Effect of plasma membrane H+-ATPase on nitrate uptake in rice under aluminum stress | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Effect of plasma membrane H+-ATPase on nitrate uptake in rice under aluminum stress Xiaohua Zhou, Zeyi Zhou, Yaqun Dong, Yuanyuan Lin, Xiaoling Zhang, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6517400/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract The aim of the experiments was to investigate the effects of the plasma membrane (PM) H + -ATPase on the nitrate (NO 3 − -N) uptake of rice under aluminum (Al) stress. The hydroponic experiment was designed to study the activities of PM H + -ATPase and H + -pump, the level of interaction of PM H + -ATPase and 14-3-3 protein, H + efflux, and the expression levels of PM H + -ATPase gene ( OsA1 - OsA10 ). The effects of both the activator fusicoccin (FC) and inhibitor adenosine-5’-monophosphate (AMP) of PM H + -ATPase on the uptake of NO 3 − -N in rice have been designed with the hybrid Dianyou 35 rice as the subject. The results showed that Al stress decreased NO 3 − -N uptake by declining the gene expressions of PM H + -ATPase except for OsA6 and OsA10 , as well as the activity of PM H + -ATPase, H + -pump activity, and H + efflux. FC improved NO 3 − -N uptake by increasing the gene expressions of PM H + -ATPase, with the exception of for OsA6 and OsA10 . It also enhanced the activities of PM H + -ATPase, H + -pump and H + efflux as well as the interaction of the PM H + -ATPase with 14-3-3 protein. In contrast, AMP showed opposing trends, reducing NO 3 − -N uptake by diminishing the gene expression of OsA1 and OsA7. These results indicated that PM H + -ATPase plays an important regulatory role by regulating the expressions of OsA1 and OsA7 in the transmembrane transport process of NO 3 − -N in rice under Al stress. This study could provide a theoretical basis for enhancing the ability of rice to absorb NO 3 − -N under acidic Al conditions, thereby promoting their growth. Aluminum stress Nitrate Plasma membrane H+-ATPase 14-3-3 protein Gene expressions Rice (Oryza sativa L.) Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Introduction In the past few years, with the extensive use of chemical fertilizers and the increase in acid rain have contributed to the expansion of acidic cultivated land. According to Bungau et al. ( 2021 ) and Li et al. ( 2022 a), 50% of the world’s arable soil and 21% of the arable soil in China are acidic, representing a significant environmental concern. A soil pH value below 5.5 will result in the dissolution of aluminum in the soil, leading to the release of aluminum ions (Al 3+ ). The presence of micromolar Al 3+ in the soil can result in the toxicity of plants, leading to severe inhibition of root growth and the absorption of essential nutrients such as nitrogen (N) and phosphorus (P) (Ofoe et al. 2023 ; Basit et al. 2022 ). Rice is one of the most important food crops, providing sustenance to over half of the global population( Sakhare et al. 2025 ). In China, approximately 30% of rice cultivation occurs in acidic soil. In the presence of aluminum (Al) stress, Al 3+ has the potential to infiltrate rice root cells, leading to damage to the integrity of the cytoplasmic membrane. This, in turn, impairs the absorption of essential nutrients (such as N and P) by the rice plant, which can have a significant impact on its growth and yield. Therefore, Al toxicity has emerged as a significant constraint on rice growth and yield enhancement (Wang et al. 2023 ; Lu et al. 2024 ). It is widely accepted that rice is an ammonium-dependent crop, due to the oxygen secretion of rice roots, which can be utilized by microorganisms to convert ammonium nitrogen (NH 4 + -N) to nitrate nitrogen (NO 3 − -N) through nitrification. The NO 3 − -N on the root surface can be immediately absorbed by rice plants, the ratio of NO 3 − -N and NH 4 + -N absorbed in rice roots is approximately 4:6, indicating that NO 3 − -N absorption is the primary factor that controls the growth of root and plant. N nutrient deficiency has a significant impact on crop growth and yield (Huo et al. 2020 ; Xiao et al. 2023 ). Therefore, the absorption and utilization of NO 3 − -N may directly influence the development and growth of rice. The plasma membrane (PM) H + -ATPase is the most abundant protein in the cell membranes of plants. PM H + -ATPase is described as the “master enzyme” in the activities of higher plants, playing a central role in maintaining cytoplasmic pH, metabolite homeostasis and stress adaptation. It regulates many vital physiological reactions, including participating in the transport and uptake of N, P, and amino acids (Gutiérrez-Nájera et al. 2020 ; Xia et al. 2019 ). The 14-3-3 protein is a type of highly conserved regulatory protein in eukaryotic cells that plays an important role in regulating the activity of PM H + -ATPase in plants. It regulates the activity of PM H + -ATPase by interacting it with the phosphorylated PM H + -ATPase (Nguyen et al. 2018 ; Fiorillo et al. 2023 ), PM H + -ATPase represents the primary binding target of the 14-3-3 protein in the plasma membrane. The cooperative interaction between the 14-3-3 protein and PM H + -ATPase has been demonstrated to activate the PM H + -ATPase activity in Al-resistant broad bean under Al stress (Zhao et al. 2021 ; Chen et al. 2013 ). Fusicoccin (FC) is a carbontricyclic diterpene glycoside toxin produced by Fusicoccina amygdale L. Its role is similar to that of auxin. FC is also a PM H + -ATPase specific activator. FC has the potential to significantly enhance the activity of PM H + -ATPase by binding the 14-3-3/H + -ATPase complex more firmly (Marra et al. 2021 ; de Boer. 2024). However, adenosine 5’-monophosphate (AMP) is a PM H + -ATPase specific inhibitor that inhibits the activity of PM H + -ATPase by reducing the level of phosphorylation of the PM H + -ATPase and its binding to the 14-3-3 protein (Jahn et al. 1997 ; Li et al. 2020 ). The degree of interaction between 14-3-3 protein and PM H + -ATPase will affect the activity of the latter. The activity of PM H + -ATPase directly affects the absorption of NO 3 − -N by crops. The adsorption of NO 3 − -N by plant cells occurs via the transmembrane transport process, which is closely related to the activity of PM H + -ATPase. This process involves the cell membrane ion channels, transporters, and carriers. The cell membranes of rice roots possess both high-affinity and low-affinity nitrate transport systems(Lin et al. 2019 ). The two NO 3 − -N absorption systems are driven by the dissipation of energy from the active transport process, which is inversely proportional to the concentration gradient and electrochemical gradient. The absorption of NO 3 − -N occurs through the cell membrane transport protein in the 2H + /1NO 3 − co-transport mode, wherein PM H + -ATPase provides the energy and proton gradient across the membrane, thereby creating driving force for the uptake of various ions and small molecules by plants (Zhang et al. 2011 ; Elmore and Coaker 2011 ). PM H + -ATPase plays a role in regulating NO 3 − -N absorption in rice. Increased PM H + -ATPase activity has been observed to result in a net uptake of NO 3 − -N in rice (Zhou et al. 2016 ; Loss Sperandio et al. 2011 ). The increase in PM H + - ATPase activity is associated with the expression level of the enzyme gene. Regulation of plasma membrane enzyme activity is achieved through transcriptional regulation, whereby the specific expression of homologous genes is altered to regulate enzyme activity. Rice has been found to possess ten homologous proteins of PM H + -ATPase, designated OsA1 through OsA10 (Li et al. 2022 b; Zhang et al. 2024 ). The regulation of nitrogen uptake by different H + - ATPase genes is dependent on the specific crop variety. Zhang et al. ( 2017 ) found that acid rain with pH values of 5.0 and 3.5 increased the transcription levels of OsA1 , OsA4 , OsA5 , OsA6 , OsA7 , OsA8 , OsA9 , and OsA10 , enhanced PM H + -ATPase activity, and promoted the absorption of ammonium by rice. In response to NH 4 + stress, K + has been demonstrated to enhance PM H + -ATPase activity and protein expression in rice roots by upregulating the expression levels of OsA1 , OsA3 , OsA7 , OsA8 and OsA9 genes (Weng et al. 2020 ). The activity of PM H + -ATPase has the potential to enhance the uptake of nitrogen and phosphorus by regulating the expression of OsA1 ( Ding et al. 2022 ). The overexpression of OsA1 , OsA2 and OsA8 in rice roots has been demonstrated to enhance the absorption and utilization efficiency of nitrogen, the absorption of NO 3 − -N, and the absorption and translocation of phosphorus (Zhang et al. 2021 ; Loss Sperandio et al. 2020 ). Based on the above literature analysis, it can be postulated that Al stress may affect the activity of PM H + -ATPase by regulating the expression level of PM H + -ATPase genes, which in turn affects the absorption of NO 3 − -N by rice. However, the molecular regulatory mechanism of PM H + -ATPase gene on NO 3 − -N uptake in rice under Al stress remains poorly understood, particularly with regard to the specific activators (FC) and inhibitors (AMP) of PM H + -ATPase. The potential of these as a tool to verify the effect of PM H + -ATPase on NO 3 − -N uptake is yet to be fully explored. Therefore, this study analyzed the absorption of NO 3 − -N in rice under Al stress, as well as the activity of PM H + -ATPase and the expression level of PM H + -ATPase genes, with a particular focus on the correlation between PM H + -ATPase and NO 3 − -N absorption following the the addition of FC and AMP. The objective was to gain further insight into the regulatory mechanism of PM H + -ATPase on NO 3 − -N absorption in rice under Al stress, with a view to providing genetic resources for the screening and cultivation of rice varieties adapted to acidic soil and the improvement of rice genetic breeding. Materials and methods Plant materials and growth conditions The rice seeds were of Yunnan native rice variety (Dianyou 35 (hybrid rice, japonica)), provided by the Rice Research Institute of Yunnan Agricultural University. Dianyou 35 has demonstrated better adaptability to red soil in the plateau area and has a large planting area. The seeds were disinfected with a 10% H 2 O 2 solution and then subsequently rinsed in distilled water for a period of 5 min. They were then soaked in distilled water for a duration of 24 h. Then, the seeds were germinated at a temperature of 25°C in a dark incubator. The sprouted seeds were planted in a polypropylene container containing a 0.5 mmol·L − 1 CaCl 2 solution at a pH of 4.5, which was replenished every two days. Seedlings of a similar size at 1-leaf stage were planted in ¼-strength rice nutrient solution (International rice research institute, IRRI) at a pH of 4.5 for 7 days. Subsequently, the seedlings were planted in a rice nutrient solution containing the following nutrients in mmol·L − 1 : NH 4 NO 3 , 2.86; CaCl 2 , 1.0; MgSO 4 ,1.0; K 2 SO 4 , 0.35; KH 2 PO 4 , 0.3; MnCl 2 , 9.0×10 − 3 ; (NH 4 ) 6 Mo 7 O 24 , 0.39×10 − 4 ; H 3 BO 3 , 2.0×10 − 2 ; ZnSO 4 , 7.7×10 − 4 ; Na 2 EDTA-Fe (II), 2.0×10 − 2 ; CuSO 4 , 3.2×10 − 4 and Na 2 SiO 3 , 5.0×10 − 4 . The solution was adjusted to pH 4.5 and renewed every other day. All experiments were carried out under greenhouse conditions at night/day temperatures of 20°C/28°C with light (1000 µmol·m − 2 ·s − 1 ) for 12 h per day. Previous research results showed that the optimal Al stress concentration was 50 µmol·L − 1 (Zhou et al. 2020 ). To determine the optimal treatment concentration and time for FC (Sigma-Aldrich) and AMP (Sigma-Aldrich), the activity of PM H + -ATPase was measured. Similar size seedlings at the 4-leaf stage were selected and exposed to either 0 or 50 µmol·L − 1 Al 3+ in combination with varying concentrations of FC (0, 1, or 2 µmol·L − 1 ) or AMP (0, 50, or 100 µmol·L − 1 ) in the rice nutrient solution (pH 4.5) for a period of 24 h. The seedlings were exposed to 0 or 50 µmol·L − 1 Al 3+ in combination with the optimal concentration of FC and AMP for different time periods (0, 3, 6, 12, 24 or 48 h), respectively. Seedlings that were not exposed to Al 3+ , FC and AMP (-Al-FC-AMP) were used as controls (CK). following the completion of the treatment, the root tip materials (0–20 mm) were collected, frozen in liquid nitrogen, and stored at − 80℃ for subsequent analysis of their biochemical indices, gene expression, co-immunoprecipitation, and western blot analysis. Determination of NO-N and H efflux The concentration of NO 3 − -N in the solution was determined by UV spectrophotometry, as previously described by Zhou et al. ( 2016 ). H + efflux in the root tip was determined by the non-damage micromeasurement (noninvasive microtest technology system, NMT100 Series; Younger), as previously described by Li et al. ( 2018 ), The root tips of the seedlings treated for 24 h were equilibrated for 15 min in the measurement solution(in mmol·L − 1 ): 0.1 MgCl 2 , 0.1 CaCl 2 , 0.3 MES (2-(4-Morpholino) ethanesulfonic acid), 0.5 NaCl, 0.1 KCl, and 0.2 Na 2 SO 4 , pH 4.0, and then the flow rate of H + was recorded. RNA extraction and qRT-PCR assay RNA extraction and qRT-PCR assay The RNA of the rice root was extracted using the Trizol reagent (Invitrogen) method. The root tip sample were ground with liquid nitrogen, extracted with Trizol reagent, emulsify with chloroform, and them centrifuged at 12000 rpm at 4°C for 15 min. The resulting supernatant was purified with chloroform once more. Isopropanol should then be added to the supernatant and mixed thoroughly. The samples were then subjected to centrifuge at 12000 rpm at 4°C for 30 min. The supernatant should be discarded, and the precipitate should be washed three times with 75% ethanol in diethyl pyrocarbonate (DEPC). The ethanol should then be removed by drying on ice. Following air drying, the precipitation was cleaned and dissolved by dilution with DEPC. The RNA was stored at − 80℃ in preparation for future use. The reverse transcription procedure should be carried out according to the instructions provided by Norwizan reverse transcription kit (Vazyme Biotech Co., Ltd: HiScript® Ⅱ 1st strand cDNA synthesis kit (+ GDNA wiper) R212-01/02). The qPCR experiments were performed using the ChamQTM Universal SYBR qPCR Master Mix (Q711-02/03) of Vazyme Biotech Co., Ltd. In accordance with the instructions provided by the manufacturer. This article employs Dianyou 35 as the research material to design primers based on the gene sequence of Nipponbare (Japonica), which has been sequenced in its entirety. In this study, the 10 PM H + -ATPase isoforms ( OsA1 - OsA10 ) were selected for subsequent qRT-PCR experiments, with OsEF-1ɑ used as the reference gene. The results of the primer sequences are shown in Table 1 . These were identical to those used by Loss Sperandio et al. ( 2011 ), which were synthesized by Kunming Tsingke Biotechnology Co., Ltd. Table 1 The prime sequences used for qRT-PCR for 10 PM H + -ATPase isoforms ( OsA1–OsA10 ) Gene Primers Forward (5´-3´) Reverse primer(5´-3´) NCBI OsA1 TGGGCACATGCACATAGGA GCTCACTGTAGCCGGTCTTCTC NM_001057482.1 OsA2 GCAGAAGAGGCCCGTAGGA CAGGGTGGTCAGCTCTCTCAA NM_001065628.1 OsA3 AATTCTGCAATCACCTACGTGTACTT GCTGGAGCAGGAGGGACAA NM_001073914.1 OsA4 CGTCGAGTCGGTGGTCAAG CGGTGTAGTGGTTCTGGATGGT NM_001061721.1 OsA5 CGGCGTCATCTGGCTCTAC GACGGCGAACTTGAAGATGTC NM_001067873.1 OsA6 TTTCACTCTTGGTGTGAAGCAGAT GACTTCCTTCACGATTTCATCGTAA NM_001054930.1 OsA7 TCGACACGATCCAGCAGAAC GCTGATGACGATCTCTCGTTGA NM_001060653.1 OsA8 TGTTTAACCTACAACACGACAATGC AATGGGATGGGAAAGGAAAATAC NM_001055182.1 OsA9 GTTCTACGCCCCCCTCGAT CTTCCTGTCGAACAGCAGGTT NM_001055720.1 OsA10 CGCCGAGGTCGCAAGAT CGCTCAAAACCACGCAAAC NM_001063515.1 OsEF-1α TTTCACTCTTGGTGTGAAGCAGAT GACTTCCTTCACGATTTCATCGTAA NM_001055681.1 Assays of PM H-ATPase activity and the activity and initial rate of H-pump The plasma membrane proteins of rice roots were extracted from the extract (containing 0.25 mmol·L − 1 sorbitol, 1 mmol·L − 1 EDTA, 10 mmol·L − 1 Tris-HCl (pH7.4), 10 µmol·L − 1 NaF, 0.5 mmol·L − 1 Phenylmethanesulfonyl fluoride (PMSF), 0.015% (V/V) Triton X-100) as described by Shen et al. ( 2005 ). The protein concentration was quantified according to the method of Bradford. Purity determination of plasma membrane was conducted according to Guo et al. (2018), Na 3 VO 4 , a specific inhibitor of plasma membrane, was added to the reaction system for determination of the activity of H + -ATPase. The activity of H + -ATPase was determined without Na 3 VO 4 as a control. The extracted PM protein had high purity and could be used for subsequent experiments when the inhibition rate of 85% or greater for H + -ATPase activity upon exposure to Na 3 VO 4 . The results showed that the H + -ATPase activity sensitive to Na 3 VO 4 accounted for 85% of the total activity of PM components, while the enzyme activity sensitive to other inhibitors (KNO 3 , NaN 3 ) may be ignored, the results indicate that the technology used for separating PM is practical. The activity of PM H + -ATPase was determined using the spectrophotometric method as described by Guo et al. ( 2013 ), PM H + -pump activity was measured according to the acridine orange method described by Yan et al. ( 2002 ), The changes in OD 492 were recorded every 15 s over a 20-min period. The assay of the initial rate of H + -pump was described as the slope of the absorbance quenching of acridine orange in the first 60 s by Ying et al. ( 2015 ). Co-immunoprecipitation and western blot analysis To assay the interaction between the PM H + -ATPase and 14-3-3 protein by co-immunoprecipitation (Co-IP), 2 µg of a specific phosphorylation antibody targeted against VHA2, in conjunction with a total of 500 µg of PM protein, were incubated for a period of 6 h at 4°C with shaking (40 rpm). Subsequently, 20 µL of protein A/G plus-agarose (Santa Cruz Biotech, Santa Cruz, CA) was added to the protein solution, and incubated for 12 h at 4°C. Following this, the solution was centrifuged in order to obtain the precipitated protein. The protein sample was cleaned with pre-cooled phosphate buffer saline (PBS) for several times. Thereafter, the precipitated protein was dissolved with pre-cooled PBS and loading buffer, and separated by 10% sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS-PAGE) for western blot analysis. The isolated protein was transferred to a polyvinylidene fluoride (PVDF) membrane via a semi-dry electrotransfer instrument. The membrane was initially treated with an antibody specific to Malus domestica 14-3-3 protein antibody or with an antibody targeting the characteristic phosphorylation of VHA2. Subsequently, a goat anti-rabbit IgG antibody conjugated with peroxidase was incubated for 2 h at room temperature. Finally, the Efficient chemiluminescence (ECL) kit was added to above solution, and observation was conducted using a gel imager instrument. Quantitative analysis of the western blot signals was performed using Image analysis software Image J software. The expression levels of PM H + -ATPase and 14-3-3 protein in rice root tips treated with Al for 0 h were set to 1.0 as a reference point. Statistical analysis All data are the average of three biological replicates (n = 3), and the differences between the various treatment groups were analyzed using one-way ANOVA with the least significant difference method (LSD) test, conducted using SPSS 21.0 software. A P-value of less than 0.05 was considered statistically significant. The next step is to draw in Excel 2010. Results Effects of 24 h exposure to different concentrations of FC and AMP on the activity of PM H + -ATPase under Al stress To determine the optimal treatment concentration of FC and AMP during Al stress, thg dianyou 35 seedlings were treated with different concentrations (0, 1, or 2 µmol·L − 1 ) of FC or (0, 100, or 200 µmol·L − 1 ) of AMP for 24 h under 0 µmol·L − 1 and 50 µmol·L − 1 Al. Figure 1 a illustrated the impact of varying FC and AMP concentrations on PM H + - ATPase activity. Plants treated with FC exhibited a markedly elevated the PM H + -ATPase activity compared to those not treated with FC. With increasing FC concentration, PM H + -ATPase activity demonstrated a notable increase. However, there was no discernible difference in PM H + -ATPase activity between plants treated with 1 and 2 µmol·L − 1 FC, irrespective of Al stress conditions. In comparison to the control group, the PM H + -ATPase activity in plants treated with 100 µmol·L − 1 or 200 µmol·L − 1 AMP was found to be significantly reduced. Furthermore, the PM H + -ATPase activity demonstrated a decline with the increase of AMP concentration. Although the PM H + -ATPase activity in roots treated with 200 µmol·L − 1 AMP was slightly lower than that of 100 µmol·L − 1 AMP, no significant difference was observed (Fig. 1 b). The PM H + -ATPase activity in the root tips of seedlings treated with Al stress was found to be significantly lower than that of seedlings treated without Al, regardless of whether FC or AMP was added. The PM H + -ATPase activity in the root tips of seedlings treated with Al was observed to be 61% − 65% of that of seedlings treated without Al under the same concentration treatment conditions, and the difference was found to be significant (Fig. 1 ). Considering the efficacy of the reagents, the optimal concentrations of FC and AMP for use in subsequent experiments are 1 µmol·L − 1 and 100 µmol·L − 1 , respectively. Effects of different time on the activity of PM H + -ATPase under the optimal concentrations of FC and AMP combined with Al To determine the optimal treatment time of FC and AMP under Al stress, the dianyou 35 seedlings were treated for varying durations (0, 3, 6, 12, 24, or 48 h) in 1 µmol·L − 1 FC and 100 µmol·L − 1 AMP combined with 0 or 50 µmol·L − 1 Al. The PM H + -ATPase activity exhibited marked differences between seedlings treated with FC and AMP and those treated with the same conditions (Fig. 2 ). As shown in Fig. 2 a, the activity of PM H + -ATPase in roots exhibited a gradual increase over the 48 h period, with a peak observed at 24 h of exposure to FC, irrespective of Al stress. As shown in Fig. 2 b, the activity of PM H + -ATPase in roots exhibited a gradual decline with increasing exposure to AMP, reaching a minimum level at 48 h. The PM H + - ATPase activity in the root tips treated with FC and AMP for 24 h exhibited a significantly difference compared to 12 h, and no significant difference compared to 48 h, irrespective of the presence of FC and AMP. A significant difference was observed in the PM H + - ATPase activity between seedlings treated with Al and those treated without Al under identical time conditions. The application of Al resulted in a notable reduction in PM H + - ATPase activity within rice root tips (Fig. 2 ). Therefore, in consideration of temporal and financial constraints, the optimal treatment duration for FC and AMP was determined to be 24 h, which was subsequently employed in the subsequent experiments. Effects of FC and AMP on NO-N uptake during Al stress As shown in Fig. 3 , there was a significant discrepancy in the absorption of NO 3 − -N between seedlings treated with Al and those treated without Al under identical conditions. The Al treatment resulted in a considerable reduction in NO 3 − -N uptake in rice, with the absorption of NO 3 − -N in rice under Al stress reaching only 79% of the control level (- Al-FC-AMP). The absorption of NO 3 − -N in rice treated with FC was significantly greater than that of observed in seedlings treated without FC. The absorption of NO 3 − -N in rice treated with Al and FC was almost equivalent to that of the control. However, the absorption of NO 3 − -N in rice treated with AMP was significantly reduced, reaching a level significantly lower than that of seedlings treated without AMP. The NO 3 − -N uptake exhibited a significantly difference between seedlings treated with FC or AMP and those treated with the same conditions. Effects of FC and AMP on the activity of PM H + -ATPase, the initial rate and activity of H + -pump and H + efflux in rice roots under Al stress The results presented in Fig. 3 confirmed the hypothesis that FC improved the absorption of NO 3 − -N, whereas AMP impedes this process. To understand whether the efficiency of NO 3 − -N uptake was related to the activity of PM H + -ATPase, this study analyzed the alteration in the PM H + -ATPase activity, H + efflux, and H + -pump activity in rice roots subjected to different treatment. The results depicted in Fig. 4 showed that a notable difference in PM H + -ATPase activity between seedlings subjected to FC or AMP treatment and those not exposed to FC or AMP (Fig. 4 a). FC was observed to significantly increase and AMP to significantly decrease PM H + -ATPase activity in rice seedlings, regardless of whether FC and AMP were present or not. The most immediate consequence of the increased activity of PM H + -ATPase is believed to be the activation of the H + pump, the activation of H + pump can promote the exudation of H + from the inner side of the cell to the outer side. Therefore, the changes in H + efflux and H + pump activity of PM extracts from rice root tips under different treatments have been analyzed. The alterations in H + efflux (Fig. 4 b) and H + -pump activity (Fig. 4 c) were consistent with the modifications in PM H + -ATPase activity in rice roots, indicating that FC markedly enhanced, while AMP markedly reduced the activities of PM H + -ATPase and H + -pump, as well as H + efflux. Effect of FC and AMP on the expression of PM H + -ATPase and its interaction with 14-3-3 protein in rice roots under Al stress It is hypothesized that the 14-3-3 protein/PM H + -ATPase complex may enhance the activity of PM H + -ATPase. To clarify whether the effect of FC or AMP on the absorption of NO 3 − -N in rice was related to the degree of interaction level between PM H + -ATPase and 14-3-3 protein in rice root tips under Al or non-Al stress conditions, we extracted PM proteins from dianyou 35 seedling root tips that underwent FC treatment (Fig. 5 a) or AMP treatment (Fig. 5 c) for 24 h and analyzed them by co-immunoprecipitation (Co-IP). The data presented in Fig. 5 a and Fig. 5 c demonstrated that the phosphorylation level of the PM H + -ATPase protein in the root tips was essentially equivalent to that of the 14-3-3 protein. FC was observed to up-regulated and AMP down-regulated the phosphorylation level of PM H + -ATPase protein and the expression of 14-3-3 protein. Moreover, the relative expression of PM H + -ATPase protein and 14-3-3 protein following FC treatment (Fig. 5 b) or AMP treatment (Fig. 5 d) was analyzed in silico method. The data in Fig. 5 b demonstrated that FC could enhance the interaction of PM H + -ATPase with 14-3-3 protein, whether or not Al treatment was present, and significantly upregulate the relative expression levels of PM H + -ATPase-bound 14-3-3 protein and 14-3-3 protein-bound PM H + -ATPase. The data in Fig. 6 d indicated that, regardless of Al treatment, AMP could degrade the interaction between PM H + -ATPase and 14-3-3 protein, significantly downregulating the relative expression levels of PM H + -ATPase-bound 14-3-3 protein and 14-3-3 protein-bound PM H + -ATPase. Effects of FC and AMP on the expression of PM H + -ATPase isoforms in rice under Al stress To understand whether the activity of PM H + -ATPase was related to the expression of PM H + -ATPase isoforms, this study analyzed the relative expression level of 10 PM H + -ATPase isoforms ( OsA1 - OsA10 ) in rice roots subjected to different treatments. The results were shown in Fig. 6 . The relative expression of OsA6 and OsA10 was markedly low or undetectable in rice whether Al stress or not. Compared with the control group, the relative expression of 10 PM H + -ATPase isoforms was significantly inhibited by Al strees, with the exception of OsA6 and OsA10 . The inhibitor AMP was observed to down-regulate the relative expression of OsA1 and OsA7 in rice root subjected to Al stress, while simultaneously up-regulating the relative expression of OsA2, OsA3, OsA4, OsA5, OsA8, and OsA9 . In comparison to the control group, the application of AMP resulted in a reduction in the relative expression of OsA1, OsA3, OsA5 and OsA7 , while an increase was observed in the relative expression of OsA2, OsA4, OsA8 and OsA9 . The activator FC was observed to significantly up-regulate the relative expression of 10 PM H + -ATPase isoforms in rice roots, irrespective of the presence of Al, with the exception of OsA6 and OsA10 . Discussion The degree of lipid peroxidation in rice root tips intensifies under Al stress, leading to increased levels of H 2 O 2 and MDA, which disrupts the integrity of the cell membrane structure (Zhou et al. 2021 ). The PM H + -ATPase plays an important physiological role in the growth, development, and stress resistance of plant cells. The active transport of nitrate NO 3 − -N requires the energy produced by the hydrolysis of adenosine triphosphate (ATP) by PM H + -ATPase. This process generates an electric potential gradient and provides a driving force for NO 3 − -N transport, thereby promoting the absorption of NO 3 − -N by plant roots (Liu et al. 2021 ). Some studies have demonstrated that Al stress can impede the absorption of NO 3 − -N in rice(Zhou et al. 2016 ). Al has been demonstrated to impede NO 3 − -N uptake and N-use efficiency by inhibiting root growth ( Zhao and Shen. 2018 ). The results presented in Fig. 3 are consistent with these reports. It was observed that Al stress resulted in a reduction in the absorption of NO 3 − -N in rice, with the absorption of NO 3 − -N under Al stress being approximately 80% of that observed in the control. The most significant consequence of increasing or decreasing PM H + -ATPase activity is the activation or inhibition of H + -pump activity (Fig. 4 ). The released H + forms a potential gradient, which provides energy for the transport of secondary transporters and channel proteins to various nutrients and ions. The formation of the PM H + -ATPase/14-3-3 protein complex, which occurs through the binding of 14-3-3 protein with phosphorylated PM H + -ATPase, results in the activation of PM H + -ATPase (Lapshin et al. 2021 ; Wang et al. 2021 ; Kabała and Janicka 2023 ). Guo et al. ( 2013 ) found that Al stress could significantly reduce the binding of 14-3-3 protein with phosphorylated PM H + -ATPase in root tip of Al-sensitive black bean, thereby reducing PM H + -ATPase and H + -pump activity. The study by Yang et al. ( 2017 ) corroborates the hypothesis that Al stress reduced the interaction level between phosphorylated PM H + -ATPase and 14-3-3 protein, thereby reducing the uptake of NO 3 − -N through the inhibition of PM H + -ATPase activity in the root tips of black soybean. The results of this experiment were largely consistent with the above research findings. The phosphorylation of PM H + -ATPase and its interaction with 14-3-3 protein were observed to decrease in rice under Al stress (Fig. 5 ), as was the H + efflux in root tips, the H + -pump activity and initial rate, which were all lower than those in the control (Fig. 4 ). This resulted in a reduction in PM H + -ATPase activity (Fig. 4 ) and a subsequent decrease in the absorption of NO 3 − -N (Fig. 3 ) in rice. The above results indicated that Al stress reduced the absorption capacity of NO 3 − -N and the activity of PM H + -ATPase and H + -pump. There was a positive correlation between PM H + -ATPase activity and NO 3 − -N absorption, indicating that PM H + -ATPase activity directly affects the absorption capacity of NO 3 − -N in rice. FC, an activator of the PM H + -ATPase, has the potential to enhance the activity of PM H + -ATPase, improve the hydrolysis activity of PM H + -ATPase and the capacity for pumping hydrogen and increase PM H + -ATPase binding to 14-3-3 protein (Lapshin et al. 2021 ; Zhang et al. 2021 ). FC has been demonstrated to improve the activity of PM H + -ATPase in the root tips of soybean and black bean plants. (Shen et al. 2005 ; Yi et al. 2014 ). In contrast, AMP has been demonstrated to function as an inhibitor of PM H + -ATPase, with the capacity to reduce the activity of PM H + -ATPase in black bean root tips (Guo et al. 2013 ). Our findings were similar to those previously reported, confirming that FC can markedly improve and AMP can significantly decrease the activity of PM H + -ATPase and H + -pump, as well as the interaction level between PM H + -ATPase and 14-3-3 protein in rice roots, irrespective of Al stress(Fig. 3 , Fig. 4 , Fig. 5 ). The evidence suggests that FC may improve NO 3 − -N absorption by regulating PM H + -ATPase activity, the H + -pump, as well as H + efflux in rice, irrespective of Al stress or not. Conversely, AMP may inhibit NO 3 − -N absorption by regulating these processes. Currently, gene function is typically inferred based on the strength of gene expression, with functional assessment conducted through the examination of gene expression alterations in response to diverse environmental stimuli. Previous studies have shown that PM H + -ATPase is a multigene family that plays an important role in regulating plant development and stress resistance (Zhou et al. 2021 ). Plants adapt to the external conditions by regulating the activity of PM H + -ATPase and gene expression, PM H + -ATPase is divided into five different subfamilies, with subfamilies I ( OsA1 , OsA2 , OsA3 ) and II ( OsA5 , OsA7 ) being highly expressed under normal conditions, whereas the subfamilies IV ( OsA4 , OsA6 , and OsA10 ) are low expressed or expressed in specific cell-expressed under normal conditions (Loss Sperandio et al. 2011 ). This study analyzed the gene expression levels of OsA1 to OsA10 . The relative expression levels of OsA6 and OsA10 genes in rice root tips were found to be low and undetectable whether Al stress or not, which was consistent with the low expression of the subfamily IV (Fig. 6 ). Loss Sperandio et al. ( 2020 ) proposed that OsA2 and OsA7 may be key genes influencing the uptake and transport of nitrogen in Japanese rice. Zhu et al. ( 2009 ) demonstrated a positive correlation between the activity and protein expression of PM H + - ATPase in rice roots and the gene expression levels of OsA1 , OsA3 , OsA5 , OsA7 , and OsA8 . The regulation of nitrate uptake by different PM H + -ATPase genes is related to crop varieties. The results of this study are consistent with those previous research, indicating that the relative expression of eight PM H + -ATPase isoforms and PM H + -ATPase activity are inhibited in rice roots under Al stress, except for OsA6 and OsA10 . AMP has been demonstrated to downregulate the relative expression levels of OsA1 and OsA7 , as well as reduce PM H + -ATPase activity in rice, irrespective of whether the plant is subjected to Al stress. However, the relative expression levels of OsA2 , OsA3 , OsA4 , OsA5 , OsA8 , and OsA9 did not align with the observed changes in PM H + -ATPase activity. FC was observed to upregulate the expression levels of 8 PM H + -ATPase isoforms, with the exception of OsA6 and OsA10 . Additionally, it demonstrated the ability to somewhat restore the relative expression levels of the PM H + -ATPase isoforms and the activity of PM H + -ATPase in rice under Al stress. This indicates that the expression levels of OsA1 and OsA7 are correlated with the activity of PM H + -ATPase in rice under FC or AMP treatment. It can be postulated that FC and AMP may affect PM H + -ATPase activity by regulating the expression levels of OsA1 and OsA7 . Our findings are consistent with those of Loss Sperandio et al. ( 2011 ), who proposed that OsA7 may play a role in nitrogen uptake in rice. Al stress has been demonstrated to downregulate the expression levels of OsA1 and OsA7 in rice root tips, leading to a reduction in H + -pump activity and initial rate, as well as a decrease in H + efflux. This resulted in a reduction in the interaction level between PM H + -ATPase and 14-3-3 protein, which in turn led to a decrease in PM H + -ATPase activity and a reduction in the uptake of NO 3 − -N in rice. The expression of OsA1 and OsA7 was found to be involved in regulation of NO 3 − -N uptake of in rice plants subjected to Al stress. Conclusion The present study demonstrates that Al stress can reduce the relative expression of eight PM H + -ATPase isoforms, with the exception of OsA6 and OsA10 . This results in a decrease in H + -pump activity and initial rate, H + efflux, and a reduction in the interaction level between PM H + -ATPase and 14-3-3 protein. Consequently, there is a decrease in PM H + -ATPase activity and a reduction in the absorption of NO 3 − -N in rice. FC increased the relative expression levels of eight PM H + -ATPase isoforms, with the exception of OsA6 and OsA10 . Additionally, FC enhanced the interaction level between phosphorylated PM H + -ATPase and 14-3-3 protein, as well as PM H + -ATPase activity. This resulted in the provision of a substantial amount of H + and energy, thereby enhancing the absorption capacity of NO 3 − -N in rice. However, the activity of PM H + -ATPase was found to be reduced by AMP, which led to a decrease in the absorption of NO 3 − -N. This was due to a reduction in the relative expression of OsA1 and OsA7 in rice. In summary, the absorption of NO 3 − -N in rice is directly related to the activity of PM H + -ATPase, and OsA1 and OsA7 may be crucial regulators in the transmembrane transport of NO 3 − -N in rice under Al stress. Declarations Conflict of interests The authors declare that they have no conflict of interests. Funding The work was supported by the National Natural Science Fund of China(No. 31560351 and 31960071); Universities Union Fund of Yunnan(No.202301BA070001-005); Yunnan Provincial College Students' Innovation and Entrepreneurship Training Program Project (S202211393051, S202411393048). Author contributions All authors contributed to the study conception and design. XHZ conceived and drafted this project for research. ZYZ and YQD conducted and carried out the experiments necessary for the research, and YYL helped with some experiments and data analysis. XHZ and ZYZ drafted the manuscript. XLZ and KZL reviewed and revised the final version of the manuscript. All authors read and approved the final manuscript. Acknowledgements We extend our gratitude to Professor Guangxi Tao for providing the seeds of Dianyou 35. We are grateful to all team members who contributed to the success of this work. Data availability Data will be made available on request. References Basit F, Liu JX, An JY, Chen M, He C, Zhu XB, Li Z, Hu J, Guan YJ (2022) Seed priming with brassinosteroids alleviates aluminum toxicity in rice via improving antioxidant defense system and suppressing aluminum uptake. Environmental Science and Pollution Research, 29(7): 10183-10197. https://doi.org/10.1007/s11356-021-16209-y Bungau S, Behl T, Aleya L, Bourgeade P, Aloui-Sossé B, Purza AL, Abid A, Samuel AD (2021) Expatiating the impact of anthropogenic aspects and climatic factors on long-term soil monitoring and management. Environmental Science and Pollution Research, 28(24): 30528-30550. https://doi.org/10.1007/s11356-021-14127-7 Chen Q, Guo CL, Wang P, Chen XQ, Wu KH, Li KZ, Yu YX, Chen LM (2013) Up-regulation and interaction of the plasma membrane (H + )-ATPase and the 14-3-3 protein are involved in the regulation of citrate exudation from the broad bean ( Vicia faba L.) under Al stress. Plant Physiology and Biochemistry, 70: 504-511. https://doi.org/10.1016/j.plaphy.2013.06.015 de Boer AH (2024) The Fusicoccin story revisited. Journal of Experimental Botany, 75(18): 5531-5546. https://doi.org/10.1093/jxb/erae300 Ding M, Zhang M, Wang Z, Yu X, Kinoshita T, Zeng H, Zhu Y (2022) Overexpression of a plasma membrane H + -ATPase gene O s A1 stimulates the uptake of pimary macronutrients in rice roots. International Journal of Molecular Sciences, 23(22): 13904. https://doi.org/10.3390/ijms232213904 Elmore JM, Coaker G (2011) The role of the plasma membrane H + -ATPase in plant-microbe interactions. Molecular Plant, 4(3): 416-427. https://doi.org/10.1093/mp/ssq083 Fiorillo A, Parmagnani AS, Visconti S, Mannino G, Camoni L, Maffei ME (2023) 14-3-3 proteins and the plasma membrane H + -ATPase are involved in maize ( Zea mays ) magnetic induction. Plants (Basel), 12(15): 2887. https://doi.org/10.3390/plants12152887 Guo CL, Chen Q, Zhao XL, Chen XQ, Zhao Y, Wang L, Li KZ, Yu YX Chen LM (2013) Al-enhanced expression and interaction of 14-3-3 protein and plasma membrane H + -ATPase is related to Al-induced citrate secretion in an Al-resistant black soybean. Plant Molecular Biology Reporter, 31(4): 1012-1024. https://doi.org/10.1007/s11105-013-0569-0 Gutiérrez-Nájera NA, Saucedo-García M, Noyola-Martínez L, Vázquez-Vázquez C, Palacios-Bahena S, Carmona-Salazar L, Plasencia J, El-Hafidi M, Gavilanes-Ruiz M (2020) Sphingolipid efffects on the plasma membrane produced by addition of fumonisin B1 to maize embryos. Plants(Basel), 9(2): 150. https://doi.org/10.3390/plants9020150 Huo K, Shangguan XC, Xia Y, Shen ZG, Chen C (2020) Excess copper inhibits the growth of rice seedlings by decreasing uptake of nitrate. Ecotoxicology and Environmental Safety, 190: 110105. https://doi.org/10.1016/j.ecoenv.2019.110105 Jahn T, Fuglsang AT, Olsson A, Bruntrup IM, Collinge DB, Volkmann D, Sommarin M, Larsson PC (1997) The 14-3-3 protein interacts directly with the C-terminal region of the plant plasma membrane H + -ATPase. Plant Cell, 9(10): 1805-1814. https://doi.org/10.1105/tpc.9.10.1805 Kabała K, Janicka M (2023) Structural and functional diversity of two ATP-triven plant proton pumps. International Journal of Molecular Sciences, 24(5): 4512. https://doi.org/ 10.3390/ijms24054512 Lapshin NK, Piotrovskii MS, Trofimova MS (2021) Involvement of plasma membrane H + -ATPase in diamide-induced extracellular alkalization by roots from pea seedlings. Planta, 253(1): 10. https://doi.org/10.1007/s00425-020-03532-w Li C, Xiao EZ, Bai Q, Xu F, Ji XY, Li CE, Wang Y Q (2022 a) Functional analysis of gene OsCLF and its response to aluminum stress in rice( Oryza sativa ). Journal of Agricultural Biotechnology, 30(5): 837-846. https://doi.org/10.3969/j.issn.1674-7968.2022.05.002 Li CX, Huang DJ, Wang CL, Wang N, Yao YD, Li WF, Liao WB (2020) NO is involved in H 2 -induced adventitious rooting in cucumber by regulating the expression and interaction of plasma membrane H + -ATPase and 14-3-3. Planta, 252(2): 9. https://doi.org/10.1007/s00425-020-03416-z Li J, Guo Y, Yang YQ (2022 b) The molecular mechanism of plasma membrane H + -ATPases in plant responses to abiotic stress. Journal of Genetics and Genomics, 49(8): 715-725. https://doi.org/10.1016/j.jgg.2022.05.007 Li XW, Li YL, Mai JW, Tao L, Qu M, Liu JY, Shen RF, Xu GL, Feng YM, Xiao HD, Wu LH, Shi L, Guo SX, Liang J, Zhu YY, He YM, Baluška F, Shabala S, Yu M (2018) Boron alleviates aluminum toxicity by promoting root alkalization in transition zone via polar auxin transport. Plant Physiology, 177(3): 1254-1266. https://doi.org/10.1104/pp.18.00188 Lin CH, Zhang SR, Xiao Z, Liu CL, Lu LY, Wang J, Ding XD (2019) The absorption dynamic parameter of NO 3 - in flue-cured tobacco pretreated in different concentrations of KCl. Chinese Journal of Tropical Crops, 40(9): 1677-1684. https://doi.org/10.3969/j.issn.1000-2561.2019.09.002 Liu R R, Cui B, Lu X B, Song J. The positive effect of salinity on nitrate uptake in suaeda salsa. Plant Physiology and Biochemistry, 2021, 166(7): 958-963. https://doi.org/10.1016/j.plaphy.2021.07.010 Loss Sperandio MV, Santos LA, Bucher CA, Fernandes MS, de Souza SR (2011) Isoforms of plasma membrane H( + )-ATPase in rice root and shoot are differentially induced by starvation and resupply of NO 3 - or NH 4 + . Plant Science. 180(2): 251-258. https://doi.org/10.1016/j.plantsci.2010.08.018 Loss Sperandio MV, Santos LA, Huertas Tavares OC, Fernandes MS, de Freitas Lima M, de Souza SR (2020) Silencing the Oryza sativa plasma membrane H + -ATPase isoform OsA2 affects grain yield and shoot growth and decreases nitrogen concentration. Journal of Plant Physiology, 251: 153220. https://doi.org/10.1016/j.jplph.2020.153220 Lu L, Chen XY, Tan QY, Li WQ, Sun YY, Zhang ZL, Song YY, Zeng RS (2024) Gibberellin-mediated sensitivity of rice roots to aluminum stress. Plants (Basel), 13(4): 543. https://doi.org/10.3390/plants13040543 Marra M, Camoni L, Visconti S, Fiorillo A, Evidente A (2021) The surprising story of fusicoccin: A wilt-inducing phytotoxin, a tool in plant physiology and a 14-3-3-targeted drug. Biomolecules, 11(9): 1393. https://doi.org/10.3390/biom11091393 Nguyen TT, Sabat G, Sussman MR (2018) In vivo cross-linking supports a head-to-tail mechanism for regulation of the plant plasma membrane P-type H + -ATPase. Journal of Biological Chemistry, 293(44): 17095-17106. https://doi.org/10.1074/jbc.RA118.003528 Ofoe R, Thomas RH, Asiedu SK, Wang-Pruski G, Fofana B, Abbey L (2023) Aluminum in plant: Benefits, toxicity and tolerance mechanisms. Frontiers in Plant Science, 13: 1085998. https://doi.org/10.3389/fpls.2022.1085998 Sakhare, AS, Kumar, S, Ellur, RK, Prahalada GD, Kota S, Kumar RR, Ray S, Mandal BN (2025) Genome-wide association study on root traits under non-stress and osmotic stress conditions to improve drought tolerance in rice ( Oryza sativa Lin.). Acta Physiologiae Plantarum, 47, 6. https://doi.org/10.1007/s11738-024-03752-7 Shen H, He LF, Sasaki T, Yamamoto Y, Zheng SJ, Ligaba A, Yan XL, Ahn SJ, Yamaguchi M, Sasakawa H, Matsumoto H (2005) Citrate secretion coupled with the modulation of soybean root tip under aluminum stress. Upregulation of transcription, translation, and threonine-oriented phosphorylation of plasma membrane H + -ATPase. Plant Physiology, 138(1): 287-296. https://doi.org/10.1104/pp.104.058065 Wang JB, Su C, Cui ZB, Huang LX, Gu S, Jiang SX, Feng J, Xu H, Zhang WZ, Jiang LL, Zhao MH (2023) Transcriptomics and metabolomics reveal tolerance new mechanism of rice roots to Al stress. Frontiers in Genetics, 13: 1063984. https://doi.org/10.3389/fgene.2022.1063984 Wang K, Xu FY, Yuan W, Zhang DP, Liu JP, Sun LY, Cui LY, Zhang JH, Xu WF (2021) Rice G protein γ subunit qPE9-1 modulates root elongation for phosphorus uptake by involving 14-3-3 protein OsGF14 band plasma membrane H + -ATPase. The Plant Journal, 107(6): 1603-1615. https://doi.org/10.1111/tpj.15402 Weng LY, Zhang M., Wang K, Chen GL, Ding M, Yuan W, Zhu YY, Xu WF, Xu FY (2020) Potassium alleviates ammonium toxicity in rice by reducing its uptake through activation of plasma membrane H + -ATPase to enhance proton extrusion. Plant Physiology and Biochemistry, 151: 429-437. https://doi.org/10.1016/j.plaphy.2020.03.040 Xia LF, Marquès-Bueno MM, Bruce CG, Karnik R (2019) Unusual roles of secretory SNARE SYP132 in plasma membrane H + -ATPase traffic and vegetative plant growth. Plant Physiology, 180(2): 837-858. https://doi.org/10.1104/pp.19.00266 Xiao X, Liu ZT, Shen RF, Zhao XQ (2023) Nitrate has a stronger rhizobacterial-based efect on rice growth and nitrogen use than ammonium in acidic paddy soil. Plant and Soil, 487: 605-621. https://doi.org/10.1007/s11104-023-05957-0 Yan F, Zhu YY, Muller C, Zorb C, Schubert S (2002) Adaption of H + -pumping and plasma membrane H + -ATPase activity in proteoid roots of white lupin under phosphate deficiency. Plant Physiology, 129(1): 50-63. https://doi.org/10.1104/pp.010869 Yang D, Chen DJ, Wang P, Jiang DH, Xu HN, Pang XL, Chen LM, Yu YX, Li KZ (2017) Aluminium-inhibited NO 3 - uptake is related to Al-increased H 2 O 2 content and Al-decreased plasma membrane ATPase activity in the root tips of Al-sensitive black soybean. Functional Plant Biology, 44(2): 198-207. https://doi.org/10.1071/FP15289 Yi J, Guo CL, Wu KH, Wang L, Zhao XL, Li KZ, Chen LM (2014) Effects of fusicoccin on aluminum tolerance in Al-sensitive black soybean. Soybean Science, 33(3): 389-392. https://doi.org/10.11861 /j.issn.1000-9841.2014.03.0389 Ying H, Qin A, Cheng TS, Pavlos NJ, Rea S, Dai K, Zheng MH (2015) Disulfiram attenuates osteoclast differentiation in vitro: a potential antiresorptive agent. PLoS One, 10(4): e0125696. https://doi.org/10.1371/journal.pone.0125696 Zhang BJ, Bu JJ, Liang CJ (2017) Regulation of nitrogen and phosphorus absorption by plasma membrane H + -ATPase in rice roots under simulated acid rain. International Journal of Environmental Science and Technology, 14(1): 101-112. https://doi.org/10.1007/s13762-016-1125-x Zhang F, Yuan AP, Nie ZY, Chu ML, An YL (2024) Identification of the potato ( Solanum tuberosum L.) P-type ATPase gene family and investigating the role of PHA2 in response to Pep13. Frontiers in Plant Science, 15: 1353024. https://doi.org/10.3389/fpls.2024.1353024 Zhang MX, Wang Y, Chen X, Xu FY, Ding M, Ye WX, Kawai YY, Toda Y, Hayashi YK, Suzuki T, Zeng HQ, Xiao L, Xiao X, Xu J, Guo SW, Yan F, Shen QR, Xu GH, Kinoshita T, Zhu YY (2021) Plasma membrane H + -ATPase overexpression increases rice yield via simultaneous enhancement of nutrient uptake and photosynthesis. Nature Communications, 12(1): 735. https://doi.org/10.1038/s41467-021-20964-4 Zhang RP, Liu G, Wu N, Gu M, Zeng HQ, Zhu YY, Xu GH (2011) Adaptation of plasma membrane H + -ATPase and H + -pump to P deficiency in rice roots. Plant and Soil, 349: 3-11. https://doi.org/10.1007/s11104-011-0774-2 Zhao X, Li F, Li K (2021) The 14-3-3 proteins: regulators of plant metabolism and stress responses. Plant Biology, 23(4): 531-539. https://doi.org/10.1111/plb.13268 Zhao XQ, Shen RF (2018) Aluminum-nitrogen interactions in the soil-plant system. Frontiers in Plant Science, 9: 807. https://doi.org/10.3389/fpls.2018.00807 Zhou SJ, Zhang M, Wang P (2021) Response of plant plasma membrane H + -ATPase to environmental stress factors: a review. Chinese Journal of Applied and Environmental Biology, 27(2): 485-494. https://doi.org/10.19675/j.cnki.1006-687x.2020.02022 Zhou XH, Gu ZH, Xu HN, Tao GX, Yu YX, Li KZ (2016) The effects of exogenous ascorbic acid on the mechanism of physiological and biochemical responses to nitrate uptake in two rice cultivars ( oryza sativa L.) under aluminum stress. Journal of Plant Growth Regulation, 35(4): 1013-1024. https://doi.org/10.1007/s00344-016-9599-9 Zhou XH, Li KZ, Zhao Z, Zhang XL, Cheng X, Feng Q (2021) Effects of exogenous ascorbic acid on physiological Indexes in rice under aluminum stress. Chinese Journal of Tropical Crops, 42(3): 769-776. https://doi.org/10.3969/j.issn.1000-2561.2021.03.023 Zhou XH, Zhou ZY, Li KZ (2020) Effects of exogenous ascorbic acid on antioxidant function of rice seedling under aluminum stress. Journal of Nuclear Agricultural Sciences, 34(10): 2368-2375. https://doi.org/10.11869 /j.issn.100-8551.2020.10.2368 Zhu YY, Di TJ, Xu GH, Chen X, Zeng HQ, Yan F, Shen QR (2009) A daptation of plasma membrane H + -ATPase of rice roots to low pH as related to ammonium nutrition. Plant Cell and Environment, 32(10): 1428-1440. https://doi.org/10.1111/j.1365-3040.2009.02009.x Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-6517400","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":449714549,"identity":"6ba3384a-08ed-402c-817f-60912cec4903","order_by":0,"name":"Xiaohua Zhou","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAx0lEQVRIiWNgGAWjYFACHsYHCQYSPPzsjY0PPhCphdngQ4WNnGTP4WbDGURqYZOccSbN2OBGeps0BzEa5GfkHpDmbTucOHPmwwZpBgY7Od0GAloYe84lGIO09EsnNhgXMCQbmx0goIWZvccgGWzL7MSG5BkMBxK3EdLCxsxjcBikZcPNgw2HeYjRwsPeY9gI8T5jYzNRWiR4zhgzQAI5sZlxhgERfpGfkWP+AxKVx5//+FBhJ0dQCxowIE35KBgFo2AUjAIcAAAsi0Uu+f/rNgAAAABJRU5ErkJggg==","orcid":"https://orcid.org/0009-0004-1833-7442","institution":"Kunming University","correspondingAuthor":true,"prefix":"","firstName":"Xiaohua","middleName":"","lastName":"Zhou","suffix":""},{"id":449714550,"identity":"270af6af-3907-411d-9220-93b6777f089c","order_by":1,"name":"Zeyi Zhou","email":"","orcid":"","institution":"Kunming University of Science and Technology","correspondingAuthor":false,"prefix":"","firstName":"Zeyi","middleName":"","lastName":"Zhou","suffix":""},{"id":449714551,"identity":"a659de7e-c693-4e33-9d6d-89a1efcbc116","order_by":2,"name":"Yaqun Dong","email":"","orcid":"","institution":"Kunming University","correspondingAuthor":false,"prefix":"","firstName":"Yaqun","middleName":"","lastName":"Dong","suffix":""},{"id":449714552,"identity":"ce949a91-d6ed-4945-ae77-18b1c7742ca1","order_by":3,"name":"Yuanyuan Lin","email":"","orcid":"","institution":"Kunming University","correspondingAuthor":false,"prefix":"","firstName":"Yuanyuan","middleName":"","lastName":"Lin","suffix":""},{"id":449714553,"identity":"a90a18a5-e9ae-479b-9a84-dd1a67d6a435","order_by":4,"name":"Xiaoling Zhang","email":"","orcid":"","institution":"Kunming University","correspondingAuthor":false,"prefix":"","firstName":"Xiaoling","middleName":"","lastName":"Zhang","suffix":""},{"id":449714554,"identity":"190d4c70-22c7-489c-bd9a-f7ad7926cfee","order_by":5,"name":"Kunzhi Li","email":"","orcid":"","institution":"Kunming University of Science and Technology","correspondingAuthor":false,"prefix":"","firstName":"Kunzhi","middleName":"","lastName":"Li","suffix":""}],"badges":[],"createdAt":"2025-04-24 05:53:38","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-6517400/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-6517400/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":81955161,"identity":"c0142f7f-342a-4e6b-b3e8-9c62979d7bab","added_by":"auto","created_at":"2025-05-05 09:48:48","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":40396,"visible":true,"origin":"","legend":"\u003cp\u003eThe effects of treatment concentrations of FC (a) and AMP (b) on the activity of PM H\u003csup\u003e+\u003c/sup\u003e-ATPase in rice whether Al stress or not for 24 h. Data represent mean ± SD (n = 3). Different letters indicate significant difference at \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05.\u003c/p\u003e","description":"","filename":"1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-6517400/v1/b3d912ffca7dafac2c84bebf.jpg"},{"id":81955162,"identity":"d143dd71-ccf5-4211-8af8-549601d4f89a","added_by":"auto","created_at":"2025-05-05 09:48:48","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":47374,"visible":true,"origin":"","legend":"\u003cp\u003eThe effects of treatment time of\u003cem\u003e \u003c/em\u003e1 μmol·L\u003csup\u003e-1 \u003c/sup\u003eFC (a) and 100 μmol·L\u003csup\u003e-1 \u003c/sup\u003eAMP (b) on the activity of PM H\u003csup\u003e+\u003c/sup\u003e-ATPase in rice whether Al stress or not. Data represent mean ± SD (n = 3). Different letters indicate significant difference at \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05.\u003c/p\u003e","description":"","filename":"2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-6517400/v1/4000af8b4fd6d32b669457a8.jpg"},{"id":81955163,"identity":"a6dce980-c5ab-4ab7-ad3c-931f8d8bc018","added_by":"auto","created_at":"2025-05-05 09:48:48","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":18415,"visible":true,"origin":"","legend":"\u003cp\u003eThe effects of FC and AMP on the uptake of NO\u003csub\u003e3\u003c/sub\u003e\u003csup\u003e-\u003c/sup\u003e-N in rice whether Al stress or not. Data represent mean ± SD (n = 3). Different letters indicate significant difference at \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05.\u003c/p\u003e","description":"","filename":"3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-6517400/v1/534975e48ad3156019a7408a.jpg"},{"id":81955172,"identity":"c24f7630-a0f3-40b8-a28f-95d2d197263c","added_by":"auto","created_at":"2025-05-05 09:48:48","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":63325,"visible":true,"origin":"","legend":"\u003cp\u003eThe effects of FC and AMP on the activity of PM H\u003csup\u003e+\u003c/sup\u003e-ATPase (a) and H\u003csup\u003e+ \u003c/sup\u003eefflux (b) and H\u003csup\u003e+\u003c/sup\u003e-pump activity (c) in rice whether Al stress or not. Data represent mean ± SD (n = 3). Different letters indicate significant difference at \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05.\u003c/p\u003e","description":"","filename":"4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-6517400/v1/1829709ebe08401843d2c5f5.jpg"},{"id":81955164,"identity":"97fad03d-8c0b-42c3-986f-a6798a29bd9d","added_by":"auto","created_at":"2025-05-05 09:48:48","extension":"jpg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":60610,"visible":true,"origin":"","legend":"\u003cp\u003eThe effects of FC and AMP on the co-immunoprecipitation of phosphorylated PM H\u003csup\u003e+\u003c/sup\u003e-ATPase and 14-3-3 protein (a, c) and the relative expression of PM H\u003csup\u003e+\u003c/sup\u003e-ATPase and 14-3-3 protein (b, d) in rice whether Al stress or not. Data represent mean ± SD (n = 3). Different letters indicate significant difference at \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05.\u003c/p\u003e","description":"","filename":"5.jpg","url":"https://assets-eu.researchsquare.com/files/rs-6517400/v1/63928fb5951c586543385932.jpg"},{"id":81955170,"identity":"52da90ba-bc94-45c1-82a1-d3cdba9913ce","added_by":"auto","created_at":"2025-05-05 09:48:48","extension":"jpg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":50313,"visible":true,"origin":"","legend":"\u003cp\u003eThe effect of FC and AMP on the relative expression of PM H\u003csup\u003e+\u003c/sup\u003e-ATPase isoforms in rice whether Al stress or not. Data represent mean ± SD (n = 3). Different letters indicate significant difference at \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05.\u003c/p\u003e","description":"","filename":"6.jpg","url":"https://assets-eu.researchsquare.com/files/rs-6517400/v1/0b1efccbdf946c31807a27ed.jpg"},{"id":83298186,"identity":"04b5f1c7-db2c-4c5a-a303-5c208b16ef44","added_by":"auto","created_at":"2025-05-22 14:25:24","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1356839,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6517400/v1/ad8b2a93-2d01-433f-bd76-25506e979f27.pdf"}],"financialInterests":"","formattedTitle":"Effect of plasma membrane H+-ATPase on nitrate uptake in rice under aluminum stress","fulltext":[{"header":"Introduction","content":"\u003cp\u003eIn the past few years, with the extensive use of chemical fertilizers and the increase in acid rain have contributed to the expansion of acidic cultivated land. According to Bungau et al. (\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2021\u003c/span\u003e) and Li et al. (\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2022\u003c/span\u003e a), 50% of the world\u0026rsquo;s arable soil and 21% of the arable soil in China are acidic, representing a significant environmental concern. A soil pH value below 5.5 will result in the dissolution of aluminum in the soil, leading to the release of aluminum ions (Al\u003csup\u003e3+\u003c/sup\u003e). The presence of micromolar Al\u003csup\u003e3+\u003c/sup\u003e in the soil can result in the toxicity of plants, leading to severe inhibition of root growth and the absorption of essential nutrients such as nitrogen (N) and phosphorus (P) (Ofoe et al. \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2023\u003c/span\u003e; Basit et al. \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Rice is one of the most important food crops, providing sustenance to over half of the global population( Sakhare et al. \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2025\u003c/span\u003e). In China, approximately 30% of rice cultivation occurs in acidic soil. In the presence of aluminum (Al) stress, Al\u003csup\u003e3+\u003c/sup\u003e has the potential to infiltrate rice root cells, leading to damage to the integrity of the cytoplasmic membrane. This, in turn, impairs the absorption of essential nutrients (such as N and P) by the rice plant, which can have a significant impact on its growth and yield. Therefore, Al toxicity has emerged as a significant constraint on rice growth and yield enhancement (Wang et al. \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2023\u003c/span\u003e; Lu et al. \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). It is widely accepted that rice is an ammonium-dependent crop, due to the oxygen secretion of rice roots, which can be utilized by microorganisms to convert ammonium nitrogen (NH\u003csub\u003e4\u003c/sub\u003e\u003csup\u003e+\u003c/sup\u003e-N) to nitrate nitrogen (NO\u003csub\u003e3\u003c/sub\u003e\u003csup\u003e\u0026minus;\u003c/sup\u003e-N) through nitrification. The NO\u003csub\u003e3\u003c/sub\u003e\u003csup\u003e\u0026minus;\u003c/sup\u003e-N on the root surface can be immediately absorbed by rice plants, the ratio of NO\u003csub\u003e3\u003c/sub\u003e\u003csup\u003e\u0026minus;\u003c/sup\u003e-N and NH\u003csub\u003e4\u003c/sub\u003e\u003csup\u003e+\u003c/sup\u003e-N absorbed in rice roots is approximately 4:6, indicating that NO\u003csub\u003e3\u003c/sub\u003e\u003csup\u003e\u0026minus;\u003c/sup\u003e-N absorption is the primary factor that controls the growth of root and plant. N nutrient deficiency has a significant impact on crop growth and yield (Huo et al. \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Xiao et al. \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). Therefore, the absorption and utilization of NO\u003csub\u003e3\u003c/sub\u003e\u003csup\u003e\u0026minus;\u003c/sup\u003e-N may directly influence the development and growth of rice.\u003c/p\u003e \u003cp\u003eThe plasma membrane (PM) H\u003csup\u003e+\u003c/sup\u003e-ATPase is the most abundant protein in the cell membranes of plants. PM H\u003csup\u003e+\u003c/sup\u003e-ATPase is described as the \u0026ldquo;master enzyme\u0026rdquo; in the activities of higher plants, playing a central role in maintaining cytoplasmic pH, metabolite homeostasis and stress adaptation. It regulates many vital physiological reactions, including participating in the transport and uptake of N, P, and amino acids (Guti\u0026eacute;rrez-N\u0026aacute;jera et al. \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Xia et al. \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). The 14-3-3 protein is a type of highly conserved regulatory protein in eukaryotic cells that plays an important role in regulating the activity of PM H\u003csup\u003e+\u003c/sup\u003e-ATPase in plants. It regulates the activity of PM H\u003csup\u003e+\u003c/sup\u003e-ATPase by interacting it with the phosphorylated PM H\u003csup\u003e+\u003c/sup\u003e-ATPase (Nguyen et al. \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; Fiorillo et al. \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2023\u003c/span\u003e), PM H\u003csup\u003e+\u003c/sup\u003e-ATPase represents the primary binding target of the 14-3-3 protein in the plasma membrane. The cooperative interaction between the 14-3-3 protein and PM H\u003csup\u003e+\u003c/sup\u003e-ATPase has been demonstrated to activate the PM H\u003csup\u003e+\u003c/sup\u003e-ATPase activity in Al-resistant broad bean under Al stress (Zhao et al. \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Chen et al. \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). Fusicoccin (FC) is a carbontricyclic diterpene glycoside toxin produced by Fusicoccina \u003cem\u003eamygdale\u003c/em\u003e L. Its role is similar to that of auxin. FC is also a PM H\u003csup\u003e+\u003c/sup\u003e-ATPase specific activator. FC has the potential to significantly enhance the activity of PM H\u003csup\u003e+\u003c/sup\u003e-ATPase by binding the 14-3-3/H\u003csup\u003e+\u003c/sup\u003e-ATPase complex more firmly (Marra et al. \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; de Boer. 2024). However, adenosine 5\u0026rsquo;-monophosphate (AMP) is a PM H\u003csup\u003e+\u003c/sup\u003e-ATPase specific inhibitor that inhibits the activity of PM H\u003csup\u003e+\u003c/sup\u003e-ATPase by reducing the level of phosphorylation of the PM H\u003csup\u003e+\u003c/sup\u003e-ATPase and its binding to the 14-3-3 protein (Jahn et al. \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e1997\u003c/span\u003e; Li et al. \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). The degree of interaction between 14-3-3 protein and PM H\u003csup\u003e+\u003c/sup\u003e-ATPase will affect the activity of the latter.\u003c/p\u003e \u003cp\u003eThe activity of PM H\u003csup\u003e+\u003c/sup\u003e-ATPase directly affects the absorption of NO\u003csub\u003e3\u003c/sub\u003e\u003csup\u003e\u0026minus;\u003c/sup\u003e-N by crops. The adsorption of NO\u003csub\u003e3\u003c/sub\u003e\u003csup\u003e\u0026minus;\u003c/sup\u003e-N by plant cells occurs via the transmembrane transport process, which is closely related to the activity of PM H\u003csup\u003e+\u003c/sup\u003e-ATPase. This process involves the cell membrane ion channels, transporters, and carriers. The cell membranes of rice roots possess both high-affinity and low-affinity nitrate transport systems(Lin et al. \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). The two NO\u003csub\u003e3\u003c/sub\u003e\u003csup\u003e\u0026minus;\u003c/sup\u003e-N absorption systems are driven by the dissipation of energy from the active transport process, which is inversely proportional to the concentration gradient and electrochemical gradient. The absorption of NO\u003csub\u003e3\u003c/sub\u003e\u003csup\u003e\u0026minus;\u003c/sup\u003e-N occurs through the cell membrane transport protein in the 2H\u003csup\u003e+\u003c/sup\u003e/1NO\u003csub\u003e3\u003c/sub\u003e\u003csup\u003e\u0026minus;\u003c/sup\u003e co-transport mode, wherein PM H\u003csup\u003e+\u003c/sup\u003e-ATPase provides the energy and proton gradient across the membrane, thereby creating driving force for the uptake of various ions and small molecules by plants (Zhang et al. \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e2011\u003c/span\u003e; Elmore and Coaker \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2011\u003c/span\u003e). PM H\u003csup\u003e+\u003c/sup\u003e-ATPase plays a role in regulating NO\u003csub\u003e3\u003c/sub\u003e\u003csup\u003e\u0026minus;\u003c/sup\u003e-N absorption in rice. Increased PM H\u003csup\u003e+\u003c/sup\u003e-ATPase activity has been observed to result in a net uptake of NO\u003csub\u003e3\u003c/sub\u003e\u003csup\u003e\u0026minus;\u003c/sup\u003e-N in rice (Zhou et al. \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e2016\u003c/span\u003e; Loss Sperandio et al. \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2011\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThe increase in PM H\u003csup\u003e+\u003c/sup\u003e- ATPase activity is associated with the expression level of the enzyme gene. Regulation of plasma membrane enzyme activity is achieved through transcriptional regulation, whereby the specific expression of homologous genes is altered to regulate enzyme activity. Rice has been found to possess ten homologous proteins of PM H\u003csup\u003e+\u003c/sup\u003e-ATPase, designated \u003cem\u003eOsA1\u003c/em\u003e through \u003cem\u003eOsA10\u003c/em\u003e (Li et al. \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2022\u003c/span\u003e b; Zhang et al. \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). The regulation of nitrogen uptake by different H\u003csup\u003e+\u003c/sup\u003e- ATPase genes is dependent on the specific crop variety. Zhang et al. (\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2017\u003c/span\u003e) found that acid rain with pH values of 5.0 and 3.5 increased the transcription levels of \u003cem\u003eOsA1\u003c/em\u003e, \u003cem\u003eOsA4\u003c/em\u003e, \u003cem\u003eOsA5\u003c/em\u003e, \u003cem\u003eOsA6\u003c/em\u003e, \u003cem\u003eOsA7\u003c/em\u003e, \u003cem\u003eOsA8\u003c/em\u003e, \u003cem\u003eOsA9\u003c/em\u003e, and \u003cem\u003eOsA10\u003c/em\u003e, enhanced PM H\u003csup\u003e+\u003c/sup\u003e-ATPase activity, and promoted the absorption of ammonium by rice. In response to NH\u003csub\u003e4\u003c/sub\u003e\u003csup\u003e+\u003c/sup\u003e stress, K\u003csup\u003e+\u003c/sup\u003e has been demonstrated to enhance PM H\u003csup\u003e+\u003c/sup\u003e-ATPase activity and protein expression in rice roots by upregulating the expression levels of \u003cem\u003eOsA1\u003c/em\u003e, \u003cem\u003eOsA3\u003c/em\u003e, \u003cem\u003eOsA7\u003c/em\u003e, \u003cem\u003eOsA8\u003c/em\u003e and \u003cem\u003eOsA9\u003c/em\u003e genes (Weng et al. \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). The activity of PM H\u003csup\u003e+\u003c/sup\u003e-ATPase has the potential to enhance the uptake of nitrogen and phosphorus by regulating the expression of \u003cem\u003eOsA1\u003c/em\u003e ( Ding et al. \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). The overexpression of \u003cem\u003eOsA1\u003c/em\u003e, \u003cem\u003eOsA2\u003c/em\u003e and \u003cem\u003eOsA8\u003c/em\u003e in rice roots has been demonstrated to enhance the absorption and utilization efficiency of nitrogen, the absorption of NO\u003csub\u003e3\u003c/sub\u003e\u003csup\u003e\u0026minus;\u003c/sup\u003e-N, and the absorption and translocation of phosphorus (Zhang et al. \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Loss Sperandio et al. \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2020\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eBased on the above literature analysis, it can be postulated that Al stress may affect the activity of PM H\u003csup\u003e+\u003c/sup\u003e-ATPase by regulating the expression level of PM H\u003csup\u003e+\u003c/sup\u003e-ATPase genes, which in turn affects the absorption of NO\u003csub\u003e3\u003c/sub\u003e\u003csup\u003e\u0026minus;\u003c/sup\u003e-N by rice. However, the molecular regulatory mechanism of PM H\u003csup\u003e+\u003c/sup\u003e-ATPase gene on NO\u003csub\u003e3\u003c/sub\u003e\u003csup\u003e\u0026minus;\u003c/sup\u003e-N uptake in rice under Al stress remains poorly understood, particularly with regard to the specific activators (FC) and inhibitors (AMP) of PM H\u003csup\u003e+\u003c/sup\u003e-ATPase. The potential of these as a tool to verify the effect of PM H\u003csup\u003e+\u003c/sup\u003e-ATPase on NO\u003csub\u003e3\u003c/sub\u003e\u003csup\u003e\u0026minus;\u003c/sup\u003e-N uptake is yet to be fully explored. Therefore, this study analyzed the absorption of NO\u003csub\u003e3\u003c/sub\u003e\u003csup\u003e\u0026minus;\u003c/sup\u003e-N in rice under Al stress, as well as the activity of PM H\u003csup\u003e+\u003c/sup\u003e-ATPase and the expression level of PM H\u003csup\u003e+\u003c/sup\u003e-ATPase genes, with a particular focus on the correlation between PM H\u003csup\u003e+\u003c/sup\u003e-ATPase and NO\u003csub\u003e3\u003c/sub\u003e\u003csup\u003e\u0026minus;\u003c/sup\u003e-N absorption following the the addition of FC and AMP. The objective was to gain further insight into the regulatory mechanism of PM H\u003csup\u003e+\u003c/sup\u003e-ATPase on NO\u003csub\u003e3\u003c/sub\u003e\u003csup\u003e\u0026minus;\u003c/sup\u003e-N absorption in rice under Al stress, with a view to providing genetic resources for the screening and cultivation of rice varieties adapted to acidic soil and the improvement of rice genetic breeding.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003ePlant materials and growth conditions\u003c/h2\u003e \u003cp\u003eThe rice seeds were of Yunnan native rice variety (Dianyou 35 (hybrid rice, japonica)), provided by the Rice Research Institute of Yunnan Agricultural University. Dianyou 35 has demonstrated better adaptability to red soil in the plateau area and has a large planting area. The seeds were disinfected with a 10% H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e solution and then subsequently rinsed in distilled water for a period of 5 min. They were then soaked in distilled water for a duration of 24 h. Then, the seeds were germinated at a temperature of 25\u0026deg;C in a dark incubator. The sprouted seeds were planted in a polypropylene container containing a 0.5 mmol\u0026middot;L\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e CaCl\u003csub\u003e2\u003c/sub\u003e solution at a pH of 4.5, which was replenished every two days. Seedlings of a similar size at 1-leaf stage were planted in \u0026frac14;-strength rice nutrient solution (International rice research institute, IRRI) at a pH of 4.5 for 7 days. Subsequently, the seedlings were planted in a rice nutrient solution containing the following nutrients in mmol\u0026middot;L\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e: NH\u003csub\u003e4\u003c/sub\u003eNO\u003csub\u003e3\u003c/sub\u003e, 2.86; CaCl\u003csub\u003e2\u003c/sub\u003e, 1.0; MgSO\u003csub\u003e4\u003c/sub\u003e,1.0; K\u003csub\u003e2\u003c/sub\u003eSO\u003csub\u003e4\u003c/sub\u003e, 0.35; KH\u003csub\u003e2\u003c/sub\u003ePO\u003csub\u003e4\u003c/sub\u003e, 0.3; MnCl\u003csub\u003e2\u003c/sub\u003e, 9.0\u0026times;10\u003csup\u003e\u0026minus;\u0026thinsp;3\u003c/sup\u003e; (NH\u003csub\u003e4\u003c/sub\u003e)\u003csub\u003e6\u003c/sub\u003eMo\u003csub\u003e7\u003c/sub\u003eO\u003csub\u003e24\u003c/sub\u003e, 0.39\u0026times;10\u003csup\u003e\u0026minus;\u0026thinsp;4\u003c/sup\u003e; H\u003csub\u003e3\u003c/sub\u003eBO\u003csub\u003e3\u003c/sub\u003e, 2.0\u0026times;10\u003csup\u003e\u0026minus;\u0026thinsp;2\u003c/sup\u003e; ZnSO\u003csub\u003e4\u003c/sub\u003e, 7.7\u0026times;10\u003csup\u003e\u0026minus;\u0026thinsp;4\u003c/sup\u003e; Na\u003csub\u003e2\u003c/sub\u003eEDTA-Fe (II), 2.0\u0026times;10\u003csup\u003e\u0026minus;\u0026thinsp;2\u003c/sup\u003e; CuSO\u003csub\u003e4\u003c/sub\u003e, 3.2\u0026times;10\u003csup\u003e\u0026minus;\u0026thinsp;4\u003c/sup\u003e and Na\u003csub\u003e2\u003c/sub\u003eSiO\u003csub\u003e3\u003c/sub\u003e, 5.0\u0026times;10\u003csup\u003e\u0026minus;\u0026thinsp;4\u003c/sup\u003e. The solution was adjusted to pH 4.5 and renewed every other day. All experiments were carried out under greenhouse conditions at night/day temperatures of 20\u0026deg;C/28\u0026deg;C with light (1000 \u0026micro;mol\u0026middot;m\u003csup\u003e\u0026minus;\u0026thinsp;2\u003c/sup\u003e\u0026middot;s\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e) for 12 h per day.\u003c/p\u003e \u003cp\u003ePrevious research results showed that the optimal Al stress concentration was 50 \u0026micro;mol\u0026middot;L\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e (Zhou et al. \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). To determine the optimal treatment concentration and time for FC (Sigma-Aldrich) and AMP (Sigma-Aldrich), the activity of PM H\u003csup\u003e+\u003c/sup\u003e-ATPase was measured. Similar size seedlings at the 4-leaf stage were selected and exposed to either 0 or 50 \u0026micro;mol\u0026middot;L\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e Al\u003csup\u003e3+\u003c/sup\u003e in combination with varying concentrations of FC (0, 1, or 2 \u0026micro;mol\u0026middot;L\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e) or AMP (0, 50, or 100 \u0026micro;mol\u0026middot;L\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e) in the rice nutrient solution (pH 4.5) for a period of 24 h. The seedlings were exposed to 0 or 50 \u0026micro;mol\u0026middot;L\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e Al\u003csup\u003e3+\u003c/sup\u003e in combination with the optimal concentration of FC and AMP for different time periods (0, 3, 6, 12, 24 or 48 h), respectively. Seedlings that were not exposed to Al\u003csup\u003e3+\u003c/sup\u003e, FC and AMP (-Al-FC-AMP) were used as controls (CK). following the completion of the treatment, the root tip materials (0\u0026ndash;20 mm) were collected, frozen in liquid nitrogen, and stored at \u0026minus;\u0026thinsp;80℃ for subsequent analysis of their biochemical indices, gene expression, co-immunoprecipitation, and western blot analysis.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eDetermination of NO-N and H efflux\u003c/h3\u003e\n\u003cp\u003eThe concentration of NO\u003csub\u003e3\u003c/sub\u003e\u003csup\u003e\u0026minus;\u003c/sup\u003e-N in the solution was determined by UV spectrophotometry, as previously described by Zhou et al. (\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). H\u003csup\u003e+\u003c/sup\u003e efflux in the root tip was determined by the non-damage micromeasurement (noninvasive microtest technology system, NMT100 Series; Younger), as previously described by Li et al. (\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2018\u003c/span\u003e), The root tips of the seedlings treated for 24 h were equilibrated for 15 min in the measurement solution(in mmol\u0026middot;L\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e): 0.1 MgCl\u003csub\u003e2\u003c/sub\u003e, 0.1 CaCl\u003csub\u003e2\u003c/sub\u003e, 0.3 MES (2-(4-Morpholino) ethanesulfonic acid), 0.5 NaCl, 0.1 KCl, and 0.2 Na\u003csub\u003e2\u003c/sub\u003eSO\u003csub\u003e4\u003c/sub\u003e, pH 4.0, and then the flow rate of H\u003csup\u003e+\u003c/sup\u003e was recorded.\u003c/p\u003e\n\u003ch3\u003eRNA extraction and qRT-PCR assay\u003c/h3\u003e\n\u003cdiv class=\"Heading\"\u003eRNA extraction and qRT-PCR assay\u003c/div\u003e \u003cp\u003eThe RNA of the rice root was extracted using the Trizol reagent (Invitrogen) method. The root tip sample were ground with liquid nitrogen, extracted with Trizol reagent, emulsify with chloroform, and them centrifuged at 12000 rpm at 4\u0026deg;C for 15 min. The resulting supernatant was purified with chloroform once more. Isopropanol should then be added to the supernatant and mixed thoroughly. The samples were then subjected to centrifuge at 12000 rpm at 4\u0026deg;C for 30 min. The supernatant should be discarded, and the precipitate should be washed three times with 75% ethanol in diethyl pyrocarbonate (DEPC). The ethanol should then be removed by drying on ice. Following air drying, the precipitation was cleaned and dissolved by dilution with DEPC. The RNA was stored at \u0026minus;\u0026thinsp;80℃ in preparation for future use. The reverse transcription procedure should be carried out according to the instructions provided by Norwizan reverse transcription kit (Vazyme Biotech Co., Ltd: HiScript\u0026reg; Ⅱ 1st strand cDNA synthesis kit (+\u0026thinsp;GDNA wiper) R212-01/02). The qPCR experiments were performed using the ChamQTM Universal SYBR qPCR Master Mix (Q711-02/03) of Vazyme Biotech Co., Ltd. In accordance with the instructions provided by the manufacturer. This article employs Dianyou 35 as the research material to design primers based on the gene sequence of Nipponbare (Japonica), which has been sequenced in its entirety. In this study, the 10 PM H\u003csup\u003e+\u003c/sup\u003e-ATPase isoforms (\u003cem\u003eOsA1\u003c/em\u003e-\u003cem\u003eOsA10\u003c/em\u003e) were selected for subsequent qRT-PCR experiments, with \u003cem\u003eOsEF-1ɑ\u003c/em\u003e used as the reference gene. The results of the primer sequences are shown in Table \u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. These were identical to those used by Loss Sperandio et al. (\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2011\u003c/span\u003e), which were synthesized by Kunming Tsingke Biotechnology Co., Ltd.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eThe prime sequences used for qRT-PCR for 10 PM H\u003csup\u003e+\u003c/sup\u003e -ATPase isoforms (\u003cem\u003eOsA1\u0026ndash;OsA10\u003c/em\u003e)\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePrimers Forward (5\u0026acute;-3\u0026acute;)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eReverse primer(5\u0026acute;-3\u0026acute;)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eNCBI\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eOsA1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTGGGCACATGCACATAGGA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGCTCACTGTAGCCGGTCTTCTC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eNM_001057482.1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eOsA2\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGCAGAAGAGGCCCGTAGGA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCAGGGTGGTCAGCTCTCTCAA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eNM_001065628.1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eOsA3\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAATTCTGCAATCACCTACGTGTACTT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGCTGGAGCAGGAGGGACAA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eNM_001073914.1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eOsA4\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCGTCGAGTCGGTGGTCAAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCGGTGTAGTGGTTCTGGATGGT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eNM_001061721.1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eOsA5\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCGGCGTCATCTGGCTCTAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGACGGCGAACTTGAAGATGTC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eNM_001067873.1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eOsA6\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTTTCACTCTTGGTGTGAAGCAGAT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGACTTCCTTCACGATTTCATCGTAA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eNM_001054930.1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eOsA7\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTCGACACGATCCAGCAGAAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGCTGATGACGATCTCTCGTTGA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eNM_001060653.1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eOsA8\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTGTTTAACCTACAACACGACAATGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAATGGGATGGGAAAGGAAAATAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eNM_001055182.1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eOsA9\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGTTCTACGCCCCCCTCGAT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCTTCCTGTCGAACAGCAGGTT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eNM_001055720.1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eOsA10\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCGCCGAGGTCGCAAGAT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCGCTCAAAACCACGCAAAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eNM_001063515.1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eOsEF-1α\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTTTCACTCTTGGTGTGAAGCAGAT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGACTTCCTTCACGATTTCATCGTAA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eNM_001055681.1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e\n\u003ch3\u003eAssays of PM H-ATPase activity and the activity and initial rate of H-pump\u003c/h3\u003e\n\u003cp\u003eThe plasma membrane proteins of rice roots were extracted from the extract (containing 0.25 mmol\u0026middot;L\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e sorbitol, 1 mmol\u0026middot;L\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e EDTA, 10 mmol\u0026middot;L\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e Tris-HCl (pH7.4), 10 \u0026micro;mol\u0026middot;L\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e NaF, 0.5 mmol\u0026middot;L\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e Phenylmethanesulfonyl fluoride (PMSF), 0.015% (V/V) Triton X-100) as described by Shen et al. (\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2005\u003c/span\u003e). The protein concentration was quantified according to the method of Bradford. Purity determination of plasma membrane was conducted according to Guo et al. (2018), Na\u003csub\u003e3\u003c/sub\u003eVO\u003csub\u003e4\u003c/sub\u003e, a specific inhibitor of plasma membrane, was added to the reaction system for determination of the activity of H\u003csup\u003e+\u003c/sup\u003e-ATPase. The activity of H\u003csup\u003e+\u003c/sup\u003e-ATPase was determined without Na\u003csub\u003e3\u003c/sub\u003eVO\u003csub\u003e4\u003c/sub\u003e as a control. The extracted PM protein had high purity and could be used for subsequent experiments when the inhibition rate of 85% or greater for H\u003csup\u003e+\u003c/sup\u003e-ATPase activity upon exposure to Na\u003csub\u003e3\u003c/sub\u003eVO\u003csub\u003e4\u003c/sub\u003e. The results showed that the H\u003csup\u003e+\u003c/sup\u003e-ATPase activity sensitive to Na\u003csub\u003e3\u003c/sub\u003eVO\u003csub\u003e4\u003c/sub\u003e accounted for 85% of the total activity of PM components, while the enzyme activity sensitive to other inhibitors (KNO\u003csub\u003e3\u003c/sub\u003e, NaN\u003csub\u003e3\u003c/sub\u003e) may be ignored, the results indicate that the technology used for separating PM is practical. The activity of PM H\u003csup\u003e+\u003c/sup\u003e-ATPase was determined using the spectrophotometric method as described by Guo et al. (\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2013\u003c/span\u003e), PM H\u003csup\u003e+\u003c/sup\u003e-pump activity was measured according to the acridine orange method described by Yan et al. (\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2002\u003c/span\u003e), The changes in OD\u003csub\u003e492\u003c/sub\u003e were recorded every 15 s over a 20-min period. The assay of the initial rate of H\u003csup\u003e+\u003c/sup\u003e-pump was described as the slope of the absorbance quenching of acridine orange in the first 60 s by Ying et al. (\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e2015\u003c/span\u003e).\u003c/p\u003e\n\u003ch3\u003eCo-immunoprecipitation and western blot analysis\u003c/h3\u003e\n\u003cp\u003eTo assay the interaction between the PM H\u003csup\u003e+\u003c/sup\u003e-ATPase and 14-3-3 protein by co-immunoprecipitation (Co-IP), 2 \u0026micro;g of a specific phosphorylation antibody targeted against VHA2, in conjunction with a total of 500 \u0026micro;g of PM protein, were incubated for a period of 6 h at 4\u0026deg;C with shaking (40 rpm). Subsequently, 20 \u0026micro;L of protein A/G plus-agarose (Santa Cruz Biotech, Santa Cruz, CA) was added to the protein solution, and incubated for 12 h at 4\u0026deg;C. Following this, the solution was centrifuged in order to obtain the precipitated protein. The protein sample was cleaned with pre-cooled phosphate buffer saline (PBS) for several times. Thereafter, the precipitated protein was dissolved with pre-cooled PBS and loading buffer, and separated by 10% sodium dodecyl sulfate\u0026ndash;polyacrylamide gel electrophoresis (SDS-PAGE) for western blot analysis. The isolated protein was transferred to a polyvinylidene fluoride (PVDF) membrane via a semi-dry electrotransfer instrument. The membrane was initially treated with an antibody specific to \u003cem\u003eMalus domestica\u003c/em\u003e 14-3-3 protein antibody or with an antibody targeting the characteristic phosphorylation of VHA2. Subsequently, a goat anti-rabbit IgG antibody conjugated with peroxidase was incubated for 2 h at room temperature. Finally, the Efficient chemiluminescence (ECL) kit was added to above solution, and observation was conducted using a gel imager instrument. Quantitative analysis of the western blot signals was performed using Image analysis software Image J software. The expression levels of PM H\u003csup\u003e+\u003c/sup\u003e-ATPase and 14-3-3 protein in rice root tips treated with Al for 0 h were set to 1.0 as a reference point.\u003c/p\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eAll data are the average of three biological replicates (n\u0026thinsp;=\u0026thinsp;3), and the differences between the various treatment groups were analyzed using one-way ANOVA with the least significant difference method (LSD) test, conducted using SPSS 21.0 software. A P-value of less than 0.05 was considered statistically significant. The next step is to draw in Excel 2010.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cp\u003e \u003cb\u003eEffects of 24 h exposure to different concentrations of FC and AMP on the activity of PM H\u003c/b\u003e \u003csup\u003e \u003cb\u003e+\u003c/b\u003e \u003c/sup\u003e \u003cb\u003e-ATPase under Al stress\u003c/b\u003e \u003c/p\u003e \u003cp\u003eTo determine the optimal treatment concentration of FC and AMP during Al stress, thg dianyou 35 seedlings were treated with different concentrations (0, 1, or 2 \u0026micro;mol\u0026middot;L\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e) of FC or (0, 100, or 200 \u0026micro;mol\u0026middot;L\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e) of AMP for 24 h under 0 \u0026micro;mol\u0026middot;L\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e and 50 \u0026micro;mol\u0026middot;L\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e Al. Figure\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ea illustrated the impact of varying FC and AMP concentrations on PM H\u003csup\u003e+\u003c/sup\u003e- ATPase activity. Plants treated with FC exhibited a markedly elevated the PM H\u003csup\u003e+\u003c/sup\u003e-ATPase activity compared to those not treated with FC. With increasing FC concentration, PM H\u003csup\u003e+\u003c/sup\u003e-ATPase activity demonstrated a notable increase. However, there was no discernible difference in PM H\u003csup\u003e+\u003c/sup\u003e-ATPase activity between plants treated with 1 and 2 \u0026micro;mol\u0026middot;L\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e FC, irrespective of Al stress conditions. In comparison to the control group, the PM H\u003csup\u003e+\u003c/sup\u003e-ATPase activity in plants treated with 100 \u0026micro;mol\u0026middot;L\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e or 200 \u0026micro;mol\u0026middot;L\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e AMP was found to be significantly reduced. Furthermore, the PM H\u003csup\u003e+\u003c/sup\u003e-ATPase activity demonstrated a decline with the increase of AMP concentration. Although the PM H\u003csup\u003e+\u003c/sup\u003e-ATPase activity in roots treated with 200 \u0026micro;mol\u0026middot;L\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e AMP was slightly lower than that of 100 \u0026micro;mol\u0026middot;L\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e AMP, no significant difference was observed (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eb). The PM H\u003csup\u003e+\u003c/sup\u003e-ATPase activity in the root tips of seedlings treated with Al stress was found to be significantly lower than that of seedlings treated without Al, regardless of whether FC or AMP was added. The PM H\u003csup\u003e+\u003c/sup\u003e-ATPase activity in the root tips of seedlings treated with Al was observed to be 61% \u0026minus;\u0026thinsp;65% of that of seedlings treated without Al under the same concentration treatment conditions, and the difference was found to be significant (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). Considering the efficacy of the reagents, the optimal concentrations of FC and AMP for use in subsequent experiments are 1 \u0026micro;mol\u0026middot;L\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e and 100 \u0026micro;mol\u0026middot;L\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e, respectively.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eEffects of different time on the activity of PM H\u003c/b\u003e \u003csup\u003e \u003cb\u003e+\u003c/b\u003e \u003c/sup\u003e \u003cb\u003e-ATPase under the optimal concentrations of FC and AMP combined with Al\u003c/b\u003e \u003c/p\u003e \u003cp\u003eTo determine the optimal treatment time of FC and AMP under Al stress, the dianyou 35 seedlings were treated for varying durations (0, 3, 6, 12, 24, or 48 h) in 1 \u0026micro;mol\u0026middot;L\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e FC and 100 \u0026micro;mol\u0026middot;L\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e AMP combined with 0 or 50 \u0026micro;mol\u0026middot;L\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e Al. The PM H\u003csup\u003e+\u003c/sup\u003e-ATPase activity exhibited marked differences between seedlings treated with FC and AMP and those treated with the same conditions (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ea, the activity of PM H\u003csup\u003e+\u003c/sup\u003e-ATPase in roots exhibited a gradual increase over the 48 h period, with a peak observed at 24 h of exposure to FC, irrespective of Al stress. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eb, the activity of PM H\u003csup\u003e+\u003c/sup\u003e-ATPase in roots exhibited a gradual decline with increasing exposure to AMP, reaching a minimum level at 48 h. The PM H\u003csup\u003e+\u003c/sup\u003e- ATPase activity in the root tips treated with FC and AMP for 24 h exhibited a significantly difference compared to 12 h, and no significant difference compared to 48 h, irrespective of the presence of FC and AMP. A significant difference was observed in the PM H\u003csup\u003e+\u003c/sup\u003e- ATPase activity between seedlings treated with Al and those treated without Al under identical time conditions. The application of Al resulted in a notable reduction in PM H\u003csup\u003e+\u003c/sup\u003e- ATPase activity within rice root tips (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). Therefore, in consideration of temporal and financial constraints, the optimal treatment duration for FC and AMP was determined to be 24 h, which was subsequently employed in the subsequent experiments.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e\n\u003ch3\u003eEffects of FC and AMP on NO-N uptake during Al stress\u003c/h3\u003e\n\u003cp\u003eAs shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e, there was a significant discrepancy in the absorption of NO\u003csub\u003e3\u003c/sub\u003e\u003csup\u003e\u0026minus;\u003c/sup\u003e-N between seedlings treated with Al and those treated without Al under identical conditions. The Al treatment resulted in a considerable reduction in NO\u003csub\u003e3\u003c/sub\u003e\u003csup\u003e\u0026minus;\u003c/sup\u003e-N uptake in rice, with the absorption of NO\u003csub\u003e3\u003c/sub\u003e\u003csup\u003e\u0026minus;\u003c/sup\u003e-N in rice under Al stress reaching only 79% of the control level (- Al-FC-AMP). The absorption of NO\u003csub\u003e3\u003c/sub\u003e\u003csup\u003e\u0026minus;\u003c/sup\u003e-N in rice treated with FC was significantly greater than that of observed in seedlings treated without FC. The absorption of NO\u003csub\u003e3\u003c/sub\u003e\u003csup\u003e\u0026minus;\u003c/sup\u003e-N in rice treated with Al and FC was almost equivalent to that of the control. However, the absorption of NO\u003csub\u003e3\u003c/sub\u003e\u003csup\u003e\u0026minus;\u003c/sup\u003e-N in rice treated with AMP was significantly reduced, reaching a level significantly lower than that of seedlings treated without AMP. The NO\u003csub\u003e3\u003c/sub\u003e\u003csup\u003e\u0026minus;\u003c/sup\u003e-N uptake exhibited a significantly difference between seedlings treated with FC or AMP and those treated with the same conditions.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eEffects of FC and AMP on the activity of PM H\u003c/b\u003e \u003csup\u003e \u003cb\u003e+\u003c/b\u003e \u003c/sup\u003e \u003cb\u003e-ATPase, the initial rate and activity of H\u003c/b\u003e \u003csup\u003e \u003cb\u003e+\u003c/b\u003e \u003c/sup\u003e \u003cb\u003e-pump and H\u003c/b\u003e \u003csup\u003e \u003cb\u003e+\u003c/b\u003e \u003c/sup\u003e \u003cb\u003eefflux in rice roots under Al stress\u003c/b\u003e\u003c/p\u003e \u003cp\u003eThe results presented in Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e confirmed the hypothesis that FC improved the absorption of NO\u003csub\u003e3\u003c/sub\u003e\u003csup\u003e\u0026minus;\u003c/sup\u003e-N, whereas AMP impedes this process. To understand whether the efficiency of NO\u003csub\u003e3\u003c/sub\u003e\u003csup\u003e\u0026minus;\u003c/sup\u003e-N uptake was related to the activity of PM H\u003csup\u003e+\u003c/sup\u003e-ATPase, this study analyzed the alteration in the PM H\u003csup\u003e+\u003c/sup\u003e-ATPase activity, H\u003csup\u003e+\u003c/sup\u003e efflux, and H\u003csup\u003e+\u003c/sup\u003e-pump activity in rice roots subjected to different treatment. The results depicted in Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e showed that a notable difference in PM H\u003csup\u003e+\u003c/sup\u003e-ATPase activity between seedlings subjected to FC or AMP treatment and those not exposed to FC or AMP (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ea). FC was observed to significantly increase and AMP to significantly decrease PM H\u003csup\u003e+\u003c/sup\u003e-ATPase activity in rice seedlings, regardless of whether FC and AMP were present or not. The most immediate consequence of the increased activity of PM H\u003csup\u003e+\u003c/sup\u003e-ATPase is believed to be the activation of the H\u003csup\u003e+\u003c/sup\u003e pump, the activation of H\u003csup\u003e+\u003c/sup\u003e pump can promote the exudation of H\u003csup\u003e+\u003c/sup\u003e from the inner side of the cell to the outer side. Therefore, the changes in H\u003csup\u003e+\u003c/sup\u003e efflux and H\u003csup\u003e+\u003c/sup\u003e pump activity of PM extracts from rice root tips under different treatments have been analyzed. The alterations in H\u003csup\u003e+\u003c/sup\u003e efflux (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eb) and H\u003csup\u003e+\u003c/sup\u003e-pump activity (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ec) were consistent with the modifications in PM H\u003csup\u003e+\u003c/sup\u003e-ATPase activity in rice roots, indicating that FC markedly enhanced, while AMP markedly reduced the activities of PM H\u003csup\u003e+\u003c/sup\u003e-ATPase and H\u003csup\u003e+\u003c/sup\u003e-pump, as well as H\u003csup\u003e+\u003c/sup\u003e efflux.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eEffect of FC and AMP on the expression of PM H\u003c/b\u003e \u003csup\u003e \u003cb\u003e+\u003c/b\u003e \u003c/sup\u003e \u003cb\u003e-ATPase and its interaction with 14-3-3 protein in rice roots under Al stress\u003c/b\u003e \u003c/p\u003e \u003cp\u003eIt is hypothesized that the 14-3-3 protein/PM H\u003csup\u003e+\u003c/sup\u003e-ATPase complex may enhance the activity of PM H\u003csup\u003e+\u003c/sup\u003e-ATPase. To clarify whether the effect of FC or AMP on the absorption of NO\u003csub\u003e3\u003c/sub\u003e\u003csup\u003e\u0026minus;\u003c/sup\u003e-N in rice was related to the degree of interaction level between PM H\u003csup\u003e+\u003c/sup\u003e-ATPase and 14-3-3 protein in rice root tips under Al or non-Al stress conditions, we extracted PM proteins from dianyou 35 seedling root tips that underwent FC treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ea) or AMP treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ec) for 24 h and analyzed them by co-immunoprecipitation (Co-IP). The data presented in Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ea and Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ec demonstrated that the phosphorylation level of the PM H\u003csup\u003e+\u003c/sup\u003e-ATPase protein in the root tips was essentially equivalent to that of the 14-3-3 protein. FC was observed to up-regulated and AMP down-regulated the phosphorylation level of PM H\u003csup\u003e+\u003c/sup\u003e-ATPase protein and the expression of 14-3-3 protein. Moreover, the relative expression of PM H\u003csup\u003e+\u003c/sup\u003e-ATPase protein and 14-3-3 protein following FC treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eb) or AMP treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ed) was analyzed in silico method. The data in Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eb demonstrated that FC could enhance the interaction of PM H\u003csup\u003e+\u003c/sup\u003e-ATPase with 14-3-3 protein, whether or not Al treatment was present, and significantly upregulate the relative expression levels of PM H\u003csup\u003e+\u003c/sup\u003e-ATPase-bound 14-3-3 protein and 14-3-3 protein-bound PM H\u003csup\u003e+\u003c/sup\u003e-ATPase. The data in Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003ed indicated that, regardless of Al treatment, AMP could degrade the interaction between PM H\u003csup\u003e+\u003c/sup\u003e-ATPase and 14-3-3 protein, significantly downregulating the relative expression levels of PM H\u003csup\u003e+\u003c/sup\u003e-ATPase-bound 14-3-3 protein and 14-3-3 protein-bound PM H\u003csup\u003e+\u003c/sup\u003e-ATPase.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eEffects of FC and AMP on the expression of PM H\u003c/b\u003e \u003csup\u003e \u003cb\u003e+\u003c/b\u003e \u003c/sup\u003e \u003cb\u003e-ATPase isoforms in rice under Al stress\u003c/b\u003e \u003c/p\u003e \u003cp\u003eTo understand whether the activity of PM H\u003csup\u003e+\u003c/sup\u003e-ATPase was related to the expression of PM H\u003csup\u003e+\u003c/sup\u003e-ATPase isoforms, this study analyzed the relative expression level of 10 PM H\u003csup\u003e+\u003c/sup\u003e-ATPase isoforms (\u003cem\u003eOsA1\u003c/em\u003e-\u003cem\u003eOsA10\u003c/em\u003e) in rice roots subjected to different treatments. The results were shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e. The relative expression of \u003cem\u003eOsA6\u003c/em\u003e and \u003cem\u003eOsA10\u003c/em\u003e was markedly low or undetectable in rice whether Al stress or not. Compared with the control group, the relative expression of 10 PM H\u003csup\u003e+\u003c/sup\u003e-ATPase isoforms was significantly inhibited by Al strees, with the exception of \u003cem\u003eOsA6\u003c/em\u003e and \u003cem\u003eOsA10\u003c/em\u003e. The inhibitor AMP was observed to down-regulate the relative expression of \u003cem\u003eOsA1\u003c/em\u003e and \u003cem\u003eOsA7\u003c/em\u003e in rice root subjected to Al stress, while simultaneously up-regulating the relative expression of \u003cem\u003eOsA2, OsA3, OsA4, OsA5, OsA8, and OsA9\u003c/em\u003e. In comparison to the control group, the application of AMP resulted in a reduction in the relative expression of \u003cem\u003eOsA1, OsA3, OsA5\u003c/em\u003e and \u003cem\u003eOsA7\u003c/em\u003e, while an increase was observed in the relative expression of \u003cem\u003eOsA2, OsA4, OsA8 and OsA9\u003c/em\u003e. The activator FC was observed to significantly up-regulate the relative expression of 10 PM H\u003csup\u003e+\u003c/sup\u003e-ATPase isoforms in rice roots, irrespective of the presence of Al, with the exception of \u003cem\u003eOsA6\u003c/em\u003e and \u003cem\u003eOsA10\u003c/em\u003e.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eThe degree of lipid peroxidation in rice root tips intensifies under Al stress, leading to increased levels of H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e and MDA, which disrupts the integrity of the cell membrane structure (Zhou et al. \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). The PM H\u003csup\u003e+\u003c/sup\u003e-ATPase plays an important physiological role in the growth, development, and stress resistance of plant cells. The active transport of nitrate NO\u003csub\u003e3\u003c/sub\u003e\u003csup\u003e\u0026minus;\u003c/sup\u003e-N requires the energy produced by the hydrolysis of adenosine triphosphate (ATP) by PM H\u003csup\u003e+\u003c/sup\u003e-ATPase. This process generates an electric potential gradient and provides a driving force for NO\u003csub\u003e3\u003c/sub\u003e\u003csup\u003e\u0026minus;\u003c/sup\u003e-N transport, thereby promoting the absorption of NO\u003csub\u003e3\u003c/sub\u003e\u003csup\u003e\u0026minus;\u003c/sup\u003e-N by plant roots (Liu et al. \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Some studies have demonstrated that Al stress can impede the absorption of NO\u003csub\u003e3\u003c/sub\u003e\u003csup\u003e\u0026minus;\u003c/sup\u003e-N in rice(Zhou et al. \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). Al has been demonstrated to impede NO\u003csub\u003e3\u003c/sub\u003e\u003csup\u003e\u0026minus;\u003c/sup\u003e-N uptake and N-use efficiency by inhibiting root growth (\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eZhao\u003c/span\u003e and \u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eShen. 2018\u003c/span\u003e). The results presented in Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e are consistent with these reports. It was observed that Al stress resulted in a reduction in the absorption of NO\u003csub\u003e3\u003c/sub\u003e\u003csup\u003e\u0026minus;\u003c/sup\u003e-N in rice, with the absorption of NO\u003csub\u003e3\u003c/sub\u003e\u003csup\u003e\u0026minus;\u003c/sup\u003e-N under Al stress being approximately 80% of that observed in the control. The most significant consequence of increasing or decreasing PM H\u003csup\u003e+\u003c/sup\u003e-ATPase activity is the activation or inhibition of H\u003csup\u003e+\u003c/sup\u003e-pump activity (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e). The released H\u003csup\u003e+\u003c/sup\u003e forms a potential gradient, which provides energy for the transport of secondary transporters and channel proteins to various nutrients and ions. The formation of the PM H\u003csup\u003e+\u003c/sup\u003e-ATPase/14-3-3 protein complex, which occurs through the binding of 14-3-3 protein with phosphorylated PM H\u003csup\u003e+\u003c/sup\u003e-ATPase, results in the activation of PM H\u003csup\u003e+\u003c/sup\u003e-ATPase (Lapshin et al. \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Wang et al. \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Kabała and Janicka \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). Guo et al. (\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2013\u003c/span\u003e) found that Al stress could significantly reduce the binding of 14-3-3 protein with phosphorylated PM H\u003csup\u003e+\u003c/sup\u003e-ATPase in root tip of Al-sensitive black bean, thereby reducing PM H\u003csup\u003e+\u003c/sup\u003e-ATPase and H\u003csup\u003e+\u003c/sup\u003e-pump activity. The study by Yang et al. (\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2017\u003c/span\u003e) corroborates the hypothesis that Al stress reduced the interaction level between phosphorylated PM H\u003csup\u003e+\u003c/sup\u003e-ATPase and 14-3-3 protein, thereby reducing the uptake of NO\u003csub\u003e3\u003c/sub\u003e\u003csup\u003e\u0026minus;\u003c/sup\u003e-N through the inhibition of PM H\u003csup\u003e+\u003c/sup\u003e-ATPase activity in the root tips of black soybean. The results of this experiment were largely consistent with the above research findings. The phosphorylation of PM H\u003csup\u003e+\u003c/sup\u003e-ATPase and its interaction with 14-3-3 protein were observed to decrease in rice under Al stress (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e), as was the H\u003csup\u003e+\u003c/sup\u003e efflux in root tips, the H\u003csup\u003e+\u003c/sup\u003e-pump activity and initial rate, which were all lower than those in the control (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e). This resulted in a reduction in PM H\u003csup\u003e+\u003c/sup\u003e-ATPase activity (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e) and a subsequent decrease in the absorption of NO\u003csub\u003e3\u003c/sub\u003e\u003csup\u003e\u0026minus;\u003c/sup\u003e-N (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e) in rice. The above results indicated that Al stress reduced the absorption capacity of NO\u003csub\u003e3\u003c/sub\u003e\u003csup\u003e\u0026minus;\u003c/sup\u003e-N and the activity of PM H\u003csup\u003e+\u003c/sup\u003e-ATPase and H\u003csup\u003e+\u003c/sup\u003e-pump. There was a positive correlation between PM H\u003csup\u003e+\u003c/sup\u003e-ATPase activity and NO\u003csub\u003e3\u003c/sub\u003e\u003csup\u003e\u0026minus;\u003c/sup\u003e-N absorption, indicating that PM H\u003csup\u003e+\u003c/sup\u003e-ATPase activity directly affects the absorption capacity of NO\u003csub\u003e3\u003c/sub\u003e\u003csup\u003e\u0026minus;\u003c/sup\u003e-N in rice.\u003c/p\u003e \u003cp\u003eFC, an activator of the PM H\u003csup\u003e+\u003c/sup\u003e-ATPase, has the potential to enhance the activity of PM H\u003csup\u003e+\u003c/sup\u003e-ATPase, improve the hydrolysis activity of PM H\u003csup\u003e+\u003c/sup\u003e-ATPase and the capacity for pumping hydrogen and increase PM H\u003csup\u003e+\u003c/sup\u003e-ATPase binding to 14-3-3 protein (Lapshin et al. \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Zhang et al. \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). FC has been demonstrated to improve the activity of PM H\u003csup\u003e+\u003c/sup\u003e-ATPase in the root tips of soybean and black bean plants. (Shen et al. \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2005\u003c/span\u003e; Yi et al. \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). In contrast, AMP has been demonstrated to function as an inhibitor of PM H\u003csup\u003e+\u003c/sup\u003e-ATPase, with the capacity to reduce the activity of PM H\u003csup\u003e+\u003c/sup\u003e-ATPase in black bean root tips (Guo et al. \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). Our findings were similar to those previously reported, confirming that FC can markedly improve and AMP can significantly decrease the activity of PM H\u003csup\u003e+\u003c/sup\u003e-ATPase and H\u003csup\u003e+\u003c/sup\u003e-pump, as well as the interaction level between PM H\u003csup\u003e+\u003c/sup\u003e-ATPase and 14-3-3 protein in rice roots, irrespective of Al stress(Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e, Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e, Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e). The evidence suggests that FC may improve NO\u003csub\u003e3\u003c/sub\u003e\u003csup\u003e\u0026minus;\u003c/sup\u003e-N absorption by regulating PM H\u003csup\u003e+\u003c/sup\u003e-ATPase activity, the H\u003csup\u003e+\u003c/sup\u003e-pump, as well as H\u003csup\u003e+\u003c/sup\u003e efflux in rice, irrespective of Al stress or not. Conversely, AMP may inhibit NO\u003csub\u003e3\u003c/sub\u003e\u003csup\u003e\u0026minus;\u003c/sup\u003e-N absorption by regulating these processes.\u003c/p\u003e \u003cp\u003eCurrently, gene function is typically inferred based on the strength of gene expression, with functional assessment conducted through the examination of gene expression alterations in response to diverse environmental stimuli. Previous studies have shown that PM H\u003csup\u003e+\u003c/sup\u003e-ATPase is a multigene family that plays an important role in regulating plant development and stress resistance (Zhou et al. \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Plants adapt to the external conditions by regulating the activity of PM H\u003csup\u003e+\u003c/sup\u003e-ATPase and gene expression, PM H\u003csup\u003e+\u003c/sup\u003e-ATPase is divided into five different subfamilies, with subfamilies I (\u003cem\u003eOsA1\u003c/em\u003e, \u003cem\u003eOsA2\u003c/em\u003e, \u003cem\u003eOsA3\u003c/em\u003e) and II (\u003cem\u003eOsA5\u003c/em\u003e, \u003cem\u003eOsA7\u003c/em\u003e) being highly expressed under normal conditions, whereas the subfamilies IV (\u003cem\u003eOsA4\u003c/em\u003e, \u003cem\u003eOsA6\u003c/em\u003e, and \u003cem\u003eOsA10\u003c/em\u003e) are low expressed or expressed in specific cell-expressed under normal conditions (Loss Sperandio et al. \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2011\u003c/span\u003e). This study analyzed the gene expression levels of \u003cem\u003eOsA1\u003c/em\u003e to \u003cem\u003eOsA10\u003c/em\u003e. The relative expression levels of \u003cem\u003eOsA6\u003c/em\u003e and \u003cem\u003eOsA10\u003c/em\u003e genes in rice root tips were found to be low and undetectable whether Al stress or not, which was consistent with the low expression of the subfamily IV (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e). Loss Sperandio et al. (\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2020\u003c/span\u003e) proposed that \u003cem\u003eOsA2\u003c/em\u003e and \u003cem\u003eOsA7\u003c/em\u003e may be key genes influencing the uptake and transport of nitrogen in Japanese rice. Zhu et al. (\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e2009\u003c/span\u003e) demonstrated a positive correlation between the activity and protein expression of PM H\u003csup\u003e+\u003c/sup\u003e- ATPase in rice roots and the gene expression levels of \u003cem\u003eOsA1\u003c/em\u003e, \u003cem\u003eOsA3\u003c/em\u003e, \u003cem\u003eOsA5\u003c/em\u003e, \u003cem\u003eOsA7\u003c/em\u003e, and \u003cem\u003eOsA8\u003c/em\u003e. The regulation of nitrate uptake by different PM H\u003csup\u003e+\u003c/sup\u003e-ATPase genes is related to crop varieties. The results of this study are consistent with those previous research, indicating that the relative expression of eight PM H\u003csup\u003e+\u003c/sup\u003e-ATPase isoforms and PM H\u003csup\u003e+\u003c/sup\u003e-ATPase activity are inhibited in rice roots under Al stress, except for \u003cem\u003eOsA6\u003c/em\u003e and \u003cem\u003eOsA10\u003c/em\u003e. AMP has been demonstrated to downregulate the relative expression levels of \u003cem\u003eOsA1\u003c/em\u003e and \u003cem\u003eOsA7\u003c/em\u003e, as well as reduce PM H\u003csup\u003e+\u003c/sup\u003e-ATPase activity in rice, irrespective of whether the plant is subjected to Al stress. However, the relative expression levels of \u003cem\u003eOsA2\u003c/em\u003e, \u003cem\u003eOsA3\u003c/em\u003e, \u003cem\u003eOsA4\u003c/em\u003e, \u003cem\u003eOsA5\u003c/em\u003e, \u003cem\u003eOsA8\u003c/em\u003e, and \u003cem\u003eOsA9\u003c/em\u003e did not align with the observed changes in PM H\u003csup\u003e+\u003c/sup\u003e-ATPase activity. FC was observed to upregulate the expression levels of 8 PM H\u003csup\u003e+\u003c/sup\u003e-ATPase isoforms, with the exception of \u003cem\u003eOsA6\u003c/em\u003e and \u003cem\u003eOsA10\u003c/em\u003e. Additionally, it demonstrated the ability to somewhat restore the relative expression levels of the PM H\u003csup\u003e+\u003c/sup\u003e-ATPase isoforms and the activity of PM H\u003csup\u003e+\u003c/sup\u003e-ATPase in rice under Al stress. This indicates that the expression levels of \u003cem\u003eOsA1\u003c/em\u003e and \u003cem\u003eOsA7\u003c/em\u003e are correlated with the activity of PM H\u003csup\u003e+\u003c/sup\u003e-ATPase in rice under FC or AMP treatment. It can be postulated that FC and AMP may affect PM H\u003csup\u003e+\u003c/sup\u003e-ATPase activity by regulating the expression levels of \u003cem\u003eOsA1\u003c/em\u003e and \u003cem\u003eOsA7\u003c/em\u003e. Our findings are consistent with those of Loss Sperandio et al. (\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2011\u003c/span\u003e), who proposed that \u003cem\u003eOsA7\u003c/em\u003e may play a role in nitrogen uptake in rice. Al stress has been demonstrated to downregulate the expression levels of \u003cem\u003eOsA1\u003c/em\u003e and \u003cem\u003eOsA7\u003c/em\u003e in rice root tips, leading to a reduction in H\u003csup\u003e+\u003c/sup\u003e-pump activity and initial rate, as well as a decrease in H\u003csup\u003e+\u003c/sup\u003e efflux. This resulted in a reduction in the interaction level between PM H\u003csup\u003e+\u003c/sup\u003e-ATPase and 14-3-3 protein, which in turn led to a decrease in PM H\u003csup\u003e+\u003c/sup\u003e-ATPase activity and a reduction in the uptake of NO\u003csub\u003e3\u003c/sub\u003e\u003csup\u003e\u0026minus;\u003c/sup\u003e-N in rice. The expression of \u003cem\u003eOsA1\u003c/em\u003e and \u003cem\u003eOsA7\u003c/em\u003e was found to be involved in regulation of NO\u003csub\u003e3\u003c/sub\u003e\u003csup\u003e\u0026minus;\u003c/sup\u003e-N uptake of in rice plants subjected to Al stress.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eThe present study demonstrates that Al stress can reduce the relative expression of eight PM H\u003csup\u003e+\u003c/sup\u003e-ATPase isoforms, with the exception of \u003cem\u003eOsA6\u003c/em\u003e and \u003cem\u003eOsA10\u003c/em\u003e. This results in a decrease in H\u003csup\u003e+\u003c/sup\u003e-pump activity and initial rate, H\u003csup\u003e+\u003c/sup\u003e efflux, and a reduction in the interaction level between PM H\u003csup\u003e+\u003c/sup\u003e-ATPase and 14-3-3 protein. Consequently, there is a decrease in PM H\u003csup\u003e+\u003c/sup\u003e-ATPase activity and a reduction in the absorption of NO\u003csub\u003e3\u003c/sub\u003e\u003csup\u003e\u0026minus;\u003c/sup\u003e-N in rice. FC increased the relative expression levels of eight PM H\u003csup\u003e+\u003c/sup\u003e-ATPase isoforms, with the exception of \u003cem\u003eOsA6\u003c/em\u003e and \u003cem\u003eOsA10\u003c/em\u003e. Additionally, FC enhanced the interaction level between phosphorylated PM H\u003csup\u003e+\u003c/sup\u003e-ATPase and 14-3-3 protein, as well as PM H\u003csup\u003e+\u003c/sup\u003e-ATPase activity. This resulted in the provision of a substantial amount of H\u003csup\u003e+\u003c/sup\u003e and energy, thereby enhancing the absorption capacity of NO\u003csub\u003e3\u003c/sub\u003e\u003csup\u003e\u0026minus;\u003c/sup\u003e-N in rice. However, the activity of PM H\u003csup\u003e+\u003c/sup\u003e-ATPase was found to be reduced by AMP, which led to a decrease in the absorption of NO\u003csub\u003e3\u003c/sub\u003e\u003csup\u003e\u0026minus;\u003c/sup\u003e-N. This was due to a reduction in the relative expression of \u003cem\u003eOsA1\u003c/em\u003e and \u003cem\u003eOsA7\u003c/em\u003e in rice. In summary, the absorption of NO\u003csub\u003e3\u003c/sub\u003e\u003csup\u003e\u0026minus;\u003c/sup\u003e-N in rice is directly related to the activity of PM H\u003csup\u003e+\u003c/sup\u003e-ATPase, and \u003cem\u003eOsA1\u003c/em\u003e and \u003cem\u003eOsA7\u003c/em\u003e may be crucial regulators in the transmembrane transport of NO\u003csub\u003e3\u003c/sub\u003e\u003csup\u003e\u0026minus;\u003c/sup\u003e-N in rice under Al stress.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e \u003ch2\u003eConflict of interests\u003c/h2\u003e \u003cp\u003eThe authors declare that they have no conflict of interests.\u003c/p\u003e \u003c/p\u003e\u003ch2\u003eFunding\u003c/h2\u003e \u003cp\u003eThe work was supported by the National Natural Science Fund of China(No. 31560351 and 31960071); Universities Union Fund of Yunnan(No.202301BA070001-005); Yunnan Provincial College Students' Innovation and Entrepreneurship Training Program Project (S202211393051, S202411393048).\u003c/p\u003e\u003ch2\u003eAuthor contributions\u003c/h2\u003e \u003cp\u003eAll authors contributed to the study conception and design. XHZ conceived and drafted this project for research. ZYZ and YQD conducted and carried out the experiments necessary for the research, and YYL helped with some experiments and data analysis. XHZ and ZYZ drafted the manuscript. XLZ and KZL reviewed and revised the final version of the manuscript. All authors read and approved the final manuscript.\u003c/p\u003e\u003ch2\u003eAcknowledgements\u003c/h2\u003e \u003cp\u003eWe extend our gratitude to Professor Guangxi Tao for providing the seeds of Dianyou 35. We are grateful to all team members who contributed to the success of this work.\u003c/p\u003e\u003ch2\u003eData availability\u003c/h2\u003e \u003cp\u003eData will be made available on request.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eBasit F, Liu JX, An JY, Chen M, He C, Zhu XB, Li Z, Hu J, Guan YJ (2022) Seed priming with brassinosteroids alleviates aluminum toxicity in rice via improving antioxidant defense system and suppressing aluminum uptake. Environmental Science and Pollution Research, 29(7): 10183-10197. https://doi.org/10.1007/s11356-021-16209-y\u003c/li\u003e\n\u003cli\u003eBungau S, Behl T, Aleya L, Bourgeade P, Aloui-Soss\u0026eacute; B, Purza AL, Abid A, Samuel AD (2021) Expatiating the impact of anthropogenic aspects and climatic factors on long-term soil monitoring and management. Environmental Science and Pollution Research, 28(24): 30528-30550. https://doi.org/10.1007/s11356-021-14127-7\u003c/li\u003e\n\u003cli\u003eChen Q, Guo CL, Wang P, Chen XQ, Wu KH, Li KZ, Yu YX, Chen LM (2013) Up-regulation and interaction of the plasma membrane (H\u003csup\u003e+\u003c/sup\u003e)-ATPase and the 14-3-3 protein are involved in the regulation of citrate exudation from the broad bean (\u003cem\u003eVicia faba\u003c/em\u003e L.) under Al stress. Plant Physiology and Biochemistry, 70: 504-511. https://doi.org/10.1016/j.plaphy.2013.06.015\u003c/li\u003e\n\u003cli\u003ede Boer AH (2024) The Fusicoccin story revisited. Journal of Experimental Botany, 75(18): 5531-5546. https://doi.org/10.1093/jxb/erae300\u003c/li\u003e\n\u003cli\u003eDing M, Zhang M, Wang Z, Yu X, Kinoshita T, Zeng H, Zhu Y (2022) Overexpression of a plasma membrane H\u003csup\u003e+\u003c/sup\u003e-ATPase gene \u003cem\u003eO\u003c/em\u003e\u003cem\u003es\u003c/em\u003e\u003cem\u003eA1\u003c/em\u003e stimulates the uptake of pimary macronutrients in rice roots. International Journal of Molecular Sciences, 23(22): 13904. https://doi.org/10.3390/ijms232213904\u003c/li\u003e\n\u003cli\u003eElmore JM, Coaker G (2011) The role of the plasma membrane H\u003csup\u003e+\u003c/sup\u003e-ATPase in plant-microbe interactions. Molecular Plant, 4(3): 416-427. https://doi.org/10.1093/mp/ssq083\u003c/li\u003e\n\u003cli\u003eFiorillo A, Parmagnani AS, Visconti S, Mannino G, Camoni L, Maffei ME (2023) 14-3-3 proteins and the plasma membrane H\u003csup\u003e+\u003c/sup\u003e-ATPase are involved in maize (\u003cem\u003eZea mays\u003c/em\u003e) magnetic induction. Plants (Basel), 12(15): 2887. https://doi.org/10.3390/plants12152887\u003c/li\u003e\n\u003cli\u003eGuo CL, Chen Q, Zhao XL, Chen XQ, Zhao Y, Wang L, Li KZ, Yu YX Chen LM (2013) Al-enhanced expression and interaction of 14-3-3 protein and plasma membrane H\u003csup\u003e+\u003c/sup\u003e-ATPase is related to Al-induced citrate secretion in an Al-resistant black soybean. Plant Molecular Biology Reporter, 31(4): 1012-1024. https://doi.org/10.1007/s11105-013-0569-0\u003c/li\u003e\n\u003cli\u003eGuti\u0026eacute;rrez-N\u0026aacute;jera NA, Saucedo-Garc\u0026iacute;a M, Noyola-Mart\u0026iacute;nez L, V\u0026aacute;zquez-V\u0026aacute;zquez C, Palacios-Bahena S, Carmona-Salazar L, Plasencia J, El-Hafidi M, Gavilanes-Ruiz M (2020) Sphingolipid efffects on the plasma membrane produced by addition of fumonisin B1 to maize embryos. Plants(Basel), 9(2): 150. https://doi.org/10.3390/plants9020150\u003c/li\u003e\n\u003cli\u003eHuo K, Shangguan XC, Xia Y, Shen ZG, Chen C (2020) Excess copper inhibits the growth of rice seedlings by decreasing uptake of nitrate. Ecotoxicology and Environmental Safety, 190: 110105. https://doi.org/10.1016/j.ecoenv.2019.110105\u003c/li\u003e\n\u003cli\u003eJahn T, Fuglsang AT, Olsson A, Bruntrup IM, Collinge DB, Volkmann D, Sommarin M, Larsson PC (1997) The 14-3-3 protein interacts directly with the C-terminal region of the plant plasma membrane H\u003csup\u003e+\u003c/sup\u003e-ATPase. Plant Cell, 9(10): 1805-1814. https://doi.org/10.1105/tpc.9.10.1805\u003c/li\u003e\n\u003cli\u003eKabała K, Janicka M (2023) Structural and functional diversity of two ATP-triven plant proton pumps. International Journal of Molecular Sciences, 24(5): 4512. https://doi.org/ 10.3390/ijms24054512\u003c/li\u003e\n\u003cli\u003eLapshin NK, Piotrovskii MS, Trofimova MS (2021) Involvement of plasma membrane H\u003csup\u003e+\u003c/sup\u003e-ATPase in diamide-induced extracellular alkalization by roots from pea seedlings. Planta, 253(1): 10. https://doi.org/10.1007/s00425-020-03532-w\u003c/li\u003e\n\u003cli\u003eLi C, Xiao EZ, Bai Q, Xu F, Ji XY, Li CE, Wang Y Q (2022 a) Functional analysis of gene \u003cem\u003eOsCLF\u003c/em\u003e and its response to aluminum stress in rice(\u003cem\u003eOryza sativa\u003c/em\u003e). Journal of Agricultural Biotechnology, 30(5): 837-846. https://doi.org/10.3969/j.issn.1674-7968.2022.05.002\u003c/li\u003e\n\u003cli\u003eLi CX, Huang DJ, Wang CL, Wang N, Yao YD, Li WF, Liao WB (2020) NO is involved in H\u003csub\u003e2\u003c/sub\u003e-induced adventitious rooting in cucumber by regulating the expression and interaction of plasma membrane H\u003csup\u003e+\u003c/sup\u003e-ATPase and 14-3-3. Planta, 252(2): 9. https://doi.org/10.1007/s00425-020-03416-z\u003c/li\u003e\n\u003cli\u003eLi J, Guo Y, Yang YQ (2022 b) The molecular mechanism of plasma membrane H\u003csup\u003e+\u003c/sup\u003e-ATPases in plant responses to abiotic stress. Journal of Genetics and Genomics, 49(8): 715-725. https://doi.org/10.1016/j.jgg.2022.05.007\u003c/li\u003e\n\u003cli\u003eLi XW, Li YL, Mai JW, Tao L, Qu M, Liu JY, Shen RF, Xu GL, Feng YM, Xiao HD, Wu LH, Shi L, Guo SX, Liang J, Zhu YY, He YM, Balu\u0026scaron;ka F, Shabala S, Yu M (2018) Boron alleviates aluminum toxicity by promoting root alkalization in transition zone via polar auxin transport. Plant Physiology, 177(3): 1254-1266. https://doi.org/10.1104/pp.18.00188\u003c/li\u003e\n\u003cli\u003eLin CH, Zhang SR, Xiao Z, Liu CL, Lu LY, Wang J, Ding XD (2019) The absorption dynamic parameter of NO\u003csub\u003e3\u003c/sub\u003e\u003csup\u003e- \u003c/sup\u003ein flue-cured tobacco pretreated in different concentrations of KCl. Chinese Journal of Tropical Crops, 40(9): 1677-1684. https://doi.org/10.3969/j.issn.1000-2561.2019.09.002\u003c/li\u003e\n\u003cli\u003eLiu R R, Cui B, Lu X B, Song J. The positive effect of salinity on nitrate uptake in suaeda salsa. Plant Physiology and Biochemistry, 2021, 166(7): 958-963. https://doi.org/10.1016/j.plaphy.2021.07.010\u003c/li\u003e\n\u003cli\u003eLoss Sperandio MV, Santos LA, Bucher CA, Fernandes MS, de Souza SR (2011) Isoforms of plasma membrane H(\u003csup\u003e+\u003c/sup\u003e)-ATPase in rice root and shoot are differentially induced by starvation and resupply of NO\u003csub\u003e3\u003c/sub\u003e\u003csup\u003e-\u003c/sup\u003e or NH\u003csub\u003e4\u003c/sub\u003e\u003csup\u003e+\u003c/sup\u003e. Plant Science. 180(2): 251-258. https://doi.org/10.1016/j.plantsci.2010.08.018\u003c/li\u003e\n\u003cli\u003eLoss Sperandio MV, Santos LA, Huertas Tavares OC, Fernandes MS, de Freitas Lima M, de Souza SR (2020) Silencing the \u003cem\u003eOryza sativa\u003c/em\u003e plasma membrane H\u003csup\u003e+\u003c/sup\u003e-ATPase isoform \u003cem\u003eOsA2\u003c/em\u003e affects grain yield and shoot growth and decreases nitrogen concentration. Journal of Plant Physiology, 251: 153220. https://doi.org/10.1016/j.jplph.2020.153220\u003c/li\u003e\n\u003cli\u003eLu L, Chen XY, Tan QY, Li WQ, Sun YY, Zhang ZL, Song YY, Zeng RS (2024) Gibberellin-mediated sensitivity of rice roots to aluminum stress. Plants (Basel), 13(4): 543. https://doi.org/10.3390/plants13040543\u003c/li\u003e\n\u003cli\u003eMarra M, Camoni L, Visconti S, Fiorillo A, Evidente A (2021) The surprising story of fusicoccin: A wilt-inducing phytotoxin, a tool in plant physiology and a 14-3-3-targeted drug. Biomolecules, 11(9): 1393. https://doi.org/10.3390/biom11091393\u003c/li\u003e\n\u003cli\u003eNguyen TT, Sabat G, Sussman MR (2018) In vivo cross-linking supports a head-to-tail mechanism for regulation of the plant plasma membrane P-type H\u003csup\u003e+\u003c/sup\u003e-ATPase. Journal of Biological Chemistry, 293(44): 17095-17106. https://doi.org/10.1074/jbc.RA118.003528\u003c/li\u003e\n\u003cli\u003eOfoe R, Thomas RH, Asiedu SK, Wang-Pruski G, Fofana B, Abbey L (2023) Aluminum in plant: Benefits, toxicity and tolerance mechanisms. Frontiers in Plant Science, 13: 1085998. https://doi.org/10.3389/fpls.2022.1085998\u003c/li\u003e\n\u003cli\u003eSakhare, AS, Kumar, S, Ellur, RK, Prahalada GD, Kota S, Kumar RR, Ray S, Mandal BN (2025) Genome-wide association study on root traits under non-stress and osmotic stress conditions to improve drought tolerance in rice (\u003cem\u003eOryza sativa\u003c/em\u003e Lin.). Acta Physiologiae Plantarum, 47, 6. https://doi.org/10.1007/s11738-024-03752-7\u003c/li\u003e\n\u003cli\u003eShen H, He LF, Sasaki T, Yamamoto Y, Zheng SJ, Ligaba A, Yan XL, Ahn SJ, Yamaguchi M, Sasakawa H, Matsumoto H (2005) Citrate secretion coupled with the modulation of soybean root tip under aluminum stress. Upregulation of transcription, translation, and threonine-oriented phosphorylation of plasma membrane H\u003csup\u003e+\u003c/sup\u003e-ATPase. Plant Physiology, 138(1): 287-296. https://doi.org/10.1104/pp.104.058065\u003c/li\u003e\n\u003cli\u003eWang JB, Su C, Cui ZB, Huang LX, Gu S, Jiang SX, Feng J, Xu H, Zhang WZ, Jiang LL, Zhao MH (2023) Transcriptomics and metabolomics reveal tolerance new mechanism of rice roots to Al stress. Frontiers in Genetics, 13: 1063984. https://doi.org/10.3389/fgene.2022.1063984\u003c/li\u003e\n\u003cli\u003eWang K, Xu FY, Yuan W, Zhang DP, Liu JP, Sun LY, Cui LY, Zhang JH, Xu WF (2021) Rice G protein \u0026gamma; subunit qPE9-1 modulates root elongation for phosphorus uptake by involving 14-3-3 protein OsGF14 band plasma membrane H\u003csup\u003e+\u003c/sup\u003e-ATPase. The Plant Journal, 107(6): 1603-1615. https://doi.org/10.1111/tpj.15402\u003c/li\u003e\n\u003cli\u003eWeng LY, Zhang M., Wang K, Chen GL, Ding M, Yuan W, Zhu YY, Xu WF, Xu FY (2020) Potassium alleviates ammonium toxicity in rice by reducing its uptake through activation of plasma membrane H\u003csup\u003e+\u003c/sup\u003e-ATPase to enhance proton extrusion. Plant Physiology and Biochemistry, 151: 429-437. https://doi.org/10.1016/j.plaphy.2020.03.040\u003c/li\u003e\n\u003cli\u003eXia LF, Marqu\u0026egrave;s-Bueno MM, Bruce CG, Karnik R (2019) Unusual roles of secretory SNARE SYP132 in plasma membrane H\u003csup\u003e+\u003c/sup\u003e-ATPase traffic and vegetative plant growth. Plant Physiology, 180(2): 837-858. https://doi.org/10.1104/pp.19.00266\u003c/li\u003e\n\u003cli\u003eXiao X, Liu ZT, Shen RF, Zhao XQ (2023) Nitrate has a stronger rhizobacterial-based efect on rice growth and nitrogen use than ammonium in acidic paddy soil. Plant and Soil, 487: 605-621. https://doi.org/10.1007/s11104-023-05957-0\u003c/li\u003e\n\u003cli\u003eYan F, Zhu YY, Muller C, Zorb C, Schubert S (2002) Adaption of H\u003csup\u003e+\u003c/sup\u003e-pumping and plasma membrane H\u003csup\u003e+\u003c/sup\u003e-ATPase activity in proteoid roots of white lupin under phosphate deficiency. Plant Physiology, 129(1): 50-63. https://doi.org/10.1104/pp.010869\u003c/li\u003e\n\u003cli\u003eYang D, Chen DJ, Wang P, Jiang DH, Xu HN, Pang XL, Chen LM, Yu YX, Li KZ (2017) Aluminium-inhibited NO\u003csub\u003e3\u003c/sub\u003e\u003csup\u003e- \u003c/sup\u003euptake is related to Al-increased H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e content and Al-decreased plasma membrane ATPase activity in the root tips of Al-sensitive black soybean. Functional Plant Biology, 44(2): 198-207. https://doi.org/10.1071/FP15289\u003c/li\u003e\n\u003cli\u003eYi J, Guo CL, Wu KH, Wang L, Zhao XL, Li KZ, Chen LM (2014) Effects of fusicoccin on aluminum tolerance in Al-sensitive black soybean. Soybean Science, 33(3): 389-392. https://doi.org/10.11861 /j.issn.1000-9841.2014.03.0389\u003c/li\u003e\n\u003cli\u003eYing H, Qin A, Cheng TS, Pavlos NJ, Rea S, Dai K, Zheng MH (2015) Disulfiram attenuates osteoclast differentiation in vitro: a potential antiresorptive agent. PLoS One, 10(4): e0125696. https://doi.org/10.1371/journal.pone.0125696\u003c/li\u003e\n\u003cli\u003eZhang BJ, Bu JJ, Liang CJ (2017) Regulation of nitrogen and phosphorus absorption by plasma membrane H\u003csup\u003e+\u003c/sup\u003e-ATPase in rice roots under simulated acid rain. International Journal of Environmental Science and Technology, 14(1): 101-112. https://doi.org/10.1007/s13762-016-1125-x\u003c/li\u003e\n\u003cli\u003eZhang F, Yuan AP, Nie ZY, Chu ML, An YL (2024) Identification of the potato (\u003cem\u003eSolanum tuberosum\u003c/em\u003e L.) P-type ATPase gene family and investigating the role of PHA2 in response to Pep13. Frontiers in Plant Science, 15: 1353024. https://doi.org/10.3389/fpls.2024.1353024\u003c/li\u003e\n\u003cli\u003eZhang MX, Wang Y, Chen X, Xu FY, Ding M, Ye WX, Kawai YY, Toda Y, Hayashi YK, Suzuki T, Zeng HQ, Xiao L, Xiao X, Xu J, Guo SW, Yan F, Shen QR, Xu GH, Kinoshita T, Zhu YY (2021) Plasma membrane H\u003csup\u003e+\u003c/sup\u003e-ATPase overexpression increases rice yield via simultaneous enhancement of nutrient uptake and photosynthesis. Nature Communications, 12(1): 735. https://doi.org/10.1038/s41467-021-20964-4\u003c/li\u003e\n\u003cli\u003eZhang RP, Liu G, Wu N, Gu M, Zeng HQ, Zhu YY, Xu GH (2011) Adaptation of plasma membrane H\u003csup\u003e+\u003c/sup\u003e-ATPase and H\u003csup\u003e+\u003c/sup\u003e-pump to P deficiency in rice roots. Plant and Soil, 349: 3-11. https://doi.org/10.1007/s11104-011-0774-2\u003c/li\u003e\n\u003cli\u003eZhao X, Li F, Li K (2021) The 14-3-3 proteins: regulators of plant metabolism and stress responses. Plant Biology, 23(4): 531-539. https://doi.org/10.1111/plb.13268\u003c/li\u003e\n\u003cli\u003eZhao XQ, Shen RF (2018) Aluminum-nitrogen interactions in the soil-plant system. Frontiers in Plant Science, 9: 807. https://doi.org/10.3389/fpls.2018.00807\u003c/li\u003e\n\u003cli\u003eZhou SJ, Zhang M, Wang P (2021) Response of plant plasma membrane H\u003csup\u003e+\u003c/sup\u003e-ATPase to environmental stress factors: a review. Chinese Journal of Applied and Environmental Biology, 27(2): 485-494. https://doi.org/10.19675/j.cnki.1006-687x.2020.02022\u003c/li\u003e\n\u003cli\u003eZhou XH, Gu ZH, Xu HN, Tao GX, Yu YX, Li KZ (2016) The effects of exogenous ascorbic acid on the mechanism of physiological and biochemical responses to nitrate uptake in two rice cultivars (\u003cem\u003eoryza sativa\u003c/em\u003e L.) under aluminum stress. Journal of\u0026ensp;Plant Growth\u0026ensp;Regulation, 35(4): 1013-1024. https://doi.org/10.1007/s00344-016-9599-9\u003c/li\u003e\n\u003cli\u003eZhou XH, Li KZ, Zhao Z, Zhang XL, Cheng X, Feng Q (2021) Effects of exogenous ascorbic acid on physiological Indexes in rice under aluminum stress. Chinese Journal of Tropical Crops, 42(3): 769-776. https://doi.org/10.3969/j.issn.1000-2561.2021.03.023\u003c/li\u003e\n\u003cli\u003eZhou XH, Zhou ZY, Li KZ (2020) Effects of exogenous ascorbic acid on antioxidant function of rice seedling under aluminum stress. Journal of Nuclear Agricultural Sciences, 34(10): 2368-2375. https://doi.org/10.11869 /j.issn.100-8551.2020.10.2368\u003c/li\u003e\n\u003cli\u003eZhu YY, Di TJ, Xu GH, Chen X, Zeng HQ, Yan F, Shen QR (2009) A daptation of plasma membrane H\u003csup\u003e+\u003c/sup\u003e-ATPase of rice roots to low pH as related to ammonium nutrition. Plant Cell and Environment, 32(10): 1428-1440. https://doi.org/10.1111/j.1365-3040.2009.02009.x\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Aluminum stress, Nitrate, Plasma membrane H+-ATPase, 14-3-3 protein, Gene expressions, Rice (Oryza sativa L.)","lastPublishedDoi":"10.21203/rs.3.rs-6517400/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-6517400/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eThe aim of the experiments was to investigate the effects of the plasma membrane (PM) H\u003csup\u003e+\u003c/sup\u003e-ATPase on the nitrate (NO\u003csub\u003e3\u003c/sub\u003e\u003csup\u003e\u0026minus;\u003c/sup\u003e-N) uptake of rice under aluminum (Al) stress. The hydroponic experiment was designed to study the activities of PM H\u003csup\u003e+\u003c/sup\u003e-ATPase and H\u003csup\u003e+\u003c/sup\u003e-pump, the level of interaction of PM H\u003csup\u003e+\u003c/sup\u003e-ATPase and 14-3-3 protein, H\u003csup\u003e+\u003c/sup\u003e efflux, and the expression levels of PM H\u003csup\u003e+\u003c/sup\u003e-ATPase gene (\u003cem\u003eOsA1\u003c/em\u003e-\u003cem\u003eOsA10\u003c/em\u003e). The effects of both the activator fusicoccin (FC) and inhibitor adenosine-5\u0026rsquo;-monophosphate (AMP) of PM H\u003csup\u003e+\u003c/sup\u003e-ATPase on the uptake of NO\u003csub\u003e3\u003c/sub\u003e\u003csup\u003e\u0026minus;\u003c/sup\u003e-N in rice have been designed with the hybrid Dianyou 35 rice as the subject. The results showed that Al stress decreased NO\u003csub\u003e3\u003c/sub\u003e\u003csup\u003e\u0026minus;\u003c/sup\u003e-N uptake by declining the gene expressions of PM H\u003csup\u003e+\u003c/sup\u003e-ATPase except for \u003cem\u003eOsA6\u003c/em\u003e and \u003cem\u003eOsA10\u003c/em\u003e, as well as the activity of PM H\u003csup\u003e+\u003c/sup\u003e-ATPase, H\u003csup\u003e+\u003c/sup\u003e-pump activity, and H\u003csup\u003e+\u003c/sup\u003e efflux. FC improved NO\u003csub\u003e3\u003c/sub\u003e\u003csup\u003e\u0026minus;\u003c/sup\u003e-N uptake by increasing the gene expressions of PM H\u003csup\u003e+\u003c/sup\u003e-ATPase, with the exception of for \u003cem\u003eOsA6\u003c/em\u003e and \u003cem\u003eOsA10\u003c/em\u003e. It also enhanced the activities of PM H\u003csup\u003e+\u003c/sup\u003e-ATPase, H\u003csup\u003e+\u003c/sup\u003e-pump and H\u003csup\u003e+\u003c/sup\u003e efflux as well as the interaction of the PM H\u003csup\u003e+\u003c/sup\u003e-ATPase with 14-3-3 protein. In contrast, AMP showed opposing trends, reducing NO\u003csub\u003e3\u003c/sub\u003e\u003csup\u003e\u0026minus;\u003c/sup\u003e-N uptake by diminishing the gene expression of \u003cem\u003eOsA1\u003c/em\u003e and \u003cem\u003eOsA7.\u003c/em\u003e These results indicated that PM H\u003csup\u003e+\u003c/sup\u003e-ATPase plays an important regulatory role by regulating the expressions of \u003cem\u003eOsA1\u003c/em\u003e and \u003cem\u003eOsA7\u003c/em\u003e in the transmembrane transport process of NO\u003csub\u003e3\u003c/sub\u003e\u003csup\u003e\u0026minus;\u003c/sup\u003e-N in rice under Al stress. This study could provide a theoretical basis for enhancing the ability of rice to absorb NO\u003csub\u003e3\u003c/sub\u003e\u003csup\u003e\u0026minus;\u003c/sup\u003e-N under acidic Al conditions, thereby promoting their growth.\u003c/p\u003e","manuscriptTitle":"Effect of plasma membrane H+-ATPase on nitrate uptake in rice under aluminum stress","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-05-05 09:48:43","doi":"10.21203/rs.3.rs-6517400/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"6104fce8-c8b9-44c7-86c7-cb92e419402e","owner":[],"postedDate":"May 5th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2025-05-22T14:17:17+00:00","versionOfRecord":[],"versionCreatedAt":"2025-05-05 09:48:43","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-6517400","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-6517400","identity":"rs-6517400","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.