Comparative Network Analysis under ABA and Chitosan Treatments: Unveiling Key Transcriptional Regulators of Valerenic Acid Biosynthesis in Valerian Hairy Roots

Comparative Network Analysis under ABA and Chitosan Treatments: Unveiling Key Transcriptional Regulators of Valerenic Acid Biosynthesis in Valerian Hairy Roots | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Comparative Network Analysis under ABA and Chitosan Treatments: Unveiling Key Transcriptional Regulators of Valerenic Acid Biosynthesis in Valerian Hairy Roots Arash Mokhtari, Pejman Azadi, Morteza Ebrahimi, Ahmad Sobhani, and 4 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-5417801/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 17 Feb, 2025 Read the published version in Plant Cell, Tissue and Organ Culture (PCTOC) → Version 1 posted 4 You are reading this latest preprint version Abstract Valerenic acid is a sesquiterpene compound found in Valeriana officinalis (valerian) and has gained attention for its potential as a natural remedy for anxiety, insomnia, and stress-related disorders due to its calming and sedative properties. The low compound content and slow plant growth have limited its production, so a biotechnological approach such as hairy root culture is needed to scale up valerenic acid without using natural resources. This study aims to elucidate the structural and dynamic features of the gene and transcription factor network underlying valerenic acid production in the hairy root cultures of valerian under ABA and chitosan elicitation. ABA treatment induced significant changes in the expression of BHLH and ERBP transcription factors. Their relative expression levels peaked on the second day. Among the genes encoding terpene synthase enzymes, TPS5 shows the strongest induction. When induced with chitosan, the transcription factors BHLH and ERBP play a critical role in enhancing valerenic acid accumulation by upregulating the expression of HMGR, TPS2, and TPS5. In addition, WRKY, ERBP, and MYB transcription factors act as critical regulators in the activation of terpene synthases. Chitosan treatment leads to the highest valerenic acid level (0.68 mg/g DW) on day 2. In comparison, ABA triggers the highest valerenic acid level (0.65 mg/g DW) on day 4. Our results have significant implications for the development of efficient and sustainable strategies for the large-scale production of valerenic acid, a valuable compound widely used in the pharmaceutical industry. Abiotic stress Coexpression network Sesquiterpene synthases transcription factor Valeriana officinalis Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Key message Our research employed comparative network analysis to elucidate the effects of abscisic acid (ABA) and chitosan treatments on the gene and transcription factor network associated with valerenic acid production in V. officinalis hairy roots. Introduction Over 50,000 terpenes have been identified, primarily from plants, which are derived from C 5 isoprene units (C 5 H 8 ) and are basic molecular building blocks (Chen & Zhang, 2024 ). Sesquiterpenes (C 15 ) are the most extensive category of terpenes and play a crucial role in the flavor and fragrance sector and exhibit various pharmacological properties, such as anticancer, antibacterial, and anti-inflammatory effects (Coca-Ruíz et al., 2022 ). In addition, sesquiterpenes offer significant research and commercial prospects as advanced biofuels or biofuel precursors (Walls & Rios-Solis, 2020 ). Sesquiterpenes are typically obtained by extraction from plants or chemical synthesis. Extraction from plants is limited by low compound content and slow plant growth, which can affect commercial viability. Although chemical synthesis is a viable approach, its implementation is hampered by high cost, toxicity concerns, and the complicated process of separating chiral isoforms of sesquiterpenes (Mai et al., 2021 ). Valerenic acid (C 15 H 22 O 2 ) is a sesquiterpene compound in Valeriana officinalis , commonly known as valerian. It possesses pharmacological properties, including its potential as a natural remedy for anxiety, insomnia, and stress-related disorders due to its calming and sedative effects (Mokhtari et al., 2024 ). The overall biosynthetic pathway for valerenic acid involves the synthesis of farnesyl pyrophosphate (FPS) as a precursor, followed by the conversion of FPS to valerena-4,7(11)-diene by valerena-4,7(11)-diene synthase (VDS). Valerena-4,7(11)-diene is then oxidized to valerenic acid by cytochrome P450 monooxygenase (Zhao et al., 2022 ). Efforts to optimize the biosynthetic pathway of valerenic acid have made progress, but challenges remain in understanding the critical genes involved in its biosynthetic pathway. Further research is needed to unravel the complexity of the pathway and identify additional enzymatic reactions and regulatory mechanisms that control its metabolic efficiency. Co-expression analysis can play an essential role in identifying correlations between genes and transcription factors involved in sesquiterpenoid biosynthesis, thus helping to discover new regulatory elements that affect valerenic acid production (Wong, 2017 ). integrating co-expression studies with pathway optimization efforts can provide valuable insights into the genetic factors that influence valerenic acid biosynthesis. This pioneering study investigates the co-expression correlations between genes and transcription factors essential for valerenic acid biosynthesis in hairy roots of V. officinalis when exposed to abscisic acid (ABA) and chitosan elicitors. Our results are expected to provide new insights into the regulatory mechanisms of this complex biosynthetic pathway. Material ans methods 2.1 Hairy root induction The ATCC15834 strain of Rhizobium rhizogenes was used to induce hairy roots on leaf explants of valerian. The bacteria were grown and maintained on a solid Luria-Bertani (LB) medium supplemented with rifampin (50 mg/mL) at 28°C. Single colonies were inoculated into liquid LB medium and grown overnight by shaking at 140 rpm. Bacteria were collected by centrifugation, resuspended in a liquid MS medium, and adjusted to an optical density of 0.8. Leaf explants from four-week-old in vitro -grown seedlings of V. officinalis were immersed in the R. rhizogenes suspension for 10 minutes. They then blotted dry on sterile filter paper to remove excess bacteria. The infected explants were cocultured in the dark at 25°C for three days on MS solid medium supplemented with sucrose (30 g/l), agar (8 g/l), and acetosyringone (20 mg/l). Following co-cultivation, the explants were transferred to a hormone-free MS medium containing cefotaxime (300 mg/l) to inhibit bacterial growth. Hairy roots emerged from the wound sites within 7–10 days. After four weeks, individual hairy roots were isolated and subcultured every three weeks on fresh hormone-free MS medium with a gradual reduction of cefotaxime. The transformation was confirmed through the detection of the VirD and rolB genes using PCR. 2.2 Gene selection and primer design To obtain reliable transcriptome data essential for subsequent gene selection and primer design, we performed a de novo assembly using the Short Read Archive (SRA) datasets of V. officinalis . 2.2.1 de novo transcriptome assembly Briefly, the raw RNA-Seq reads of V. officinalis (accession numbers SRR125357, SRR125358, SRR125359, SRR343119, and SRR14294419) were downloaded from the European Nucleotide Archive ( https://www.ebi.ac.uk/ena/browser/home ). The quality of the raw reads was assessed using FastQC. Low-quality bases and adapter sequences were trimmed using Trimmomatic. Only high-quality reads were retained for downstream analysis. Trinity v2.9 was used for de novo assembly of the cleaned RNA-Seq reads (Mokhtari et al., 2023 ). 2.2.2 Gene and Transcription Factor Selection The transcripts of the assembled transcriptome were annotated using TransDecoder to predict open reading frames. The predicted protein sequences were submitted to KEGG's GhostKOALA for KEGG Orthology (KO) assignment and pathway mapping. Genes encoding key enzymes in the terpenoid backbone biosynthesis pathway (map00900) were selected based on KO annotations and pathway information in KEGG. The study used the String database to identify potential transcription factors interacting with the selected genes encoding metabolic enzymes. The amino acid sequences of the selected genes were compared blasted against the assembled transcriptome using tBlastn with an e-value of 10 − 6 to identify corresponding contigs within the assembled transcriptome. Additional genes involved in sesquiterpenoid biosynthesis were selected based on an extensive literature review (Table 1 ). Table 1 Characterization of genes encoding enzymes and transcription factors involved in the terpenoid biosynthetic pathway in V.officinalis. Entry Protein names Organism Enzymes 1 A0A178V5I0 1-deoxy-D-xylulose-5-phosphate synthase (DXS) (EC:2.2.1.7) Arabidopsis thaliana 2 Q9XFS9 1-deoxy-D-xylulose 5-phosphate reductoisomerase (DXR) (EC 1.1.1.267) Arabidopsis thaliana 3 P14891 3-hydroxy-3-methylglutaryl-coenzyme A reductase 1 (HMGR) (EC 1.1.1.34) Arabidopsis thaliana 4 O22043 Geranylgeranyl pyrophosphate synthase (GGPS) (EC 2.5.1.-) Arabidopsis thaliana 5 Q43315 Farnesyl pyrophosphate synthase (FPP synthase 2) (EC 2.5.1.10) Arabidopsis thaliana 6 U3KYL2 (-)-drimenol synthase (VoTPS3) Valeriana officinalis 7 J9R5V4 Valerena-4,7(11)-diene synthase (EC 4.2.3.139) (VoTPS2) Valeriana officinalis 8 JX494703 Sesquiterpene synthase 5 Valeriana officinalis Transcription Factors 9 A0A2R4RN66 BHLH4 Phalaenopsis bellina 10 G3CU72 Ethylene-responsive element binding protein 1 Hevea brasiliensis 11 K4D336 R2R3 MYB transcription factor Solanum lycopersicum 12 Q39204 Transcription factor MYC2 Arabidopsis thaliana 13 A0A060KY90 Transcription factor MYC1 Solanum lycopersicum 14 Q6R8H1 Transcription factor WRKY1 Gossypium arboreum 2.3. Primer Design The coding sequences of the selected enzyme and transcription factor coding genes were extracted from the V. officinalis assembly. Primer3, a primer design software, was utilized to design ten pairs of gene-specific primers. These primers target reverse transcription quantitative PCR (RT-qPCR) products in the range of 90–150 base pairs (bp). The primer optimization tool, OligoAnalyzer, was used to select primers with optimal melting temperatures, GC content, and lowest predicted secondary structure formation and primer dimer probability. The ePCR tool in TBTools was used to verify primer pair specificity by in silico amplification of single target sequences from the V. officinalis transcriptome. The primers listed in Table 2 were commercially synthesized. To confirm the amplification of single products after 40 cycles, polymerase chain reaction (PCR) amplification and agarose gel electrophoresis were performed. Table 2 Sequence of specific primers for amplification of genes and transcription factors. Enzymatic Genes 1-deoxy-D-xylulose-5-phosphate synthase (DXS) ACTATTTCGGCTCGTAGTTCTG CCACCAACTCCTCTGTTAGATAC 1-deoxy-D-xylulose 5-phosphate reductoisomerase (DXR) GGATGATAGACTGAGGGTGGATAA CCAAACTGGAGCATGGGTAAA 3-hydroxy-3-methylglutaryl-coenzyme A reductase 1 (HMGR) GTACTATGCCTTCATACTCCC CTGCCCTAGAATAGACTCGT Geranylgeranyl pyrophosphate synthase (GGPS) TTCCACCTCCCAGAATAGCG ATAGCTTCCACCGGAGTGTC Farnesyl pyrophosphate synthase (FPP synthase 2) TCATTTGCCCAGATGCTGTCT TGCTGTAAACGACGGTGTGT (-)-drimenol synthase (VoTPS3) ACCGATTGACACTACCGCAT AGCTATCGCCAAGTGCTACG Valerena-4,7(11)-diene synthase (EC 4.2.3.139) (VoTPS2) GCATACTCAACCCGGTAGGA TTCACCGATGCAGTCAAAAG Sesquiterpene synthase 5 TACCCATTTAAAGGCGTCCTC ATGATAAAAGTAATGTGCCGAA Transcription Factors BHLH4 TCCTACCTCTATGCCCAGCC GTAACAATCCCGGTCTACGC Ethylene-responsive element binding protein 1 GTAGGCTTTAGCGGCTTCCT AGAGGTGCATTACAGAGGCG R2R3 MYB transcription factor TCACTCCACATGAAGAAGGCA ATCGGTTCGTTGAGGAAGGT Transcription factor MYC1 TCACATCTATTTCCACATCAACAAG GACAAGGACGAGCTGAATCATA Transcription factor MYC2 CTGCCCTGGAAGACCATCTC TTTCCGGTACTCAAGCCTCG Transcription factor WRKY1 CTGTTATCGGATGATTCGGTCTT TCGGAGACTAGTTCTAGTGATGAA 2.3 Experimental design and elicitor treatments Hairy roots with a fresh weight of 5 mg were cultured in 8 cm Petri dishes, each filled with 15 mL of half-strength MS liquid medium. These cultures were placed on an orbital shaker set at 120 rpm and incubated in the dark at 20°C for 21 days. After incubation, the spent medium was aspirated from the Petri dishes and discarded. A fresh culture medium was then prepared, to which abscisic acid (ABA) and chitosan were added to achieve final concentrations of 50 µM and 200 mg/l, respectively. Then, 15 mL of this freshly prepared culture medium was added to each Petri dish. Cultures not exposed to ABA or chitosan served as controls. The cultures were then divided into three sets based on a time series of 1, 2, and 4 days of treatment, with each set consisting of three replicates. These sets were then placed on an orbital shaker in growth chambers and maintained under dark conditions at 20°C. 2.4 RNA extraction Root tissues (600 mg) were collected from hairy roots at 1, 2, and 4 days post-elicitation and immediately frozen in liquid nitrogen. Total RNA was extracted using a homemade TRIzol-based buffer (Valach, 2016 ) containing phenol, guanidinium isothiocyanate, ammonium thiocyanate, and sodium acetate. The RNA extraction process was performed as follows: 600 µL of homemade TRIzol buffer was added to the frozen and powdered tissues of the 15-mL falcons. Samples were inverted and incubated at room temperature for 5 minutes to ensure thorough mixing. For each milliliter of TRIzol, 350 µL of chloroform: isoamyl alcohol (24:1) was added. After thorough mixing for 15 seconds (45° inverted), samples were incubated for 3 minutes at room temperature. The samples were centrifuged at 12000g for 10 minutes. The supernatant was transferred to a new sterile 15- mL Falcon tube, and 0.1 volume of 3 M sodium acetate (pH 5.2) was added. This was followed by thorough mixing and several gentle inverting steps. After adding an equal volume of isopropyl alcohol and thoroughly mixing with several inverting steps, the samples were incubated at room temperature for 15 minutes. The samples were centrifuged at 12000g for 10 minutes, and the supernatant was removed. To the resulting sediment, 1 mL of 75% ethanol was added per 1 mL of TRIzol, the sediment was immersed in ethanol, gently inverted, and the samples were centrifuged at 12000g for 5 minutes. Repeat the previous step with 70% ethanol. The alcohol was removed and 100 µL of 70% ethanol was added to dissolve the precipitate. The above solution was transferred to a sterile 1.5 mL tube and centrifuged at 12000 g for 5 minutes. The supernatant was drained, and the sediment was allowed to dry in laminar flow. 1 µL DNase I, 10 µL DNase I buffer (10x), 89 µL RNase water were added. Tubes were incubated at 37°C for 30 minutes. 1 mL of TRIzol was added. Steps 2–8 were repeated. The alcohol was removed, and the precipitate was allowed to dry in a laminar flow. The RNA pellet was gently solubilized in 50 µL RNase-free water. Samples were stored at -20°C until cDNA synthesis. RNA quality and quantity were evaluated using agarose gel electrophoresis and nanodrop spectrophotometry. Only samples with A260/A280 ratios of 1.8–2.1 and A260/A230 ratios greater than 2.0 were used for cDNA synthesis and downstream applications. The extracted RNA was stored at -80°C until further use. 2.5 cDNA Synthesis and qRT-PCR Analysis First-strand cDNA was synthesized from 2 µg of total RNA using the Pars Toos cDNA synthesis kit and oligo(dT)16 primers, following the manufacturer's instructions. The reaction mixture was incubated at 25°C for 10 minutes, followed by 47°C for 60 minutes, and then at 85°C for 5 minutes. The resulting cDNA was cooled on ice and stored at -20°C for qRT-PCR reaction. The LightCycler 96™ Real-Time PCR System (Roche, Switzerland) was used to perform quantitative real-time polymerase chain reaction (qRT-PCR). Reaction mixtures consisted of 2.5 µL of diluted cDNA, 5 µL of 2x SYBR Green Real-Time PCR Master Mix (Pars Toos™), and 1.25 µL of each primer at a concentration of 10 µM. The qRT-PCR protocol consisted of an initial denaturation phase at 95°C for 30 seconds, followed by 40 cycles of denaturation at 95°C for 5 seconds and annealing at 60°C for 30 seconds. To verify the specificity of the amplification process, a melting curve analysis was performed from 65°C to 95°C. The relative expression levels of the genes were calculated using the 2 −ΔΔCt method with EF-1 as the internal reference gene. Each reaction was performed in triplicate to ensure technical accuracy. 2.6. Analysis of gene expression data The gene expression data underwent analysis of variance (ANOVA) to detect statistically significant differences with a threshold p-value of ≤ 0.05. The Anova function of the 'EnvStats' package was used for this purpose. Subsequently, Tukey's multiple comparison tests were performed for each gene using the 'emmeans' and 'multcomp' packages. Graphs of relative fold changes were generated using the 'ggplot2' package. The statistical analyses were conducted using R software version 4.3.1 (R Core Team, 2020) and RStudio version 2023.12.1 Build 402. 6. Extraction of valerenic acid and HPLC analysis Valerenic acid was extracted and quantified by HPLC according to the methodology described in our previous work (Mokhtari et al., 2024 ). Finely ground dry roots (100 mg) were mixed with 1 mL of 94.88% methanol solvent. The samples were then ultrasonicated in a BANDELIN SONEREX, RK-100H system at 25˚C for 48.95 minutes, operating at 320 W and 35 KHz. After sonication, the samples were vigorously mixed for 30 minutes at 25˚C and 350 rpm. Subsequently, the mixed samples were centrifuged at 8000g for 10 minutes, and the supernatant was collected in 2 mL tubes. This mixing and centrifugation process were repeated twice. Finally, the samples were adjusted to a final volume of 1.5 mL and stored in a freezer at -20 ˚C before phytochemical analysis. The HPLC system consisted of a SYKAM S 9100 pump, SYKAM S 5300 autosampler, S 3210 UV/Vis detector, and Clarity software. A 100 µL aliquot of each sample was injected onto a Eurospher II 100-5 column at 60°C. The mobile phase consisted of a gradient system of (A) 0.1% trifluoroacetic acid in water and (B) acetonitrile. The gradient began at 5% B and was maintained for 5 minutes. It then increased to 95% B over 20 minutes and was held at that level for 15 minutes before returning to 5% B for 1 minute. The flow rate was kept constant at 0.4 mL/min. A calibration curve was generated using a valerenic acid standard for sample quantification. Resultes 1. Relative fold change of TF-encoding genes under ABA treatment Figure 1 displays the time course analysis of the relative fold change (RFC) for various transcription factor families following treatment with 50 µM ABA for 1, 2, and 4 days. The BHLH and ERBP transcription factors showed the most significant response to ABA, with their RFCs peaking at day 2, showing a 4.61-fold and 4.89-fold increase, respectively, compared to the untreated control. The transcription factors MYB and WRKY showed a slight increase. Specifically, MYB showed a 1.23-fold increase on the first day, while WRKY showed a 1.2-fold increase on the second day, compared to the control. In contrast, MYCA/S transcription factors consistently decreased throughout the experimental period in response to ABA treatment. 2. Relative fold change of enzyme-encoding genes under ABA treatment Transcriptomic analysis revealed significant changes in the RFCs of enzyme-encoding genes involved in sesquiterpene biosynthesis after ABA treatment (Fig. 2 ). Except the DXS gene, all other genes showed an increase in RFCs on at least one day compared to the untreated control group. TPS5, among the genes encoding terpene synthase enzymes, showed the most significant induction, with a peak RFC of 6.76 observed on the second day post-treatment. Similarly, on day 2, the RFC of TPS2 increased by 5.69-fold. Furthermore, genes encoding crucial regulatory enzymes in the mevalonate pathway, namely HMGR and FPS, also exhibited elevated RFCs. This observation suggests a coordinated response to ABA treatment. 3. Relative fold change of TF-encoding genes under chitosan treatment Using chitosan at a concentration of 200 mg/l resulted in significant changes in the expression profiles of transcription factors, as depicted in Fig. 3 . All transcription factors showed increased RFCs compared to the untreated control. The WRKY transcription factor exhibited the most significant induction, with peak increases of 10.28-fold and 9.53-fold observed on days 2 and 4, respectively. ERBP was closely followed with a maximum RFC of 3.69 on day 4. Two different groups showed different expression patterns. ERBP, MYCA, and MYCS were continuously upregulated over the 4-day treatment period, whereas BHLH, MYB, and WRKY showed a transient increase in expression followed by a decrease by day 4. 4. Relative fold change of TF-encoding genes under chitosan treatment Analysis of RFC for genes encoding enzymes involved in the terpenoid biosynthetic pathway revealed distinct regulatory patterns after chitosan treatment (Fig. 4 ). Notably, TPS2 and TPS3 exhibited the highest RFCs, peaking at 9.29 and 6.77 on days 4 and 2, respectively. Notably, a decrease in TPS2 expression was observed on day 2, with a concomitant increase in TPS3. The RFC of the FPS showed an upward trend (reaching a maximum value of 5), while TPS5 showed a bell-shaped pattern. The enzymes DXR, GGPS and HMGR showed decreased expression on all days. In contrast to ABA treatment, the DXS gene, which encodes the rate-limiting enzyme, showed increased expression under chitosan treatment, reaching 1.61-fold of the control on day 2. 5. The effect of ABA and chitosan on the content of valerenic acid Concurrently with the transcriptome analyses, we determined the valerenic acid content as mg/g of dry weight of hairy root (mg/g DW) after 1, 2, and 4 days of ABA and chitosan treatments. An untreated sample served as a control each day (Fig. 5 ). The results indicate that chitosan treatment had the highest valerenic acid level (0.68 mg/g DW) on the second day and maintained this level until the fourth day. In contrast, the ABA treatment did not show a significant difference in valerenic acid content between the first and second days. However, it peaked at 0.65 mg/g DW on the fourth day. By the fourth day, the ABA treatment was equal to the chitosan treatment in valerenic acid content. The two treatments were statistically indistinguishable on day four and showed a 1.59-fold increase compared to the control group. Both treatments resulted in a significant increase in valerenic acid levels compared to the control group. 6. Analysis of co-expression networks Cytoscape software was used to construct a co-expression network to explore the positive correlations between RFCs of enzymes, transcription factors (transcriptomics), and valerenic acid profile (metabolomics) following ABA and chitosan treatments. Figure 6 illustrates the co-expression network of genes encoding enzymes and transcription factors associated with valerenic acid levels following ABA treatment. Notably, two separate subnetworks (1 and 2) can be identified, with focal points around the WRKY transcription factor and the GGPS enzyme. Subnetwork 2 contains a group of transcription factors (BHLH, ERBP) and critical enzymes (HMGR, DXR) as well as the FPS and terpene synthases TPS2 and TPS5. Two primary modules BHLH - TPS2 - ERBP and DXR - TPS2 - TPS5 (shown as green egg-shaped structures) converge on TPS2, which s is a central hub. Activation of HMGR, TPS2, and TPS5 by the transcription factors BHLH and ERBP is critical for enhancing valerenic acid accumulation. Furthermore, the significant correlation between HMGR and FPS suggests an increase in metabolic flux and activation of farnesyl diphosphate synthase, which provides precursors for sesquiterpene synthases. Subnetwork 1 includes the transcription factors MYCA/S and MYB and the enzymes DXS and TPS3. These components are linked to subnetwork 2 by GGPS or WRKY mediators. The co-expression network under chitosan treatment (Fig. 7 ) exhibits two distinct subnetworks. Notably, Subnetwork 2 contains a significant module involving TPS3 - ERBP - MYB - MYCA. The transcription factors ERBP and MYB serve as hubs and collectively activate three terpene synthases (TPS2/3/5). The level of valerenic acid is highly correlated with the genes encoding FPS and TPS5, suggesting that an elevated farnesyl diphosphate precursor plays a crucial role in activating sesquiterpene synthase 5 (TPS5) and consequently enhancing valerenic acid biosynthesis. Disscussion 1. Effect of ABA on genes involved in the valerenic acid biosynthesis pathway Our results show that the treatment of V. officinalis hairy roots with ABA (50 µM) led toa significant increase in valerenic acid accumulation. By the fourth day after treatment, the concentration of valerenic acid had peaked at 0.65 mg/g DW (Fig. 5 ). This finding is supported by the data from RFCs (Fig. 1 ), indicating an upregulation in the expression of the transcription factors BHLH and ERBP, along with an increase in TPS2, a pivotal gene in this pathway. The bHLH transcription factors are known to play a crucial role in the signaling pathways of JA, ABA, and GA, as well as in the regulation of terpenoid biosynthesis in plants (Hong et al., 2012 ). Recent studies have shown that specific bHLH transcription factors, such as AabHLH112, regulate sesquiterpene biosynthesis, with exogenous MeJA treatment further enhancing this process (Xiang et al., 2022 ). Moreover, the upregulation of ERBP and BHLH transcription factors in response to exogenous ABA indicates a potential crosstalk between ABA and jasmonate signaling pathways in controlling sesquiterpenoid biosynthesis (Mertens et al., 2016 ). Identifying of PpbHLH1 binding to the PpTPS3 promoter and activating linalool production in peach cultivars further supports this hypothesis (Wei et al., 2021 ). In conclusion, our research suggests that exogenous ABA may interact with JA, with the bHLH transcription factor being a key player in modulating valerenic acid biosynthesis. 2.Effect of Chitosan on the genes involved in the valerenic acid biosynthetic pathway Our study found that treatment of valerian hairy roots with chitosan (200 mg/L) resulted in a significant increase in valerenic acid production (0.68 mg/g DW) within only two days (Fig. 5 ). This increase seems to be related to the activation of genes involved in valerenic acid biosynthesis by transcription factors. Interestingly, the transcription factor expression data (Fig. 3 ) show a marked increase in all factors, with a firm increase in WRKY. This active network of transcription factors probably plays a critical role in inducing the expression of genes involved in valerenic acid production, especially those related to TPS, FPS, and DXS enzymes (Fig. 4 ). Chitosan treatment offers an advantage over ABA because it significantly increases the activity of two key enzymes: DXS and FPS. DXS controls the rate of MEP pathway MEP, while FPS directly produces a building block (farnesyl diphosphate) needed for the sesquiterpene synthases studied. This explains why chitosan treatment leads to faster and higher production of valerenic acid. In a parallel study conducted on the hairy root of Psammosilene tunicoides , it was observed that the transcription of genes involved in saponin metabolism was enhanced by chitosan. This was particularly true for genes encoding stress-responsive transcription factors (WRKYs and NACs) and terpenoid biosynthetic enzymes (DXS), thereby corroborating the findings of our current study (Qiu et al., 2021 ). 3. Analysis of co-expression networks Analysis of the co-expression network using Cytoscape software, and its output metrics provides valuable insights into its structural characteristics. Betweenness centrality identifies key nodes that serve as bridges and control the flow of information along the shortest paths, while closeness centrality highlights central nodes that facilitate efficient information dissemination. Degree quantifies a node's direct connections. Together, these metrics provide a comprehensive understanding of the network's topology, node importance, and potential vulnerabilities, shedding light on the dynamics of information flow within the network. 3.1 ABA Co-expression Network Examination of network centrality metrics following ABA treatment provided valuable insights into the structural layout and operational changes within the network. WRKY has the highest betweenness centrality score (0.173), highlighting the central role of the WRKY node in controlling the flow of information through several critical pathways. Figure 6 shows that the two subnetworks are connected by the transcription factor WRKY and the enzyme GGPS, which act as a bridge to facilitate the exchange of information between them. The highest closeness centrality score (0.736) assigned to HMGR, GGPS, and valerenic acid indicates their closer proximity to other nodes within the network. The positioning of HMGR, a key regulator influencing pathway rate, among other network nodes, plays a critical role in orchestrating metabolic flow within the regulatory network. The degree analysis highlighted HMGR, GGPS and valerenic acid as nodes with high connectivity, each with a degree of 9, while MYCS and MYCA showed lower connectivity with a degree of 5. It is essential to note the strong activation of DXS by MYCS and the co-expression of DXS and TPS3, as shown in Fig. 6 . Although TPS3 and valerenic acid are directly related, their correlation is relatively weak because they are controlled by subnetworks 1 and 2, respectively. This may indicate the different roles played by the product of the TPS3 enzyme, drimenol, and valerenic acid under the influence of ABA treatment. Compared to chitosan treatment, ABA treatment splits the metabolic flux between drimenol and valerenic acid, resulting in a lower accumulation of valerenic acid. 3.2 Chitosan Co-expression Network In the context of chitosan treatment, network analysis revealed notable trends in centrality metrics. DXS exhibited the highest betweenness centrality value of 0.285, highlighting its critical role in regulating information flow within the network. Closeness centrality values ranged from 0.56 (for HMGR and GGPS) to 1 (for DXS), with DXS emerging as the node closest to others, potentially facilitating efficient information dissemination. DXS had the highest degree of 14, while GGPS and HMGR had a degree of 3, indicating fewer connections in comparison. Distinct differences between the ABA and chitosan networks were observed. A more robust co-expression association was observed between valerenic acid content and the enzyme TPS3 under chitosan treatment. TPS3 showed significant co-expression with the bottleneck enzyme DXS and is stimulated by the WRKY transcription factor. This suggests a possible connection between the chitosan elicitor and the up-regulation of TPS3, a key player in the response to biotic stress, in contrast to ABA treatment. This implies a potential link between the chitosan elicitor and the enhancement of TPS3 expression, a pivotal component in the defense against biotic stress, unlike under ABA treatment. This correlation is reinforced by the conversion of farnesyl pyrophosphate into the sesquiterpene drimenol by VoTPS3 in valerian (Kwon et al., 2014 ), renowned for its antifungal and insect-repellent attributes (Edouarzin et al., 2020 ; Henquet et al., 2017 ). Furthermore, while the GGPS enzyme plays a vital role in the ABA-treated network, its role in the chitosan network is comparatively limited. GGPS is responsible for the conversion of farnesyl diphosphate to geranylgeranyl pyrophosphate, thereby redirecting metabolic flux from the sesquiterpenoid pathway to the diterpenoid and carotenoid pathways (Mokhtari et al., 2023 ). These differences likely account for the earlier accumulation of more valerenic acid under chitosan treatment than ABA treatment, indicating unique metabolic responses elicited by these two stimulants. In subnetwork 2 under chitosan treatment, DXS (rate-limiting enzyme in the MEP biosynthetic pathway;(Tian et al., 2022 )) plays a crucial connecting node (Fig. 7 ). On the other hand, in subnetwork 2 under ABA treatment, HMGR (rate-limiting enzyme in the mevalonate biosynthetic pathway;(Liao et al., 2016 )) occupies an important position (Fig. 6 ). This suggests that the mevalonate biosynthetic pathway may be more important in response to abiotic stress. In contrast, the MEP biosynthetic pathway may be critical in response to biotic stress. In Panax ginseng , treatment with ABA leads to increased accumulation of triterpenoid ginsenosides and induces upregulation of PgHMGR (Kong et al., 2023 ). The control of DXS and HMGR implies a metabolic reorganization in response to ABA treatment. The plant appears to favor the mevalonate pathway over the MEP pathway to generate the sesquiterpenoid ABA. The increased expression of HMGR may indicate an increased need for mevalonate-derived compounds, possibly to support increased ABA production needed for abiotic stress adaptation or developmental functions in treated tissues. These results emphasize the critical role of specific nodes in information dissemination and network resilience and highlight the structural characteristics and connectivity dynamics of the network under ABA and chitosan treatment. Conclusion This study provides a comprehensive investigation of the valerenic acid metabolic pathways in the hairy roots of V. officinalis . Specifically, it examines the response of the plant to two treatments: abscisic acid (ABA) and chitosan ABA treatment primarily affected the BHLH and ERBP transcription factors, while chitosan broadly increased transcript levels of all transcription factor families (WRKY, ERBP, and MYB). TPS5, a terpene synthase gene, showed the most robust response under ABA. Conversely, chitosan treatment activated several terpene synthases through these transcription factor hubs. This research paves the way for a new generation of valerian plants with increased valerenic acid content. This not only benefits the production of potential therapeutic drugs, but also enhances our understanding of plant stress responses and metabolic regulation. Ultimately, this knowledge can be used to optimize the production of various valuable plant compounds. Future Perspectives and Concluding Remarks This study lays the basis for future research to optimize valerenic acid production in V. officinalis . By elucidating the critical transcriptional regulators under stress conditions (ABA and chitosan), we have gained valuable insights into how plants fine-tune their metabolism. Here are some future directions: Engineering high valerenic acid producers : We can use the identified hubs (BHLH, ERBP, WRKY, MYB transcription factors) to develop targeted manipulation strategies. This could involve genetic engineering or tailor-made elicitors to increase valerenic acid production. Network modeling for prediction : The established network can be further refined to predict the effect of different stimuli on valerenic acid biosynthesis. This will be a powerful tool for identifying optimal growth conditions and stress factors to maximize yield. Investigating the role of other stress signals : As ABA and chitosan elicited significant responses, it is promising to investigate the influence of other environmental stresses on valerenic acid production. Declarations Declaration of interest Authors do not have any declarations of interest. Author Contributions All authors contributed to the study conception and design. Conceptualization: [Arash Mokhtari]; Methodology: [Rasoul Amirian], [Mozhdeh Shafaei], [Iman Arezi], Formal analysis and investigation: [Arash Mokhtari], [Ahmad sobhani]; Writing - original draft preparation: [Arash Mokhtari]; Writing - review and editing: [Arash Mokhtari]; Funding acquisition: [Morteza Ebrahimi]; Resources: [Reza Zarghami], [Pejman Azadi]; Supervision: [Arash Mokhatri]. All authors commented on previous versions of the manuscript. All authors read and approved the final manuscript. Data availability The data that support the findings of this study are available from the corresponding authorupon reasonable request. References Chen, R., & Zhang, L. (2024). Engineering biology fundamental for plant-derived bioactive compounds: challenges and prospects. Engineering Biology for Microbial Biosynthesis of Plant-Derived Bioactive Compounds , 285-313. Coca-Ruíz, V., Suárez, I., Aleu, J., & Collado, I. G. (2022). Structures, occurrences and biosynthesis of 11, 12, 13-tri-nor-sesquiterpenes, an intriguing class of bioactive metabolites. Plants , 11 (6), 769. Edouarzin, E., Horn, C., Paudyal, A., Zhang, C., Lu, J., Tong, Z., Giaever, G., Nislow, C., Veerapandian, R., & Hua, D. H. (2020). Broad-spectrum antifungal activities and mechanism of drimane sesquiterpenoids. Microbial Cell , 7 (6), 146. Henquet, M. G., Prota, N., van der Hooft, J. J., Varbanova‐Herde, M., Hulzink, R. J., de Vos, M., Prins, M., de Both, M. T., Franssen, M. C., & Bouwmeester, H. (2017). Identification of a drimenol synthase and drimenol oxidase from Persicaria hydropiper, involved in the biosynthesis of insect deterrent drimanes. The Plant Journal , 90 (6), 1052-1063. Hong, G.-J., Xue, X.-Y., Mao, Y.-B., Wang, L.-J., & Chen, X.-Y. (2012). Arabidopsis MYC2 interacts with DELLA proteins in regulating sesquiterpene synthase gene expression. The Plant Cell , 24 (6), 2635-2648. Kong, L., Chen, P., & Chang, C. (2023). Drought resistance and ginsenosides biosynthesis in response to abscisic acid in Panax ginseng CA Meyer. International journal of molecular sciences , 24 (11), 9194. Kwon, M., Cochrane, S. A., Vederas, J. C., & Ro, D.-K. (2014). Molecular cloning and characterization of drimenol synthase from valerian plant (Valeriana officinalis). FEBS letters , 588 (24), 4597-4603. Liao, P., Hemmerlin, A., Bach, T. J., & Chye, M.-L. (2016). The potential of the mevalonate pathway for enhanced isoprenoid production. Biotechnology advances , 34 (5), 697-713. Mai, J., Li, W., Ledesma-Amaro, R., & Ji, X.-J. (2021). Engineering plant sesquiterpene synthesis into yeasts: a review. Journal of Agricultural and Food Chemistry , 69 (33), 9498-9510. Mertens, J., Van Moerkercke, A., Vanden Bossche, R., Pollier, J., & Goossens, A. (2016). Clade IVa basic helix–loop–helix transcription factors form part of a conserved jasmonate signaling circuit for the regulation of bioactive plant terpenoid biosynthesis. Plant and Cell Physiology , 57 (12), 2564-2575. Mokhtari, A., Omidi, M., Ebrahimi, M., Alizade, H., & Sobhani, A. (2023). Evaluation of the transcriptome of valerian (Valeriana officinalis) to identify genes involved in terpenoids biosynthesis pathway. فصلنامه علمی ژنتیک نوین, 18(2), 111-123 . Mokhtari, A., Omidi, M., Ebrahimi, M., Alizadeh, H., Sobhani, A., Azadi, P., Noormohammadi, N., & Shafaie, M. (2024). Optimizing the extract yield of bioactive compounds in Valeriana officinalis root: a D-optimal design. Preparative Biochemistry & Biotechnology , 1-11. Qiu, H., Su, L., Wang, H., & Zhang, Z. (2021). Chitosan elicitation of saponin accumulation in Psammosilene tunicoides hairy roots by modulating antioxidant activity, nitric oxide production and differential gene expression. Plant Physiology and Biochemistry , 166 , 115-127. Tian, S., Wang, D., Yang, L., Zhang, Z., & Liu, Y. (2022). A systematic review of 1-Deoxy-D-xylulose-5-phosphate synthase in terpenoid biosynthesis in plants. Plant Growth Regulation , 96 (2), 221-235. Valach, M. (2016). RNA extraction using the'home-made'Trizol substitute. In. Walls, L. E., & Rios-Solis, L. (2020). Sustainable production of microbial isoprenoid derived advanced biojet fuels using different generation feedstocks: A review. Frontiers in Bioengineering and Biotechnology , 8 , 599560. Wei, C., Liu, H., Cao, X., Zhang, M., Li, X., Chen, K., & Zhang, B. (2021). Synthesis of flavour‐related linalool is regulated by PpbHLH1 and associated with changes in DNA methylation during peach fruit ripening. Plant Biotechnology Journal , 19 (10), 2082-2096. Wong, J. (2017). Engineering microbial production of terpenoids . University of California, Berkeley. Xiang, L., He, P., Shu, G., Yuan, M., Wen, M., Lan, X., Liao, Z., & Tang, Y. (2022). AabHLH112, a bHLH transcription factor, positively regulates sesquiterpenes biosynthesis in Artemisia annua. Frontiers in Plant Science , 13 , 973591. Zhao, M., Zhang, C., Wang, H., He, S., & Lu, W. (2022). Biosynthesis of valerenic acid by engineered Saccharomyces cerevisiae. Biotechnology Letters , 44 (7), 857-865. Cite Share Download PDF Status: Published Journal Publication published 17 Feb, 2025 Read the published version in Plant Cell, Tissue and Organ Culture (PCTOC) → Version 1 posted Reviewers agreed at journal 11 Nov, 2024 Reviewers invited by journal 11 Nov, 2024 Editor assigned by journal 09 Nov, 2024 First submitted to journal 08 Nov, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-5417801","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":376760028,"identity":"31d26431-eb7c-486a-9a0e-779f7bd5e6ee","order_by":0,"name":"Arash Mokhtari","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA1UlEQVRIiWNgGAWjYFACNjYQycPPwMPAkGAAYjM2ENZyAKhFsoFULQwGB3iIdJZue1va4w8192SMj5899uFBAYM8fwNz2wd8WszOHDtucOBYMY/ZmbzkGUCHGc44wNg8A6+WG+ltEgfYEnjMDuQYg/zCuIGBsRmvwyBa/iXwGPe/AWuxJ0JL2jGJg20JPAYSEFsSCWs5cyxN4mxfAo/EjXfJQC0SyTMOE9JyvM1MouJbgj1/f+5hxh9/bGz729sf49WCDiQYGJhJ0jAKRsEoGAWjABsAADhrRZosT6jZAAAAAElFTkSuQmCC","orcid":"","institution":"ABRII: Agricultural Biotechnology Research Institute of Iran","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"Arash","middleName":"","lastName":"Mokhtari","suffix":""},{"id":376760029,"identity":"8a7f3a65-6021-4652-84a4-9483c5eaad61","order_by":1,"name":"Pejman Azadi","email":"","orcid":"","institution":"ABRII: Agricultural Biotechnology Research Institute of Iran","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Pejman","middleName":"","lastName":"Azadi","suffix":""},{"id":376760030,"identity":"8fbc2bf0-796a-40a1-915f-30c288fdfdcd","order_by":2,"name":"Morteza Ebrahimi","email":"","orcid":"","institution":"ABRII: Agricultural Biotechnology Research Institute of Iran","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Morteza","middleName":"","lastName":"Ebrahimi","suffix":""},{"id":376760031,"identity":"8a1dcba0-55a7-4d88-8ca1-fb4f907cb680","order_by":3,"name":"Ahmad Sobhani","email":"","orcid":"","institution":"ABRII: Agricultural Biotechnology Research Institute of Iran","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Ahmad","middleName":"","lastName":"Sobhani","suffix":""},{"id":376760032,"identity":"4fbe2bfc-1a7d-47ec-bab5-9c2da4c683b6","order_by":4,"name":"Reza Zarghami","email":"","orcid":"","institution":"ABRII: Agricultural Biotechnology Research Institute of Iran","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Reza","middleName":"","lastName":"Zarghami","suffix":""},{"id":376760033,"identity":"d624afa0-f63d-4909-b620-d3f47a1246a4","order_by":5,"name":"Rasoul Amirian","email":"","orcid":"","institution":"ABRII: Agricultural Biotechnology Research Institute of Iran","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Rasoul","middleName":"","lastName":"Amirian","suffix":""},{"id":376760034,"identity":"c4cf7dbd-ac3a-4379-8df3-9aa7334ee67a","order_by":6,"name":"Iman Arezi","email":"","orcid":"","institution":"ABRII: Agricultural Biotechnology Research Institute of Iran","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Iman","middleName":"","lastName":"Arezi","suffix":""},{"id":376760035,"identity":"389b7dab-118d-4fd6-bd6b-709b129d768e","order_by":7,"name":"mozhdeh Shafaei","email":"","orcid":"","institution":"ABRII: Agricultural Biotechnology Research Institute of Iran","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"mozhdeh","middleName":"","lastName":"Shafaei","suffix":""}],"badges":[],"createdAt":"2024-11-08 16:10:42","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-5417801/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-5417801/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1007/s11240-025-02990-y","type":"published","date":"2025-02-17T15:57:03+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":70165793,"identity":"1b3bd35f-ac98-4631-b486-d70b77752920","added_by":"auto","created_at":"2024-11-29 05:40:55","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":47507,"visible":true,"origin":"","legend":"\u003cp\u003eRelative fold change of BHLH, ERBP, MYB, MYC and WRKY transcription factors in hairy roots of \u003cem\u003eV. officinalis\u003c/em\u003e after treatment with 50 μM ABA for 1, 2 and 4 days.\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-5417801/v1/575ca65653bfa1507ba843ca.png"},{"id":70167297,"identity":"414e40e8-7e9c-411d-be5f-b8b55709228d","added_by":"auto","created_at":"2024-11-29 06:04:55","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":56361,"visible":true,"origin":"","legend":"\u003cp\u003eRelative fold change of enzyme-encoding genes involved in valerenic acid biosynthesis, including TPS3, DXR, DXS, FPS, GGPS, TPS2, and TPS5 \u0026nbsp;in hairy roots of \u003cem\u003eV. officinalis\u003c/em\u003e after treatment with 50 μM ABA for 1, 2 and 4 days.\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-5417801/v1/fc9903218d4ec2fca258b75b.png"},{"id":70165795,"identity":"00d862e3-71a5-4062-a828-ecce3d4667bc","added_by":"auto","created_at":"2024-11-29 05:40:55","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":56517,"visible":true,"origin":"","legend":"\u003cp\u003eRelative fold change of BHLH, ERBP, MYB, MYC, and WRKY transcription factors in hairy roots of \u003cem\u003eV. officinalis\u003c/em\u003e after treatment with 200 mg/l chitosan for 1, 2, and 4 days.\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-5417801/v1/6acc72a446bf9a51f0b6bb9e.png"},{"id":70166787,"identity":"57499dfb-774d-48e7-8522-bcb34cbb67ec","added_by":"auto","created_at":"2024-11-29 05:56:55","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":64819,"visible":true,"origin":"","legend":"\u003cp\u003eRelative fold change of enzyme-encoding genes involved in valerenic acid biosynthesis,including TPS3, DXR, DXS, FPS, GGPS, TPS2, and TPS5 in hairy roots of \u003cem\u003eV. officinalis\u003c/em\u003e after treatment with 200 mg/l chitosan for 1, 2 and 4 days.\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-5417801/v1/adce800e4aa363b3d08f4c38.png"},{"id":70165797,"identity":"3c176e7b-25ab-4559-b552-c640d18923ef","added_by":"auto","created_at":"2024-11-29 05:40:55","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":42988,"visible":true,"origin":"","legend":"\u003cp\u003eComparison of mean valerenic acid content (mg/g DW) between ABA, chitosan elicitors, and control in hairy roots of \u003cem\u003eV. officinalis\u003c/em\u003e. Means with the same letter are not statistically (P \u0026lt; 0.05) significantly different. Mean ± se was used to draw the error bars. The horizontal axis is different times (1, 2 and 4 days).\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-5417801/v1/4100d31334969584048535d3.png"},{"id":70166789,"identity":"5515ca4a-bee1-42f4-9d70-d880b4014ed4","added_by":"auto","created_at":"2024-11-29 05:56:55","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":172685,"visible":true,"origin":"","legend":"\u003cp\u003eCo-expression network of enzyme-encoding genes involved in valerenic acid biosynthesis, including TPS3, DXR, DXS, FPS2, GGPS, TPS2 and TPS5, transcription factors BHLH, ERBP, MYB, MYCA, MYCS and WRKY and valerenic acid content under ABA treatment in hairy roots of \u003cem\u003eV. officinalis\u003c/em\u003e.\u003c/p\u003e","description":"","filename":"6.png","url":"https://assets-eu.researchsquare.com/files/rs-5417801/v1/9b8853766cf0ece25d3386fc.png"},{"id":70165800,"identity":"45956c8f-b056-4e56-9061-4dd28407417a","added_by":"auto","created_at":"2024-11-29 05:40:55","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":143488,"visible":true,"origin":"","legend":"\u003cp\u003eCo-expression network of enzyme-encoding genes involved in valerenic acid biosynthesis, including TPS3, DXR, DXS, FPS2, GGPS, TPS2 and TPS5, transcription factors BHLH, ERBP, MYB, MYCA, MYCS and WRKY and valerenic acid content under chitosan treatment in hairy roots of \u003cem\u003eV. officinalis\u003c/em\u003e.\u003c/p\u003e","description":"","filename":"7.png","url":"https://assets-eu.researchsquare.com/files/rs-5417801/v1/d4631f82815c1705e481e2c8.png"},{"id":77052490,"identity":"d0fb711b-0a75-4d98-bfa2-0b2444fde2f4","added_by":"auto","created_at":"2025-02-24 16:10:32","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1656060,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-5417801/v1/5d1f6f69-9cea-4596-84a8-756455598738.pdf"}],"financialInterests":"","formattedTitle":"Comparative Network Analysis under ABA and Chitosan Treatments: Unveiling Key Transcriptional Regulators of Valerenic Acid Biosynthesis in Valerian Hairy Roots","fulltext":[{"header":"Key message","content":"\u003cp\u003eOur research employed comparative network analysis to elucidate the effects of abscisic acid (ABA) and chitosan treatments on the gene and transcription factor network associated with valerenic acid production in \u003cem\u003eV. officinalis\u003c/em\u003e hairy roots.\u003c/p\u003e"},{"header":"Introduction","content":"\u003cp\u003eOver 50,000 terpenes have been identified, primarily from plants, which are derived from C\u003csub\u003e5\u003c/sub\u003e isoprene units (C\u003csub\u003e5\u003c/sub\u003eH\u003csub\u003e8\u003c/sub\u003e) and are basic molecular building blocks (Chen \u0026amp; Zhang, \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). Sesquiterpenes (C\u003csub\u003e15\u003c/sub\u003e) are the most extensive category of terpenes and play a crucial role in the flavor and fragrance sector and exhibit various pharmacological properties, such as anticancer, antibacterial, and anti-inflammatory effects (Coca-Ru\u0026iacute;z et al., \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). In addition, sesquiterpenes offer significant research and commercial prospects as advanced biofuels or biofuel precursors (Walls \u0026amp; Rios-Solis, \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Sesquiterpenes are typically obtained by extraction from plants or chemical synthesis. Extraction from plants is limited by low compound content and slow plant growth, which can affect commercial viability. Although chemical synthesis is a viable approach, its implementation is hampered by high cost, toxicity concerns, and the complicated process of separating chiral isoforms of sesquiterpenes (Mai et al., \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2021\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eValerenic acid (C\u003csub\u003e15\u003c/sub\u003eH\u003csub\u003e22\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e) is a sesquiterpene compound in \u003cem\u003eValeriana officinalis\u003c/em\u003e, commonly known as valerian. It possesses pharmacological properties, including its potential as a natural remedy for anxiety, insomnia, and stress-related disorders due to its calming and sedative effects (Mokhtari et al., \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). The overall biosynthetic pathway for valerenic acid involves the synthesis of farnesyl pyrophosphate (FPS) as a precursor, followed by the conversion of FPS to valerena-4,7(11)-diene by valerena-4,7(11)-diene synthase (VDS). Valerena-4,7(11)-diene is then oxidized to valerenic acid by cytochrome P450 monooxygenase (Zhao et al., \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Efforts to optimize the biosynthetic pathway of valerenic acid have made progress, but challenges remain in understanding the critical genes involved in its biosynthetic pathway. Further research is needed to unravel the complexity of the pathway and identify additional enzymatic reactions and regulatory mechanisms that control its metabolic efficiency.\u003c/p\u003e \u003cp\u003eCo-expression analysis can play an essential role in identifying correlations between genes and transcription factors involved in sesquiterpenoid biosynthesis, thus helping to discover new regulatory elements that affect valerenic acid production (Wong, \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). integrating co-expression studies with pathway optimization efforts can provide valuable insights into the genetic factors that influence valerenic acid biosynthesis. This pioneering study investigates the co-expression correlations between genes and transcription factors essential for valerenic acid biosynthesis in hairy roots of \u003cem\u003eV. officinalis\u003c/em\u003e when exposed to abscisic acid (ABA) and chitosan elicitors. Our results are expected to provide new insights into the regulatory mechanisms of this complex biosynthetic pathway.\u003c/p\u003e"},{"header":"Material ans methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e2.1 Hairy root induction\u003c/h2\u003e \u003cp\u003eThe ATCC15834 strain of \u003cem\u003eRhizobium rhizogenes\u003c/em\u003e was used to induce hairy roots on leaf explants of valerian. The bacteria were grown and maintained on a solid Luria-Bertani (LB) medium supplemented with rifampin (50 mg/mL) at 28\u0026deg;C. Single colonies were inoculated into liquid LB medium and grown overnight by shaking at 140 rpm. Bacteria were collected by centrifugation, resuspended in a liquid MS medium, and adjusted to an optical density of 0.8. Leaf explants from four-week-old \u003cem\u003ein vitro\u003c/em\u003e-grown seedlings of \u003cem\u003eV. officinalis\u003c/em\u003e were immersed in the \u003cem\u003eR. rhizogenes\u003c/em\u003e suspension for 10 minutes. They then blotted dry on sterile filter paper to remove excess bacteria. The infected explants were cocultured in the dark at 25\u0026deg;C for three days on MS solid medium supplemented with sucrose (30 g/l), agar (8 g/l), and acetosyringone (20 mg/l). Following co-cultivation, the explants were transferred to a hormone-free MS medium containing cefotaxime (300 mg/l) to inhibit bacterial growth. Hairy roots emerged from the wound sites within 7\u0026ndash;10 days. After four weeks, individual hairy roots were isolated and subcultured every three weeks on fresh hormone-free MS medium with a gradual reduction of cefotaxime. The transformation was confirmed through the detection of the \u003cem\u003eVirD\u003c/em\u003e and \u003cem\u003erolB\u003c/em\u003e genes using PCR.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003e2.2 Gene selection and primer design\u003c/h3\u003e\n\u003cp\u003eTo obtain reliable transcriptome data essential for subsequent gene selection and primer design, we performed a \u003cem\u003ede novo\u003c/em\u003e assembly using the Short Read Archive (SRA) datasets of \u003cem\u003eV. officinalis\u003c/em\u003e.\u003c/p\u003e\n\u003ch3\u003e2.2.1 de novo transcriptome assembly\u003c/h3\u003e\n\u003cp\u003eBriefly, the raw RNA-Seq reads of \u003cem\u003eV. officinalis\u003c/em\u003e (accession numbers SRR125357, SRR125358, SRR125359, SRR343119, and SRR14294419) were downloaded from the European Nucleotide Archive (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.ebi.ac.uk/ena/browser/home\u003c/span\u003e\u003cspan address=\"https://www.ebi.ac.uk/ena/browser/home\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). The quality of the raw reads was assessed using FastQC. Low-quality bases and adapter sequences were trimmed using Trimmomatic. Only high-quality reads were retained for downstream analysis. Trinity v2.9 was used for \u003cem\u003ede novo\u003c/em\u003e assembly of the cleaned RNA-Seq reads (Mokhtari et al., \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2023\u003c/span\u003e).\u003c/p\u003e\n\u003ch3\u003e2.2.2 Gene and Transcription Factor Selection\u003c/h3\u003e\n\u003cp\u003eThe transcripts of the assembled transcriptome were annotated using TransDecoder to predict open reading frames. The predicted protein sequences were submitted to KEGG's GhostKOALA for KEGG Orthology (KO) assignment and pathway mapping. Genes encoding key enzymes in the terpenoid backbone biosynthesis pathway (map00900) were selected based on KO annotations and pathway information in KEGG. The study used the String database to identify potential transcription factors interacting with the selected genes encoding metabolic enzymes. The amino acid sequences of the selected genes were compared blasted against the assembled transcriptome using tBlastn with an e-value of 10\u003csup\u003e\u0026minus;\u0026thinsp;6\u003c/sup\u003e to identify corresponding contigs within the assembled transcriptome. Additional genes involved in sesquiterpenoid biosynthesis were selected based on an extensive literature review (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eCharacterization of genes encoding enzymes and transcription factors involved in the terpenoid biosynthetic pathway in V.officinalis.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eEntry\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eProtein names\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eOrganism\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colspan=\"3\" nameend=\"c4\" namest=\"c2\"\u003e \u003cp\u003e\u003cem\u003eEnzymes\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eA0A178V5I0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1-deoxy-D-xylulose-5-phosphate synthase (DXS) (EC:2.2.1.7)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cem\u003eArabidopsis thaliana\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eQ9XFS9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1-deoxy-D-xylulose 5-phosphate reductoisomerase (DXR) (EC 1.1.1.267)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cem\u003eArabidopsis thaliana\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eP14891\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e3-hydroxy-3-methylglutaryl-coenzyme A reductase 1 (HMGR) (EC 1.1.1.34)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cem\u003eArabidopsis thaliana\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eO22043\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGeranylgeranyl pyrophosphate synthase (GGPS) (EC 2.5.1.-)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cem\u003eArabidopsis thaliana\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eQ43315\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eFarnesyl pyrophosphate synthase (FPP synthase 2) (EC 2.5.1.10)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cem\u003eArabidopsis thaliana\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eU3KYL2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e(-)-drimenol synthase (VoTPS3)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cem\u003eValeriana officinalis\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eJ9R5V4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eValerena-4,7(11)-diene synthase (EC 4.2.3.139) (VoTPS2)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cem\u003eValeriana officinalis\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eJX494703\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSesquiterpene synthase 5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cem\u003eValeriana officinalis\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colspan=\"3\" nameend=\"c4\" namest=\"c2\"\u003e \u003cp\u003e\u003cem\u003eTranscription Factors\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eA0A2R4RN66\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eBHLH4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cem\u003ePhalaenopsis bellina\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eG3CU72\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eEthylene-responsive element binding protein 1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cem\u003eHevea brasiliensis\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eK4D336\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eR2R3 MYB transcription factor\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cem\u003eSolanum lycopersicum\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eQ39204\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTranscription factor MYC2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cem\u003eArabidopsis thaliana\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eA0A060KY90\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTranscription factor MYC1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cem\u003eSolanum lycopersicum\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eQ6R8H1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTranscription factor WRKY1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cem\u003eGossypium arboreum\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e\n\u003ch3\u003e2.3. Primer Design\u003c/h3\u003e\n\u003cp\u003eThe coding sequences of the selected enzyme and transcription factor coding genes were extracted from the \u003cem\u003eV. officinalis\u003c/em\u003e assembly. Primer3, a primer design software, was utilized to design ten pairs of gene-specific primers. These primers target reverse transcription quantitative PCR (RT-qPCR) products in the range of 90\u0026ndash;150 base pairs (bp). The primer optimization tool, OligoAnalyzer, was used to select primers with optimal melting temperatures, GC content, and lowest predicted secondary structure formation and primer dimer probability. The ePCR tool in TBTools was used to verify primer pair specificity by \u003cem\u003ein silico\u003c/em\u003e amplification of single target sequences from the \u003cem\u003eV. officinalis\u003c/em\u003e transcriptome. The primers listed in Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e were commercially synthesized. To confirm the amplification of single products after 40 cycles, polymerase chain reaction (PCR) amplification and agarose gel electrophoresis were performed.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eSequence of specific primers for amplification of genes and transcription factors.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"2\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003e\u003cem\u003eEnzymatic Genes\u003c/em\u003e\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e1-deoxy-D-xylulose-5-phosphate synthase (DXS)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eACTATTTCGGCTCGTAGTTCTG\u003c/p\u003e \u003cp\u003eCCACCAACTCCTCTGTTAGATAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e1-deoxy-D-xylulose 5-phosphate reductoisomerase (DXR)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGGATGATAGACTGAGGGTGGATAA\u003c/p\u003e \u003cp\u003eCCAAACTGGAGCATGGGTAAA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e3-hydroxy-3-methylglutaryl-coenzyme A reductase 1 (HMGR)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGTACTATGCCTTCATACTCCC\u003c/p\u003e \u003cp\u003eCTGCCCTAGAATAGACTCGT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGeranylgeranyl pyrophosphate synthase (GGPS)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTTCCACCTCCCAGAATAGCG\u003c/p\u003e \u003cp\u003eATAGCTTCCACCGGAGTGTC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eFarnesyl pyrophosphate synthase (FPP synthase 2)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTCATTTGCCCAGATGCTGTCT\u003c/p\u003e \u003cp\u003eTGCTGTAAACGACGGTGTGT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e(-)-drimenol synthase (VoTPS3)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eACCGATTGACACTACCGCAT\u003c/p\u003e \u003cp\u003eAGCTATCGCCAAGTGCTACG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eValerena-4,7(11)-diene synthase (EC 4.2.3.139) (VoTPS2)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGCATACTCAACCCGGTAGGA\u003c/p\u003e \u003cp\u003eTTCACCGATGCAGTCAAAAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSesquiterpene synthase 5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTACCCATTTAAAGGCGTCCTC\u003c/p\u003e \u003cp\u003eATGATAAAAGTAATGTGCCGAA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003e\u003cb\u003eTranscription Factors\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eBHLH4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTCCTACCTCTATGCCCAGCC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGTAACAATCCCGGTCTACGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eEthylene-responsive element binding protein 1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGTAGGCTTTAGCGGCTTCCT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAGAGGTGCATTACAGAGGCG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eR2R3 MYB transcription factor\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTCACTCCACATGAAGAAGGCA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eATCGGTTCGTTGAGGAAGGT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTranscription factor MYC1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTCACATCTATTTCCACATCAACAAG\u003c/p\u003e \u003cp\u003eGACAAGGACGAGCTGAATCATA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eTranscription factor MYC2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCTGCCCTGGAAGACCATCTC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTTTCCGGTACTCAAGCCTCG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eTranscription factor WRKY1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCTGTTATCGGATGATTCGGTCTT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTCGGAGACTAGTTCTAGTGATGAA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003e2.3 Experimental design and elicitor treatments\u003c/h2\u003e \u003cp\u003eHairy roots with a fresh weight of 5 mg were cultured in 8 cm Petri dishes, each filled with 15 mL of half-strength MS liquid medium. These cultures were placed on an orbital shaker set at 120 rpm and incubated in the dark at 20\u0026deg;C for 21 days. After incubation, the spent medium was aspirated from the Petri dishes and discarded. A fresh culture medium was then prepared, to which abscisic acid (ABA) and chitosan were added to achieve final concentrations of 50 \u0026micro;M and 200 mg/l, respectively. Then, 15 mL of this freshly prepared culture medium was added to each Petri dish. Cultures not exposed to ABA or chitosan served as controls. The cultures were then divided into three sets based on a time series of 1, 2, and 4 days of treatment, with each set consisting of three replicates. These sets were then placed on an orbital shaker in growth chambers and maintained under dark conditions at 20\u0026deg;C.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003e2.4 RNA extraction\u003c/h3\u003e\n\u003cp\u003eRoot tissues (600 mg) were collected from hairy roots at 1, 2, and 4 days post-elicitation and immediately frozen in liquid nitrogen. Total RNA was extracted using a homemade TRIzol-based buffer (Valach, \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2016\u003c/span\u003e) containing phenol, guanidinium isothiocyanate, ammonium thiocyanate, and sodium acetate. The RNA extraction process was performed as follows:\u003c/p\u003e \u003cp\u003e \u003col\u003e \u003cspan\u003e \u003cli\u003e \u003cp\u003e600 \u0026micro;L of homemade TRIzol buffer was added to the frozen and powdered tissues of the 15-mL falcons.\u003c/p\u003e \u003c/li\u003e \u003c/span\u003e \u003cspan\u003e \u003cli\u003e \u003cp\u003eSamples were inverted and incubated at room temperature for 5 minutes to ensure thorough mixing.\u003c/p\u003e \u003c/li\u003e \u003c/span\u003e \u003cspan\u003e \u003cli\u003e \u003cp\u003eFor each milliliter of TRIzol, 350 \u0026micro;L of chloroform: isoamyl alcohol (24:1) was added. After thorough mixing for 15 seconds (45\u0026deg; inverted), samples were incubated for 3 minutes at room temperature.\u003c/p\u003e \u003c/li\u003e \u003c/span\u003e \u003cspan\u003e \u003cli\u003e \u003cp\u003eThe samples were centrifuged at 12000g for 10 minutes.\u003c/p\u003e \u003c/li\u003e \u003c/span\u003e \u003cspan\u003e \u003cli\u003e \u003cp\u003eThe supernatant was transferred to a new sterile 15- mL Falcon tube, and 0.1 volume of 3 M sodium acetate (pH 5.2) was added. This was followed by thorough mixing and several gentle inverting steps.\u003c/p\u003e \u003c/li\u003e \u003c/span\u003e \u003cspan\u003e \u003cli\u003e \u003cp\u003eAfter adding an equal volume of isopropyl alcohol and thoroughly mixing with several inverting steps, the samples were incubated at room temperature for 15 minutes.\u003c/p\u003e \u003c/li\u003e \u003c/span\u003e \u003cspan\u003e \u003cli\u003e \u003cp\u003eThe samples were centrifuged at 12000g for 10 minutes, and the supernatant was removed.\u003c/p\u003e \u003c/li\u003e \u003c/span\u003e \u003cspan\u003e \u003cli\u003e \u003cp\u003eTo the resulting sediment, 1 mL of 75% ethanol was added per 1 mL of TRIzol, the sediment was immersed in ethanol, gently inverted, and the samples were centrifuged at 12000g for 5 minutes.\u003c/p\u003e \u003c/li\u003e \u003c/span\u003e \u003cspan\u003e \u003cli\u003e \u003cp\u003eRepeat the previous step with 70% ethanol.\u003c/p\u003e \u003c/li\u003e \u003c/span\u003e \u003cspan\u003e \u003cli\u003e \u003cp\u003eThe alcohol was removed and 100 \u0026micro;L of 70% ethanol was added to dissolve the precipitate.\u003c/p\u003e \u003c/li\u003e \u003c/span\u003e \u003cspan\u003e \u003cli\u003e \u003cp\u003eThe above solution was transferred to a sterile 1.5 mL tube and centrifuged at 12000 g for 5 minutes.\u003c/p\u003e \u003c/li\u003e \u003c/span\u003e \u003cspan\u003e \u003cli\u003e \u003cp\u003eThe supernatant was drained, and the sediment was allowed to dry in laminar flow.\u003c/p\u003e \u003c/li\u003e \u003c/span\u003e \u003cspan\u003e \u003cli\u003e \u003cp\u003e1 \u0026micro;L DNase I, 10 \u0026micro;L DNase I buffer (10x), 89 \u0026micro;L RNase water were added.\u003c/p\u003e \u003c/li\u003e \u003c/span\u003e \u003cspan\u003e \u003cli\u003e \u003cp\u003eTubes were incubated at 37\u0026deg;C for 30 minutes.\u003c/p\u003e \u003c/li\u003e \u003c/span\u003e \u003cspan\u003e \u003cli\u003e \u003cp\u003e1 mL of TRIzol was added. Steps 2\u0026ndash;8 were repeated. The alcohol was removed, and the precipitate was allowed to dry in a laminar flow.\u003c/p\u003e \u003c/li\u003e \u003c/span\u003e \u003cspan\u003e \u003cli\u003e \u003cp\u003eThe RNA pellet was gently solubilized in 50 \u0026micro;L RNase-free water.\u003c/p\u003e \u003c/li\u003e \u003c/span\u003e \u003cspan\u003e \u003cli\u003e \u003cp\u003eSamples were stored at -20\u0026deg;C until cDNA synthesis.\u003c/p\u003e \u003c/li\u003e \u003c/span\u003e \u003c/ol\u003e \u003c/p\u003e \u003cp\u003eRNA quality and quantity were evaluated using agarose gel electrophoresis and nanodrop spectrophotometry. Only samples with A260/A280 ratios of 1.8\u0026ndash;2.1 and A260/A230 ratios greater than 2.0 were used for cDNA synthesis and downstream applications. The extracted RNA was stored at -80\u0026deg;C until further use.\u003c/p\u003e\n\u003ch3\u003e2.5 cDNA Synthesis and qRT-PCR Analysis\u003c/h3\u003e\n\u003cp\u003eFirst-strand cDNA was synthesized from 2 \u0026micro;g of total RNA using the Pars Toos cDNA synthesis kit and oligo(dT)16 primers, following the manufacturer's instructions. The reaction mixture was incubated at 25\u0026deg;C for 10 minutes, followed by 47\u0026deg;C for 60 minutes, and then at 85\u0026deg;C for 5 minutes. The resulting cDNA was cooled on ice and stored at -20\u0026deg;C for qRT-PCR reaction. The LightCycler 96\u0026trade; Real-Time PCR System (Roche, Switzerland) was used to perform quantitative real-time polymerase chain reaction (qRT-PCR). Reaction mixtures consisted of 2.5 \u0026micro;L of diluted cDNA, 5 \u0026micro;L of 2x SYBR Green Real-Time PCR Master Mix (Pars Toos\u0026trade;), and 1.25 \u0026micro;L of each primer at a concentration of 10 \u0026micro;M. The qRT-PCR protocol consisted of an initial denaturation phase at 95\u0026deg;C for 30 seconds, followed by 40 cycles of denaturation at 95\u0026deg;C for 5 seconds and annealing at 60\u0026deg;C for 30 seconds. To verify the specificity of the amplification process, a melting curve analysis was performed from 65\u0026deg;C to 95\u0026deg;C. The relative expression levels of the genes were calculated using the 2\u003csup\u003e\u0026minus;ΔΔCt\u003c/sup\u003e method with EF-1 as the internal reference gene. Each reaction was performed in triplicate to ensure technical accuracy.\u003c/p\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003e2.6. Analysis of gene expression data\u003c/h2\u003e \u003cp\u003eThe gene expression data underwent analysis of variance (ANOVA) to detect statistically significant differences with a threshold p-value of \u0026le;\u0026thinsp;0.05. The Anova function of the 'EnvStats' package was used for this purpose. Subsequently, Tukey's multiple comparison tests were performed for each gene using the 'emmeans' and 'multcomp' packages. Graphs of relative fold changes were generated using the 'ggplot2' package. The statistical analyses were conducted using R software version 4.3.1 (R Core Team, 2020) and RStudio version 2023.12.1 Build 402.\u003c/p\u003e \u003cp\u003e6. Extraction of valerenic acid and HPLC analysis\u003c/p\u003e \u003cp\u003eValerenic acid was extracted and quantified by HPLC according to the methodology described in our previous work (Mokhtari et al., \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). Finely ground dry roots (100 mg) were mixed with 1 mL of 94.88% methanol solvent. The samples were then ultrasonicated in a BANDELIN SONEREX, RK-100H system at 25˚C for 48.95 minutes, operating at 320 W and 35 KHz. After sonication, the samples were vigorously mixed for 30 minutes at 25˚C and 350 rpm. Subsequently, the mixed samples were centrifuged at 8000g for 10 minutes, and the supernatant was collected in 2 mL tubes. This mixing and centrifugation process were repeated twice. Finally, the samples were adjusted to a final volume of 1.5 mL and stored in a freezer at -20 ˚C before phytochemical analysis.\u003c/p\u003e \u003cp\u003eThe HPLC system consisted of a SYKAM S 9100 pump, SYKAM S 5300 autosampler, S 3210 UV/Vis detector, and Clarity software. A 100 \u0026micro;L aliquot of each sample was injected onto a Eurospher II 100-5 column at 60\u0026deg;C. The mobile phase consisted of a gradient system of (A) 0.1% trifluoroacetic acid in water and (B) acetonitrile. The gradient began at 5% B and was maintained for 5 minutes. It then increased to 95% B over 20 minutes and was held at that level for 15 minutes before returning to 5% B for 1 minute. The flow rate was kept constant at 0.4 mL/min. A calibration curve was generated using a valerenic acid standard for sample quantification.\u003c/p\u003e \u003c/div\u003e"},{"header":"Resultes","content":"\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003e1. Relative fold change of TF-encoding genes under ABA treatment\u003c/h2\u003e \u003cp\u003eFigure \u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e displays the time course analysis of the relative fold change (RFC) for various transcription factor families following treatment with 50 \u0026micro;M ABA for 1, 2, and 4 days. The BHLH and ERBP transcription factors showed the most significant response to ABA, with their RFCs peaking at day 2, showing a 4.61-fold and 4.89-fold increase, respectively, compared to the untreated control. The transcription factors MYB and WRKY showed a slight increase. Specifically, MYB showed a 1.23-fold increase on the first day, while WRKY showed a 1.2-fold increase on the second day, compared to the control. In contrast, MYCA/S transcription factors consistently decreased throughout the experimental period in response to ABA treatment.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003e2. Relative fold change of enzyme-encoding genes under ABA treatment\u003c/h2\u003e \u003cp\u003eTranscriptomic analysis revealed significant changes in the RFCs of enzyme-encoding genes involved in sesquiterpene biosynthesis after ABA treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). Except the DXS gene, all other genes showed an increase in RFCs on at least one day compared to the untreated control group. TPS5, among the genes encoding terpene synthase enzymes, showed the most significant induction, with a peak RFC of 6.76 observed on the second day post-treatment. Similarly, on day 2, the RFC of TPS2 increased by 5.69-fold. Furthermore, genes encoding crucial regulatory enzymes in the mevalonate pathway, namely HMGR and FPS, also exhibited elevated RFCs. This observation suggests a coordinated response to ABA treatment.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003e3. Relative fold change of TF-encoding genes under chitosan treatment\u003c/h2\u003e \u003cp\u003eUsing chitosan at a concentration of 200 mg/l resulted in significant changes in the expression profiles of transcription factors, as depicted in Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e. All transcription factors showed increased RFCs compared to the untreated control. The WRKY transcription factor exhibited the most significant induction, with peak increases of 10.28-fold and 9.53-fold observed on days 2 and 4, respectively. ERBP was closely followed with a maximum RFC of 3.69 on day 4. Two different groups showed different expression patterns. ERBP, MYCA, and MYCS were continuously upregulated over the 4-day treatment period, whereas BHLH, MYB, and WRKY showed a transient increase in expression followed by a decrease by day 4.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003e4. Relative fold change of TF-encoding genes under chitosan treatment\u003c/h2\u003e \u003cp\u003eAnalysis of RFC for genes encoding enzymes involved in the terpenoid biosynthetic pathway revealed distinct regulatory patterns after chitosan treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e). Notably, TPS2 and TPS3 exhibited the highest RFCs, peaking at 9.29 and 6.77 on days 4 and 2, respectively. Notably, a decrease in TPS2 expression was observed on day 2, with a concomitant increase in TPS3. The RFC of the FPS showed an upward trend (reaching a maximum value of 5), while TPS5 showed a bell-shaped pattern. The enzymes DXR, GGPS and HMGR showed decreased expression on all days. In contrast to ABA treatment, the DXS gene, which encodes the rate-limiting enzyme, showed increased expression under chitosan treatment, reaching 1.61-fold of the control on day 2.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003e5. The effect of ABA and chitosan on the content of valerenic acid\u003c/h2\u003e \u003cp\u003eConcurrently with the transcriptome analyses, we determined the valerenic acid content as mg/g of dry weight of hairy root (mg/g DW) after 1, 2, and 4 days of ABA and chitosan treatments. An untreated sample served as a control each day (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e). The results indicate that chitosan treatment had the highest valerenic acid level (0.68 mg/g DW) on the second day and maintained this level until the fourth day. In contrast, the ABA treatment did not show a significant difference in valerenic acid content between the first and second days. However, it peaked at 0.65 mg/g DW on the fourth day. By the fourth day, the ABA treatment was equal to the chitosan treatment in valerenic acid content. The two treatments were statistically indistinguishable on day four and showed a 1.59-fold increase compared to the control group. Both treatments resulted in a significant increase in valerenic acid levels compared to the control group.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003e6. Analysis of co-expression networks\u003c/h2\u003e \u003cp\u003eCytoscape software was used to construct a co-expression network to explore the positive correlations between RFCs of enzymes, transcription factors (transcriptomics), and valerenic acid profile (metabolomics) following ABA and chitosan treatments.\u003c/p\u003e \u003cp\u003eFigure \u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e illustrates the co-expression network of genes encoding enzymes and transcription factors associated with valerenic acid levels following ABA treatment. Notably, two separate subnetworks (1 and 2) can be identified, with focal points around the WRKY transcription factor and the GGPS enzyme.\u003c/p\u003e \u003cp\u003eSubnetwork 2 contains a group of transcription factors (BHLH, ERBP) and critical enzymes (HMGR, DXR) as well as the FPS and terpene synthases TPS2 and TPS5. Two primary modules BHLH - TPS2 - ERBP and DXR - TPS2 - TPS5 (shown as green egg-shaped structures) converge on TPS2, which s is a central hub. Activation of HMGR, TPS2, and TPS5 by the transcription factors BHLH and ERBP is critical for enhancing valerenic acid accumulation. Furthermore, the significant correlation between HMGR and FPS suggests an increase in metabolic flux and activation of farnesyl diphosphate synthase, which provides precursors for sesquiterpene synthases.\u003c/p\u003e \u003cp\u003eSubnetwork 1 includes the transcription factors MYCA/S and MYB and the enzymes DXS and TPS3. These components are linked to subnetwork 2 by GGPS or WRKY mediators.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eThe co-expression network under chitosan treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003e) exhibits two distinct subnetworks. Notably, Subnetwork 2 contains a significant module involving TPS3 - ERBP - MYB - MYCA. The transcription factors ERBP and MYB serve as hubs and collectively activate three terpene synthases (TPS2/3/5). The level of valerenic acid is highly correlated with the genes encoding FPS and TPS5, suggesting that an elevated farnesyl diphosphate precursor plays a crucial role in activating sesquiterpene synthase 5 (TPS5) and consequently enhancing valerenic acid biosynthesis.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"Disscussion","content":"\u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003e1. Effect of ABA on genes involved in the valerenic acid biosynthesis pathway\u003c/h2\u003e \u003cp\u003eOur results show that the treatment of \u003cem\u003eV. officinalis hairy roots\u003c/em\u003e with ABA (50 \u0026micro;M) led toa significant increase in valerenic acid accumulation. By the fourth day after treatment, the concentration of valerenic acid had peaked at 0.65 mg/g DW (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e). This finding is supported by the data from RFCs (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e), indicating an upregulation in the expression of the transcription factors BHLH and ERBP, along with an increase in TPS2, a pivotal gene in this pathway.\u003c/p\u003e \u003cp\u003eThe bHLH transcription factors are known to play a crucial role in the signaling pathways of JA, ABA, and GA, as well as in the regulation of terpenoid biosynthesis in plants (Hong et al., \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2012\u003c/span\u003e). Recent studies have shown that specific bHLH transcription factors, such as AabHLH112, regulate sesquiterpene biosynthesis, with exogenous MeJA treatment further enhancing this process (Xiang et al., \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Moreover, the upregulation of ERBP and BHLH transcription factors in response to exogenous ABA indicates a potential crosstalk between ABA and jasmonate signaling pathways in controlling sesquiterpenoid biosynthesis (Mertens et al., \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). Identifying of PpbHLH1 binding to the PpTPS3 promoter and activating linalool production in peach cultivars further supports this hypothesis (Wei et al., \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). In conclusion, our research suggests that exogenous ABA may interact with JA, with the bHLH transcription factor being a key player in modulating valerenic acid biosynthesis.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec21\" class=\"Section2\"\u003e \u003ch2\u003e2.Effect of Chitosan on the genes involved in the valerenic acid biosynthetic pathway\u003c/h2\u003e \u003cp\u003eOur study found that treatment of valerian hairy roots with chitosan (200 mg/L) resulted in a significant increase in valerenic acid production (0.68 mg/g DW) within only two days (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e). This increase seems to be related to the activation of genes involved in valerenic acid biosynthesis by transcription factors. Interestingly, the transcription factor expression data (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e) show a marked increase in all factors, with a firm increase in WRKY. This active network of transcription factors probably plays a critical role in inducing the expression of genes involved in valerenic acid production, especially those related to TPS, FPS, and DXS enzymes (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e). Chitosan treatment offers an advantage over ABA because it significantly increases the activity of two key enzymes: DXS and FPS. DXS controls the rate of MEP pathway MEP, while FPS directly produces a building block (farnesyl diphosphate) needed for the sesquiterpene synthases studied. This explains why chitosan treatment leads to faster and higher production of valerenic acid.\u003c/p\u003e \u003cp\u003eIn a parallel study conducted on the hairy root of \u003cem\u003ePsammosilene tunicoides\u003c/em\u003e, it was observed that the transcription of genes involved in saponin metabolism was enhanced by chitosan. This was particularly true for genes encoding stress-responsive transcription factors (WRKYs and NACs) and terpenoid biosynthetic enzymes (DXS), thereby corroborating the findings of our current study (Qiu et al., \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2021\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec22\" class=\"Section2\"\u003e \u003ch2\u003e3. Analysis of co-expression networks\u003c/h2\u003e \u003cp\u003eAnalysis of the co-expression network using Cytoscape software, and its output metrics provides valuable insights into its structural characteristics. Betweenness centrality identifies key nodes that serve as bridges and control the flow of information along the shortest paths, while closeness centrality highlights central nodes that facilitate efficient information dissemination. Degree quantifies a node's direct connections. Together, these metrics provide a comprehensive understanding of the network's topology, node importance, and potential vulnerabilities, shedding light on the dynamics of information flow within the network.\u003c/p\u003e \u003cdiv id=\"Sec23\" class=\"Section3\"\u003e \u003ch2\u003e3.1 ABA Co-expression Network\u003c/h2\u003e \u003cp\u003eExamination of network centrality metrics following ABA treatment provided valuable insights into the structural layout and operational changes within the network. WRKY has the highest betweenness centrality score (0.173), highlighting the central role of the WRKY node in controlling the flow of information through several critical pathways. Figure\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e shows that the two subnetworks are connected by the transcription factor WRKY and the enzyme GGPS, which act as a bridge to facilitate the exchange of information between them.\u003c/p\u003e \u003cp\u003eThe highest closeness centrality score (0.736) assigned to HMGR, GGPS, and valerenic acid indicates their closer proximity to other nodes within the network. The positioning of HMGR, a key regulator influencing pathway rate, among other network nodes, plays a critical role in orchestrating metabolic flow within the regulatory network. The degree analysis highlighted HMGR, GGPS and valerenic acid as nodes with high connectivity, each with a degree of 9, while MYCS and MYCA showed lower connectivity with a degree of 5. It is essential to note the strong activation of DXS by MYCS and the co-expression of DXS and TPS3, as shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e. Although TPS3 and valerenic acid are directly related, their correlation is relatively weak because they are controlled by subnetworks 1 and 2, respectively. This may indicate the different roles played by the product of the TPS3 enzyme, drimenol, and valerenic acid under the influence of ABA treatment. Compared to chitosan treatment, ABA treatment splits the metabolic flux between drimenol and valerenic acid, resulting in a lower accumulation of valerenic acid.\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec24\" class=\"Section2\"\u003e \u003ch2\u003e3.2 Chitosan Co-expression Network\u003c/h2\u003e \u003cp\u003eIn the context of chitosan treatment, network analysis revealed notable trends in centrality metrics. DXS exhibited the highest betweenness centrality value of 0.285, highlighting its critical role in regulating information flow within the network. Closeness centrality values ranged from 0.56 (for HMGR and GGPS) to 1 (for DXS), with DXS emerging as the node closest to others, potentially facilitating efficient information dissemination. DXS had the highest degree of 14, while GGPS and HMGR had a degree of 3, indicating fewer connections in comparison.\u003c/p\u003e \u003cp\u003eDistinct differences between the ABA and chitosan networks were observed. A more robust co-expression association was observed between valerenic acid content and the enzyme TPS3 under chitosan treatment. TPS3 showed significant co-expression with the bottleneck enzyme DXS and is stimulated by the WRKY transcription factor. This suggests a possible connection between the chitosan elicitor and the up-regulation of TPS3, a key player in the response to biotic stress, in contrast to ABA treatment.\u003c/p\u003e \u003cp\u003eThis implies a potential link between the chitosan elicitor and the enhancement of TPS3 expression, a pivotal component in the defense against biotic stress, unlike under ABA treatment. This correlation is reinforced by the conversion of farnesyl pyrophosphate into the sesquiterpene drimenol by VoTPS3 in valerian (Kwon et al., \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2014\u003c/span\u003e), renowned for its antifungal and insect-repellent attributes (Edouarzin et al., \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Henquet et al., \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2017\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eFurthermore, while the GGPS enzyme plays a vital role in the ABA-treated network, its role in the chitosan network is comparatively limited. GGPS is responsible for the conversion of farnesyl diphosphate to geranylgeranyl pyrophosphate, thereby redirecting metabolic flux from the sesquiterpenoid pathway to the diterpenoid and carotenoid pathways (Mokhtari et al., \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2023\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThese differences likely account for the earlier accumulation of more valerenic acid under chitosan treatment than ABA treatment, indicating unique metabolic responses elicited by these two stimulants.\u003c/p\u003e \u003cp\u003eIn subnetwork 2 under chitosan treatment, DXS (rate-limiting enzyme in the MEP biosynthetic pathway;(Tian et al., \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2022\u003c/span\u003e)) plays a crucial connecting node (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003e). On the other hand, in subnetwork 2 under ABA treatment, HMGR (rate-limiting enzyme in the mevalonate biosynthetic pathway;(Liao et al., \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2016\u003c/span\u003e)) occupies an important position (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e). This suggests that the mevalonate biosynthetic pathway may be more important in response to abiotic stress. In contrast, the MEP biosynthetic pathway may be critical in response to biotic stress. In \u003cem\u003ePanax ginseng\u003c/em\u003e, treatment with ABA leads to increased accumulation of triterpenoid ginsenosides and induces upregulation of \u003cem\u003ePgHMGR\u003c/em\u003e (Kong et al., \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2023\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThe control of DXS and HMGR implies a metabolic reorganization in response to ABA treatment. The plant appears to favor the mevalonate pathway over the MEP pathway to generate the sesquiterpenoid ABA. The increased expression of HMGR may indicate an increased need for mevalonate-derived compounds, possibly to support increased ABA production needed for abiotic stress adaptation or developmental functions in treated tissues.\u003c/p\u003e \u003cp\u003eThese results emphasize the critical role of specific nodes in information dissemination and network resilience and highlight the structural characteristics and connectivity dynamics of the network under ABA and chitosan treatment.\u003c/p\u003e \u003c/div\u003e"},{"header":"Conclusion","content":"\u003cp\u003eThis study provides a comprehensive investigation of the valerenic acid metabolic pathways in the hairy roots of \u003cem\u003eV. officinalis\u003c/em\u003e. Specifically, it examines the response of the plant to two treatments: abscisic acid (ABA) and chitosan\u003c/p\u003e \u003cp\u003eABA treatment primarily affected the BHLH and ERBP transcription factors, while chitosan broadly increased transcript levels of all transcription factor families (WRKY, ERBP, and MYB). TPS5, a terpene synthase gene, showed the most robust response under ABA. Conversely, chitosan treatment activated several terpene synthases through these transcription factor hubs.\u003c/p\u003e \u003cp\u003eThis research paves the way for a new generation of valerian plants with increased valerenic acid content. This not only benefits the production of potential therapeutic drugs, but also enhances our understanding of plant stress responses and metabolic regulation. Ultimately, this knowledge can be used to optimize the production of various valuable plant compounds.\u003c/p\u003e \u003cdiv id=\"Sec26\" class=\"Section2\"\u003e \u003ch2\u003eFuture Perspectives and Concluding Remarks\u003c/h2\u003e \u003cp\u003eThis study lays the basis for future research to optimize valerenic acid production in \u003cem\u003eV. officinalis\u003c/em\u003e. By elucidating the critical transcriptional regulators under stress conditions (ABA and chitosan), we have gained valuable insights into how plants fine-tune their metabolism.\u003c/p\u003e \u003cp\u003eHere are some future directions:\u003c/p\u003e \u003cp\u003e \u003cul\u003e \u003cli\u003e \u003cp\u003e \u003cb\u003eEngineering high valerenic acid producers\u003c/b\u003e: We can use the identified hubs (BHLH, ERBP, WRKY, MYB transcription factors) to develop targeted manipulation strategies. This could involve genetic engineering or tailor-made elicitors to increase valerenic acid production.\u003c/p\u003e \u003c/li\u003e \u003cli\u003e \u003cp\u003e \u003cb\u003eNetwork modeling for prediction\u003c/b\u003e: The established network can be further refined to predict the effect of different stimuli on valerenic acid biosynthesis. This will be a powerful tool for identifying optimal growth conditions and stress factors to maximize yield.\u003c/p\u003e \u003c/li\u003e \u003cli\u003e \u003cp\u003e \u003cb\u003eInvestigating the role of other stress signals\u003c/b\u003e: As ABA and chitosan elicited significant responses, it is promising to investigate the influence of other environmental stresses on valerenic acid production.\u003c/p\u003e \u003c/li\u003e \u003c/ul\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"Declarations","content":"\u003cp\u003e \u003ch2\u003eDeclaration of interest\u003c/h2\u003e \u003cp\u003eAuthors do not have any declarations of interest.\u003c/p\u003e \u003c/p\u003e\u003ch2\u003eAuthor Contributions\u003c/h2\u003e \u003cp\u003eAll authors contributed to the study conception and design. Conceptualization: [Arash Mokhtari]; Methodology: [Rasoul Amirian], [Mozhdeh Shafaei], [Iman Arezi], Formal analysis and investigation: [Arash Mokhtari], [Ahmad sobhani]; Writing - original draft preparation: [Arash Mokhtari]; Writing - review and editing: [Arash Mokhtari]; Funding acquisition: [Morteza Ebrahimi]; Resources: [Reza Zarghami], [Pejman Azadi]; Supervision: [Arash Mokhatri]. All authors commented on previous versions of the manuscript. All authors read and approved the final manuscript.\u003c/p\u003e\u003ch2\u003eData availability\u003c/h2\u003e \u003cp\u003eThe data that support the findings of this study are available from the corresponding authorupon reasonable request.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eChen, R., \u0026amp; Zhang, L. (2024). Engineering biology fundamental for plant-derived bioactive compounds: challenges and prospects. \u003cem\u003eEngineering Biology for Microbial Biosynthesis of Plant-Derived Bioactive Compounds\u003c/em\u003e, 285-313.\u003c/li\u003e\n\u003cli\u003eCoca-Ru\u0026iacute;z, V., Su\u0026aacute;rez, I., Aleu, J., \u0026amp; Collado, I. G. (2022). Structures, occurrences and biosynthesis of 11, 12, 13-tri-nor-sesquiterpenes, an intriguing class of bioactive metabolites. \u003cem\u003ePlants\u003c/em\u003e,\u003cem\u003e 11\u003c/em\u003e(6), 769.\u003c/li\u003e\n\u003cli\u003eEdouarzin, E., Horn, C., Paudyal, A., Zhang, C., Lu, J., Tong, Z., Giaever, G., Nislow, C., Veerapandian, R., \u0026amp; Hua, D. H. (2020). Broad-spectrum antifungal activities and mechanism of drimane sesquiterpenoids. \u003cem\u003eMicrobial Cell\u003c/em\u003e,\u003cem\u003e 7\u003c/em\u003e(6), 146.\u003c/li\u003e\n\u003cli\u003eHenquet, M. G., Prota, N., van der Hooft, J. J., Varbanova‐Herde, M., Hulzink, R. J., de Vos, M., Prins, M., de Both, M. T., Franssen, M. C., \u0026amp; Bouwmeester, H. (2017). Identification of a drimenol synthase and drimenol oxidase from Persicaria hydropiper, involved in the biosynthesis of insect deterrent drimanes. \u003cem\u003eThe Plant Journal\u003c/em\u003e,\u003cem\u003e 90\u003c/em\u003e(6), 1052-1063.\u003c/li\u003e\n\u003cli\u003eHong, G.-J., Xue, X.-Y., Mao, Y.-B., Wang, L.-J., \u0026amp; Chen, X.-Y. (2012). Arabidopsis MYC2 interacts with DELLA proteins in regulating sesquiterpene synthase gene expression. \u003cem\u003eThe Plant Cell\u003c/em\u003e,\u003cem\u003e 24\u003c/em\u003e(6), 2635-2648.\u003c/li\u003e\n\u003cli\u003eKong, L., Chen, P., \u0026amp; Chang, C. (2023). Drought resistance and ginsenosides biosynthesis in response to abscisic acid in Panax ginseng CA Meyer. \u003cem\u003eInternational journal of molecular sciences\u003c/em\u003e,\u003cem\u003e 24\u003c/em\u003e(11), 9194.\u003c/li\u003e\n\u003cli\u003eKwon, M., Cochrane, S. A., Vederas, J. C., \u0026amp; Ro, D.-K. (2014). Molecular cloning and characterization of drimenol synthase from valerian plant (Valeriana officinalis). \u003cem\u003eFEBS letters\u003c/em\u003e,\u003cem\u003e 588\u003c/em\u003e(24), 4597-4603.\u003c/li\u003e\n\u003cli\u003eLiao, P., Hemmerlin, A., Bach, T. J., \u0026amp; Chye, M.-L. (2016). The potential of the mevalonate pathway for enhanced isoprenoid production. \u003cem\u003eBiotechnology advances\u003c/em\u003e,\u003cem\u003e 34\u003c/em\u003e(5), 697-713.\u003c/li\u003e\n\u003cli\u003eMai, J., Li, W., Ledesma-Amaro, R., \u0026amp; Ji, X.-J. (2021). Engineering plant sesquiterpene synthesis into yeasts: a review. \u003cem\u003eJournal of Agricultural and Food Chemistry\u003c/em\u003e,\u003cem\u003e 69\u003c/em\u003e(33), 9498-9510.\u003c/li\u003e\n\u003cli\u003eMertens, J., Van Moerkercke, A., Vanden Bossche, R., Pollier, J., \u0026amp; Goossens, A. (2016). Clade IVa basic helix\u0026ndash;loop\u0026ndash;helix transcription factors form part of a conserved jasmonate signaling circuit for the regulation of bioactive plant terpenoid biosynthesis. \u003cem\u003ePlant and Cell Physiology\u003c/em\u003e,\u003cem\u003e 57\u003c/em\u003e(12), 2564-2575.\u003c/li\u003e\n\u003cli\u003eMokhtari, A., Omidi, M., Ebrahimi, M., Alizade, H., \u0026amp; Sobhani, A. (2023). Evaluation of the transcriptome of valerian (Valeriana officinalis) to identify genes involved in terpenoids biosynthesis pathway. \u003cspan dir=\"RTL\"\u003eفصلنامه علمی ژنتیک نوین, 18(2), 111-123\u003c/span\u003e.\u003c/li\u003e\n\u003cli\u003eMokhtari, A., Omidi, M., Ebrahimi, M., Alizadeh, H., Sobhani, A., Azadi, P., Noormohammadi, N., \u0026amp; Shafaie, M. (2024). Optimizing the extract yield of bioactive compounds in Valeriana officinalis root: a D-optimal design. \u003cem\u003ePreparative Biochemistry \u0026amp; Biotechnology\u003c/em\u003e, 1-11.\u003c/li\u003e\n\u003cli\u003eQiu, H., Su, L., Wang, H., \u0026amp; Zhang, Z. (2021). Chitosan elicitation of saponin accumulation in Psammosilene tunicoides hairy roots by modulating antioxidant activity, nitric oxide production and differential gene expression. \u003cem\u003ePlant Physiology and Biochemistry\u003c/em\u003e,\u003cem\u003e 166\u003c/em\u003e, 115-127.\u003c/li\u003e\n\u003cli\u003eTian, S., Wang, D., Yang, L., Zhang, Z., \u0026amp; Liu, Y. (2022). A systematic review of 1-Deoxy-D-xylulose-5-phosphate synthase in terpenoid biosynthesis in plants. \u003cem\u003ePlant Growth Regulation\u003c/em\u003e,\u003cem\u003e 96\u003c/em\u003e(2), 221-235.\u003c/li\u003e\n\u003cli\u003eValach, M. (2016). RNA extraction using the\u0026apos;home-made\u0026apos;Trizol substitute. In.\u003c/li\u003e\n\u003cli\u003eWalls, L. E., \u0026amp; Rios-Solis, L. (2020). Sustainable production of microbial isoprenoid derived advanced biojet fuels using different generation feedstocks: A review. \u003cem\u003eFrontiers in Bioengineering and Biotechnology\u003c/em\u003e,\u003cem\u003e 8\u003c/em\u003e, 599560.\u003c/li\u003e\n\u003cli\u003eWei, C., Liu, H., Cao, X., Zhang, M., Li, X., Chen, K., \u0026amp; Zhang, B. (2021). Synthesis of flavour‐related linalool is regulated by PpbHLH1 and associated with changes in DNA methylation during peach fruit ripening. \u003cem\u003ePlant Biotechnology Journal\u003c/em\u003e,\u003cem\u003e 19\u003c/em\u003e(10), 2082-2096.\u003c/li\u003e\n\u003cli\u003eWong, J. (2017). \u003cem\u003eEngineering microbial production of terpenoids\u003c/em\u003e. University of California, Berkeley.\u003c/li\u003e\n\u003cli\u003eXiang, L., He, P., Shu, G., Yuan, M., Wen, M., Lan, X., Liao, Z., \u0026amp; Tang, Y. (2022). AabHLH112, a bHLH transcription factor, positively regulates sesquiterpenes biosynthesis in Artemisia annua. \u003cem\u003eFrontiers in Plant Science\u003c/em\u003e,\u003cem\u003e 13\u003c/em\u003e, 973591.\u003c/li\u003e\n\u003cli\u003eZhao, M., Zhang, C., Wang, H., He, S., \u0026amp; Lu, W. (2022). Biosynthesis of valerenic acid by engineered Saccharomyces cerevisiae. \u003cem\u003eBiotechnology Letters\u003c/em\u003e,\u003cem\u003e 44\u003c/em\u003e(7), 857-865.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"plant-cell-tissue-and-organ-culture-pctoc","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"pcto","sideBox":"Learn more about [Plant Cell, Tissue and Organ Culture (PCTOC)](https://www.springer.com/journal/11240)","snPcode":"11240","submissionUrl":"https://submission.nature.com/new-submission/11240/3","title":"Plant Cell, Tissue and Organ Culture (PCTOC)","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"Abiotic stress, Coexpression network, Sesquiterpene synthases, transcription factor, Valeriana officinalis","lastPublishedDoi":"10.21203/rs.3.rs-5417801/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-5417801/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eValerenic acid is a sesquiterpene compound found in \u003cem\u003eValeriana officinalis\u003c/em\u003e (valerian) and has gained attention for its potential as a natural remedy for anxiety, insomnia, and stress-related disorders due to its calming and sedative properties. The low compound content and slow plant growth have limited its production, so a biotechnological approach such as hairy root culture is needed to scale up valerenic acid without using natural resources. This study aims to elucidate the structural and dynamic features of the gene and transcription factor network underlying valerenic acid production in the hairy root cultures of valerian under ABA and chitosan elicitation. ABA treatment induced significant changes in the expression of BHLH and ERBP transcription factors. Their relative expression levels peaked on the second day. Among the genes encoding terpene synthase enzymes, TPS5 shows the strongest induction. When induced with chitosan, the transcription factors BHLH and ERBP play a critical role in enhancing valerenic acid accumulation by upregulating the expression of HMGR, TPS2, and TPS5. In addition, WRKY, ERBP, and MYB transcription factors act as critical regulators in the activation of terpene synthases. Chitosan treatment leads to the highest valerenic acid level (0.68 mg/g DW) on day 2. In comparison, ABA triggers the highest valerenic acid level (0.65 mg/g DW) on day 4. Our results have significant implications for the development of efficient and sustainable strategies for the large-scale production of valerenic acid, a valuable compound widely used in the pharmaceutical industry.\u003c/p\u003e","manuscriptTitle":"Comparative Network Analysis under ABA and Chitosan Treatments: Unveiling Key Transcriptional Regulators of Valerenic Acid Biosynthesis in Valerian Hairy Roots","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-11-29 05:40:50","doi":"10.21203/rs.3.rs-5417801/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"reviewerAgreed","content":"","date":"2024-11-12T02:05:15+00:00","index":0,"fulltext":""},{"type":"reviewersInvited","content":"","date":"2024-11-11T16:08:32+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-11-09T14:46:40+00:00","index":"","fulltext":""},{"type":"submitted","content":"Plant Cell, Tissue and Organ Culture (PCTOC)","date":"2024-11-08T11:08:08+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"plant-cell-tissue-and-organ-culture-pctoc","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"pcto","sideBox":"Learn more about [Plant Cell, Tissue and Organ Culture (PCTOC)](https://www.springer.com/journal/11240)","snPcode":"11240","submissionUrl":"https://submission.nature.com/new-submission/11240/3","title":"Plant Cell, Tissue and Organ Culture (PCTOC)","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"452b71f9-5cc0-480d-a146-1397ba326569","owner":[],"postedDate":"November 29th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2025-02-24T15:59:32+00:00","versionOfRecord":{"articleIdentity":"rs-5417801","link":"https://doi.org/10.1007/s11240-025-02990-y","journal":{"identity":"plant-cell-tissue-and-organ-culture-pctoc","isVorOnly":false,"title":"Plant Cell, Tissue and Organ Culture (PCTOC)"},"publishedOn":"2025-02-17 15:57:03","publishedOnDateReadable":"February 17th, 2025"},"versionCreatedAt":"2024-11-29 05:40:50","video":"","vorDoi":"10.1007/s11240-025-02990-y","vorDoiUrl":"https://doi.org/10.1007/s11240-025-02990-y","workflowStages":[]},"version":"v1","identity":"rs-5417801","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-5417801","identity":"rs-5417801","version":["v1"]},"buildId":"ApUGefWb6u5IBVtyqm6d5","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}