Examining the relationship between maternal body size, gestational glucose tolerance status, mode of delivery and ethnicity on mother’s milk microbiota at three months post-partum

Examining the relationship between maternal body size, gestational glucose tolerance status, mode of delivery and ethnicity on mother’s milk microbiota at three months post-partum | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research article Examining the relationship between maternal body size, gestational glucose tolerance status, mode of delivery and ethnicity on mother’s milk microbiota at three months post-partum Lauren LeMay-Nedjelski, James Butcher, Sylvia H. Ley, Michelle R. Asbury, and 8 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-17184/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 20 Jul, 2020 Read the published version in BMC Microbiology → Version 1 posted 8 You are reading this latest preprint version Abstract Background: Few studies have examined how maternal body mass index (BMI), mode of delivery and ethnicity affect the microbial composition of human milk and none have examined associations with maternal metabolic status. Given the high prevalence of maternal adiposity and impaired glucose metabolism, and the importance of human milk in the colonization of the infant gut, we systematically investigated the associations between these maternal factors and milk microbial composition and functionality. Methods: Women ≥20 years were recruited during pregnancy and milk samples were collected at 3 months post-partum (NCT01405547). Demographic data, weight, height, and a 3-hour oral glucose tolerance test were conducted at 30 (95% CI: 25-33) weeks gestation. Metagenomic DNA extraction and 16S ribosomal RNA gene sequencing of the V4 hypervariable region (Illumina MiSeq) was carried out on 113 milk samples. Results: Multivariable linear regression analyses demonstrated no significant associations between maternal characteristics (maternal BMI [pre-pregnancy, 3 months post-partum], glucose tolerance, mode of delivery and ethnicity) and microbiota alpha-diversity; however, pre-pregnancy BMI was associated with human milk beta-diversity (Bray-Curtis p=0.040). Women with a pre-pregnancy BMI >30 kg/m2 (obese) had a greater incidence of Bacteroidetes (incidence rate ratio [IRR]: 3.70 [95% CI: 1.61-8.48]) and a reduced incidence of Proteobacteria (0.62 [0.43-0.90]), compared to overweight women (BMI 25.0-29.9 kg/m2) as assessed by multivariable Poisson regression. Increased incidence of Gemella was observed among overweight (versus healthy) mothers with gestational diabetes (5.96 [1.85-19.21]) and obese (versus healthy) mothers with impaired glucose tolerance (4.04 [1.63-10.01]). An increased incidence of Brevundimonas (16.70 [5.99-46.57]) was found in the milk of women who underwent an unscheduled C-section versus vaginal delivery. Lastly, functional gene inference demonstrated that obesity was associated with increased abundance of genes encoding for the biosynthesis of secondary metabolites in milk (coefficient=0.00028, p=0.0070). Conclusions: Mother’s milk has a diverse microbiota of which its diversity and differential abundance appear associated with maternal body size, glucose tolerance status, mode of delivery, and ethnicity. Further research is warranted to determine whether this variability in the milk microbiota impacts colonization of the infant gut. Applied & Industrial Microbiology Nutrition & Dietetics Mother’s milk microbiota body mass index gestational diabetes impaired glucose tolerance mode of delivery vaginal delivery Caesarean delivery ethnicity microbiome Figures Figure 1 Figure 2 Figure 3 Background Breastfeeding is the recommended method of feeding for all infants irrespective of whether the country of origin is low, middle, or high-income (1). Mother’s milk is a rich source of nutrients and bioactive components, such as the antimicrobial proteins lactoferrin and lysozyme, and contains an array of oligosaccharides which serve as a source of prebiotics (2–5). It is now well accepted that mother’s milk contains a rich supply of bacteria (~ 10 6 bacterial cells/mL), which are believed to play an important role in postnatal colonization of the infant’s gastrointestinal tract (gut) (6–13). Microbial composition of the gut, in turn, is associated with maturation of an infant’s gut and immune system, and aberrant gut microbial compositions have been linked to a number of short- and long-term health outcomes including diarrhea, respiratory tract infection, asthma, inflammatory bowel disease, obesity, and metabolic syndrome (14–18). There is a limited understanding of the stability of the human milk microbiota in the face of environmental influences. Despite the high prevalence and known impact on other milk constituents, no study we are aware of has examined the association between maternal glucose tolerance status, either gestational diabetes or impaired glucose tolerance, and the milk microbiota. Only a few studies to date have cross-sectionally examined other maternal factors, such as maternal body size and mode of delivery, on the microbiota composition of mature mother’s milk (collected from 1-week to 6-months post-partum) (19–23). Moreover, the findings from the few available studies are inconsistent likely due, in part, to the small number of study participants, and differing methods of milk collection and analysis (Supplementary Table 1). Of the limited studies conducted, maternal BMI and mode of delivery have been associated with the mature milk microbiota; however, many of these reports relied on small cohorts and thus their findings require replication in larger scale studies (19–23). Further, most studies were unable to employ multivariable statistical modelling to adjust for multiple potential maternal factors of interest simultaneously. Lastly, none of these studies carried out functional inference analyses to determine if maternal body size and mode of delivery also perturb the milk microbiome’s potential metabolic activities or functional capabilities. It is vital to determine if maternal metabolic (BMI, glucose tolerance status), obstetrical (mode of delivery), and demographic (ethnicity) factors impact the mother’s milk microbiota and metagenome due to the role they play in the colonization of the infant gut and the importance of a healthy gut microbiome in human health. Therefore, we set out to fill these knowledge gaps in the field. We collected a large cohort of mother’s milk samples from women prospectively enrolled in a study to investigate the impact of metabolic abnormalities and maternal nutrition in pregnancy on human milk (NCT01405547). The objective of this current study was to investigate the associations between maternal pre-pregnancy BMI (healthy, overweight, or obese), 3-month post-partum BMI, maternal glucose tolerance status in late pregnancy (gestational diabetes mellitus [GDM], impaired glucose tolerance [IGT], or normoglycemia), mode of delivery (vaginal delivery, unscheduled Caesarean delivery [C-section], or scheduled C-section), and ethnicity (white, Asian, or other) on the microbial community composition and functional capabilities of mother’s milk at three months post-partum. This research will help to elucidate the modulatory potential of mother’s milk microbiota in the face of physiological perturbations. Results Participant Description Milk samples were collected at 3 ± 1-month post-partum (mean ± standard deviation) (n = 113). Fifty-six (49.6%) mothers fed their infants their own milk exclusively at the time of milk collection, and 61 (53.9%) samples were from a complete breast expression. The mean (± standard deviation) age of the mothers was 34.2 ± 4.2 years (Table 1) with a pre-pregnancy BMI (kg/m 2 ) of 24.3 ± 4.6, which is within a healthy BMI range (18.5–24.9 kg/m 2 ). A modified oral glucose tolerance test (OGTT) administered at 30 weeks’ gestation (95% CI: 25–33 weeks) revealed that 24 (21.2%) women had GDM, 20 (17.7%) had IGT, and 69 (61.1%) had healthy glucose metabolism (normoglycemic). Among women with a healthy pre-pregnancy BMI, 12 and 16 had IGT and GDM, respectively. Among women with an overweight pre-pregnancy BMI, 5 had IGT and 5 had GDM (10 total). Lastly, among women with an obese pre-pregnancy BMI 3 had IGT and 3 had GDM (6 total; Supplementary Table 2). Sixty-four (56.6%) mothers delivered their infants vaginally, compared to the 49 (43.4%) who underwent a C-section. Following 16S rRNA gene sequencing, rarefying, and filtering, the bacterial taxa from 109 milk samples were included in the analyses. The total counts per sample were rarefied to 20,000 reads prior to calculating diversity metrics. Overall microbial composition of mother’s milk Twenty-six unique phyla-level and 292 unique genus-level taxa were identified (Figs. 1 and 2 ). Proteobacteria and Firmicutes were the most abundant phyla at 58.6 ± 27.3% and 35.6 ± 26.3%, respectively, followed by Actinobacteria (4.1 ± 4.7%), Bacteroidetes (1.4 ± 2.7%), and Fusobacteria (0.1 ± 0.3%). Pseudomonas (43.4 ± 26.0%) and Streptococcus (30.6 ± 25.3%) were the predominant genera across all samples, followed by smaller abundances of Staphylococcus (6.2 ± 11.5%), Acinetobacter (3.5 ± 7.4%), Veillonella (3.2 ± 7.2%), Gemella (1.9 ± 3.3%), Corynebacterium (1.6 ± 5.5%), Rothia (1.3 ± 2.4%), Aeromonas (0.6 ± 6.2%), and Brevundimonas (0.6 ± 5.7%). Plotting the relative abundances of taxa at the phylum (Fig. 1 ) and genus taxonomic levels (Fig. 2 ) reveals obvious inter-individual variability in the microbial composition of milk. Associations between maternal body size, glucose tolerance status, mode of delivery, ethnicity and the milk microbiota The Chao1 and Shannon indices were used to assess alpha diversity (richness and evenness, respectively) within each mother’s milk sample. No statistically significant associations were found between maternal characteristics (maternal glucose tolerance status, mode of delivery, pre-pregnancy BMI, 3-month post-partum BMI, ethnicity), and milk microbiota richness or evenness using multivariable linear regression analyses (Fig. 3 A-E; complete results in Supplementary Table 3). To further investigate associations between maternal characteristics and microbial composition, the beta-diversity of the microbiota in milk samples was assessed by principal coordinate analysis (PCoA) using the weighted UniFrac distance metric and the Bray-Curtis index of dissimilarity (Supplementary Figs. 1, 2; Supplementary Table 4 ) (24). No obvious clustering or separation based on maternal characteristics was observed; however, small but statistically significant associations between maternal pre-pregnancy BMI and beta-diversity clustering were identified (Bray-Curtis R 2 = 0.037, p = 0.044). No other statistically significant associations were found for the other maternal characteristics and beta-diversity. We assessed whether taxa abundance was associated with maternal characteristics by using multivariable Poisson regressions and accounting for multiple comparisons (Tables 2, 3, 4, 5; Supplementary Tables 5, 6). At least one maternal characteristic was associated with the differential abundance of Proteobacteria, Bacteroidetes, and Actinobacteria at the phylum level, and Staphylococcus , Veillonella , Gemella , Corynebacterium , and Brevundimonas at the genus level. Association between maternal body size and the milk microbiota Pre-pregnancy BMI (i.e., healthy, overweight, obese) was found to be most consistently associated with differentially abundant taxa after controlling for relevant maternal characteristics. Mothers categorized as obese pre-pregnancy displayed a lower incidence of Proteobacteria (incidence rate ratio [IRR]: 0.62 [95% CI: 0.43–0.90]) in their milk as compared to mothers who were overweight. Conversely, mothers who were overweight presented with an increased incidence of Proteobacteria in their milk, compared to healthy weight mothers (1.23 [1.00-1.50]). Mothers defined as obese pre-pregnancy had a greater incidence of Bacteroidetes in their milk as compared to overweight (3.70 [1.61–8.48]) or had a healthy BMI (2.56 [1.27–5.17]) mothers. When examining 3-month post-partum BMI, Actinobacteria incidence was greater in obese women versus both overweight (2.34 [1.38–3.98]) and healthy weight mothers (2.02 [1.18–3.46]). At the genus-level, women who were obese pre-pregnancy displayed a higher incidence of Staphylococcus as compared to overweight (2.50 [1.09–5.72]) or healthy weight mothers (3.15 [1.47–6.08]) (Table 2). Mothers who were obese pre-pregnancy also displayed a greater incidence of Corynebacterium in their milk versus both overweight (5.13 [1.79–14.70]) and healthy weight (4.98 [2.11–11.74]) mothers. This same relationship with Corynebacterium was seen in mothers who were obese at 3-months post-partum compared to overweight (4.84 [2.19–10.72]) and healthy weight (7.77 [2.95–20.43]) mothers. An increased incidence of Brevundimonas was also observed in mothers who were overweight pre-pregnancy vs healthy weight (8.72 [3.24–23.48]). At 3-months post-partum, women who were obese also displayed a greater incidence of Brevundimonas versus both overweight (8.89 [2.29–34.57]) and healthy (9.56 [2.17–42.22]) mothers (Table 2). Association between maternal glucose tolerance status and the milk microbiota When examining an interaction between BMI and maternal glucose tolerance status, Gemella showed an increased incidence among overweight (versus healthy) mothers with gestational diabetes (5.96 [1.85–19.21]). In addition, Gemella was increased in obese mothers with impaired glucose tolerance versus overweight (11.42 [1.49–87.67]) and versus healthy (4.04 [1.63–10.01]) mothers with impaired glucose tolerance (Table 2). Association between mode of delivery and the milk microbiota Associations between mode of delivery and the differential abundance of select taxa at the phylum and genus level were found for both pre-pregnancy and post-partum BMI models (Table 2). A greater incidence of Brevundimonas was observed in mothers who underwent an unscheduled C-section versus a vaginal delivery from both the pre-pregnancy BMI model (16.70 [5.99–46.57]) and 3-month post-partum BMI model (13.01 [4.01–42.20]). Conversely, a reduced incidence of Brevundimonas was observed in mothers who underwent a scheduled C-section versus an unscheduled C-section from both the pre-pregnancy BMI model (0.070 [0.011–0.46]) and 3-month post-partum BMI model (0.08 [0.013–0.62]). Association between maternal ethnicity and the milk microbiota Lastly, ethnicity (white, Asian, other) was associated with the differential abundance of Corynebacterium and Brevundimonas (Table 3). White mothers had a reduced incidence of both Corynebacterium (0.27 [0.12–0.59]) and Brevundimonas (0.084 [0.015–0.46]) when compared to ‘other’ mothers and Asian mothers, respectively; Asian mothers also had a reduced incidence of Corynebacterium when compared to ‘other’ mothers (0.17 [0.049–0.63]). Association between maternal body size, glucose tolerance status, mode of delivery, ethnicity and functional gene expression of the milk microbiota We carried out functional inference analyses using Piphillin to assess if there were any differences in functional capabilities of the milk microbiota based on the maternal clinical data. In contrast with the bacterial taxonomic results, the relative abundance of the 20 top KEGG pathways across all milk samples was fairly consistent (Supplementary Fig. 3). We analyzed the association between maternal clinical data and KEGG ortholog beta-diversity as well as examined the association between maternal clinical parameters and differentially-expressed KEGG pathways (Supplementary Tables 7–9). No significant results were found when examining metadata and KEGG ortholog beta-diversity (Supplementary Table 7); however, one statistically significant differentially-expressed pathway was observed (Supplementary Table 8, Supplementary Fig. 4). BMI, specifically the obese sub-category, was shown to be significantly associated with enrichment of the KEGG category “Biosynthesis of secondary metabolites” (Coefficient 0.00024, p = 0.0079). (Supplementary Fig. 4). Discussion Our results suggest that maternal factors, and most consistently maternal pre-pregnancy BMI, are associated with the microbial composition of mother’s milk. This is the first study to include maternal glucose tolerance status in the investigations of the association between maternal body size and the milk microbiota (Supplementary Table 1). Gestational diabetes, a well-known risk factor of maternal adiposity, is associated with a number of negative health outcomes, including increased risk of type 2 diabetes and metabolic syndrome in the mother, as well as large for gestational age, congenital malformations and hypoglycemia in the infant (25–28). These changes in infant health may be partially mediated by microbes transmitted from mother to infant, from both the birthing process as well as during direct breastfeeding. For this reason, it is imperative to study the relationship between these factors in order to best mitigate these maternal and infant outcomes as well as distinguish the role of body size versus glucose tolerance status on the milk microbiota and, hence, the infant. According to a recent systematic review and dose-response meta-analysis, the risk of GDM increases by 4% for every unit increase in BMI; thus, to investigate BMI without also adjusting for GDM could lead to erroneous results (28). Our results suggest that these associations extend beyond the gut microbiota and that alterations in glucose tolerance status may also perturb the composition (Tables 2, 4) of mother’s milk microbiota. Previous studies have reported associations between both type 2 diabetes and insulin resistance and the gut microbiota composition (29). Potential mechanisms of action linking impaired glucose tolerance and the gut microbial community include lipopolysaccharide-triggered inflammation, impairment of GLP-1 and GLP-2 via bacterial production of short chain fatty acids, insulin resistance triggered by bacterial synthesis and absorption of branch-chained amino acids, or the metabolism of bile acids by bacteria and their organ-specific effects (29). It is unclear how impaired glucose tolerance may modulate the bacteria in human milk and the interplay present with maternal body size. We did not find any differences in alpha diversity based on our maternal characteristics; however, we did find statistically significant differences in beta-diversity, with mother’s milk microbiota separating, or non-randomly clustering, based on pre-pregnancy BMI even after adjustment for other covariates (Supplementary Table 4, Supplementary Figs. 1 and 2). The human gut microbiota has been reported to cluster as a function of body size, but this has not yet been reported for the human milk microbiota (30). Our results demonstrating an association between maternal body size and microbial composition is consistent with other smaller scale studies on human milk microbiotas (Supplementary Table 1). Cabrera-Rubio et al. (2012) examined the association between maternal body size and the differential abundance of mother’s milk genera in a study of healthy Finnish women (n = 18) (20). They reported an increase in Staphylococcus in mother’s milk collected from obese women, which mirrors the findings in our study (Table 4). Mode of delivery was also associated with changes in mother’s milk microbiota at both the phylum and genus levels (Table 2, 4). For example, we observed greater differential abundance of Staphylococcus in mother’s milk from women who underwent a (scheduled) C-section versus vaginal delivery (Table 4). Our results are similar to that reported by Cabrera-Rubio et al. (2012, 2016). These two small cross-sectional cohorts of healthy Finnish women (n = 18, 10) showed a non-statistically significant increase in Staphylococcus in milk observed among women who delivered their infant via a scheduled C-section versus a vaginal delivery (Table 4) (19, 20). The proposed mechanism whereby mode of delivery alters the milk microbiota is via the infant oral cavity, which is colonized during either vaginal delivery or C-section; from here, retrograde inoculation of bacteria can occur from the infant’s oral cavity into the mammary gland via the suckling process with direct breastfeeding (31–34). The results of our multi-ethnic cohort revealed associations between ethnicity and specific bacterial taxa. Ethnicity and/or geographic location have been shown to be factors in determining various microbiomes of the body including the gut, oral cavity, respiratory tract, skin, and urogenital tract (35). Ethnicity and geographic location typically come with an overlay of dietary variation, making the impact of each variable challenging to separate. Only a few studies to date have assessed associations between ethnicity and the milk microbiota; however, the ethnic/geographic groups differed from our study as they generally examined Europe, Africa and the United States, making it challenging to compare findings (Tables 3, 5; Supplementary Tables 5, 6) (12,21,36,37). We used a functional inference approach to characterize the microbial genetic potential in human milk. In agreement with what has been reported for other human-associated microbiotas, the functional capacity of the human milk microbiota is more stable than its taxonomic composition (38). We then assessed whether there were specific pathways that were associated with maternal characteristics and found that maternal BMI, specifically the obese sub-category, was significantly associated with an increase in the “Biosynthesis of secondary metabolites” KEGG pathway. Microbes produce secondary metabolites, which are small, bioactive molecules, not necessary for growth or development but are instead involved in microbe-host or microbe-microbe interactions (39,40). Indeed, many of the genes in the biosynthesis of secondary metabolites pathway encode for the biosynthesis of antibiotics (41). Increased production of these secondary metabolites could impact the overall microbial composition/function in these feeding infants. These potential alterations could represent a mechanism by which maternal BMI impacts infant health over both the short- and long-term and warrants future investigation. Human milk is considered a low biomass sample and, for this reason, may be more affected by sample processing than higher biomass samples, such as stool. To address this concern, we used PCoA plots to visualize clustering, or lack thereof, of our milk samples and negative controls (Supplementary Fig. 5). Our negative controls were seen to cluster away from the samples, suggesting that our results do not arise from technical contaminates, which was confirmed using Adonis analyses to statistically corroborate that our samples clustered away from the negative controls (Weighted UniFrac R 2 = 0.07, p = 0.0001; Bray-Curtis R 2 = 0.10, p = 0.0001, Supplementary Fig. 5). Strengths of the current study include its relatively large sample size, the diverse ethnicity of women included, clinical examination via an OGTT, and enrichment of the cohort with women of varying body size who had abnormal glucose tolerance status. These strengths allowed for a more fulsome investigation using multivariable statistics to determine how each maternal factor is independently associated with the milk microbiome. Limitations of the current study include a lack of disinfection of the mother’s breast, peri-areolar region, and/or nipple prior to milk sampling, and single time-point sampling. The microbes identified in the milk from the present study likely include bacteria from the skin microbiota. Practically, however, mothers do not disinfect their breast prior to pumping and storing milk for their infant, nor do they disinfect prior to breastfeeding. Therefore, the mother’s milk microbiota as collected in the current study is likely a more accurate depiction of what the infant would receive. Secondly, we could not adjust for all variables of interest to due sample size constraints, so we are likely missing additional determinants of both the milk microbiota and functional capabilities. Lastly, our study is limited by its cross-sectional design and thus we cannot assess how the milk microbiome changes over time. It is possible that the associations we identified between maternal factors and microbial composition in milk are not transitory and change across the course of lactation. Conclusions Our study found that mother’s milk has a highly personalized microbiota with high inter-individual variability. Expressed mother’s milk at both the phylum and genus levels appear to be related to maternal metabolic and obstetrical factors. Surprisingly, glucose tolerance status was significantly associated with fewer microbiota parameters than anticipated. Most consistently, maternal pre-pregnancy BMI, despite glucose tolerance status, was associated with the differential abundance of various taxa in mother’s milk and potentially the production of bacterial secondary metabolites as well. To understand the clinical significance of these findings, future research should explore the impact of differences in the microbial composition of mother’s milk on colonization of the infant gut microbiome and infant health. Methods Study participants and design To address the research objectives of this study, we used maternal metabolic and obstetrical health data and bio-banked human milk samples available from a previously conducted prospective cohort study (ClinicalTrials.gov Identifier: NCT01405547); a detailed description of the study protocol has been previously published (42). Pregnant women (n = 216) were recruited from outpatient clinics at Mount Sinai Hospital in Toronto, Canada and completed a 3-hour 100 g OGTT between March 2009 and July 2010. In total, 117 women donated a milk sample at 3 months post-partum, with 113 samples available for this study (Supplementary Fig. 6). Women were eligible for inclusion in the original study if they were ≥ 20 years of age and had an intention to breastfeed. Exclusion criteria included pre-existing diabetes diagnosis, current use of insulin, or completion of an OGTT prior to recruitment (43). By design, mothers were recruited from clinics which follow higher risk pregnancies with a greater risk of either GDM or IGT diagnosis. Written informed consent was obtained from all women and the study protocol was approved by the Mount Sinai Hospital Human Research Ethics Board (42). Collection of Demographic, Anthropometric and Metabolic Data During the first study visit, which occurred in late pregnancy (30 weeks [95% CI: 25–33 weeks]), demographic and anthropometric data were collected (e.g. age, ethnicity, weight, height); mothers were asked to recall their pre-pregnancy weight. All pregnant women in Canada are screened for GDM by way of a 50 g glucose challenge test (GCT). If the plasma glucose concentration at 1-hour post-glucose load is ≥7.8 mmol/L, the patient is then referred for a diagnostic OGTT. Contrary to standard obstetrical practice, all women completed a 3-hour 100 g OGTT in the current study during their first study visit regardless of whether or not they completed a GCT. The OGTT involved having blood samples drawn at fasting, 30, 60, 90, 120- and 180-minutes post-glucose load. Women were then diagnosed with either GDM, IGT, or as normoglycemic based on the following glycemic thresholds: 1) GDM diagnosis = 2 or more of the following: fasting blood glucose ≥ 5.8 mmol/L, 1-hour blood glucose ≥ 10.6 mmol/L, 2-hour blood glucose ≥ 9.2 mmol/L, or 3-hour blood glucose ≥ 8.1 mmol/L, or 2) IGT diagnosis would exceed only one of the previous thresholds, or 3) normoglycemic = normal OGTT (42). Mother’s milk collection, processing and amplification At the three-month post-partum research visit, mothers were asked to pump a complete breast expression of milk using a double electric breast pump (Medela Inc., Illinois, USA) with a sterile pumping kit. Mothers were instructed not to pump or breastfeed their infant for 2 hours before the study visit. Samples of whole human milk were then divided into aliquots and stored at -80 °C until the time of analyses. DNA was extracted from human milk using the NucleoSpin Food DNA Isolation Kit (Macherey-Nagel, Pennsylvania, USA) according to manufacturer’s instructions with modifications as we have described previously (44). Due to the small concentration of DNA in human milk, an elution buffer volume of 30 µL, instead of the recommended 100 µL, was used to ensure adequate DNA concentrations for downstream PCR. PCR amplification of the V4 hypervariable region was performed using the forward primer (515F) 5’AATGATACGGCGACCACCGAGATCTACACTATGGTA ATTGTGTGCCAGCMGCCGCGGTAA and reverse primer (806R) 5’CAAGCAGA AGACGGCATACGAGATA GTCAGTCAGCCGGACTACHVGGGTWTCTAAT (45). PCR reactions were set up following the manufacturer’s recommendations (Roche) including 12.5 µL of KAPA2G Robust HotStart ReadyMix, 1.5 µL of 10 µM forward and 1.5 µL of 10 µM reverse primer, 3.5 µL of sterile water and 6 µL of DNA. Amplification of the V4 hypervariable region of the 16S rRNA gene involved 28 cycles of PCR: 95 °C for 3 minutes, 25–30 cycles of 95 °C for 15 seconds, 50 °C for 15 seconds and 72 °C for 15 seconds, followed by a 5 minute 72 °C extension (different numbers of cycles between PCR runs were adjusted for statistically). All amplifications were completed in triplicate and all amplicons were run on a 1% TBE agarose gel to ensure accurate amplification (amplicon size ~ 390 bp). A negative control without template DNA and a positive control with DNA from a known bacterial species ( Pseudomonas aeruginosa ) were also included to confirm the amplification quality. Bands of the same size and intensity were pooled and quantified to create the pooled sequence library. Purification of the pooled library was completed with AMPure XP beads (0.8X volume of beads to 1X volume of library DNA) following the manufacturer’s protocol. The purified library was quantified using the Qubit High Sensitivity DNA Kit (Thermo Fisher). The quantified library was loaded on an Illumina MiSeq and sequenced using the MiSeq-V2-300 cycle chemistry to generate 150 PE reads. Bioinformatics analyses The raw paired end sequences from the MiSeq instrument have been deposited to the NCBI Sequence Read Archive ( http://www.ncbi.nlm.nih.gov/sra ) under accession number PRJNA516669. The UPARSE pipeline (USEARCH) was used for sequence analysis. Raw paired end sequences were assembled (-fastq_mergepairs; -fastq_merge_maxee = 1.0), filtered (-fastq_filter; -fastq_maxee = 0.5) and sequences shorter than 225 base pairs were removed (-fastq_filter; -fastq_minlen 225) (46). Sequences were then de-replicated and sorted using USEARCH (-derep_full; -sortybysize). Chimeric sequences in the OTUs were detected and removed using the Ribosomal Database Project (RDP) 16S gold database (USEARCH), while ensuring the number of false positive chimeras detected was minimized (47). Sequences were then grouped together into Operational Taxonomic Units (OTUs) at 97% similarity (-usearch_global). Taxonomy was assigned to these OTUs (RDP 16S gold database) (-utax) and OTU fasta sequences were aligned using PyNast via a QIIME python script (align_seqs.py). A phylogenetic tree was assembled using the FastTree QIIME python script (make_phylogeny.py) (48). Data analysis and statistics The phyloseq package (1.25.2) in R (version 3.4.1) was used to analyze microbiota composition (49). OTUs that only appeared once or twice (singletons and doubletons) were removed and all OTUs were rarefied to 20,000 reads prior to calculating relative abundances at different taxonomic levels, alpha diversities and beta diversities using phyloseq. Statistically significant differences between the alpha diversities (Chao1/Shannon indices determined in R) and maternal metabolic or obstetrical characteristics were determined using multivariable linear regression models (PROC MIXED) in SAS version 9.4. Independent variables included in the models were: maternal BMI (healthy = 18.5–24.9 kg/m 2 , overweight = 25-29.9 kg/m 2 , obese = > 30 kg/m 2 ), maternal glucose tolerance status (GDM, IGT, normoglycemic), mode of delivery (vaginal, unscheduled C-section, scheduled C-section), DNA extraction batch, and PCR sequencing batch. Separate statistical models were built using pre-pregnancy and 3-month post-partum BMI as covariates, due to concerns about collinearity. An interaction term between BMI and maternal glucose tolerance status was also tested in each model and removed if it was non-significant. Due to our sample size and the number of covariates we wished to test, separate models for ethnicity (white, Asian, other) were run that adjusted for DNA extraction and PCR sequencing batches, but no other covariates. Multicollinearity was assessed between independent variables in all models, using a variance inflation cut-off of > 5. The significance level was set at p < 0.05. Of note, 6 mothers with a pre-pregnancy BMI between 18.0-18.4 kg/m 2 were placed in the “healthy BMI” group for all analyses. Beta diversities and principal coordinate analysis (PCoA) were also ascertained in phyloseq and statistical significance based on maternal characteristics was determined using the adonis function in vegan (version 2.5-3) (24). Adonis assesses the amount of variation explained by each metadata variable, such as maternal BMI or glucose tolerance status; all variables were run individually and together in adonis to adjust for one another. The interaction term between BMI and glucose tolerance status was also tested and removed if non-significant. Four patient’s samples were missing the post-partum BMI data and thus we used their pre-pregnancy BMI for the post-partum analyses. Again, the significance level was set at p < 0.05. Multivariable Poisson regression models (PROC GENMOD) were run in SAS version 9.4 to assess differential abundance at the phylum and genus levels based on maternal characteristics. The Benjamini-Yekutieli cut point approach was used to account for multiple testing. A p ≤ 0.022 at the phylum level (5 tests) and p ≤ 0.017 (10 tests) at the genus level were considered statistically significant for the overall group effect. If the overall group-adjusted p -value was significant, pairwise comparisons were conducted and a pairwise p < 0.05 was considered statistically significant. Piphillin: Functional analysis of human milk microbiota Piphillin, a metagenomics inference tool, was used to infer functional capabilities in milk samples ( https://piphillin.secondgenome.com/ ) (50). In this study, the Kyoto Encyclopedia of Genes and Genomes (KEGG; https://www.genome.jp/kegg/ ) was used as a reference database to retrieve gene copy numbers and create a gene feature table from the 16S rRNA sequence data. Statistically significant associations between maternal characteristics and KEGG pathways where assessed in two ways: first, examining the association between maternal characteristics and KEGG orthologs beta-diversity using Adonis in R ( p < 0.05), and second, investigating metadata associated with differentially-expressed functional pathways using MaAsLin2 in R ( p < 0.1). List of Abbreviations BMI Body mass index GDM Gestational diabetes mellitus IGT Impaired glucose tolerance Caesarean delivery C-section OGTT Oral glucose tolerance test rRNA Ribosomal RNA PCoA Principal coordinates analysis OTU Operational taxonomic unit Declarations Ethics Approval and Consent to participate : The study protocol was approved by the Mount Sinai Hospital Research Ethics Board. Consent for publication: N/A Availability of data and materials The dataset supporting the conclusions of this article is available in the NCBI Sequence Read Archive ( http://www.ncbi.nlm.nih.gov/sra ) under accession number PRJNA516669. Competing Interests None to declare. Funding CIHR MOP 125997; CDA Operating Grant #OG-3-09-2393. Author’s contributions: SHL, AJH, BZ, and DLO designed the prospective cohort study, SHL coordinated data and milk collection. LLN and DLO designed the present study and LLN, JB, JKC, and PWW worked out laboratory methods and conducted the 16S rRNA sequencing. JKC and PWW performed the bioinformatics, and LLN, JB, MRA, and AK performed the data analysis and statistics. LLN wrote the first draft of the paper. All authors provided important critical review and DLO had responsibility for the final manuscript. Acknowledgements: We would like to thank Michael Jory for his assistance in setting up bioinformatic software in our laboratory References Victora CG, Bahl R, Barros AJD, França GVA, Horton S, Krasevec J, et al. Breastfeeding in the 21st century: epidemiology, mechanisms, and lifelong effect. The Lancet. 2016;387(10017):475–90. Bode L. Human milk oligosaccharides: every baby needs a sugar mama. Glycobiology. 2012;22(9):1147–62. Riskin A, Almog M, Peri R, Halasz K, Srugo I, Kessel A. Changes in immunomodulatory constituents of human milk in response to active infection in the nursing infant. Pediatr Res. 2012;71(2):220–5. Wagner CL, Taylor SN, Johnson D. Host factors in amniotic fluid and breast milk that contribute to gut maturation. Clin Rev Allergy Immunol. 2008;34(2):191–204. Sabbaj S, Ibegbu CC, Kourtis AP. Cellular immunity in breast milk: implications for postnatal transmission of HIV-1 to the infant. Adv Exp Med Biol. 2012;743:161–9. Arrieta M-C, Stiemsma LT, Amenyogbe N, Brown EM, Finlay B. The intestinal microbiome in early life: health and disease. Front Immunol. 2014;5:427. Azad MB, Konya T, Maughan H, Guttman DS, Field CJ, Chari RS, et al. Gut microbiota of healthy Canadian infants: profiles by mode of delivery and infant diet at 4 months. CMAJ. 2013;185(5):385–94. Boix-Amorós A, Collado MC, Mira A. Relationship between milk microbiota, bacterial load, macronutrients, and human cells during lactation. Front Microbiol. 2016;7:492. Fernández L, Langa S, Martín V, Maldonado A, Jiménez E, Martín R, et al. The human milk microbiota: origin and potential roles in health and disease. Pharmacol Res. 2013;69(1):1–10. Jost T, Lacroix C, Braegger CP, Rochat F, Chassard C. Vertical mother-neonate transfer of maternal gut bacteria via breastfeeding. Environ Microbiol. 2014;16(9):2891–904. Murphy K, Curley D, O’Callaghan TF, O’Shea C-A, Dempsey EM, O’Toole PW, et al. The composition of human milk and infant faecal microbiota over the first three months of life: a pilot study. Sci Rep. 2017;7:40597. Pannaraj PS, Li F, Cerini C, Bender JM, Yang S, Rollie A, et al. Association Between breast milk bacterial communities and establishment and development of the infant gut microbiome. JAMA Pediatr. 2017;171(7):647–54. Vallès Y, Artacho A, Pascual-García A, Ferrús ML, Gosalbes MJ, Abellán JJ, et al. Microbial succession in the gut: directional trends of taxonomic and functional change in a birth cohort of Spanish infants. PLoS Genet. 2014;10(6):e1004406. Binns C, Lee M, Low WY. The long-term public health benefits of breastfeeding. Asia Pac J Public Health. 2016;28(1):7–14. Dieterich CM, Felice JP, O’Sullivan E, Rasmussen KM. Breastfeeding and health outcomes for the mother-infant dyad. Pediatr Clin North Am. 2013;60(1):31–48. WHO. Short-term effects of breastfeeding: a systematic review on the benefits of breastfeeding on diarrhoea and pneumonia mortality. 2019. https://www.who.int/maternal_child_adolescent/documents/breastfeeding_short_term_effects/en/. Accessed 22 January 2019. WHO. Long-term effects of breastfeeding: a systematic review. 2019. https://www.who.int/maternal_child_adolescent/documents/breastfeeding_long_term_effects/en/. Accessed 22 January 2019. Uwaezuoke SN, Eneh CI, Ndu IK. Relationship between exclusive breastfeeding and lower risk of childhood obesity: a narrative review of published evidence. Clin Med Insights Pediatr. 2017;11:1179556517690196. Cabrera-Rubio R, Mira-Pascual L, Mira A, Collado MC. Impact of mode of delivery on the milk microbiota composition of healthy women. J Dev Orig Health Dis. 2016;7(1):54–60. Cabrera-Rubio R, Collado MC, Laitinen K, Salminen S, Isolauri E, Mira A. The human milk microbiome changes over lactation and is shaped by maternal weight and mode of delivery. Am J Clin Nutr. 2012;96(3):544–51. Kumar H, du Toit E, Kulkarni A, Aakko J, Linderborg KM, Zhang Y, et al. Distinct patterns in human milk microbiota and fatty acid profiles across specific geographic locations. Front Microbiol. 2016;7:1619. Urbaniak C, Angelini M, Gloor GB, Reid G. Human milk microbiota profiles in relation to birthing method, gestation and infant gender. Microbiome. 2016;6;4:1. Moossavi S, Sepehri S, Robertson B, Bode L, Goruk S, Field CJ, et al. Composition and variation of the human milk microbiota are influenced by maternal and early-life factors. Cell Host Microbe. 2019;25(2):324-335.e4. Oksanen J, Blanchet FG, Friendly M, Kindt R, Legendre P, McGlinn D, et al. vegan: Community Ecology Package. 2019. https://CRAN.R-project.org/package=vegan Albrecht SS, Kuklina EV, Bansil P, Jamieson DJ, Whiteman MK, Kourtis AP, et al. Diabetes trends among delivery hospitalizations in the U.S., 1994-2004. Diabetes Care. 2010;33(4):768–73. Metzger BE, Gabbe SG, Persson B, Buchanan TA, Catalano PA, et al. International association of diabetes and pregnancy study groups recommendations on the diagnosis and classification of hyperglycemia in pregnancy. Diabetes Care. 2010;33(3):676–82. Landon MB, Mele L, Spong CY, Carpenter MW, Ramin SM, Casey B, et al. The relationship between maternal glycemia and perinatal outcome. Obstet Gynecol. 2011;117(2 Pt 1):218–24. Najafi F, Hasani J, Izadi N, Hashemi‐Nazari S-S, Namvar Z, Mohammadi S, et al. The effect of prepregnancy body mass index on the risk of gestational diabetes mellitus: A systematic review and dose-response meta-analysis. Obes Rev. 2019;20(3):472–86. Utzschneider KM, Kratz M, Damman CJ, Hullar M. Mechanisms linking the gut microbiome and glucose metabolism. J Clin Endocrinol Metab. 2016;101(4):1445–54. Sze MA, Schloss PD. Looking for a signal in the noise: revisiting obesity and the microbiome. mBio. 2016;7(4). Rodríguez JM. The origin of human milk bacteria: is there a bacterial entero-mammary pathway during late pregnancy and lactation? Adv Nutr. 2014;5(6):779–84. Fernández L, Langa S, Martín V, Maldonado A, Jiménez E, Martín R, et al. The human milk microbiota: origin and potential roles in health and disease. Pharmacol Res. 2013;69(1):1–10. Jeurink PV, van Bergenhenegouwen J, Jiménez E, Knippels LMJ, Fernández L, Garssen J, et al. Human milk: a source of more life than we imagine. Benef Microbes. 2013;4(1):17–30. Biagi E, Quercia S, Aceti A, Beghetti I, Rampelli S, Turroni S, et al. The bacterial ecosystem of mother’s milk and infant’s mouth and gut. Front Microbiol. 2017;8:1214. Gupta VK, Paul S, Dutta C. Geography, ethnicity or subsistence-specific variations in human microbiome composition and diversity. Front Microbiol. 2017;8:1162. Drago L, Toscano M, De Grandi R, Grossi E, Padovani EM, Peroni DG. Microbiota network and mathematic microbe mutualism in colostrum and mature milk collected in two different geographic areas: Italy versus Burundi. ISME J. 2017;11(4):875–84. Lackey KA, Williams JE, Meehan CL, Zachek JA, Benda ED, Price WJ, et al. What’s normal? microbiomes in human milk and infant feces are related to each other but vary geographically: The INSPIRE study. Front Nutr. 2019;6(45). Structure, function and diversity of the healthy human microbiome. Nature. 2012;486(7402):207–14. Wang S, Li N, Zou H, Wu M. Gut microbiome-based secondary metabolite biosynthetic gene clusters detection in Parkinson’s disease. Neurosci Lett. 2019;696:93–8. Osbourn A. Secondary metabolic gene clusters: evolutionary toolkits for chemical innovation. Trends Genet. 2010;26(10):449–57. O’Brien J, Wright GD. An ecological perspective of microbial secondary metabolism. Curr Opin Biotechnol. 2011;22(4):552–8. Ley SH, O’Connor DL, Retnakaran R, Hamilton JK, Sermer M, Zinman B, et al. Impact of maternal metabolic abnormalities in pregnancy on human milk and subsequent infant metabolic development: methodology and design. BMC Public Health. 2010;10:590. Ley SH, Hanley AJ, Sermer M, Zinman B, O’Connor DL. Associations of prenatal metabolic abnormalities with insulin and adiponectin concentrations in human milk. Am J Clin Nutr. 2012;95(4):867–74. LeMay-Nedjelski L, Copeland J, Wang PW, Butcher J, Unger S, Stintzi A, et al. Methods and strategies to examine the human breastmilk microbiome. Methods Mol Biol Clifton NJ. 2018;1849:63–86. Caporaso JG, Lauber CL, Walters WA, Berg-Lyons D, Huntley J, Fierer N, et al. Ultra-high-throughput microbial community analysis on the Illumina HiSeq and MiSeq platforms. ISME J. 2012;6(8):1621–4. Edgar RC. Search and clustering orders of magnitude faster than BLAST. Bioinforma Oxf Engl. 2010;26(19):2460–1. Wang Q, Garrity GM, Tiedje JM, Cole JR. Naïve bayesian classifier for rapid assignment of rrna sequences into the new bacterial taxonomy. Appl Environ Microbiol. 2007;73(16):5261–7. Price LB, Liu CM, Melendez JH, Frankel YM, Engelthaler D, Aziz M, et al. Community analysis of chronic wound bacteria using 16s rrna gene-based pyrosequencing: impact of diabetes and antibiotics on chronic wound microbiota. PLoS ONE. 2009;4(7). McMurdie PJ, Holmes S. Phyloseq: a bioconductor package for handling and analysis of high-throughput phylogenetic sequence data. Pac Symp Biocomput Pac Symp Biocomput. 2012;235–46. Iwai S, Weinmaier T, Schmidt BL, Albertson DG, Poloso NJ, Dabbagh K, et al. Piphillin: improved prediction of metagenomic content by direct inference from human microbiomes. PloS One. 2016;11(11):e0166104. Tables Table 1 . Baseline characteristics of mothers Baseline variables n=113 Mean age (y), mean ± SD 34.2 ± 4.2 Ethnicity, No. (%) White 64 (56.6%) Asian (Chinese, Korean, Japanese, Filipino) 27 (23.9%) Other (South Asian, black, other) 22 (19.5%) Pre-pregnancy BMI* (kg/m 2 ), Mean ± SD 24.3 ± 4.6 Obese (>30kg/m 2 ), No. (%) 11 (9.7%) Overweight (25-29.9kg/m 2 ), No (%) 30 (26.5%) Healthy (18.5-24.9kg/m 2 ), No (%) 72 (63.7%) 3-month post-partum BMI* (kg/m 2 ), Mean ± SD 26.4 ± 5.2 Obese (>30kg/m 2 ), No. (%) 17 (15.0%) Overweight (25-29.9kg/m 2 ), No. (%) 46 (40.7%) Healthy (18.5-24.9kg/m 2 ), No. (%) 50 (44.2%) Glucose tolerance status, No. (%) Gestational diabetes mellitus 24 (21.2%) Impaired glucose tolerance 20 (17.7%) Normoglycemic 69 (61.1%) Mode of delivery, No. (%) Vaginal 64 (56.6%) Scheduled Caesarean section 21 (18.6%) Unscheduled Caesarean section 28 (24.8%) *BMI= body mass index Table 2 . Differential abundance of top 5 phyla and top 10 genera based on maternal BMI. Taxa Group effect p -value Pairwise comparison IRR 95% CI Pairwise comparison p -value Pre-pregnancy BMI Phylum Proteobacteria 0.020 Obese vs overweight 0.62 0.43-0.90 0.0012 Overweight vs healthy 1.23 1.00-1.50 0.045 Bacteroidetes 0.0051 Obese vs overweight 3.70 1.61-8.48 0.002 Obese vs healthy 2.56 1.27-5.17 0.0086 Genus Staphylococcus 0.011 Obese vs overweight 2.50 1.09-5.72 0.031 Obese vs healthy Overweight vs healthy 3.15 5.96 1.47-6.80 1.85-19.21 0.0032 0.0028 Corynebacterium 0.00030 Obese vs overweight 5.13 1.79-14.70 0.0023 Obese vs healthy 4.98 2.11-11.74 0.0002 Brevundimonas <0.0001 <0.0001 Overweight vs healthy Unscheduled C-section vs vaginal Scheduled C-section vs unscheduled C-section 8.72 16.70 0.07 3.24-23.48 5.99-46.57 0.011-0.46 <0.0001 <0.0001 0.0053 3-month post-partum BMI Phylum Actinobacteria 0.0058 Obese vs overweight 2.34 1.38-3.98 0.0017 Obese vs healthy 2.02 1.18-3.46 0.010 Genus Corynebacterium <0.0001 Obese vs overweight 4.84 2.19-10.72 0.0001 Obese vs healthy 7.77 2.95-20.43 <0.0001 Brevundimonas <0.0001 0.00050 Obese vs overweight Obese vs healthy Unscheduled C-section vs vaginal Scheduled C-section vs unscheduled C-section 8.89 9.56 13.01 0.08 2.29-34.57 2.17-42.22 4.01-42.20 0.013-0.62 0.0016 0.0029 <0.0001 0.015 Separate Poisson regression models were run for pre-pregnancy BMI and 3-month post-partum BMI, while adjusting for maternal glucose tolerance status, mode of delivery, DNA extraction batch, and PCR sequencing batch. Statistically significant main group effect findings shown only (group effect: p≤0.022 for phylum, p≤0.017 for genus; pairwise comparison: p<0.05). Abbreviations: confidence interval, CI; incidence rate ratio, IRR. Table 3. Differential abundance of top 5 phyla and top 10 genera based on ethnicity.   Taxa Group effect  p-value   Pairwise comparison  IRR 95% CI Pairwise comparison  p-value   Phylum           Corynebacterium 0.0008   White vs other Asian vs other   0.27   0.17      0.12-0.59   0.049-0.63   0.0010                 0.0075   Brevundimonas  0.0051 White vs Asian   0.084 0.015-0.46 0.0042   Ethnicity was investigated for all taxa and models were adjusted for DNA extraction and PCR sequencing batch effects. Statistically significant findings shown only (group effect: p≤0.022 for phylum, p≤0.017 for genus; pairwise comparison: p<0.05). Abbreviations: confidence interval, CI; incidence rate ratio, IRR. Table 4 . Differential abundance of top 5 phyla and top 10 genera showing results with non-significant group effect p-values but significant pairwise comparison p-values. Taxa Group effect p -value Pairwise comparison IRR 95% CI Pairwise comparison p -value Pre-pregnancy BMI Phylum Firmicutes 0.060 Obese vs overweight 1.76 1.06-2.94 0.030 Actinobacteria 0.039 Obese vs overweight 2.23 1.19-4.17 0.012 Bacteroidetes 0.070 0.066 Obese vs healthy Gestational diabetes vs normoglycemia Scheduled C-section vs vaginal 1.76 0.34 2.16 1.01-3.04 0.14-0.85 1.12-4.14 0.040 0.021 0.021 Genus Pseudomonas 0.055 Obese vs overweight 0.63 0.41-0.96 0.032 Streptococcus Staphylococcus Veillonella 0.083 0.060 0.029 Overweight vs healthy Scheduled C-section vs vaginal Obese vs overweight Obese vs healthy 0.59 2.43 3.88 2.91 0.37-0.95 1.13-5.21 1.25-12.11 1.18-7.14 0.029 0.022 0.019 0.020 3-month post-partum BMI Phylum Bacteroidetes 0.10 Scheduled C-section vs vaginal 2.16 1.05-4.44 0.037 Genus Staphylococcus 0.029 Obese vs overweight 2.59 1.25-5.38 0.011 0.023 Scheduled C-section vs vaginal 2.62 1.29-5.35 0.0079 Separate Poisson regression models were run for pre-pregnancy BMI and 3-month post-partum BMI, while adjusting for maternal glucose tolerance status, mode of delivery, DNA extraction batch, and PCR sequencing batch. All models were run testing for interaction terms between BMI and maternal glucose tolerance status. Statistically significant findings shown only (group effect: p≤0.022 for phylum, p≤0.017 for genus; pairwise comparison: p<0.05). Abbreviations: confidence interval, CI; incidence rate ratio, IRR. Table 5 . Differential abundance of top 5 phyla and top 10 genera based on ethnicity showing results with non-significant group effect p-values but significant pairwise comparison p-values. Taxa Group effect p -value Pairwise comparison IRR 95% CI Pairwise comparison p -value Phylum Gemella 0.073 White vs Asian 0.45 0.22-0.95 0.037 Aeromonas 0.022 Asian vs other 0.020 0.0007-0.59 0.023 Ethnicity was investigated for all taxa and models were adjusted for DNA extraction and PCR sequencing batch effects. Statistically significant findings shown only (group effect: p≤0.022 for phylum, p≤0.017 for genus; pairwise comparison: p<0.05). Abbreviations: confidence interval, CI; incidence rate ratio, IRR. Supplementary Files SupplementaryFiguresPaper1Nov252019.pptx Supplementaryfiguresandtables.docx Paper1SupplementaryNov2019.xlsx Cite Share Download PDF Status: Published Journal Publication published 20 Jul, 2020 Read the published version in BMC Microbiology → Version 1 posted Editorial decision: Major revision 21 Apr, 2020 Review # 1 received at journal 05 Jan, 2020 Reviewers invited by journal 09 Dec, 2019 Reviewer # 1 agreed at journal 09 Dec, 2019 Editor assigned by journal 02 Dec, 2019 Submission checks completed at journal 01 Dec, 2019 Editor invited by journal 01 Dec, 2019 First submitted to journal 29 Nov, 2019 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-17184","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research article","associatedPublications":[],"authors":[{"id":405715,"identity":"0747a924-4e72-4f4c-82d7-a8785994e6ac","order_by":1,"name":"Lauren LeMay-Nedjelski","email":"","orcid":"","institution":"University of Toronto","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Lauren","middleName":"","lastName":"LeMay-Nedjelski","suffix":""},{"id":405716,"identity":"b3b14da1-b97e-4149-aed6-0c0baec16c13","order_by":2,"name":"James Butcher","email":"","orcid":"","institution":"University of Ottawa","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"James","middleName":"","lastName":"Butcher","suffix":""},{"id":405717,"identity":"bce8b462-29db-4cc7-98aa-ae14926c13f9","order_by":3,"name":"Sylvia H. Ley","email":"","orcid":"","institution":"Tulane University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Sylvia","middleName":"H.","lastName":"Ley","suffix":""},{"id":405718,"identity":"b897f7cd-16df-4555-b151-f93862cb8dd1","order_by":4,"name":"Michelle R. Asbury","email":"","orcid":"","institution":"University of Toronto","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Michelle","middleName":"R.","lastName":"Asbury","suffix":""},{"id":405719,"identity":"e670b462-b633-409c-ba7d-d388e27bb5a6","order_by":5,"name":"Anthony J. Hanley","email":"","orcid":"","institution":"University of Toronto","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Anthony","middleName":"J.","lastName":"Hanley","suffix":""},{"id":405720,"identity":"aec5defd-c010-4e9d-9913-fa3f3830f2d6","order_by":6,"name":"Alex Kiss","email":"","orcid":"","institution":"University of Toronto","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Alex","middleName":"","lastName":"Kiss","suffix":""},{"id":405721,"identity":"ab4bc761-1b85-4fba-9506-054f08f210ec","order_by":7,"name":"Sharon Unger","email":"","orcid":"","institution":"Mount Sinai Hospital","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Sharon","middleName":"","lastName":"Unger","suffix":""},{"id":405722,"identity":"bfd4d044-6f30-4445-a976-9d5e84084926","order_by":8,"name":"Julia K. Copeland","email":"","orcid":"","institution":"University of Toronto","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Julia","middleName":"K.","lastName":"Copeland","suffix":""},{"id":405723,"identity":"4d173e5d-28f8-4466-b158-98fdb383539f","order_by":9,"name":"Pauline W. Wang","email":"","orcid":"","institution":"University of Toronto","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Pauline","middleName":"W.","lastName":"Wang","suffix":""},{"id":405724,"identity":"a190d304-2b6d-4788-a7f4-1b0617d344c0","order_by":10,"name":"Bernard Zinman","email":"","orcid":"","institution":"Mount Sinai Hospital","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Bernard","middleName":"","lastName":"Zinman","suffix":""},{"id":405725,"identity":"a94e3f01-c6bd-4447-b956-0608460ce8dd","order_by":11,"name":"Alain Stintzi","email":"","orcid":"","institution":"University of Ottawa","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Alain","middleName":"","lastName":"Stintzi","suffix":""},{"id":405726,"identity":"199d8afd-7305-4805-8501-e999b3805e7c","order_by":12,"name":"Deborah L. O’Connor","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA90lEQVRIiWNgGAWjYDCCAzxgEs6XI12LMQMbmDYgXktiAyEtfMd7Dz6uqLnDwM9++Njjgop76RvuNx/78HHHHzkG9sMPsGmRPHMu2fDMsWcMkj1p6cYzzhTnbjjGljxz5hkDYwaeNKxWGdzIMZNsYDsMZPCYSfO2JQC18Bgz87YZJDZIYHedwf03QC3/EFrSDRBa2D9gt4XHTLKxDaElAUkLD1ZbJM/kJRs29h3mAfolTZrnTILhzGNpyYwz24yN2XhyCrCH2NmDDxu+HZYDhZg0T0WCPN/hw4cZPrbJAUWOb8AaylDAgynEhk/9KBgFo2AUjAK8AACp4FydgeDljwAAAABJRU5ErkJggg==","orcid":"https://orcid.org/0000-0001-6331-091X","institution":"University of Toronto","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"Deborah","middleName":"L.","lastName":"O’Connor","suffix":""}],"badges":[],"createdAt":"2020-03-11 13:52:10","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-17184/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-17184/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1186/s12866-020-01901-9","type":"published","date":"2020-07-20T12:00:00+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":646249,"identity":"aefe2e2a-ea40-4fd1-b760-395aa040c5ac","added_by":"auto","created_at":"2020-03-13 18:35:37","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":75402,"visible":true,"origin":"","legend":"Microbial relative abundance in mother’s milk at the phylum level. The relative abundances of bacterial phyla in collected mother’s milk samples (n=109) are visualized using bar plots. For simplicity, only the most abundant 5 phyla are displayed with other phyla merged into the Other category.","description":"","filename":"fig1.png","url":"https://assets-eu.researchsquare.com/files/rs-17184/v1/fig1.png"},{"id":646250,"identity":"8955f9e8-1be1-4345-8f4f-e4ab39c8fed0","added_by":"auto","created_at":"2020-03-13 18:35:37","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":127583,"visible":true,"origin":"","legend":"Microbial relative abundance in mother’s milk at the genus level. The relative abundances of bacterial genera in collected mother’s milk samples (n=109) are visualized using bar plots. For simplicity, only the most abundant 10 genera are displayed with other genera merged into the Other category.","description":"","filename":"fig2.png","url":"https://assets-eu.researchsquare.com/files/rs-17184/v1/fig2.png"},{"id":646252,"identity":"cf32412b-6e61-4286-bda6-133d7f9f48f8","added_by":"auto","created_at":"2020-03-13 18:35:38","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":17766,"visible":true,"origin":"","legend":"Mother’s milk microbiota alpha diversity\nThe bacterial richness (Chao1 index) and evenness (Shannon index) of each mother’s milk sample are plotted using box and whisker plots (mid-line = median; upper and lower bounds of the box = first and third quartile) as a function of (A) maternal glucose tolerance, (B) mode of delivery, (C) pre-pregnancy BMI, (D) 3-month post-partum BMI, (E) ethnicity. Multivariable linear regression analyses revealed no associations between the richness or evenness of the milk microbiota and maternal metabolic and obstetrical characteristics. Abbreviations: GDM, gestational diabetes mellitus, IGT, impaired glucose tolerance; Sched CS, scheduled C-section; Unsched CS, unscheduled C-section.","description":"","filename":"fig3.png","url":"https://assets-eu.researchsquare.com/files/rs-17184/v1/fig3.png"},{"id":13493392,"identity":"e7b35a8d-35d8-46b4-9569-aa399d7f7e6b","added_by":"auto","created_at":"2021-09-16 22:35:29","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":894848,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-17184/v1/187c3f7a-fcc0-4e29-a681-e965bae39663.pdf"},{"id":646251,"identity":"8dc925f8-80e5-4c6d-a621-15d4acd5e115","added_by":"auto","created_at":"2020-03-13 18:35:38","extension":"pptx","order_by":0,"title":"","display":"","copyAsset":false,"role":"supplement","size":567624,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryFiguresPaper1Nov252019.pptx","url":"https://assets-eu.researchsquare.com/files/rs-17184/v1/Supplementary Figures_Paper1_Nov252019.pptx"},{"id":646248,"identity":"65dfdcbe-9853-46f5-aa32-f030b19ac8fd","added_by":"auto","created_at":"2020-03-13 18:35:37","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"supplement","size":23939,"visible":true,"origin":"","legend":"","description":"","filename":"Supplementaryfiguresandtables.docx","url":"https://assets-eu.researchsquare.com/files/rs-17184/v1/Supplementary figures and tables.docx"},{"id":646247,"identity":"8248a7cb-6e57-4fe6-b321-b8941b7f41f2","added_by":"auto","created_at":"2020-03-13 18:35:37","extension":"xlsx","order_by":0,"title":"","display":"","copyAsset":false,"role":"supplement","size":149432,"visible":true,"origin":"","legend":"","description":"","filename":"Paper1SupplementaryNov2019.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-17184/v1/Paper1_Supplementary_Nov2019.xlsx"}],"financialInterests":"","formattedTitle":"Examining the relationship between maternal body size, gestational glucose tolerance status, mode of delivery and ethnicity on mother’s milk microbiota at three months post-partum","fulltext":[{"header":"Background","content":" \u003cp\u003eBreastfeeding is the recommended method of feeding for all infants irrespective of whether the country of origin is low, middle, or high-income (1). Mother\u0026rsquo;s milk is a rich source of nutrients and bioactive components, such as the antimicrobial proteins lactoferrin and lysozyme, and contains an array of oligosaccharides which serve as a source of prebiotics (2\u0026ndash;5). It is now well accepted that mother\u0026rsquo;s milk contains a rich supply of bacteria (~\u0026thinsp;10\u003csup\u003e6\u003c/sup\u003e bacterial cells/mL), which are believed to play an important role in postnatal colonization of the infant\u0026rsquo;s gastrointestinal tract (gut) (6\u0026ndash;13). Microbial composition of the gut, in turn, is associated with maturation of an infant\u0026rsquo;s gut and immune system, and aberrant gut microbial compositions have been linked to a number of short- and long-term health outcomes including diarrhea, respiratory tract infection, asthma, inflammatory bowel disease, obesity, and metabolic syndrome (14\u0026ndash;18).\u003c/p\u003e \u003cp\u003eThere is a limited understanding of the stability of the human milk microbiota in the face of environmental influences. Despite the high prevalence and known impact on other milk constituents, no study we are aware of has examined the association between maternal glucose tolerance status, either gestational diabetes or impaired glucose tolerance, and the milk microbiota. Only a few studies to date have cross-sectionally examined other maternal factors, such as maternal body size and mode of delivery, on the microbiota composition of mature mother\u0026rsquo;s milk (collected from 1-week to 6-months post-partum) (19\u0026ndash;23). Moreover, the findings from the few available studies are inconsistent likely due, in part, to the small number of study participants, and differing methods of milk collection and analysis (Supplementary Table\u0026nbsp;1). Of the limited studies conducted, maternal BMI and mode of delivery have been associated with the mature milk microbiota; however, many of these reports relied on small cohorts and thus their findings require replication in larger scale studies (19\u0026ndash;23). Further, most studies were unable to employ multivariable statistical modelling to adjust for multiple potential maternal factors of interest simultaneously. Lastly, none of these studies carried out functional inference analyses to determine if maternal body size and mode of delivery also perturb the milk microbiome\u0026rsquo;s potential metabolic activities or functional capabilities. It is vital to determine if maternal metabolic (BMI, glucose tolerance status), obstetrical (mode of delivery), and demographic (ethnicity) factors impact the mother\u0026rsquo;s milk microbiota and metagenome due to the role they play in the colonization of the infant gut and the importance of a healthy gut microbiome in human health.\u003c/p\u003e \u003cp\u003eTherefore, we set out to fill these knowledge gaps in the field. We collected a large cohort of mother\u0026rsquo;s milk samples from women prospectively enrolled in a study to investigate the impact of metabolic abnormalities and maternal nutrition in pregnancy on human milk (NCT01405547). The objective of this current study was to investigate the associations between maternal pre-pregnancy BMI (healthy, overweight, or obese), 3-month post-partum BMI, maternal glucose tolerance status in late pregnancy (gestational diabetes mellitus [GDM], impaired glucose tolerance [IGT], or normoglycemia), mode of delivery (vaginal delivery, unscheduled Caesarean delivery [C-section], or scheduled C-section), and ethnicity (white, Asian, or other) on the microbial community composition and functional capabilities of mother\u0026rsquo;s milk at three months post-partum. This research will help to elucidate the modulatory potential of mother\u0026rsquo;s milk microbiota in the face of physiological perturbations.\u003c/p\u003e "},{"header":"Results","content":" \u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eParticipant Description\u003c/h2\u003e \u003cp\u003eMilk samples were collected at 3 \u0026plusmn; 1-month post-partum (mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation) (n\u0026thinsp;=\u0026thinsp;113). Fifty-six (49.6%) mothers fed their infants their own milk exclusively at the time of milk collection, and 61 (53.9%) samples were from a complete breast expression. The mean (\u0026plusmn;\u0026thinsp;standard deviation) age of the mothers was 34.2\u0026thinsp;\u0026plusmn;\u0026thinsp;4.2\u0026nbsp;years (Table\u0026nbsp;1) with a pre-pregnancy BMI (kg/m\u003csup\u003e2\u003c/sup\u003e) of 24.3\u0026thinsp;\u0026plusmn;\u0026thinsp;4.6, which is within a healthy BMI range (18.5\u0026ndash;24.9\u0026nbsp;kg/m\u003csup\u003e2\u003c/sup\u003e). A modified oral glucose tolerance test (OGTT) administered at 30 weeks\u0026rsquo; gestation (95% CI: 25\u0026ndash;33 weeks) revealed that 24 (21.2%) women had GDM, 20 (17.7%) had IGT, and 69 (61.1%) had healthy glucose metabolism (normoglycemic). Among women with a healthy pre-pregnancy BMI, 12 and 16 had IGT and GDM, respectively. Among women with an overweight pre-pregnancy BMI, 5 had IGT and 5 had GDM (10 total). Lastly, among women with an obese pre-pregnancy BMI 3 had IGT and 3 had GDM (6 total; Supplementary Table\u0026nbsp;2). Sixty-four (56.6%) mothers delivered their infants vaginally, compared to the 49 (43.4%) who underwent a C-section. Following 16S rRNA gene sequencing, rarefying, and filtering, the bacterial taxa from 109 milk samples were included in the analyses. The total counts per sample were rarefied to 20,000 reads prior to calculating diversity metrics.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eOverall microbial composition of mother\u0026rsquo;s milk\u003c/h2\u003e \u003cp\u003eTwenty-six unique phyla-level and 292 unique genus-level taxa were identified (Figs.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e and \u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). Proteobacteria and Firmicutes were the most abundant phyla at 58.6\u0026thinsp;\u0026plusmn;\u0026thinsp;27.3% and 35.6\u0026thinsp;\u0026plusmn;\u0026thinsp;26.3%, respectively, followed by Actinobacteria (4.1\u0026thinsp;\u0026plusmn;\u0026thinsp;4.7%), Bacteroidetes (1.4\u0026thinsp;\u0026plusmn;\u0026thinsp;2.7%), and Fusobacteria (0.1\u0026thinsp;\u0026plusmn;\u0026thinsp;0.3%). \u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003ePseudomonas\u003c/span\u003e (43.4\u0026thinsp;\u0026plusmn;\u0026thinsp;26.0%) and \u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003eStreptococcus\u003c/span\u003e (30.6\u0026thinsp;\u0026plusmn;\u0026thinsp;25.3%) were the predominant genera across all samples, followed by smaller abundances of \u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003eStaphylococcus\u003c/span\u003e (6.2\u0026thinsp;\u0026plusmn;\u0026thinsp;11.5%), \u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003eAcinetobacter\u003c/span\u003e (3.5\u0026thinsp;\u0026plusmn;\u0026thinsp;7.4%), \u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003eVeillonella\u003c/span\u003e (3.2\u0026thinsp;\u0026plusmn;\u0026thinsp;7.2%), \u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003eGemella\u003c/span\u003e (1.9\u0026thinsp;\u0026plusmn;\u0026thinsp;3.3%), \u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003eCorynebacterium\u003c/span\u003e (1.6\u0026thinsp;\u0026plusmn;\u0026thinsp;5.5%), \u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003eRothia\u003c/span\u003e (1.3\u0026thinsp;\u0026plusmn;\u0026thinsp;2.4%), \u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003eAeromonas\u003c/span\u003e (0.6\u0026thinsp;\u0026plusmn;\u0026thinsp;6.2%), and \u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003eBrevundimonas\u003c/span\u003e (0.6\u0026thinsp;\u0026plusmn;\u0026thinsp;5.7%). Plotting the relative abundances of taxa at the phylum (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e) and genus taxonomic levels (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e) reveals obvious inter-individual variability in the microbial composition of milk.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003ch2\u003eAssociations between maternal body size, glucose tolerance status, mode of delivery, ethnicity and the milk microbiota\u003c/h2\u003e \u003cp\u003eThe Chao1 and Shannon indices were used to assess alpha diversity (richness and evenness, respectively) within each mother\u0026rsquo;s milk sample. No statistically significant associations were found between maternal characteristics (maternal glucose tolerance status, mode of delivery, pre-pregnancy BMI, 3-month post-partum BMI, ethnicity), and milk microbiota richness or evenness using multivariable linear regression analyses (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA-E; complete results in Supplementary Table\u0026nbsp;3).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eTo further investigate associations between maternal characteristics and microbial composition, the beta-diversity of the microbiota in milk samples was assessed by principal coordinate analysis (PCoA) using the weighted UniFrac distance metric and the Bray-Curtis index of dissimilarity (Supplementary Figs.\u0026nbsp;1, 2; Supplementary Table\u0026nbsp;4 ) (24). No obvious clustering or separation based on maternal characteristics was observed; however, small but statistically significant associations between maternal pre-pregnancy BMI and beta-diversity clustering were identified (Bray-Curtis R\u003csup\u003e2\u003c/sup\u003e\u0026thinsp;=\u0026thinsp;0.037, \u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003ep\u003c/span\u003e\u0026thinsp;=\u0026thinsp;0.044). No other statistically significant associations were found for the other maternal characteristics and beta-diversity.\u003c/p\u003e \u003cp\u003eWe assessed whether taxa abundance was associated with maternal characteristics by using multivariable Poisson regressions and accounting for multiple comparisons (Tables\u0026nbsp;2, 3, 4, 5; Supplementary Tables\u0026nbsp;5, 6). At least one maternal characteristic was associated with the differential abundance of Proteobacteria, Bacteroidetes, and Actinobacteria at the phylum level, and \u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003eStaphylococcus\u003c/span\u003e, \u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003eVeillonella\u003c/span\u003e, \u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003eGemella\u003c/span\u003e, \u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003eCorynebacterium\u003c/span\u003e, and \u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003eBrevundimonas\u003c/span\u003e at the genus level.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eAssociation between maternal body size and the milk microbiota\u003c/h2\u003e \u003cp\u003ePre-pregnancy BMI (i.e., healthy, overweight, obese) was found to be most consistently associated with differentially abundant taxa after controlling for relevant maternal characteristics. Mothers categorized as obese pre-pregnancy displayed a lower incidence of Proteobacteria (incidence rate ratio [IRR]: 0.62 [95% CI: 0.43\u0026ndash;0.90]) in their milk as compared to mothers who were overweight. Conversely, mothers who were overweight presented with an increased incidence of Proteobacteria in their milk, compared to healthy weight mothers (1.23 [1.00-1.50]). Mothers defined as obese pre-pregnancy had a greater incidence of Bacteroidetes in their milk as compared to overweight (3.70 [1.61\u0026ndash;8.48]) or had a healthy BMI (2.56 [1.27\u0026ndash;5.17]) mothers. When examining 3-month post-partum BMI, Actinobacteria incidence was greater in obese women versus both overweight (2.34 [1.38\u0026ndash;3.98]) and healthy weight mothers (2.02 [1.18\u0026ndash;3.46]).\u003c/p\u003e \u003cp\u003eAt the genus-level, women who were obese pre-pregnancy displayed a higher incidence of \u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003eStaphylococcus\u003c/span\u003e as compared to overweight (2.50 [1.09\u0026ndash;5.72]) or healthy weight mothers (3.15 [1.47\u0026ndash;6.08]) (Table\u0026nbsp;2). Mothers who were obese pre-pregnancy also displayed a greater incidence of \u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003eCorynebacterium\u003c/span\u003e in their milk versus both overweight (5.13 [1.79\u0026ndash;14.70]) and healthy weight (4.98 [2.11\u0026ndash;11.74]) mothers. This same relationship with \u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003eCorynebacterium\u003c/span\u003e was seen in mothers who were obese at 3-months post-partum compared to overweight (4.84 [2.19\u0026ndash;10.72]) and healthy weight (7.77 [2.95\u0026ndash;20.43]) mothers. An increased incidence of \u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003eBrevundimonas\u003c/span\u003e was also observed in mothers who were overweight pre-pregnancy vs healthy weight (8.72 [3.24\u0026ndash;23.48]). At 3-months post-partum, women who were obese also displayed a greater incidence of \u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003eBrevundimonas\u003c/span\u003e versus both overweight (8.89 [2.29\u0026ndash;34.57]) and healthy (9.56 [2.17\u0026ndash;42.22]) mothers (Table\u0026nbsp;2).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eAssociation between maternal glucose tolerance status and the milk microbiota\u003c/h2\u003e \u003cp\u003eWhen examining an interaction between BMI and maternal glucose tolerance status, \u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003eGemella\u003c/span\u003e showed an increased incidence among overweight (versus healthy) mothers with gestational diabetes (5.96 [1.85\u0026ndash;19.21]). In addition, \u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003eGemella\u003c/span\u003e was increased in obese mothers with impaired glucose tolerance versus overweight (11.42 [1.49\u0026ndash;87.67]) and versus healthy (4.04 [1.63\u0026ndash;10.01]) mothers with impaired glucose tolerance (Table\u0026nbsp;2).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eAssociation between mode of delivery and the milk microbiota\u003c/h2\u003e \u003cp\u003eAssociations between mode of delivery and the differential abundance of select taxa at the phylum and genus level were found for both pre-pregnancy and post-partum BMI models (Table\u0026nbsp;2). A greater incidence of \u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003eBrevundimonas\u003c/span\u003e was observed in mothers who underwent an unscheduled C-section versus a vaginal delivery from both the pre-pregnancy BMI model (16.70 [5.99\u0026ndash;46.57]) and 3-month post-partum BMI model (13.01 [4.01\u0026ndash;42.20]). Conversely, a reduced incidence of \u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003eBrevundimonas\u003c/span\u003e was observed in mothers who underwent a scheduled C-section versus an unscheduled C-section from both the pre-pregnancy BMI model (0.070 [0.011\u0026ndash;0.46]) and 3-month post-partum BMI model (0.08 [0.013\u0026ndash;0.62]).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eAssociation between maternal ethnicity and the milk microbiota\u003c/h2\u003e \u003cp\u003eLastly, ethnicity (white, Asian, other) was associated with the differential abundance of \u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003eCorynebacterium\u003c/span\u003e and \u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003eBrevundimonas\u003c/span\u003e (Table\u0026nbsp;3). White mothers had a reduced incidence of both \u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003eCorynebacterium\u003c/span\u003e (0.27 [0.12\u0026ndash;0.59]) and \u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003eBrevundimonas\u003c/span\u003e (0.084 [0.015\u0026ndash;0.46]) when compared to \u0026lsquo;other\u0026rsquo; mothers and Asian mothers, respectively; Asian mothers also had a reduced incidence of \u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003eCorynebacterium\u003c/span\u003e when compared to \u0026lsquo;other\u0026rsquo; mothers (0.17 [0.049\u0026ndash;0.63]).\u003c/p\u003e \u003ch2\u003eAssociation between maternal body size, glucose tolerance status, mode of delivery, ethnicity and functional gene expression of the milk microbiota\u003c/h2\u003e \u003cp\u003eWe carried out functional inference analyses using Piphillin to assess if there were any differences in functional capabilities of the milk microbiota based on the maternal clinical data. In contrast with the bacterial taxonomic results, the relative abundance of the 20 top KEGG pathways across all milk samples was fairly consistent (Supplementary Fig.\u0026nbsp;3). We analyzed the association between maternal clinical data and KEGG ortholog beta-diversity as well as examined the association between maternal clinical parameters and differentially-expressed KEGG pathways (Supplementary Tables\u0026nbsp;7\u0026ndash;9). No significant results were found when examining metadata and KEGG ortholog beta-diversity (Supplementary Table\u0026nbsp;7); however, one statistically significant differentially-expressed pathway was observed (Supplementary Table\u0026nbsp;8, Supplementary Fig.\u0026nbsp;4). BMI, specifically the obese sub-category, was shown to be significantly associated with enrichment of the KEGG category \u0026ldquo;Biosynthesis of secondary metabolites\u0026rdquo; (Coefficient 0.00024, \u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003ep\u003c/span\u003e\u0026thinsp;=\u0026thinsp;0.0079). (Supplementary Fig.\u0026nbsp;4).\u003c/p\u003e \u003c/div\u003e "},{"header":"Discussion","content":" \u003cp\u003eOur results suggest that maternal factors, and most consistently maternal pre-pregnancy BMI, are associated with the microbial composition of mother\u0026rsquo;s milk. This is the first study to include maternal glucose tolerance status in the investigations of the association between maternal body size and the milk microbiota (Supplementary Table\u0026nbsp;1). Gestational diabetes, a well-known risk factor of maternal adiposity, is associated with a number of negative health outcomes, including increased risk of type 2 diabetes and metabolic syndrome in the mother, as well as large for gestational age, congenital malformations and hypoglycemia in the infant (25\u0026ndash;28). These changes in infant health may be partially mediated by microbes transmitted from mother to infant, from both the birthing process as well as during direct breastfeeding. For this reason, it is imperative to study the relationship between these factors in order to best mitigate these maternal and infant outcomes as well as distinguish the role of body size versus glucose tolerance status on the milk microbiota and, hence, the infant.\u003c/p\u003e \u003cp\u003eAccording to a recent systematic review and dose-response meta-analysis, the risk of GDM increases by 4% for every unit increase in BMI; thus, to investigate BMI without also adjusting for GDM could lead to erroneous results (28). Our results suggest that these associations extend beyond the gut microbiota and that alterations in glucose tolerance status may also perturb the composition (Tables\u0026nbsp;2, 4) of mother\u0026rsquo;s milk microbiota. Previous studies have reported associations between both type 2 diabetes and insulin resistance and the gut microbiota composition (29). Potential mechanisms of action linking impaired glucose tolerance and the gut microbial community include lipopolysaccharide-triggered inflammation, impairment of GLP-1 and GLP-2 via bacterial production of short chain fatty acids, insulin resistance triggered by bacterial synthesis and absorption of branch-chained amino acids, or the metabolism of bile acids by bacteria and their organ-specific effects (29). It is unclear how impaired glucose tolerance may modulate the bacteria in human milk and the interplay present with maternal body size.\u003c/p\u003e \u003cp\u003eWe did not find any differences in alpha diversity based on our maternal characteristics; however, we did find statistically significant differences in beta-diversity, with mother\u0026rsquo;s milk microbiota separating, or non-randomly clustering, based on pre-pregnancy BMI even after adjustment for other covariates (Supplementary Table\u0026nbsp;4, Supplementary Figs.\u0026nbsp;1 and 2). The human gut microbiota has been reported to cluster as a function of body size, but this has not yet been reported for the human milk microbiota (30). Our results demonstrating an association between maternal body size and microbial composition is consistent with other smaller scale studies on human milk microbiotas (Supplementary Table\u0026nbsp;1). Cabrera-Rubio et al. (2012) examined the association between maternal body size and the differential abundance of mother\u0026rsquo;s milk genera in a study of healthy Finnish women (n\u0026thinsp;=\u0026thinsp;18) (20). They reported an increase in \u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003eStaphylococcus\u003c/span\u003e in mother\u0026rsquo;s milk collected from obese women, which mirrors the findings in our study (Table\u0026nbsp;4).\u003c/p\u003e \u003cp\u003eMode of delivery was also associated with changes in mother\u0026rsquo;s milk microbiota at both the phylum and genus levels (Table\u0026nbsp;2, 4). For example, we observed greater differential abundance of \u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003eStaphylococcus\u003c/span\u003e in mother\u0026rsquo;s milk from women who underwent a (scheduled) C-section versus vaginal delivery (Table\u0026nbsp;4). Our results are similar to that reported by Cabrera-Rubio et al. (2012, 2016). These two small cross-sectional cohorts of healthy Finnish women (n\u0026thinsp;=\u0026thinsp;18, 10) showed a non-statistically significant increase in \u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003eStaphylococcus\u003c/span\u003e in milk observed among women who delivered their infant via a scheduled C-section versus a vaginal delivery (Table\u0026nbsp;4) (19, 20). The proposed mechanism whereby mode of delivery alters the milk microbiota is via the infant oral cavity, which is colonized during either vaginal delivery or C-section; from here, retrograde inoculation of bacteria can occur from the infant\u0026rsquo;s oral cavity into the mammary gland via the suckling process with direct breastfeeding (31\u0026ndash;34).\u003c/p\u003e \u003cp\u003eThe results of our multi-ethnic cohort revealed associations between ethnicity and specific bacterial taxa. Ethnicity and/or geographic location have been shown to be factors in determining various microbiomes of the body including the gut, oral cavity, respiratory tract, skin, and urogenital tract (35). Ethnicity and geographic location typically come with an overlay of dietary variation, making the impact of each variable challenging to separate. Only a few studies to date have assessed associations between ethnicity and the milk microbiota; however, the ethnic/geographic groups differed from our study as they generally examined Europe, Africa and the United States, making it challenging to compare findings (Tables\u0026nbsp;3, 5; Supplementary Tables\u0026nbsp;5, 6) (12,21,36,37).\u003c/p\u003e \u003cp\u003eWe used a functional inference approach to characterize the microbial genetic potential in human milk. In agreement with what has been reported for other human-associated microbiotas, the functional capacity of the human milk microbiota is more stable than its taxonomic composition (38). We then assessed whether there were specific pathways that were associated with maternal characteristics and found that maternal BMI, specifically the obese sub-category, was significantly associated with an increase in the \u0026ldquo;Biosynthesis of secondary metabolites\u0026rdquo; KEGG pathway. Microbes produce secondary metabolites, which are small, bioactive molecules, not necessary for growth or development but are instead involved in microbe-host or microbe-microbe interactions (39,40). Indeed, many of the genes in the biosynthesis of secondary metabolites pathway encode for the biosynthesis of antibiotics (41). Increased production of these secondary metabolites could impact the overall microbial composition/function in these feeding infants. These potential alterations could represent a mechanism by which maternal BMI impacts infant health over both the short- and long-term and warrants future investigation.\u003c/p\u003e \u003cp\u003eHuman milk is considered a low biomass sample and, for this reason, may be more affected by sample processing than higher biomass samples, such as stool. To address this concern, we used PCoA plots to visualize clustering, or lack thereof, of our milk samples and negative controls (Supplementary Fig.\u0026nbsp;5). Our negative controls were seen to cluster away from the samples, suggesting that our results do not arise from technical contaminates, which was confirmed using Adonis analyses to statistically corroborate that our samples clustered away from the negative controls (Weighted UniFrac R\u003csup\u003e2\u003c/sup\u003e\u0026thinsp;=\u0026thinsp;0.07, \u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003ep\u003c/span\u003e\u0026thinsp;=\u0026thinsp;0.0001; Bray-Curtis R\u003csup\u003e2\u003c/sup\u003e\u0026thinsp;=\u0026thinsp;0.10, \u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003ep\u003c/span\u003e\u0026thinsp;=\u0026thinsp;0.0001, Supplementary Fig.\u0026nbsp;5).\u003c/p\u003e \u003cp\u003eStrengths of the current study include its relatively large sample size, the diverse ethnicity of women included, clinical examination via an OGTT, and enrichment of the cohort with women of varying body size who had abnormal glucose tolerance status. These strengths allowed for a more fulsome investigation using multivariable statistics to determine how each maternal factor is independently associated with the milk microbiome. Limitations of the current study include a lack of disinfection of the mother\u0026rsquo;s breast, peri-areolar region, and/or nipple prior to milk sampling, and single time-point sampling. The microbes identified in the milk from the present study likely include bacteria from the skin microbiota. Practically, however, mothers do not disinfect their breast prior to pumping and storing milk for their infant, nor do they disinfect prior to breastfeeding. Therefore, the mother\u0026rsquo;s milk microbiota as collected in the current study is likely a more accurate depiction of what the infant would receive. Secondly, we could not adjust for all variables of interest to due sample size constraints, so we are likely missing additional determinants of both the milk microbiota and functional capabilities. Lastly, our study is limited by its cross-sectional design and thus we cannot assess how the milk microbiome changes over time. It is possible that the associations we identified between maternal factors and microbial composition in milk are not transitory and change across the course of lactation.\u003c/p\u003e "},{"header":"Conclusions","content":" \u003cp\u003eOur study found that mother\u0026rsquo;s milk has a highly personalized microbiota with high inter-individual variability. Expressed mother\u0026rsquo;s milk at both the phylum and genus levels appear to be related to maternal metabolic and obstetrical factors. Surprisingly, glucose tolerance status was significantly associated with fewer microbiota parameters than anticipated. Most consistently, maternal pre-pregnancy BMI, despite glucose tolerance status, was associated with the differential abundance of various taxa in mother\u0026rsquo;s milk and potentially the production of bacterial secondary metabolites as well. To understand the clinical significance of these findings, future research should explore the impact of differences in the microbial composition of mother\u0026rsquo;s milk on colonization of the infant gut microbiome and infant health.\u003c/p\u003e "},{"header":"Methods","content":" \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eStudy participants and design\u003c/h2\u003e \u003cp\u003eTo address the research objectives of this study, we used maternal metabolic and obstetrical health data and bio-banked human milk samples available from a previously conducted prospective cohort study (ClinicalTrials.gov Identifier: NCT01405547); a detailed description of the study protocol has been previously published (42). Pregnant women (n\u0026thinsp;=\u0026thinsp;216) were recruited from outpatient clinics at Mount Sinai Hospital in Toronto, Canada and completed a 3-hour 100\u0026nbsp;g OGTT between March 2009 and July 2010. In total, 117 women donated a milk sample at 3\u0026nbsp;months post-partum, with 113 samples available for this study (Supplementary Fig.\u0026nbsp;6). Women were eligible for inclusion in the original study if they were \u0026ge;\u0026thinsp;20\u0026nbsp;years of age and had an intention to breastfeed. Exclusion criteria included pre-existing diabetes diagnosis, current use of insulin, or completion of an OGTT prior to recruitment (43). By design, mothers were recruited from clinics which follow higher risk pregnancies with a greater risk of either GDM or IGT diagnosis. Written informed consent was obtained from all women and the study protocol was approved by the Mount Sinai Hospital Human Research Ethics Board (42).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eCollection of Demographic, Anthropometric and Metabolic Data\u003c/h2\u003e \u003cp\u003eDuring the first study visit, which occurred in late pregnancy (30 weeks [95% CI: 25\u0026ndash;33 weeks]), demographic and anthropometric data were collected (e.g. age, ethnicity, weight, height); mothers were asked to recall their pre-pregnancy weight. All pregnant women in Canada are screened for GDM by way of a 50\u0026nbsp;g glucose challenge test (GCT). If the plasma glucose concentration at 1-hour post-glucose load is \u0026ge;7.8\u0026nbsp;mmol/L, the patient is then referred for a diagnostic OGTT. Contrary to standard obstetrical practice, all women completed a 3-hour 100\u0026nbsp;g OGTT in the current study during their first study visit regardless of whether or not they completed a GCT. The OGTT involved having blood samples drawn at fasting, 30, 60, 90, 120- and 180-minutes post-glucose load. Women were then diagnosed with either GDM, IGT, or as normoglycemic based on the following glycemic thresholds: 1) GDM diagnosis\u0026thinsp;=\u0026thinsp;2 or more of the following: fasting blood glucose\u0026thinsp;\u0026ge;\u0026thinsp;5.8\u0026nbsp;mmol/L, 1-hour blood glucose\u0026thinsp;\u0026ge;\u0026thinsp;10.6\u0026nbsp;mmol/L, 2-hour blood glucose\u0026thinsp;\u0026ge;\u0026thinsp;9.2\u0026nbsp;mmol/L, or 3-hour blood glucose\u0026thinsp;\u0026ge;\u0026thinsp;8.1\u0026nbsp;mmol/L, or 2) IGT diagnosis would exceed only one of the previous thresholds, or 3) normoglycemic\u0026thinsp;=\u0026thinsp;normal OGTT (42).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eMother\u0026rsquo;s milk collection, processing and amplification\u003c/h2\u003e \u003cp\u003eAt the three-month post-partum research visit, mothers were asked to pump a complete breast expression of milk using a double electric breast pump (Medela Inc., Illinois, USA) with a sterile pumping kit. Mothers were instructed not to pump or breastfeed their infant for 2 hours before the study visit. Samples of whole human milk were then divided into aliquots and stored at -80\u0026nbsp;\u0026deg;C until the time of analyses.\u003c/p\u003e \u003cp\u003eDNA was extracted from human milk using the NucleoSpin Food DNA Isolation Kit (Macherey-Nagel, Pennsylvania, USA) according to manufacturer\u0026rsquo;s instructions with modifications as we have described previously (44). Due to the small concentration of DNA in human milk, an elution buffer volume of 30 \u0026micro;L, instead of the recommended 100 \u0026micro;L, was used to ensure adequate DNA concentrations for downstream PCR.\u003c/p\u003e \u003cp\u003ePCR amplification of the V4 hypervariable region was performed using the forward primer (515F) 5\u0026rsquo;AATGATACGGCGACCACCGAGATCTACACTATGGTA ATTGTGTGCCAGCMGCCGCGGTAA and reverse primer (806R) 5\u0026rsquo;CAAGCAGA AGACGGCATACGAGATA GTCAGTCAGCCGGACTACHVGGGTWTCTAAT (45). PCR reactions were set up following the manufacturer\u0026rsquo;s recommendations (Roche) including 12.5\u0026nbsp;\u0026micro;L of KAPA2G Robust HotStart ReadyMix, 1.5\u0026nbsp;\u0026micro;L of 10\u0026nbsp;\u0026micro;M forward and 1.5\u0026nbsp;\u0026micro;L of 10\u0026nbsp;\u0026micro;M reverse primer, 3.5\u0026nbsp;\u0026micro;L of sterile water and 6\u0026nbsp;\u0026micro;L of DNA. Amplification of the V4 hypervariable region of the 16S rRNA gene involved 28 cycles of PCR: 95\u0026nbsp;\u0026deg;C for 3 minutes, 25\u0026ndash;30 cycles of 95\u0026nbsp;\u0026deg;C for 15 seconds, 50\u0026nbsp;\u0026deg;C for 15 seconds and 72\u0026nbsp;\u0026deg;C for 15 seconds, followed by a 5 minute 72\u0026nbsp;\u0026deg;C extension (different numbers of cycles between PCR runs were adjusted for statistically). All amplifications were completed in triplicate and all amplicons were run on a 1% TBE agarose gel to ensure accurate amplification (amplicon size\u0026thinsp;~\u0026thinsp;390\u0026nbsp;bp). A negative control without template DNA and a positive control with DNA from a known bacterial species (\u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003ePseudomonas aeruginosa\u003c/span\u003e) were also included to confirm the amplification quality. Bands of the same size and intensity were pooled and quantified to create the pooled sequence library. Purification of the pooled library was completed with AMPure XP beads (0.8X volume of beads to 1X volume of library DNA) following the manufacturer\u0026rsquo;s protocol. The purified library was quantified using the Qubit High Sensitivity DNA Kit (Thermo Fisher). The quantified library was loaded on an Illumina MiSeq and sequenced using the MiSeq-V2-300 cycle chemistry to generate 150 PE reads.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eBioinformatics analyses\u003c/h2\u003e \u003cp\u003eThe raw paired end sequences from the MiSeq instrument have been deposited to the NCBI Sequence Read Archive (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://www.ncbi.nlm.nih.gov/sra\u003c/span\u003e\u003c/span\u003e) under accession number PRJNA516669. The UPARSE pipeline (USEARCH) was used for sequence analysis. Raw paired end sequences were assembled (-fastq_mergepairs; -fastq_merge_maxee\u0026thinsp;=\u0026thinsp;1.0), filtered (-fastq_filter; -fastq_maxee\u0026thinsp;=\u0026thinsp;0.5) and sequences shorter than 225 base pairs were removed (-fastq_filter; -fastq_minlen 225) (46). Sequences were then de-replicated and sorted using USEARCH (-derep_full; -sortybysize). Chimeric sequences in the OTUs were detected and removed using the Ribosomal Database Project (RDP) 16S gold database (USEARCH), while ensuring the number of false positive chimeras detected was minimized (47). Sequences were then grouped together into Operational Taxonomic Units (OTUs) at 97% similarity (-usearch_global). Taxonomy was assigned to these OTUs (RDP 16S gold database) (-utax) and OTU fasta sequences were aligned using PyNast via a QIIME python script (align_seqs.py). A phylogenetic tree was assembled using the FastTree QIIME python script (make_phylogeny.py) (48).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003eData analysis and statistics\u003c/h2\u003e \u003cp\u003eThe phyloseq package (1.25.2) in R (version 3.4.1) was used to analyze microbiota composition (49). OTUs that only appeared once or twice (singletons and doubletons) were removed and all OTUs were rarefied to 20,000 reads prior to calculating relative abundances at different taxonomic levels, alpha diversities and beta diversities using phyloseq.\u003c/p\u003e \u003cp\u003eStatistically significant differences between the alpha diversities (Chao1/Shannon indices determined in R) and maternal metabolic or obstetrical characteristics were determined using multivariable linear regression models (PROC MIXED) in SAS version 9.4. Independent variables included in the models were: maternal BMI (healthy\u0026thinsp;=\u0026thinsp;18.5\u0026ndash;24.9\u0026nbsp;kg/m\u003csup\u003e2\u003c/sup\u003e, overweight\u0026thinsp;=\u0026thinsp;25-29.9\u0026nbsp;kg/m\u003csup\u003e2\u003c/sup\u003e, obese\u0026thinsp;=\u0026thinsp;\u0026gt;\u0026thinsp;30\u0026nbsp;kg/m\u003csup\u003e2\u003c/sup\u003e), maternal glucose tolerance status (GDM, IGT, normoglycemic), mode of delivery (vaginal, unscheduled C-section, scheduled C-section), DNA extraction batch, and PCR sequencing batch. Separate statistical models were built using pre-pregnancy and 3-month post-partum BMI as covariates, due to concerns about collinearity. An interaction term between BMI and maternal glucose tolerance status was also tested in each model and removed if it was non-significant. Due to our sample size and the number of covariates we wished to test, separate models for ethnicity (white, Asian, other) were run that adjusted for DNA extraction and PCR sequencing batches, but no other covariates. Multicollinearity was assessed between independent variables in all models, using a variance inflation cut-off of \u0026gt;\u0026thinsp;5. The significance level was set at \u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003ep\u003c/span\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05. Of note, 6 mothers with a pre-pregnancy BMI between 18.0-18.4\u0026nbsp;kg/m\u003csup\u003e2\u003c/sup\u003e were placed in the \u0026ldquo;healthy BMI\u0026rdquo; group for all analyses.\u003c/p\u003e \u003cp\u003eBeta diversities and principal coordinate analysis (PCoA) were also ascertained in phyloseq and statistical significance based on maternal characteristics was determined using the adonis function in vegan (version 2.5-3) (24). Adonis assesses the amount of variation explained by each metadata variable, such as maternal BMI or glucose tolerance status; all variables were run individually and together in adonis to adjust for one another. The interaction term between BMI and glucose tolerance status was also tested and removed if non-significant. Four patient\u0026rsquo;s samples were missing the post-partum BMI data and thus we used their pre-pregnancy BMI for the post-partum analyses. Again, the significance level was set at \u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003ep\u003c/span\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05.\u003c/p\u003e \u003cp\u003eMultivariable Poisson regression models (PROC GENMOD) were run in SAS version 9.4 to assess differential abundance at the phylum and genus levels based on maternal characteristics. The Benjamini-Yekutieli cut point approach was used to account for multiple testing. A \u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003ep\u003c/span\u003e\u0026thinsp;\u0026le;\u0026thinsp;0.022\u0026nbsp;at the phylum level (5 tests) and \u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003ep\u003c/span\u003e\u0026thinsp;\u0026le;\u0026thinsp;0.017 (10 tests) at the genus level were considered statistically significant for the overall group effect. If the overall group-adjusted \u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003ep\u003c/span\u003e-value was significant, pairwise comparisons were conducted and a pairwise \u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003ep\u003c/span\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05 was considered statistically significant.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003ePiphillin: Functional analysis of human milk microbiota\u003c/h2\u003e \u003cp\u003ePiphillin, a metagenomics inference tool, was used to infer functional capabilities in milk samples (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://piphillin.secondgenome.com/\u003c/span\u003e\u003c/span\u003e) (50). In this study, the Kyoto Encyclopedia of Genes and Genomes (KEGG; \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.genome.jp/kegg/\u003c/span\u003e\u003c/span\u003e) was used as a reference database to retrieve gene copy numbers and create a gene feature table from the 16S rRNA sequence data. Statistically significant associations between maternal characteristics and KEGG pathways where assessed in two ways: first, examining the association between maternal characteristics and KEGG orthologs beta-diversity using Adonis in R (\u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003ep\u003c/span\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05), and second, investigating metadata associated with differentially-expressed functional pathways using MaAsLin2 in R (\u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003ep\u003c/span\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.1).\u003c/p\u003e"},{"header":"List of Abbreviations","content":"\u003cp\u003eBMI Body mass index\u003c/p\u003e \u003cp\u003eGDM Gestational diabetes mellitus\u003c/p\u003e \u003cp\u003eIGT Impaired glucose tolerance\u003c/p\u003e \u003cp\u003eCaesarean delivery C-section\u003c/p\u003e \u003cp\u003eOGTT Oral glucose tolerance test\u003c/p\u003e \u003cp\u003erRNA Ribosomal RNA\u003c/p\u003e \u003cp\u003ePCoA Principal coordinates analysis\u003c/p\u003e \u003cp\u003eOTU Operational taxonomic unit\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthics Approval and Consent to participate\u003c/strong\u003e: The study protocol was approved by the Mount Sinai Hospital Research Ethics Board.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication:\u003c/strong\u003e N/A\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe dataset supporting the conclusions of this article is available in the NCBI Sequence Read Archive (\u003ca href=\"http://www.ncbi.nlm.nih.gov/sra\"\u003ehttp://www.ncbi.nlm.nih.gov/sra\u003c/a\u003e) under accession number PRJNA516669.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting Interests \u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNone to declare.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding \u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCIHR MOP 125997; CDA Operating Grant #OG-3-09-2393.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor\u0026rsquo;s contributions: \u003c/strong\u003eSHL, AJH, BZ, and DLO designed the prospective cohort study, SHL coordinated data and milk collection. LLN and DLO designed the present study and LLN, JB, JKC, and PWW worked out laboratory methods and conducted the 16S rRNA sequencing. JKC and PWW performed the bioinformatics, and LLN, JB, MRA, and AK performed the data analysis and statistics. LLN wrote the first draft of the paper. All authors provided important critical review and DLO had responsibility for the final manuscript. \u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements: \u003c/strong\u003eWe would like to thank Michael Jory for his assistance in setting up bioinformatic software in our laboratory\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eVictora CG, Bahl R, Barros AJD, Fran\u0026ccedil;a GVA, Horton S, Krasevec J, et al. Breastfeeding in the 21st century: epidemiology, mechanisms, and lifelong effect. The Lancet. 2016;387(10017):475\u0026ndash;90.\u003c/li\u003e\n\u003cli\u003eBode L. Human milk oligosaccharides: every baby needs a sugar mama. Glycobiology. 2012;22(9):1147\u0026ndash;62.\u003c/li\u003e\n\u003cli\u003eRiskin A, Almog M, Peri R, Halasz K, Srugo I, Kessel A. Changes in immunomodulatory constituents of human milk in response to active infection in the nursing infant. Pediatr Res. 2012;71(2):220\u0026ndash;5.\u003c/li\u003e\n\u003cli\u003eWagner CL, Taylor SN, Johnson D. Host factors in amniotic fluid and breast milk that contribute to gut maturation. Clin Rev Allergy Immunol. 2008;34(2):191\u0026ndash;204.\u003c/li\u003e\n\u003cli\u003eSabbaj S, Ibegbu CC, Kourtis AP. Cellular immunity in breast milk: implications for postnatal transmission of HIV-1 to the infant. Adv Exp Med Biol. 2012;743:161\u0026ndash;9.\u003c/li\u003e\n\u003cli\u003eArrieta M-C, Stiemsma LT, Amenyogbe N, Brown EM, Finlay B. The intestinal microbiome in early life: health and disease. Front Immunol. 2014;5:427.\u003c/li\u003e\n\u003cli\u003eAzad MB, Konya T, Maughan H, Guttman DS, Field CJ, Chari RS, et al. Gut microbiota of healthy Canadian infants: profiles by mode of delivery and infant diet at 4 months. CMAJ. 2013;185(5):385\u0026ndash;94.\u003c/li\u003e\n\u003cli\u003eBoix-Amor\u0026oacute;s A, Collado MC, Mira A. Relationship between milk microbiota, bacterial load, macronutrients, and human cells during lactation. Front Microbiol. 2016;7:492.\u003c/li\u003e\n\u003cli\u003eFern\u0026aacute;ndez L, Langa S, Mart\u0026iacute;n V, Maldonado A, Jim\u0026eacute;nez E, Mart\u0026iacute;n R, et al. The human milk microbiota: origin and potential roles in health and disease. Pharmacol Res. 2013;69(1):1\u0026ndash;10.\u003c/li\u003e\n\u003cli\u003eJost T, Lacroix C, Braegger CP, Rochat F, Chassard C. Vertical mother-neonate transfer of maternal gut bacteria via breastfeeding. Environ Microbiol. 2014;16(9):2891\u0026ndash;904.\u003c/li\u003e\n\u003cli\u003eMurphy K, Curley D, O\u0026rsquo;Callaghan TF, O\u0026rsquo;Shea C-A, Dempsey EM, O\u0026rsquo;Toole PW, et al. The composition of human milk and infant faecal microbiota over the first three months of life: a pilot study. Sci Rep. 2017;7:40597.\u003c/li\u003e\n\u003cli\u003ePannaraj PS, Li F, Cerini C, Bender JM, Yang S, Rollie A, et al. Association Between breast milk bacterial communities and establishment and development of the infant gut microbiome. JAMA Pediatr. 2017;171(7):647\u0026ndash;54.\u003c/li\u003e\n\u003cli\u003eVall\u0026egrave;s Y, Artacho A, Pascual-Garc\u0026iacute;a A, Ferr\u0026uacute;s ML, Gosalbes MJ, Abell\u0026aacute;n JJ, et al. Microbial succession in the gut: directional trends of taxonomic and functional change in a birth cohort of Spanish infants. PLoS Genet. 2014;10(6):e1004406.\u003c/li\u003e\n\u003cli\u003eBinns C, Lee M, Low WY. The long-term public health benefits of breastfeeding. Asia Pac J Public Health. 2016;28(1):7\u0026ndash;14.\u003c/li\u003e\n\u003cli\u003eDieterich CM, Felice JP, O\u0026rsquo;Sullivan E, Rasmussen KM. Breastfeeding and health outcomes for the mother-infant dyad. Pediatr Clin North Am. 2013;60(1):31\u0026ndash;48.\u003c/li\u003e\n\u003cli\u003eWHO. Short-term effects of breastfeeding: a systematic review on the benefits of breastfeeding on diarrhoea and pneumonia mortality. 2019. https://www.who.int/maternal_child_adolescent/documents/breastfeeding_short_term_effects/en/. Accessed 22 January 2019.\u003c/li\u003e\n\u003cli\u003eWHO. Long-term effects of breastfeeding: a systematic review. 2019. https://www.who.int/maternal_child_adolescent/documents/breastfeeding_long_term_effects/en/. Accessed 22 January 2019.\u003c/li\u003e\n\u003cli\u003eUwaezuoke SN, Eneh CI, Ndu IK. Relationship between exclusive breastfeeding and lower risk of childhood obesity: a narrative review of published evidence. Clin Med Insights Pediatr. 2017;11:1179556517690196.\u003c/li\u003e\n\u003cli\u003eCabrera-Rubio R, Mira-Pascual L, Mira A, Collado MC. Impact of mode of delivery on the milk microbiota composition of healthy women. J Dev Orig Health Dis. 2016;7(1):54\u0026ndash;60.\u003c/li\u003e\n\u003cli\u003eCabrera-Rubio R, Collado MC, Laitinen K, Salminen S, Isolauri E, Mira A. The human milk microbiome changes over lactation and is shaped by maternal weight and mode of delivery. Am J Clin Nutr. 2012;96(3):544\u0026ndash;51.\u003c/li\u003e\n\u003cli\u003eKumar H, du Toit E, Kulkarni A, Aakko J, Linderborg KM, Zhang Y, et al. Distinct patterns in human milk microbiota and fatty acid profiles across specific geographic locations. Front Microbiol. 2016;7:1619.\u003c/li\u003e\n\u003cli\u003eUrbaniak C, Angelini M, Gloor GB, Reid G. Human milk microbiota profiles in relation to birthing method, gestation and infant gender. Microbiome. 2016;6;4:1.\u003c/li\u003e\n\u003cli\u003eMoossavi S, Sepehri S, Robertson B, Bode L, Goruk S, Field CJ, et al. Composition and variation of the human milk microbiota are influenced by maternal and early-life factors. Cell Host Microbe. 2019;25(2):324-335.e4.\u003c/li\u003e\n\u003cli\u003eOksanen J, Blanchet FG, Friendly M, Kindt R, Legendre P, McGlinn D, et al. vegan: Community Ecology Package. 2019. https://CRAN.R-project.org/package=vegan\u003c/li\u003e\n\u003cli\u003eAlbrecht SS, Kuklina EV, Bansil P, Jamieson DJ, Whiteman MK, Kourtis AP, et al. Diabetes trends among delivery hospitalizations in the U.S., 1994-2004. Diabetes Care. 2010;33(4):768\u0026ndash;73.\u003c/li\u003e\n\u003cli\u003eMetzger BE, Gabbe SG, Persson B, Buchanan TA, Catalano PA, et al. International association of diabetes and pregnancy study groups recommendations on the diagnosis and classification of hyperglycemia in pregnancy. Diabetes Care. 2010;33(3):676\u0026ndash;82.\u003c/li\u003e\n\u003cli\u003eLandon MB, Mele L, Spong CY, Carpenter MW, Ramin SM, Casey B, et al. The relationship between maternal glycemia and perinatal outcome. Obstet Gynecol. 2011;117(2 Pt 1):218\u0026ndash;24.\u003c/li\u003e\n\u003cli\u003eNajafi F, Hasani J, Izadi N, Hashemi‐Nazari S-S, Namvar Z, Mohammadi S, et al. The effect of prepregnancy body mass index on the risk of gestational diabetes mellitus: A systematic review and dose-response meta-analysis. Obes Rev. 2019;20(3):472\u0026ndash;86.\u003c/li\u003e\n\u003cli\u003eUtzschneider KM, Kratz M, Damman CJ, Hullar M. Mechanisms linking the gut microbiome and glucose metabolism. J Clin Endocrinol Metab. 2016;101(4):1445\u0026ndash;54.\u003c/li\u003e\n\u003cli\u003eSze MA, Schloss PD. Looking for a signal in the noise: revisiting obesity and the microbiome. mBio. 2016;7(4).\u003c/li\u003e\n\u003cli\u003eRodr\u0026iacute;guez JM. The origin of human milk bacteria: is there a bacterial entero-mammary pathway during late pregnancy and lactation? Adv Nutr. 2014;5(6):779\u0026ndash;84.\u003c/li\u003e\n\u003cli\u003eFern\u0026aacute;ndez L, Langa S, Mart\u0026iacute;n V, Maldonado A, Jim\u0026eacute;nez E, Mart\u0026iacute;n R, et al. The human milk microbiota: origin and potential roles in health and disease. Pharmacol Res. 2013;69(1):1\u0026ndash;10.\u003c/li\u003e\n\u003cli\u003eJeurink PV, van Bergenhenegouwen J, Jim\u0026eacute;nez E, Knippels LMJ, Fern\u0026aacute;ndez L, Garssen J, et al. Human milk: a source of more life than we imagine. Benef Microbes. 2013;4(1):17\u0026ndash;30.\u003c/li\u003e\n\u003cli\u003eBiagi E, Quercia S, Aceti A, Beghetti I, Rampelli S, Turroni S, et al. The bacterial ecosystem of mother\u0026rsquo;s milk and infant\u0026rsquo;s mouth and gut. Front Microbiol. 2017;8:1214.\u003c/li\u003e\n\u003cli\u003eGupta VK, Paul S, Dutta C. Geography, ethnicity or subsistence-specific variations in human microbiome composition and diversity. Front Microbiol. 2017;8:1162.\u003c/li\u003e\n\u003cli\u003eDrago L, Toscano M, De Grandi R, Grossi E, Padovani EM, Peroni DG. Microbiota network and mathematic microbe mutualism in colostrum and mature milk collected in two different geographic areas: Italy versus Burundi. ISME J. 2017;11(4):875\u0026ndash;84.\u003c/li\u003e\n\u003cli\u003eLackey KA, Williams JE, Meehan CL, Zachek JA, Benda ED, Price WJ, et al. What\u0026rsquo;s normal? microbiomes in human milk and infant feces are related to each other but vary geographically: The INSPIRE study. Front Nutr. 2019;6(45).\u003c/li\u003e\n\u003cli\u003eStructure, function and diversity of the healthy human microbiome. Nature. 2012;486(7402):207\u0026ndash;14.\u003c/li\u003e\n\u003cli\u003eWang S, Li N, Zou H, Wu M. Gut microbiome-based secondary metabolite biosynthetic gene clusters detection in Parkinson\u0026rsquo;s disease. Neurosci Lett. 2019;696:93\u0026ndash;8.\u003c/li\u003e\n\u003cli\u003eOsbourn A. Secondary metabolic gene clusters: evolutionary toolkits for chemical innovation. Trends Genet. 2010;26(10):449\u0026ndash;57.\u003c/li\u003e\n\u003cli\u003eO\u0026rsquo;Brien J, Wright GD. An ecological perspective of microbial secondary metabolism. Curr Opin Biotechnol. 2011;22(4):552\u0026ndash;8.\u003c/li\u003e\n\u003cli\u003eLey SH, O\u0026rsquo;Connor DL, Retnakaran R, Hamilton JK, Sermer M, Zinman B, et al. Impact of maternal metabolic abnormalities in pregnancy on human milk and subsequent infant metabolic development: methodology and design. BMC Public Health. 2010;10:590.\u003c/li\u003e\n\u003cli\u003eLey SH, Hanley AJ, Sermer M, Zinman B, O\u0026rsquo;Connor DL. Associations of prenatal metabolic abnormalities with insulin and adiponectin concentrations in human milk. Am J Clin Nutr. 2012;95(4):867\u0026ndash;74.\u003c/li\u003e\n\u003cli\u003eLeMay-Nedjelski L, Copeland J, Wang PW, Butcher J, Unger S, Stintzi A, et al. Methods and strategies to examine the human breastmilk microbiome. Methods Mol Biol Clifton NJ. 2018;1849:63\u0026ndash;86.\u003c/li\u003e\n\u003cli\u003eCaporaso JG, Lauber CL, Walters WA, Berg-Lyons D, Huntley J, Fierer N, et al. Ultra-high-throughput microbial community analysis on the Illumina HiSeq and MiSeq platforms. ISME J. 2012;6(8):1621\u0026ndash;4.\u003c/li\u003e\n\u003cli\u003eEdgar RC. Search and clustering orders of magnitude faster than BLAST. Bioinforma Oxf Engl. 2010;26(19):2460\u0026ndash;1.\u003c/li\u003e\n\u003cli\u003eWang Q, Garrity GM, Tiedje JM, Cole JR. Na\u0026iuml;ve bayesian classifier for rapid assignment of rrna sequences into the new bacterial taxonomy. Appl Environ Microbiol. 2007;73(16):5261\u0026ndash;7.\u003c/li\u003e\n\u003cli\u003ePrice LB, Liu CM, Melendez JH, Frankel YM, Engelthaler D, Aziz M, et al. Community analysis of chronic wound bacteria using 16s rrna gene-based pyrosequencing: impact of diabetes and antibiotics on chronic wound microbiota. PLoS ONE. 2009;4(7).\u003c/li\u003e\n\u003cli\u003eMcMurdie PJ, Holmes S. Phyloseq: a bioconductor package for handling and analysis of high-throughput phylogenetic sequence data. Pac Symp Biocomput Pac Symp Biocomput. 2012;235\u0026ndash;46.\u003c/li\u003e\n\u003cli\u003eIwai S, Weinmaier T, Schmidt BL, Albertson DG, Poloso NJ, Dabbagh K, et al. Piphillin: improved prediction of metagenomic content by direct inference from human microbiomes. PloS One. 2016;11(11):e0166104.\u003c/li\u003e\n\u003c/ol\u003e"},{"header":"Tables","content":"\u003ctable border=\"1\" cellpadding=\"0\" cellspacing=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"2\" valign=\"top\" width=\"100%\"\u003e\n \u003cp\u003e\u003cstrong\u003eTable 1\u003c/strong\u003e. Baseline characteristics of mothers\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"72.17391304347827%\"\u003e\n \u003cp\u003eBaseline variables\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"27.82608695652174%\"\u003e\n \u003cp\u003en=113\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"72.17391304347827%\"\u003e\n \u003cp\u003eMean age (y), mean ± SD\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"27.82608695652174%\"\u003e\n \u003cp\u003e34.2 ± 4.2\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"72.17391304347827%\"\u003e\n \u003cp\u003eEthnicity, No. (%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"27.82608695652174%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"72.17391304347827%\"\u003e\n \u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp;White\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"27.82608695652174%\"\u003e\n \u003cp\u003e64 (56.6%)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"72.17391304347827%\"\u003e\n \u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp;Asian (Chinese, Korean, Japanese, Filipino)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"27.82608695652174%\"\u003e\n \u003cp\u003e27 (23.9%)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"72.17391304347827%\"\u003e\n \u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp;Other (South Asian, black, other)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"27.82608695652174%\"\u003e\n \u003cp\u003e22 (19.5%)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"72.17391304347827%\"\u003e\n \u003cp\u003ePre-pregnancy BMI* (kg/m\u003csup\u003e2\u003c/sup\u003e),\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"27.82608695652174%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"72.17391304347827%\"\u003e\n \u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp;Mean ± SD\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"27.82608695652174%\"\u003e\n \u003cp\u003e24.3 ± 4.6\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"72.17391304347827%\"\u003e\n \u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp;Obese (\u0026gt;30kg/m\u003csup\u003e2\u003c/sup\u003e), No. (%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"27.82608695652174%\"\u003e\n \u003cp\u003e11 (9.7%)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"72.17391304347827%\"\u003e\n \u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp;Overweight (25-29.9kg/m\u003csup\u003e2\u003c/sup\u003e), No (%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"27.82608695652174%\"\u003e\n \u003cp\u003e30 (26.5%)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"72.17391304347827%\"\u003e\n \u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp;Healthy (18.5-24.9kg/m\u003csup\u003e2\u003c/sup\u003e), No (%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"27.82608695652174%\"\u003e\n \u003cp\u003e72 (63.7%)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"72.17391304347827%\"\u003e\n \u003cp\u003e3-month post-partum BMI* (kg/m\u003csup\u003e2\u003c/sup\u003e),\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"27.82608695652174%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"72.17391304347827%\"\u003e\n \u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp;Mean ± SD\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"27.82608695652174%\"\u003e\n \u003cp\u003e26.4 ± 5.2\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"72.17391304347827%\"\u003e\n \u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp;Obese (\u0026gt;30kg/m\u003csup\u003e2\u003c/sup\u003e), No. (%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"27.82608695652174%\"\u003e\n \u003cp\u003e17 (15.0%)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"72.17391304347827%\"\u003e\n \u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp;Overweight (25-29.9kg/m\u003csup\u003e2\u003c/sup\u003e), No. (%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"27.82608695652174%\"\u003e\n \u003cp\u003e46 (40.7%)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"72.17391304347827%\"\u003e\n \u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp;Healthy (18.5-24.9kg/m\u003csup\u003e2\u003c/sup\u003e), No. (%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"27.82608695652174%\"\u003e\n \u003cp\u003e50 (44.2%)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"72.17391304347827%\"\u003e\n \u003cp\u003eGlucose tolerance status, No. (%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"27.82608695652174%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"72.17391304347827%\"\u003e\n \u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp;Gestational diabetes mellitus\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"27.82608695652174%\"\u003e\n \u003cp\u003e24 (21.2%)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"72.17391304347827%\"\u003e\n \u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp;Impaired glucose tolerance\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"27.82608695652174%\"\u003e\n \u003cp\u003e20 (17.7%)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"72.17391304347827%\"\u003e\n \u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp;Normoglycemic\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"27.82608695652174%\"\u003e\n \u003cp\u003e69 (61.1%)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"72.17391304347827%\"\u003e\n \u003cp\u003eMode of delivery, No. (%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"27.82608695652174%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"72.17391304347827%\"\u003e\n \u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp;Vaginal\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"27.82608695652174%\"\u003e\n \u003cp\u003e64 (56.6%)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"72.17391304347827%\"\u003e\n \u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp;Scheduled Caesarean section\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"27.82608695652174%\"\u003e\n \u003cp\u003e21 (18.6%)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"72.17391304347827%\"\u003e\n \u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp;Unscheduled Caesarean section\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"27.82608695652174%\"\u003e\n \u003cp\u003e28 (24.8%)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"2\" valign=\"top\" width=\"100%\"\u003e\n \u003cp\u003e*BMI= body mass index\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003ctable border=\"1\" cellpadding=\"0\" cellspacing=\"0\" width=\"798\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"6\" valign=\"top\" width=\"100%\"\u003e\n \u003cp\u003e\u003cstrong\u003eTable 2\u003c/strong\u003e. Differential abundance of top 5 phyla and top 10 genera based on maternal BMI.\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"24.68671679197995%\"\u003e\n \u003cp\u003e\u003cstrong\u003eTaxa\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"13.659147869674186%\"\u003e\n \u003cp\u003e\u003cstrong\u003eGroup effect\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003ep\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003e-value \u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"21.67919799498747%\"\u003e\n \u003cp\u003e\u003cstrong\u003ePairwise comparison\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"8.395989974937343%\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;IRR\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.528822055137844%\"\u003e\n \u003cp\u003e\u003cstrong\u003e95% CI\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"20.050125313283207%\"\u003e\n \u003cp\u003e\u003cstrong\u003ePairwise comparison\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003ep\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003e-value\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"6\" valign=\"top\" width=\"100%\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;Pre-pregnancy BMI\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"24.68671679197995%\"\u003e\n \u003cp\u003e\u003cstrong\u003ePhylum\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"13.659147869674186%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"21.67919799498747%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"8.395989974937343%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.528822055137844%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"20.050125313283207%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"24.68671679197995%\"\u003e\n \u003cp\u003eProteobacteria\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"13.659147869674186%\"\u003e\n \u003cp\u003e0.020\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"21.67919799498747%\"\u003e\n \u003cp\u003eObese vs overweight\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"8.395989974937343%\"\u003e\n \u003cp\u003e\u0026nbsp; 0.62\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.528822055137844%\"\u003e\n \u003cp\u003e0.43-0.90\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"20.050125313283207%\"\u003e\n \u003cp\u003e0.0012\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"24.68671679197995%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"13.659147869674186%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"21.67919799498747%\"\u003e\n \u003cp\u003eOverweight vs healthy\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"8.395989974937343%\"\u003e\n \u003cp\u003e\u0026nbsp; 1.23\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.528822055137844%\"\u003e\n \u003cp\u003e1.00-1.50\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"20.050125313283207%\"\u003e\n \u003cp\u003e0.045\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"24.68671679197995%\"\u003e\n \u003cp\u003eBacteroidetes\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"13.659147869674186%\"\u003e\n \u003cp\u003e0.0051\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"21.67919799498747%\"\u003e\n \u003cp\u003eObese vs overweight\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"8.395989974937343%\"\u003e\n \u003cp\u003e\u0026nbsp; 3.70\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.528822055137844%\"\u003e\n \u003cp\u003e1.61-8.48\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"20.050125313283207%\"\u003e\n \u003cp\u003e0.002\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"24.68671679197995%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"13.659147869674186%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"21.67919799498747%\"\u003e\n \u003cp\u003eObese vs healthy\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"8.395989974937343%\"\u003e\n \u003cp\u003e\u0026nbsp; 2.56\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.528822055137844%\"\u003e\n \u003cp\u003e1.27-5.17\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"20.050125313283207%\"\u003e\n \u003cp\u003e0.0086\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"24.68671679197995%\"\u003e\n \u003cp\u003e\u003cstrong\u003eGenus\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"13.659147869674186%\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"21.67919799498747%\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"8.395989974937343%\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.528822055137844%\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"20.050125313283207%\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"24.68671679197995%\"\u003e\n \u003cp\u003e\u003cem\u003eStaphylococcus\u003c/em\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"13.659147869674186%\"\u003e\n \u003cp\u003e0.011\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"21.67919799498747%\"\u003e\n \u003cp\u003eObese vs overweight\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"8.395989974937343%\"\u003e\n \u003cp\u003e\u0026nbsp; 2.50\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.528822055137844%\"\u003e\n \u003cp\u003e1.09-5.72\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"20.050125313283207%\"\u003e\n \u003cp\u003e0.031\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"24.68671679197995%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"13.659147869674186%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"21.67919799498747%\"\u003e\n \u003cp\u003eObese vs healthy\u003c/p\u003e\n \u003cp\u003eOverweight vs healthy\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"8.395989974937343%\"\u003e\n \u003cp\u003e\u0026nbsp; 3.15\u003c/p\u003e\n \u003cp\u003e\u0026nbsp; 5.96\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.528822055137844%\"\u003e\n \u003cp\u003e1.47-6.80\u003c/p\u003e\n \u003cp\u003e1.85-19.21\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"20.050125313283207%\"\u003e\n \u003cp\u003e0.0032\u003c/p\u003e\n \u003cp\u003e0.0028\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"24.68671679197995%\"\u003e\n \u003cp\u003e\u003cem\u003eCorynebacterium\u0026nbsp;\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"13.659147869674186%\"\u003e\n \u003cp\u003e0.00030\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"21.67919799498747%\"\u003e\n \u003cp\u003eObese vs overweight\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"8.395989974937343%\"\u003e\n \u003cp\u003e\u0026nbsp; \u0026nbsp;5.13\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.528822055137844%\"\u003e\n \u003cp\u003e1.79-14.70\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"20.050125313283207%\"\u003e\n \u003cp\u003e0.0023\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"24.68671679197995%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"13.659147869674186%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"21.67919799498747%\"\u003e\n \u003cp\u003eObese vs healthy\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"8.395989974937343%\"\u003e\n \u003cp\u003e\u0026nbsp; 4.98\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.528822055137844%\"\u003e\n \u003cp\u003e2.11-11.74\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"20.050125313283207%\"\u003e\n \u003cp\u003e0.0002\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"24.68671679197995%\"\u003e\n \u003cp\u003e\u003cem\u003eBrevundimonas\u003c/em\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"13.659147869674186%\"\u003e\n \u003cp\u003e\u0026lt;0.0001\u003c/p\u003e\n \u003cp\u003e\u0026lt;0.0001\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"21.67919799498747%\"\u003e\n \u003cp\u003eOverweight vs healthy\u003c/p\u003e\n \u003cp\u003eUnscheduled C-section vs vaginal\u0026nbsp;\u003c/p\u003e\n \u003cp\u003eScheduled C-section vs \u0026nbsp; \u0026nbsp;unscheduled C-section\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"8.395989974937343%\"\u003e\n \u003cp\u003e\u0026nbsp; 8.72\u003c/p\u003e\n \u003cp\u003e\u0026nbsp; 16.70\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp; 0.07\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.528822055137844%\"\u003e\n \u003cp\u003e3.24-23.48\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;5.99-46.57\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e0.011-0.46\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"20.050125313283207%\"\u003e\n \u003cp\u003e\u0026lt;0.0001\u003c/p\u003e\n \u003cp\u003e\u0026lt;0.0001\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e0.0053\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"6\" valign=\"top\" width=\"100%\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; 3-month post-partum BMI\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"24.68671679197995%\"\u003e\n \u003cp\u003e\u003cstrong\u003ePhylum\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"13.659147869674186%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"21.67919799498747%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"8.395989974937343%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.528822055137844%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"20.050125313283207%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"24.68671679197995%\"\u003e\n \u003cp\u003eActinobacteria\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"13.659147869674186%\"\u003e\n \u003cp\u003e0.0058\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"21.67919799498747%\"\u003e\n \u003cp\u003eObese vs overweight\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"8.395989974937343%\"\u003e\n \u003cp\u003e2.34\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.528822055137844%\"\u003e\n \u003cp\u003e1.38-3.98\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"20.050125313283207%\"\u003e\n \u003cp\u003e0.0017\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"24.68671679197995%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"13.659147869674186%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"21.67919799498747%\"\u003e\n \u003cp\u003eObese vs healthy\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"8.395989974937343%\"\u003e\n \u003cp\u003e2.02\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.528822055137844%\"\u003e\n \u003cp\u003e1.18-3.46\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"20.050125313283207%\"\u003e\n \u003cp\u003e0.010\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"24.68671679197995%\"\u003e\n \u003cp\u003e\u003cstrong\u003eGenus\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"13.659147869674186%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"21.67919799498747%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"8.395989974937343%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.528822055137844%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"20.050125313283207%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"24.68671679197995%\"\u003e\n \u003cp\u003e\u003cem\u003eCorynebacterium\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"13.659147869674186%\"\u003e\n \u003cp\u003e\u0026lt;0.0001\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"21.67919799498747%\"\u003e\n \u003cp\u003eObese vs overweight\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"8.395989974937343%\"\u003e\n \u003cp\u003e4.84\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.528822055137844%\"\u003e\n \u003cp\u003e2.19-10.72\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"20.050125313283207%\"\u003e\n \u003cp\u003e0.0001\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"24.68671679197995%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"13.659147869674186%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"21.67919799498747%\"\u003e\n \u003cp\u003eObese vs healthy\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"8.395989974937343%\"\u003e\n \u003cp\u003e7.77\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.528822055137844%\"\u003e\n \u003cp\u003e2.95-20.43\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"20.050125313283207%\"\u003e\n \u003cp\u003e\u0026lt;0.0001\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"24.68671679197995%\"\u003e\n \u003cp\u003e\u003cem\u003eBrevundimonas\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"13.659147869674186%\"\u003e\n \u003cp\u003e\u0026lt;0.0001\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e0.00050\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"21.67919799498747%\"\u003e\n \u003cp\u003eObese vs overweight\u003c/p\u003e\n \u003cp\u003eObese vs healthy\u003c/p\u003e\n \u003cp\u003eUnscheduled C-section vs vaginal\u003c/p\u003e\n \u003cp\u003eScheduled C-section vs unscheduled C-section\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"8.395989974937343%\"\u003e\n \u003cp\u003e8.89\u003c/p\u003e\n \u003cp\u003e9.56\u003c/p\u003e\n \u003cp\u003e13.01\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e0.08\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.528822055137844%\"\u003e\n \u003cp\u003e2.29-34.57\u003c/p\u003e\n \u003cp\u003e2.17-42.22\u003c/p\u003e\n \u003cp\u003e4.01-42.20\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e0.013-0.62\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"20.050125313283207%\"\u003e\n \u003cp\u003e0.0016\u003c/p\u003e\n \u003cp\u003e\u0026nbsp; 0.0029\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u0026lt;0.0001\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp; \u0026nbsp;0.015\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"6\" valign=\"top\" width=\"100%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003eSeparate Poisson regression models were run for pre-pregnancy BMI and 3-month post-partum BMI, while adjusting for maternal glucose tolerance status, mode of delivery, DNA extraction batch, and PCR sequencing batch. Statistically significant main group effect findings shown only (group effect: p≤0.022 for phylum, p≤0.017 for genus; pairwise comparison: p\u0026lt;0.05). Abbreviations: confidence interval, CI; incidence rate ratio, IRR.\u003c/p\u003e\u003c/table\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \n \u003ctable border=\"1\" cellpadding=\"0\" cellspacing=\"0\" width=\"784\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"6\" valign=\"top\" width=\"100%\"\u003e\n \u003cp\u003e\u003cstrong\u003eTable 3\u003c/strong\u003e. Differential abundance of top 5 phyla and top 10 genera based on ethnicity.\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"24.713375796178344%\"\u003e\n \u003cp\u003e\u003cstrong\u003eTaxa\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"13.885350318471337%\"\u003e\n \u003cp\u003e\u003cstrong\u003eGroup effect\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003ep\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003e-value \u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"21.273885350318473%\"\u003e\n \u003cp\u003e\u003cstrong\u003ePairwise comparison\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"7.388535031847134%\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;IRR\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.719745222929935%\"\u003e\n \u003cp\u003e\u003cstrong\u003e95% CI\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"21.019108280254777%\"\u003e\n \u003cp\u003e\u003cstrong\u003ePairwise comparison\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003ep\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003e-value\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"6\" valign=\"top\" width=\"100%\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"24.713375796178344%\"\u003e\n \u003cp\u003e\u003cstrong\u003ePhylum\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"13.885350318471337%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"21.273885350318473%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"7.388535031847134%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.719745222929935%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"21.019108280254777%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"24.713375796178344%\"\u003e\n \u003cp\u003e\u003cem\u003eCorynebacterium\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"13.885350318471337%\"\u003e\n \u003cp\u003e0.0008\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"21.273885350318473%\"\u003e\n \u003cp\u003eWhite vs other\u003c/p\u003e\n \u003cp\u003eAsian vs other\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"7.388535031847134%\"\u003e\n \u003cp\u003e\u0026nbsp; 0.27\u003c/p\u003e\n \u003cp\u003e\u0026nbsp; 0.17\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.719745222929935%\"\u003e\n \u003cp\u003e\u0026nbsp; 0.12-0.59\u003c/p\u003e\n \u003cp\u003e\u0026nbsp; 0.049-0.63\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"21.019108280254777%\"\u003e\n \u003cp\u003e\u0026nbsp; 0.0010\u003c/p\u003e\n \u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; 0.0075\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"24.713375796178344%\"\u003e\n \u003cp\u003e\u003cem\u003eBrevundimonas\u003c/em\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"13.885350318471337%\"\u003e\n \u003cp\u003e0.0051\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"21.273885350318473%\"\u003e\n \u003cp\u003eWhite vs Asian\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"7.388535031847134%\"\u003e\n \u003cp\u003e\u0026nbsp; 0.084\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.719745222929935%\"\u003e\n \u003cp\u003e0.015-0.46\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"21.019108280254777%\"\u003e\n \u003cp\u003e0.0042\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"6\" valign=\"top\" width=\"100%\"\u003e\n \u003cp\u003eEthnicity was investigated for all taxa and models were adjusted for DNA extraction and PCR sequencing batch effects. Statistically significant findings shown only (group effect: p≤0.022 for phylum, p≤0.017 for genus; pairwise comparison: p\u0026lt;0.05). Abbreviations: confidence interval, CI; incidence rate ratio, IRR.\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003ctable border=\"1\" cellpadding=\"0\" cellspacing=\"0\" width=\"798\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"6\" valign=\"top\" width=\"100%\"\u003e\n \u003cp\u003e\u003cstrong\u003eTable 4\u003c/strong\u003e. Differential abundance of top 5 phyla and top 10 genera showing results with non-significant group effect p-values but significant pairwise comparison p-values.\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"24.68671679197995%\"\u003e\n \u003cp\u003e\u003cstrong\u003eTaxa\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"13.659147869674186%\"\u003e\n \u003cp\u003e\u003cstrong\u003eGroup effect\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003ep\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003e-value \u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"21.67919799498747%\"\u003e\n \u003cp\u003e\u003cstrong\u003ePairwise comparison\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"8.395989974937343%\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;IRR\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.528822055137844%\"\u003e\n \u003cp\u003e\u003cstrong\u003e95% CI\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"20.050125313283207%\"\u003e\n \u003cp\u003e\u003cstrong\u003ePairwise comparison\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003ep\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003e-value\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"6\" valign=\"top\" width=\"100%\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;Pre-pregnancy BMI\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"24.68671679197995%\"\u003e\n \u003cp\u003e\u003cstrong\u003ePhylum\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"13.659147869674186%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"21.67919799498747%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"8.395989974937343%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.528822055137844%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"20.050125313283207%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"24.68671679197995%\"\u003e\n \u003cp\u003eFirmicutes\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"13.659147869674186%\"\u003e\n \u003cp\u003e0.060\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"21.67919799498747%\"\u003e\n \u003cp\u003eObese vs overweight\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"8.395989974937343%\"\u003e\n \u003cp\u003e\u0026nbsp; 1.76\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.528822055137844%\"\u003e\n \u003cp\u003e1.06-2.94\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"20.050125313283207%\"\u003e\n \u003cp\u003e0.030\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"24.68671679197995%\"\u003e\n \u003cp\u003eActinobacteria\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"13.659147869674186%\"\u003e\n \u003cp\u003e0.039\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"21.67919799498747%\"\u003e\n \u003cp\u003eObese vs overweight\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"8.395989974937343%\"\u003e\n \u003cp\u003e\u0026nbsp; 2.23\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.528822055137844%\"\u003e\n \u003cp\u003e1.19-4.17\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"20.050125313283207%\"\u003e\n \u003cp\u003e0.012\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"24.68671679197995%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003eBacteroidetes\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"13.659147869674186%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e0.070\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e0.066\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"21.67919799498747%\"\u003e\n \u003cp\u003eObese vs healthy\u003c/p\u003e\n \u003cp\u003eGestational diabetes vs normoglycemia\u003c/p\u003e\n \u003cp\u003eScheduled C-section vs vaginal\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"8.395989974937343%\"\u003e\n \u003cp\u003e\u0026nbsp; 1.76\u003c/p\u003e\n \u003cp\u003e\u0026nbsp; 0.34\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp; 2.16\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.528822055137844%\"\u003e\n \u003cp\u003e1.01-3.04\u003c/p\u003e\n \u003cp\u003e0.14-0.85\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e1.12-4.14\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"20.050125313283207%\"\u003e\n \u003cp\u003e0.040\u003c/p\u003e\n \u003cp\u003e0.021\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e0.021\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"24.68671679197995%\"\u003e\n \u003cp\u003e\u003cstrong\u003eGenus\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"13.659147869674186%\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"21.67919799498747%\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"8.395989974937343%\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.528822055137844%\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"20.050125313283207%\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"24.68671679197995%\"\u003e\n \u003cp\u003e\u003cem\u003ePseudomonas\u0026nbsp;\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"13.659147869674186%\"\u003e\n \u003cp\u003e0.055\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"21.67919799498747%\"\u003e\n \u003cp\u003eObese vs overweight\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"8.395989974937343%\"\u003e\n \u003cp\u003e\u0026nbsp;0.63\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.528822055137844%\"\u003e\n \u003cp\u003e0.41-0.96\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"20.050125313283207%\"\u003e\n \u003cp\u003e0.032\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"24.68671679197995%\"\u003e\n \u003cp\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u003c/p\u003e\n \u003cp\u003e\u003cem\u003eStreptococcus\u003c/em\u003e\u003c/p\u003e\n \u003cp\u003e\u003cem\u003eStaphylococcus\u003c/em\u003e\u003c/p\u003e\n \u003cp\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u003c/p\u003e\n \u003cp\u003e\u003cem\u003eVeillonella \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"13.659147869674186%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e0.083\u003c/p\u003e\n \u003cp\u003e0.060\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e0.029\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"21.67919799498747%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003eOverweight vs healthy\u003c/p\u003e\n \u003cp\u003eScheduled C-section vs vaginal\u0026nbsp;\u003c/p\u003e\n \u003cp\u003eObese vs overweight\u003c/p\u003e\n \u003cp\u003eObese vs healthy\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"8.395989974937343%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;0.59\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;2.43\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;3.88\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;2.91\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.528822055137844%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e0.37-0.95\u003c/p\u003e\n \u003cp\u003e1.13-5.21\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e1.25-12.11\u003c/p\u003e\n \u003cp\u003e1.18-7.14\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"20.050125313283207%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;0.029\u003c/p\u003e\n \u003cp\u003e0.022\u003c/p\u003e\n \u003cp\u003e\u0026nbsp; \u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp; \u0026nbsp;0.019\u003c/p\u003e\n \u003cp\u003e\u0026nbsp; \u0026nbsp;0.020\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"6\" valign=\"top\" width=\"100%\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; 3-month post-partum BMI\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"24.68671679197995%\"\u003e\n \u003cp\u003e\u003cstrong\u003ePhylum\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"13.659147869674186%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"21.67919799498747%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"8.395989974937343%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.528822055137844%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"20.050125313283207%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"24.68671679197995%\"\u003e\n \u003cp\u003eBacteroidetes\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"13.659147869674186%\"\u003e\n \u003cp\u003e0.10\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"21.67919799498747%\"\u003e\n \u003cp\u003eScheduled C-section vs vaginal\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"8.395989974937343%\"\u003e\n \u003cp\u003e2.16\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.528822055137844%\"\u003e\n \u003cp\u003e1.05-4.44\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"20.050125313283207%\"\u003e\n \u003cp\u003e0.037\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"24.68671679197995%\"\u003e\n \u003cp\u003e\u003cstrong\u003eGenus\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"13.659147869674186%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"21.67919799498747%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"8.395989974937343%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.528822055137844%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"20.050125313283207%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"24.68671679197995%\"\u003e\n \u003cp\u003e\u003cem\u003eStaphylococcus\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"13.659147869674186%\"\u003e\n \u003cp\u003e0.029\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"21.67919799498747%\"\u003e\n \u003cp\u003eObese vs overweight\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"8.395989974937343%\"\u003e\n \u003cp\u003e2.59\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.528822055137844%\"\u003e\n \u003cp\u003e1.25-5.38\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"20.050125313283207%\"\u003e\n \u003cp\u003e0.011\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"24.68671679197995%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"13.659147869674186%\"\u003e\n \u003cp\u003e0.023\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"21.67919799498747%\"\u003e\n \u003cp\u003eScheduled C-section vs vaginal\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"8.395989974937343%\"\u003e\n \u003cp\u003e2.62\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.528822055137844%\"\u003e\n \u003cp\u003e1.29-5.35\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"20.050125313283207%\"\u003e\n \u003cp\u003e0.0079\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"6\" valign=\"top\" width=\"100%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003eSeparate Poisson regression models were run for pre-pregnancy BMI and 3-month post-partum BMI, while adjusting for maternal glucose tolerance status, mode of delivery, DNA extraction batch, and PCR sequencing batch. All models were run testing for interaction terms between BMI and maternal glucose tolerance status. Statistically significant findings shown only (group effect: p≤0.022 for phylum, p≤0.017 for genus; pairwise comparison: p\u0026lt;0.05). Abbreviations: confidence interval, CI; incidence rate ratio, IRR.\u003c/p\u003e\u003c/tbody\u003e\u003c/table\u003e\u003cbr\u003e\n \u003ctable border=\"1\" cellpadding=\"0\" cellspacing=\"0\" width=\"784\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"6\" valign=\"top\" width=\"100%\"\u003e\n \u003cp\u003e\u003cstrong\u003eTable 5\u003c/strong\u003e. Differential abundance of top 5 phyla and top 10 genera based on ethnicity showing results with non-significant group effect p-values but significant pairwise comparison p-values.\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"24.713375796178344%\"\u003e\n \u003cp\u003e\u003cstrong\u003eTaxa\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"13.885350318471337%\"\u003e\n \u003cp\u003e\u003cstrong\u003eGroup effect\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003ep\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003e-value \u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"21.273885350318473%\"\u003e\n \u003cp\u003e\u003cstrong\u003ePairwise comparison\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"7.388535031847134%\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;IRR\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.719745222929935%\"\u003e\n \u003cp\u003e\u003cstrong\u003e95% CI\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"21.019108280254777%\"\u003e\n \u003cp\u003e\u003cstrong\u003ePairwise comparison\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003ep\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003e-value\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"6\" valign=\"top\" width=\"100%\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"24.713375796178344%\"\u003e\n \u003cp\u003e\u003cstrong\u003ePhylum\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"13.885350318471337%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"21.273885350318473%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"7.388535031847134%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.719745222929935%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"21.019108280254777%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"24.713375796178344%\"\u003e\n \u003cp\u003e\u003cem\u003eGemella\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"13.885350318471337%\"\u003e\n \u003cp\u003e0.073\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"21.273885350318473%\"\u003e\n \u003cp\u003eWhite vs Asian\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"7.388535031847134%\"\u003e\n \u003cp\u003e\u0026nbsp; 0.45\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.719745222929935%\"\u003e\n \u003cp\u003e\u0026nbsp; 0.22-0.95\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"21.019108280254777%\"\u003e\n \u003cp\u003e\u0026nbsp; 0.037\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"24.713375796178344%\"\u003e\n \u003cp\u003e\u003cem\u003eAeromonas\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"13.885350318471337%\"\u003e\n \u003cp\u003e0.022\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"21.273885350318473%\"\u003e\n \u003cp\u003eAsian vs other\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"7.388535031847134%\"\u003e\n \u003cp\u003e\u0026nbsp; 0.020\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.719745222929935%\"\u003e\n \u003cp\u003e0.0007-0.59\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"21.019108280254777%\"\u003e\n \u003cp\u003e0.023\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"6\" valign=\"top\" width=\"100%\"\u003e\n \u003cp\u003eEthnicity was investigated for all taxa and models were adjusted for DNA extraction and PCR sequencing batch effects. Statistically significant findings shown only (group effect: p≤0.022 for phylum, p≤0.017 for genus; pairwise comparison: p\u0026lt;0.05). Abbreviations: confidence interval, CI; incidence rate ratio, IRR.\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"bmc-microbiology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"mcro","sideBox":"Learn more about [BMC Microbiology](http://bmcmicrobiol.biomedcentral.com/)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/mcro","title":"BMC Microbiology","twitterHandle":"#bmcmicrobiology","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"em","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Mother’s milk, microbiota, body mass index, gestational diabetes, impaired glucose tolerance, mode of delivery, vaginal delivery, Caesarean delivery, ethnicity, microbiome ","lastPublishedDoi":"10.21203/rs.3.rs-17184/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-17184/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eBackground: Few studies have examined how maternal body mass index (BMI), mode of delivery and ethnicity affect the microbial composition of human milk and none have examined associations with maternal metabolic status. Given the high prevalence of maternal adiposity and impaired glucose metabolism, and the importance of human milk in the colonization of the infant gut, we systematically investigated the associations between these maternal factors and milk microbial composition and functionality. \u003c/p\u003e\u003cp\u003eMethods: Women ≥20 years were recruited during pregnancy and milk samples were collected at 3 months post-partum (NCT01405547). Demographic data, weight, height, and a 3-hour oral glucose tolerance test were conducted at 30 (95% CI: 25-33) weeks gestation. Metagenomic DNA extraction and 16S ribosomal RNA gene sequencing of the V4 hypervariable region (Illumina MiSeq) was carried out on 113 milk samples. \u003c/p\u003e\u003cp\u003eResults: Multivariable linear regression analyses demonstrated no significant associations between maternal characteristics (maternal BMI [pre-pregnancy, 3 months post-partum], glucose tolerance, mode of delivery and ethnicity) and microbiota alpha-diversity; however, pre-pregnancy BMI was associated with human milk beta-diversity (Bray-Curtis p=0.040). Women with a pre-pregnancy BMI \u0026gt;30 kg/m2 (obese) had a greater incidence of Bacteroidetes (incidence rate ratio [IRR]: 3.70 [95% CI: 1.61-8.48]) and a reduced incidence of Proteobacteria (0.62 [0.43-0.90]), compared to overweight women (BMI 25.0-29.9 kg/m2) as assessed by multivariable Poisson regression. Increased incidence of Gemella was observed among overweight (versus healthy) mothers with gestational diabetes (5.96 [1.85-19.21]) and obese (versus healthy) mothers with impaired glucose tolerance (4.04 [1.63-10.01]). An increased incidence of Brevundimonas (16.70 [5.99-46.57]) was found in the milk of women who underwent an unscheduled C-section versus vaginal delivery. Lastly, functional gene inference demonstrated that obesity was associated with increased abundance of genes encoding for the biosynthesis of secondary metabolites in milk (coefficient=0.00028, p=0.0070). \u003c/p\u003e\u003cp\u003eConclusions: Mother’s milk has a diverse microbiota of which its diversity and differential abundance appear associated with maternal body size, glucose tolerance status, mode of delivery, and ethnicity. Further research is warranted to determine whether this variability in the milk microbiota impacts colonization of the infant gut.\u003c/p\u003e","manuscriptTitle":"Examining the relationship between maternal body size, gestational glucose tolerance status, mode of delivery and ethnicity on mother’s milk microbiota at three months post-partum","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2020-03-13 18:35:36","doi":"10.21203/rs.3.rs-17184/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Major revision","date":"2020-04-21T12:00:00+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2020-01-05T12:00:00+00:00","index":1,"fulltext":"Recommendation: Reviewer's comments unavailable due to the journal's policy.\n"},{"type":"reviewersInvited","content":"","date":"2019-12-09T12:00:00+00:00","index":"","fulltext":""},{"type":"reviewerAgreed","content":"","date":"2019-12-09T12:00:00+00:00","index":1,"fulltext":""},{"type":"editorAssigned","content":"","date":"2019-12-02T12:00:00+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2019-12-01T12:00:00+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2019-12-01T12:00:00+00:00","index":"","fulltext":""},{"type":"submitted","content":"","date":"2019-11-29T12:00:00+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"bmc-microbiology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"mcro","sideBox":"Learn more about [BMC Microbiology](http://bmcmicrobiol.biomedcentral.com/)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/mcro","title":"BMC Microbiology","twitterHandle":"#bmcmicrobiology","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"em","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"41c19c36-5eaa-4bbd-9c99-26dd248a920e","owner":[],"postedDate":"March 13th, 2020","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[{"id":69939,"name":"Applied \u0026 Industrial Microbiology"},{"id":69940,"name":"Nutrition \u0026 Dietetics"}],"tags":[],"updatedAt":"2020-07-26T15:04:16+00:00","versionOfRecord":{"articleIdentity":"rs-17184","link":"https://doi.org/10.1186/s12866-020-01901-9","journal":{"identity":"bmc-microbiology","isVorOnly":false,"title":"BMC Microbiology"},"publishedOn":"2020-07-20 12:00:00","publishedOnDateReadable":"July 20th, 2020"},"versionCreatedAt":"2020-03-13 18:35:36","video":"","vorDoi":"10.1186/s12866-020-01901-9","vorDoiUrl":"https://doi.org/10.1186/s12866-020-01901-9","workflowStages":[]},"version":"v1","identity":"rs-17184","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-17184","identity":"rs-17184","version":["v1"]},"buildId":"WrCJVZZCHTDjtuVLN7oU0","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}