019-06504-6\u003c/li\u003e\n\u003cli\u003eHall TA, 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucl Acids Symp Ser 41: 95\u0026ndash;98\u003c/li\u003e\n\u003cli\u003eHeydorn AO (1985) The development of \u003cem\u003eSarcocystis arieticanis\u003c/em\u003e n. sp Berl M\u0026uuml;nch Tier\u0026auml;rztl Wochenschr 98(7): 231\u0026ndash;241\u003c/li\u003e\n\u003cli\u003eHu JJ, Huang S, Wen T et al (2017) \u003cem\u003eSarcocystis\u003c/em\u003e spp. in domestic sheep in Kunming City, China: Prevalence, morphology, and molecular characteristics. Parasite 24: 30. https://doi.org/10.1051/parasite/2017025\u003c/li\u003e\n\u003cli\u003eKang Y, Lu XS, He YH, Wang C et al (2024) First molecular identification and prevalence of \u003cem\u003eSarcocystis\u003c/em\u003e spp. in sheep intended for human consumption in Shanxi province, China. Vet Sci 11(10): 504. https://doi.org/10.3390/vetsci11100504\u003c/li\u003e\n\u003cli\u003eMehlhorn H, Scholtyseck E (1973) The fine structure of the cyst stages of \u003cem\u003eSarcocystis tenella\u003c/em\u003e. Z Parasitenkd 41(4): 291\u0026ndash;310\u003c/li\u003e\n\u003cli\u003eMoul\u0026eacute; ML (1886). Sur la psorospermose des bovides. Bull Soc Cent M\u0026eacute;d V\u0026eacute;t (Parsis) 40 (n. s. 4): 694\u0026ndash;696\u003c/li\u003e\n\u003cli\u003eMugridge NB, Morrison DA, J\u0026auml;kel T et al (2000) Effects of sequence alignment and structural domains of ribosomal DNA on phylogeny reconstruction for the protozoan family \u003cem\u003eSarcocystidae\u003c/em\u003e. Mol Biol Evol 17(12): 1842\u0026ndash;1853. https://doi.org/10.1093/oxfordjournals.molbev.a026285\u003c/li\u003e\n\u003cli\u003eNawshirwan S, Heucken N, Piekarek N et al (2023) Morphological, ultrastructural, genetic characteristics and remarkably low prevalence of macroscopic \u003cem\u003eSarcocystis \u003c/em\u003especies isolated from sheep and goats in Kurdistan region, Iraq. Front Vet Sci 10: 1225796. https://doi.org/10.3389/fvets.2023.1225796\u003c/li\u003e\n\u003cli\u003eObendorf DL, Munday BL (1987) Experimental infection with \u003cem\u003eSarcocystis medusiformis\u003c/em\u003e in sheep. Vet Parasitol 24(1-2): 59\u0026ndash;65. https://doi.org/10.1016/0304-4017(87)90130-0\u003c/li\u003e\n\u003cli\u003eO\u0026apos;Donoghue PJ, Ford GE (1986) The prevalence and intensity of \u003cem\u003eSarcocystis\u003c/em\u003e spp. infections in sheep. Aust Vet J 63(9): 273\u0026ndash;278. https://doi.org/10.1111/j.1751-0813.1986.tb08065.x\u003c/li\u003e\n\u003cli\u003ePeris MP, Gracia MJ, Moreno B et al (2024) Identification of \u003cem\u003eSarcocystis\u003c/em\u003e spp. in slaughtered sheep from Spain and evaluation of bradyzoite viability after freezing. Vet Sci 11(3): 103. https://doi.org/10.3390/vetsci11030103\u003c/li\u003e\n\u003cli\u003ePipia AP, Varcasia A, Zidda A et al (2016) Cross-sectional investigation on sheep sarcosporidiosis in Sardinia, Italy. Vet Parasitol Reg Stud Reports 3-4: 13\u0026ndash;17. https://doi.org/10.1016/j.vprsr.2016.05.004\u003c/li\u003e\n\u003cli\u003eRailliet A (1886). Psorospermies geanles dans L\u0026apos;oesophage et les muscles du mouton. Bull Acad V\u0026eacute;t Fr 40: 130\u0026ndash;134\u003c/li\u003e\n\u003cli\u003eSaito M, Shibata Y, Kubo M et al (1997) \u003cem\u003eSarcocystis mihoensis\u003c/em\u003e n. sp. from sheep in Japan. J Vet Med Sci 59(2):103\u0026ndash;106. https://doi.org/10.1292/jvms.59.103\u003c/li\u003e\n\u003cli\u003eScott PR, Sargison ND (2001) Extensive ascites associated with vegetative endocarditis and \u003cem\u003eSarcocystis \u003c/em\u003emyositis in a shearling ram. Vet Rec 149(8): 240\u0026ndash;241. https://doi.org/10.1136/vr.149.8.240 \u003c/li\u003e\n\u003cli\u003eStolte M, Odening K, Bockhardt I (1996) Antelopes (Bovidae) kept in European zoological gardens as intermediate hosts of \u003cem\u003eSarcocystis\u003c/em\u003e species. Parassitologia,38(3): 565\u0026ndash;570\u003c/li\u003e\n\u003cli\u003eSun Y, Ju J, Su X et al (2021) Infection survey and morphological characteristics of \u003cem\u003eSarcocystis \u003c/em\u003espp. in naturally infected Tibetan sheep from Qinghai in northwestern China. Parasitol Int 80: 102219. https://doi.org/10.1016/j.parint.2020.102219\u003c/li\u003e\n\u003cli\u003eTamura K, Stecher G, Kumar S (2021) MEGA11: Molecular evolutionary genetics analysis version 11. Mol Biol Evol 38(7): 3022\u0026ndash;3027. https://doi.org/10.1093/molbev/msab120.\u003c/li\u003e\n\u003cli\u003eWang G, Wei T, Wang X et al (1988) Morphology and life cycle of \u003cem\u003eS\u003c/em\u003e\u003cem\u003earcocystis microps\u003c/em\u003e n. sp. in sheep of Qinghai in China. China Vet Technol 6: 9\u0026ndash;11 (In Chinese)\u003c/li\u003e\n\u003cli\u003eWang G, Wei T, Wang Xet al (1989) Morphological characterization and life cycle of \u003cem\u003eSarcocystis cystiformis \u003c/em\u003en. sp. in sheep. Xinjiang Agric Sci. 1: 37\u0026ndash;40 (In Chinese)\u003c/li\u003e\n\u003cli\u003eYaziroglu O, Beyazit A. 2005. Encephalomyelitis associated with a \u003cem\u003eSarcocystis\u003c/em\u003e-like protozoan in a ten-month-old ewe lamb. Turk J Vet Anim Sci 29: 1209\u0026ndash;1212\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"parasitology-research","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"pare","sideBox":"Learn more about [Parasitology Research](http://link.springer.com/journal/436)","snPcode":"436","submissionUrl":"https://submission.nature.com/new-submission/436/3","title":"Parasitology Research","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"Sarcocysits medusiformis, Ovis aries, Morphology, Phylogeny, China","lastPublishedDoi":"10.21203/rs.3.rs-8423378/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-8423378/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eThis study reports the first detection of \u003cem\u003eSarcocysits medusiformis\u003c/em\u003e in sheep (\u003cem\u003eOvis aries\u003c/em\u003e) in China through integrated morphological and molecular analysis. Macroscopically visible \u003cem\u003eS. medusiformis\u003c/em\u003e sarcocysts were found in 4 of 92 examined sheep (4.3%), measuring 2490\u0026ndash;4796 \u0026times; 248\u0026ndash;405 \u0026micro;m and exhibiting thin, striated walls (1\u0026ndash;2 \u0026micro;m thick). Ultrastructural examination revealed trapezoidal villar protrusions covering the cysts, each lined with an electron-dense layer, with scattered microtubes extending from the apex to the base. Molecular characterization was performed by amplifying and sequencing four genetic markers (18S rRNA, 28S rRNA, ITS-1, and mitochondrial \u003cem\u003ecox1\u003c/em\u003e). The newly obtained 18S rRNA, 28S rRNA and \u003cem\u003ecox1\u003c/em\u003e sequences exhibited 100% identify with previously published \u003cem\u003eS\u003c/em\u003e. \u003cem\u003emedusiformis\u003c/em\u003e sequences in GenBank. Phylogenetic analysis based on these sequences consistently grouped \u003cem\u003eS. medusiformis\u003c/em\u003e, \u003cem\u003eS. gigantea\u003c/em\u003e, and \u003cem\u003eS. moulei\u003c/em\u003e within a distinct clade. To date, \u003cem\u003eS. medusiformis\u003c/em\u003e sarcocysts have been documented primarily in sheep, with a single known case in an addax (\u003cem\u003eAddax nasomaculatus\u003c/em\u003e). Further investigations involving expanded sampling of wild and domestic bovid ruminants are needed to clarify the epidemiology, host specificity, and phylogenetic relationships of \u003cem\u003eS. medusiformis\u003c/em\u003e and morphologically similar species.\u003c/p\u003e","manuscriptTitle":"First identification of Sarcocystis medusiformis in Chinese sheep (Ovis aries): Morphological and molecular characterization","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2026-01-08 14:19:08","doi":"10.21203/rs.3.rs-8423378/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2026-02-08T16:09:26+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2026-02-08T15:38:13+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"91034569703382840752865288179446269792","date":"2026-02-06T13:43:07+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2026-01-26T08:32:21+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"241551340552625710859832314431348150029","date":"2026-01-06T16:36:18+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2026-01-05T18:35:59+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-12-29T08:40:45+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-12-29T05:48:58+00:00","index":"","fulltext":""},{"type":"submitted","content":"Parasitology Research","date":"2025-12-22T09:13:19+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"parasitology-research","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"pare","sideBox":"Learn more about [Parasitology Research](http://link.springer.com/journal/436)","snPcode":"436","submissionUrl":"https://submission.nature.com/new-submission/436/3","title":"Parasitology Research","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"87f192f8-ec39-42d6-8feb-961678d2f61e","owner":[],"postedDate":"January 8th, 2026","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2026-03-23T16:00:57+00:00","versionOfRecord":{"articleIdentity":"rs-8423378","link":"https://doi.org/10.1007/s00436-026-08663-9","journal":{"identity":"parasitology-research","isVorOnly":false,"title":"Parasitology Research"},"publishedOn":"2026-03-18 15:58:26","publishedOnDateReadable":"March 18th, 2026"},"versionCreatedAt":"2026-01-08 14:19:08","video":"","vorDoi":"10.1007/s00436-026-08663-9","vorDoiUrl":"https://doi.org/10.1007/s00436-026-08663-9","workflowStages":[]},"version":"v1","identity":"rs-8423378","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-8423378","identity":"rs-8423378","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2026) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00
unpaywall
last seen: 2026-05-23T02:00:01.238055+00:00
License: CC-BY-4.0