Association between mitochondrial SIRTs (SIRT3, SIRT4, and SIRT5) and PCOS.

The basic clinical characteristics of patients in the PCOS group and the control group were compared and analyzed. In peripheral blood samples, there were no statistically significant differences between the two groups in terms of age, duration of infertility, FPG, and BMI ( P  > 0.05). However, basal serum LH levels, LH/FSH ratio, E2, and T levels in the PCOS group were significantly higher than the control group ( P   0.05). Additionally, the PCOS group showed significantly higher AFC, AMH, FINS, and HOMA-IR levels than the control group ( P  < 0.05) (Table  2 ). Table 2 Comparison of clinical characteristics of peripheral blood samples Clinical indicators PCOS ( n  = 103) Control ( n  = 102) t / Z P- value Age (years) 29.88 ± 5.03 30.75 ± 5.00 − 1.244 0.215 Duration of infertility (years) 3 (1,5) 2 (1,5) − 1.673 0.094 Antral follicle count 27 (22,34) 14 (10,17) − 10.908 < 0.001* Basic sex hormone  FSH (IU/L) 5.60 ± 2.32 6.08 ± 2.24 − 1.511 0.132  LH (IU/L) 7.42 (3.36,11.40) 4.48 (3.13,6.18) − 4.316 < 0.001*  LH/FSH 1.32 (0.89,2.01) 0.74 (0.56,1.02) − 6.131 < 0.001*  E2 (pg/mL) 40.18 ± 222.59 34.36 ± 16.02 2.131 0.034*   P (ng/mL) 0.37 ± 0.18 0.40 ± 0.19 − 0.912 0.363   T (ug/L) 0.73 (0.44,0.99) 0.36 (0.29,0.41) − 8.412 < 0.001*  PRL (ug/L) 17.45 ± 5.98 16.19 ± 5.51 1.567 0.119 AMH (ng/mL) 6.28 (3.76,8.96) 2.84 (1.72,4.84) − 6.465 < 0.001* FPG (mmol/L) 5.00 (4.70,5.46) 4.90 (4.67,5.26) − 1.354 0.176 FINS (pmol/L) 81.00 (65.00,121.85) 55.00 (44.30,65.00) − 8.386 < 0.001* HOMA-IR 2.60 (1.99,3.95) 1.74 (1.39,1.99) − 8.376 < 0.001* BMI (kg/m 2 ) 23.44 (20.81,26.67) 22.45 (20.54,25.77) − 1.586 0.113 Data are presented as the mean ± standard deviation, or median (interquartile range). FSH follicle-stimulating hormone, LH luteinizing hormone, E2 estradiol, P progestogens, T testosterone, PRL prolactin, AMH anti-mullerian hormone, FPG Fasting Plasma Glucose, FINS Fasting Insulin, HOMAIR homeostatic model assessment of insulin resistance, BMI body mass index; P- value from Mann–Whitney U test or independent t -test for continuous variables. * P- value < 0.05 indicates a statistically significant association between the variables Comparison of clinical characteristics of peripheral blood samples Data are presented as the mean ± standard deviation, or median (interquartile range). FSH follicle-stimulating hormone, LH luteinizing hormone, E2 estradiol, P progestogens, T testosterone, PRL prolactin, AMH anti-mullerian hormone, FPG Fasting Plasma Glucose, FINS Fasting Insulin, HOMAIR homeostatic model assessment of insulin resistance, BMI body mass index; P- value from Mann–Whitney U test or independent t -test for continuous variables. * P- value < 0.05 indicates a statistically significant association between the variables In follicular fluid samples, no significant differences were observed between the two groups in age, duration of infertility, basal serum FSH, E2, P , and PRL levels ( P  > 0.05). In contrast, the PCOS group exhibited significantly higher AFC, basal LH levels, LH/FSH ratio, AMH, FPG, HOMA-IR, and BMI compared to the control group ( P  < 0.05) (Table  3 ). Table 3 Comparison of clinical characteristics of follicular fluid samples Clinical indicators PCOS ( n  = 106) Control ( n  = 102) t / Z P- value Age (years) 31 (28,34) 31 (28,35) − 0.916 0.360 Duration of infertility (years) 3 (2,5) 3 (1,5) − 1.253 0.210 Antral follicle count 27 (23,31) 13 (10,15) − 12.115 < 0.001* Basic sex hormone  FSH (IU/L) 5.83 (4.37,5.83) 6.16 (4.50,7.67) − 1.107 0.268  LH (IU/L) 6.13 (3.56,9.54) 4.04 (2.55,5.38) − 4.627 < 0.001*  LH/FSH 1.13 (0.74,1.62) 0.68 (0.52,0.98) − 5.634 < 0.001*  E2 (pg/mL) 37.46 (27.56,53.87) 33.40 (23.35,51.65) − 1.330 0.184   P (ng/mL) 0.34 ± 0.18 0.35 ± 0.20 − 0.328 0.743   T (ug/L) 0.71 ± 0.29 0.34 ± 0.11 12.458 < 0.001*  PRL (ug/L) 17.41 ± 6.19 16.95 ± 6.27 0.536 0.592 AMH (ng/mL) 5.94 (4.14,7.89) 2.12 (1.65,3.16) − 9.777 < 0.001* FPG (mmol/L) 5.10 (4.79,5.44) 4.80 (4.60,5.13) − 4.062 < 0.001* FINS (pmol/L) 84.75 (75.00,158.98) 60.00 (45.00,74.29) − 8.719 < 0.001* HOMA-IR 2.64 (2.45,5.25) 1.88 (1.39,2.38) − 9.114 < 0.001* BMI (kg/m 2 ) 24.01 (21.44,27.37) 22.03 (19.95,24.17) − 3.786 < 0.001* P- value from Mann–Whitney U test or independent t -test for continuous variables. * P- value < 0.05 indicates a statistically significant association between the variables Comparison of clinical characteristics of follicular fluid samples P- value from Mann–Whitney U test or independent t -test for continuous variables. * P- value < 0.05 indicates a statistically significant association between the variables To investigate the expression of mitochondrial SIRTs in PCOS patients, we collected peripheral blood mononuclear cells and follicular fluid GCs in each group. The mRNA expression levels of SIRT3, SIRT4, and SIRT5 were then measured by RT-qPCR to validate their differential expression and explore their potential roles in PCOS. The results showed that in peripheral blood mononuclear cells, the mRNA expression levels of SIRT3 ( P  = 0.020) and SIRT5 ( P  = 0.010) in the PCOS group were significantly lower than control group, and the expression levels of SIRT4 were not statistically significant between the PCOS and control groups ( P  = 0.396) (Fig.  1 A–C). In follicular fluid GCs, SIRT3 ( P  = 0.042) and SIRT5 ( P  = 0.017) mRNA levels in PCOS patients were also significantly lower than the control group, consistent with peripheral blood findings. (Fig.  1 D, E). Fig. 1 The expression levels of SIRT3 and SIRT5 were decreased in peripheral blood mononuclear cells and GCs from patients with PCOS. ( A – C ) The relative expression levels of SIRT3, SIRT4, and SIRT5 were analyzed in peripheral blood mononuclear cells from women with PCOS ( n = 103) and control subjects ( n = 102). ( D , E ) The relative expression levels of SIRT3 and SIRT5 were analyzed in GCs from women with PCOS ( n = 106) and control subjects ( n = 102) The expression levels of SIRT3 and SIRT5 were decreased in peripheral blood mononuclear cells and GCs from patients with PCOS. ( A – C ) The relative expression levels of SIRT3, SIRT4, and SIRT5 were analyzed in peripheral blood mononuclear cells from women with PCOS ( n = 103) and control subjects ( n = 102). ( D , E ) The relative expression levels of SIRT3 and SIRT5 were analyzed in GCs from women with PCOS ( n = 106) and control subjects ( n = 102) In addition, this study investigated the relationship between the expression of SIRT3 and SIRT5 in GCs and the classical phenotypes of PCOS (obesity, hyperandrogenemia, and insulin resistance). Based on the presence or absence of obesity (BMI ≥ 25 kg/m 2 ), patients in both groups were categorized into four subgroups: normal-weight control group (Control, n  = 81), obese control group (Obe-Control, n  = 21), normal-weight PCOS group (PCOS, n  = 63), and obese PCOS group (Obe-PCOS, n  = 43). According to the presence or absence of hyperandrogenemia (HA, defined as T  ≥ 0.7 µg/L), patients in the PCOS group were divided into two subgroups: PCOS with HA (HA-PCOS, n  = 50) and PCOS without HA (NHA-PCOS, n  = 56). Based on the presence or absence of insulin resistance (IR, defined as HOMA-IR ≥ 2.69), PCOS patients were also classified into two subgroups: PCOS with IR (IR-PCOS, n  = 49) and PCOS without IR (NIR-PCOS, n  = 57). As shown in Fig.  2 A–C, the expression level of SIRT3 in both the HA-PCOS ( P  = 0.0122) and IR-PCOS ( P  = 0.0065) subgroups was significantly lower than the control group. In addition, the expression level of SIRT5 was significantly reduced in the Obe-PCOS ( P  = 0.0387) and IR-PCOS ( P  = 0.0049) subgroups (Fig.  2 D–F). Fig. 2 Expression levels of SIRT3 and SIRT5 mRNA in GCs from different PCOS subgroups. ( A , D ) Comparison of SIRT3, SIRT5 expression levels in Control, obe-Control, PCOS and obe-PCOS. ( B , E ) Comparison of SIRT3, SIRT5 expression levels in Control, IR-PCOS and NIR-PCOS. ( C , F ) Comparison of SIRT3, SIRT5 expression levels in Control, HA-PCOS and NHA-PCOS Expression levels of SIRT3 and SIRT5 mRNA in GCs from different PCOS subgroups. ( A , D ) Comparison of SIRT3, SIRT5 expression levels in Control, obe-Control, PCOS and obe-PCOS. ( B , E ) Comparison of SIRT3, SIRT5 expression levels in Control, IR-PCOS and NIR-PCOS. ( C , F ) Comparison of SIRT3, SIRT5 expression levels in Control, HA-PCOS and NHA-PCOS Next, we performed Pearson or Spearman correlation analysis between the expression levels of SIRTs and clinical characteristics. Higher SIRT3 expression was associated with lower levels of age ( r  = 0.2764, P  = 0.004, pFDR = 0.011), T ( r  = 0.2879, P  = 0.0028, pFDR = 0.008), FINS ( r  = 0.4109, P  < 0.0001, pFDR < 0.0001), and HOMA-IR ( r  = 0.3971, P  < 0.0001, pFDR < 0.0001) (Fig.  3 A–D). Meanwhile, Higher SIRT5 expression was associated with lower levels of FINS ( r  = 0.2824, P  = 0.0034, pFDR = 0.019) and HOMA-IR (r = 0.2601, P  = 0.0071, pFDR = 0.030) (Fig.  3 E, F). These findings suggest that SIRT3 and SIRT5 play potential roles in pathological processes such as hyperandrogenism and insulin resistance. Fig. 3 The relative expression levels of SIRT3 and SIRT5 were correlated with clinical characteristics in both PCOS and Control groups. ( A – D ) The associations between SIRT3 expression and age, T, FINS, and HOMA-IR were examined in both the control group and the PCOS group. ( E – F ) The associations between SIRT5 expression and FINS and HOMA-IR were examined in both the control group. Statistical analysis was conducted using Pearson’s correlation test. The control group is represented by blue dots, while the PCOS group is represented by red dots The relative expression levels of SIRT3 and SIRT5 were correlated with clinical characteristics in both PCOS and Control groups. ( A – D ) The associations between SIRT3 expression and age, T, FINS, and HOMA-IR were examined in both the control group and the PCOS group. ( E – F ) The associations between SIRT5 expression and FINS and HOMA-IR were examined in both the control group. Statistical analysis was conducted using Pearson’s correlation test. The control group is represented by blue dots, while the PCOS group is represented by red dots We hypothesised that SIRT3 and SIRT5 may play an important role in the development and progression of PCOS by regulating oxidative stress and mitochondrial dysfunction. To test this hypothesis, the mRNA expression levels of oxidative stress-related indicator (CAT) and mitochondrial function indicator (MTTFA) were examined by RT-qPCR in this study. Meanwhile, the correlation between the expression levels of SIRTs and the expression of the above molecules (CAT, MTTFA) was assessed by Pearson or Spearman correlation analysis. We found that the expression levels of CAT ( P  < 0.0001), and MTTFA ( P  = 0.0031) were significantly reduced in GCs from PCOS patients (Fig.  4 A, B). In addition, the expression levels of SIRT3 and SIRT5 were positively correlated with the expression levels of CAT, and MTTFA (Fig.  4 C–F). These results suggest that oxidative stress and mitochondrial dysfunction may exist in PCOS patients, and SIRT3 and SIRT5 may play an important role in the occurrence and development of PCOS by regulating oxidative stress and mitochondrial dysfunction. Fig. 4 The expression levels of CAT and MTTFA were decreased in GCs from patients with PCOS and the relative expression levels of SIRT3 and SIRT5 were correlated with the expression of CAT and MTTFA in both control women and PCOS patients. ( A – B ) The relative expression levels of CAT and MTTFA were analyzed in GCs from women with PCOS ( n = 106) and control subjects ( n = 102). ( C – D) Correlation between SIRT3 expression levels and CAT and MTTFA expression levels. ( E – F ) Correlation between SIRT5 expression levels and CAT and MTTFA expression levels The expression levels of CAT and MTTFA were decreased in GCs from patients with PCOS and the relative expression levels of SIRT3 and SIRT5 were correlated with the expression of CAT and MTTFA in both control women and PCOS patients. ( A – B ) The relative expression levels of CAT and MTTFA were analyzed in GCs from women with PCOS ( n = 106) and control subjects ( n = 102). ( C – D) Correlation between SIRT3 expression levels and CAT and MTTFA expression levels. ( E – F ) Correlation between SIRT5 expression levels and CAT and MTTFA expression levels Follicular fluid samples from patients undergoing IVF were analyzed by ELISA to assess the protein levels of SIRT3, SIRT5, CAT, and MTTFA. Consistent with the transcriptomic findings, the protein abundance of SIRT3 and SIRT5, along with CAT and MTTFA, in PCOS patients was lower than controls ( P  < 0.05) (Fig.  5 A–D). The results of the correlation between the protein expression levels of SIRTs and the protein expression of CAT and MTTFA are shown in Fig.  5 , where SIRT3 was positively correlated with the protein levels of both CAT ( r  = 0.59, P  < 0.0001, pFDR < 0.0001) and MTTFA ( r  = 0.73, P  < 0.0001, pFDR < 0.0001); moreover, the protein expression level of SIRT5 was positively correlated with the protein level of MTTFA ( r  = 0.52, P  = 0.0005, pFDR = 0.0009) (Fig.  5 E–H). These results further support the involvement of SIRT3 and SIRT5 in PCOS pathogenesis, potentially through mechanisms related to oxidative stress and mitochondrial dysfunction. Fig. 5 The protein abundance levels of SIRT3, SIRT5, CAT, and MTTFA were decreased in follicular fluid from patients with PCOS, and the protein levels of SIRT3 and SIRT5 were correlated with the protein levels of CAT and MTTFA in both control women and PCOS patients. ( A – D ) The protein abundance levels of SIRT3, SIRT5, CAT, and MTTFA were analyzed in follicular fluid from women with PCOS ( n = 20) and control subjects ( n = 21). ( E – F ) Correlation between SIRT3 protein levels and CAT and MTTFA protein levels. ( G – H ) Correlation between SIRT5 protein levels and CAT and MTTFA protein levels The protein abundance levels of SIRT3, SIRT5, CAT, and MTTFA were decreased in follicular fluid from patients with PCOS, and the protein levels of SIRT3 and SIRT5 were correlated with the protein levels of CAT and MTTFA in both control women and PCOS patients. ( A – D ) The protein abundance levels of SIRT3, SIRT5, CAT, and MTTFA were analyzed in follicular fluid from women with PCOS ( n = 20) and control subjects ( n = 21). ( E – F ) Correlation between SIRT3 protein levels and CAT and MTTFA protein levels. ( G – H ) Correlation between SIRT5 protein levels and CAT and MTTFA protein levels

In this study, a case–control study was used, and patients who visited the Reproductive Medicine Center of the Affiliated Hospital of Youjiang Medical University for Nationalities in Guangxi from September 2022 to September 2023 were selected for the study. Patients with polycystic ovary syndrome served as the case group, and age-matched patients who underwent assisted reproductive technology for fertilization due to tubal factors or male factors were selected as the control group. Inclusion criteria were as follows: ① Case group: The diagnostic criteria for PCOS were based on the Rotterdam criteria recommended by ESHRE/ASRM in 2003: (1) oligo-ovulation and/or anovulation (OA); (2) increased serum androgen levels and/or hyperandrogenism (HA); (3) polycystic ovarian changes. The presence of two of these three at the same time leads to a diagnosis of PCOS. ② Control group: patients with infertility due to tubal or male factors, regular menstruation (menstrual cycle of 28 ± 7 days), no clinical signs of hyperandrogenism, normal ovulation by ultrasound monitoring, and normal morphology of both ovaries during the same period. Exclusion criteria were as follows: ① age > 40 years; ② presence of endocrine or metabolic diseases, such as diabetes mellitus, thyroid dysfunction, Cushing’s syndrome; ③ diseases affecting ovarian function, such as premature ovarian failure, endometriosis, ovarian cysts, or a history of ovarian surgery; ④ serious systemic diseases, such as hepatic and renal insufficiency, malignant tumors. A total of 205 peripheral blood samples were collected (103 in the PCOS group and 102 in the control group) and 208 follicular fluid samples were collected (106 in the PCOS group and 102 in the control group). Complete clinical data were available for all study participants, and no significant difference was observed in the age distribution between the groups ( P  > 0.05). The study protocol was approved by the hospital Ethics Committee, and specimens were collected after obtaining informed consent from all participants. The mononuclear cells and GCs were centrifuged from peripheral blood and follicular fluid, respectively. According to the manufacturer's instructions, the total RNA was extracted from mononuclear cells and GCs using TRIzol™ Reagent (ECOTOP Scientific, Inc., Guangzhou, CHINA). The concentration and purity of the extracted RNA was analysed using a NanoDrop® 2000 spectrophotometer (Thermo, USA). The extracted RNA was transcribed into cDNA using a reverse transcription kit and quantified on a Roche Light Cycler 480 system using SYBR Green PCR Master Mix. RT‑qPCR is divided into four phases: Phase I (initial denaturation): 95 °C for 30 s. Phase II (PCR): 95 °C for 5 s, then 60 °C for 30 s. The phase was set to 40 cycles. Phase III (unlinking): reaction temperature was 95 °C for 5 s, then 65 °C for 60 s. Phase IV (cooling): reaction temperature was 50 °C for 30 s, then 4 °C. Primer sequences used in the amplification process can be found in Table  1 . The normalization was undertaken to the housekeeping gene β-actin and the 2 [−ΔΔCt] method was used to detect the relative gene expression. Table 1 RT-qPCR primers for Mitochondrial SIRTs, CAT, MTTFA and β-Actin Gene Oligonucleotide Sequence (5ʹ → 3ʹ) Tm (°C) SIRT3 SIRT3-F SIRT3-R CTTGAGAGAGTGTCGGGCATCC AGGTGGCAGAGGCAAAGGTTC 60.4 60.7 SIRT4 SIRT4-F SIRT4-R AATTCTCCTCCCACCAGCCTAAC 59.1 GTCACCAACCAGTACAGCTTTCC 58.4 SIRT5 SIRT5-F AGCAAAGCACATAGTCATCATCTCAG 56.7 SIRT5-R TTCTCCAATAACCTCCAGCTCCTC 58.4 CAT CAT-F CAT-R GACATTACCAAATACTCCAAGGCAAAG 55.8 GAACCCGATTCTCCAGCAACAG 58.7 MTTFA MTTFA-F MTTFA-R GCGGAGTGGCAGGTATATAAAGAAG 57.4 CAAAGACATAATCTGACTTGGAGTTAGC 55.1 β-Actin ACTB-F ACTB-R CCACGAAACTACCTTCAACTCCATC 57.6 AGTGATCTCCTTCTGCATCCTGTC 58.5 RT-qPCR primers for Mitochondrial SIRTs, CAT, MTTFA and β-Actin SIRT3-F SIRT3-R CTTGAGAGAGTGTCGGGCATCC AGGTGGCAGAGGCAAAGGTTC SIRT4-F SIRT4-R CAT-F CAT-R MTTFA-F MTTFA-R ACTB-F ACTB-R To quantify the levels of target proteins in serum and follicular fluid samples, enzyme-linked immunosorbent assay (ELISA) was performed. This kit uses a double antibody sandwich ELISA. In a microtiter plate pre-coated with antibody (solid phase antibody), calibrators and samples to be tested are added, and then HRP-labeled antibody (ELISA antibody) is added. After warming and sufficient washing to remove unbound components, a sandwich complex of solid phase antibody-antigen-ELISA antibody is formed on the solid phase surface of the microtiter plate. Substrate A and B are added, and the substrate, catalyzed by HRP, produces a blue product, which is finally converted to yellow under the action of the termination solution (acidic solution). Absorbance (OD) is measured at 450 nm on an enzyme marker, which is positively correlated with the concentration of the protein measured in the sample to be tested. Fitting the calibrator curve, the concentration of the target protein in the sample can be calculated. SPSS 27.0 software and GraphPad Prism 8.3 software were used for statistical processing. Normally distributed measures were expressed as \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\overline{x} \pm s$$\end{document} x ¯ ± s , non-normally distributed data were then expressed as median M and quartiles (P25, P75). Comparisons between groups were performed using t -tests, ANOVA, or rank-sum tests, as appropriate based on the data distribution and type. Correlation between variables was analyzed by Pearson or Spearman correlation analysis, and the false discovery rate (FDR) method was employed to rigorously correct for multiple comparisons. The test level a  = 0.05, and the difference was considered statistically significant at P  < 0.05.

This study found that the expression levels of SIRT3 and SIRT5 were downregulated in peripheral blood mononuclear cells and follicular fluid granulosa cells of PCOS patients, potentially contributing to oxidative stress and mitochondrial dysfunction. These findings suggest that SIRT3 and SIRT5 may play critical roles in the pathogenesis of PCOS. Although causality cannot be confirmed in this observational study, our results provide a foundation for future mechanistic investigations. Importantly, modulation of SIRT3 and SIRT5 activity holds promise as a novel therapeutic strategy to restore metabolic balance and improve reproductive outcomes in PCOS patients.

Mitochondrial SIRTs, including SIRT3, SIRT4, and SIRT5, have garnered increasing attention for their critical roles in regulating mitochondrial function, energy metabolism, oxidative stress responses, and cell survival [ 22 ]. PCOS, a common endocrine disorder characterized by metabolic dysregulation and redox imbalance, is believed to involve mitochondrial dysfunction in its pathogenesis. The relationship between mitochondrial SIRTs and PCOS has gained increasing research interest. This study aimed to systematically evaluate the expression levels of mitochondrial SIRTs in PCOS patients and to explore their associations with metabolic parameters and mitochondrial function. Based on a large clinical sample cohort, we found that the expression levels of SIRT3 and SIRT5 in PCOS were significantly lower the control group, whereas there was no statistically significant difference in the expression level of SIRT4. Further correlation analysis revealed that Higher SIRT3 expression was associated with lower levels of age, T, fasting insulin and HOMA-IR in GCs of patients with PCOS; and Higher SIRT5 expression was associated with lower levels of fasting insulin and HOMA-IR. In addition, CAT, an oxidative stress-related indicator, and MTTFA, an indicator of mitochondrial function, were significantly downregulated in PCOS patients. Notably, the expression levels of SIRT3 and SIRT5 were significantly and positively correlated with the expression levels of oxidative stress-related indicators CAT and mitochondrial function indicator MTTFA. These findings suggest that SIRT3 and SIRT5 may contribute to the pathogenesis of PCOS by modulating oxidative stress and mitochondrial function, providing new insights into the molecular mechanisms of PCOS and potential targets for therapeutic intervention. SIRT3 is a major mitochondrial deacetylase, and many of its targets have important roles in metabolic homeostasis [ 13 ]. It protects cells against oxidative stress by protecting them from ROS. Studies have shown that the expression of SIRT3 is reduced in an age-dependent manner in the ovary, and its absence accelerates mouse ovarian senescence. In addition, aberrant function of SIRT3 leads to failure of oocyte meiotic maturation [ 23 ]. Previous studies have shown inconsistent results regarding SIRT3 expression in PCOS. A clinical study [ 24 ] revealed that there was no significant difference in the level of SIRT3 gene expression in ovarian GCs of PCOS patients. In contrast, Pang [ 25 ] reported that SIRT3 expression was significantly downregulated in a dehydroepiandrosterone-induced PCOS mouse model, and overexpression of SIRT3 could improve PCOS-related ovarian structural abnormalities and hormonal imbalances. Conversely, another study [ 24 ] found that the protein expression level of SIRT3 was elevated in the ovarian tissue of PCOS mouse models. The researchers suggested that this upregulation might be an adaptive response of the ovary to methylglyoxal (MG)-dependent glycation stress and oxidative stress, rather than a direct regulation induced by PCOS itself. In our study, we observed significantly decreased SIRT3 expression in both peripheral blood mononuclear cells and follicular fluid granulosa cells from PCOS patients, with a more pronounced reduction in the IR-PCOS and HA-PCOS subgroups. This finding aligns with the majority of existing studies reporting SIRT3 downregulation in PCOS and further supports its potential regulatory role in the disease. SIRT4 is distributed in fetal and adult tissues and is expressed at high levels in liver, heart, spleen, prostate, testis, kidney, ovary, white adipose tissue and muscle, and plays an important role in the regulation of mitochondrial metabolism [ 26 ]. SIRT4 has been demonstrated to play a pivotal role in the regulation of fatty acid metabolism in skeletal muscle and white adipose tissue. This is achieved through the process of deacetylation and the inhibition of malonyl coenzyme A decarboxylase [ 27 , 28 ]. Elevated levels of active AMPK in the liver of SIRT4 knockout mice lead to inhibition of acetyl coenzyme A carboxylase, reduction of malonyl coenzyme A, induction of PGC1-α, and ultimately promotion of fatty acid oxidation [ 29 ]. It has been reported that SIRT4 may play a role in regulating insulin secretion and sensitivity [ 27 ]. SIRT4 increases ATP levels through deacetylation and inhibition of the uncoupled ADP/ATP carrier protein adenine nucleotide transporter protein 2, which promotes insulin release and may be implicated in the development of type 2 diabetes [ 30 ]. This was confirmed by a study of SIRT4 knockout mice, which rapidly developed hyperinsulinemia, insulin resistance and glucose intolerance [ 31 ]. In addition, SIRT4 protects podocytes from ROS accumulation and apoptosis under hyperglycemic conditions, and thus has a protective effect against diabetic nephropathy [ 32 ]. Considering that PCOS is also a syndrome closely associated with insulin resistance, lipid metabolism disorders, and oxidative stress, the potential role of SIRT4 in PCOS warrants attention. Our study found no statistically significant difference in SIRT4 mRNA expression levels in peripheral blood mononuclear cells between PCOS patients and the control group, suggesting that SIRT4 may not be directly involved in the pathogenesis of PCOS; however, further research is needed to confirm this. This result indicates that although SIRT4 plays regulatory roles in various metabolic pathways, its expression level in the peripheral blood may not be significantly altered in PCOS, or its mechanism of action may not be reflected through peripheral blood mononuclear cells. Therefore, the precise role of SIRT4 in PCOS remains unclear and warrants further investigation in terms of tissue-specific expression, protein-level changes, and functional mechanisms, which may help to uncover its potential role in the pathogenesis of PCOS. SIRT5, a member of the Sirtuin family, is involved in a variety of intracellular biological processes [ 33 ]. SIRT5 targets lysine residues with acyl post-translational modifications and plays a key role in mitochondrial energy metabolism [ 34 ]. Dysregulation of SIRT5 has been implicated in a range of diseases, including metabolic disorders such as obesity and type 2 diabetes, as well as neurodegenerative diseases, cardiovascular diseases, and cancers. Notably, SIRT5 is highly expressed in brown adipose tissue (BAT), where it promotes thermogenesis by catalyzing protein deacylation, highlighting its important role in energy metabolism [ 35 ]. Moreover, SIRT5-regulated metabolic pathways have emerged as potential therapeutic targets for treating metabolic dysfunction [ 22 ]. Recent studies have extended the functional relevance of SIRT5 to reproductive cells. Pacella-Ince [ 36 ] preliminarily demonstrated the presence of transcripts, proteins and activity of SIRT5 in GCs and cumulus cells (CCs) from patients undergoing in vitro fertilization (IVF). A subsequent study [ 37 ] demonstrated that SIRT5 expression and activity were significantly reduced in GCs and CCs from women with diminished ovarian reserve or of advanced maternal age, suggesting a potential role in ovarian aging. In our study, we further observed a significant downregulation of SIRT5 expression in patients with polycystic ovary syndrome (PCOS), particularly in the obe-PCOS and IR-PCOS subgroups. This reduction was evident in both peripheral blood mononuclear cells and follicular fluid GCs compared to controls. These findings suggest that SIRT5 may contribute to the pathogenesis of PCOS by modulating metabolic pathways, warranting further investigation into its specific roles and mechanisms in this context. In PCOS, abnormal apoptosis of ovarian GCs is a key pathological feature that contributes to impaired follicular development and ovulatory dysfunction [ 38 ]. Oxidative stress (OS) is considered to be an important factor in inducing apoptosis in GCs, and oxidative stress exacerbates the impairment of ovarian function by generating excess ROS, which further triggers the mitochondria-associated apoptotic pathway [ 39 ]. Within this context, SIRT3 and SIRT5—mitochondrial SIRTs involved in the regulation of ROS levels and mitochondrial homeostasis—have garnered increasing attention. In this study, we observed significantly decreased expression of CAT and MTTFA in follicular fluid GCs of PCOS patients, indicating elevated oxidative stress and impaired mitochondrial function. Notably, the expression levels of SIRT3 and SIRT5 were also significantly reduced and showed strong positive correlations with both CAT and MTTFA. These findings suggest that SIRT3 and SIRT5 may play important roles in modulating oxidative defense and mitochondrial integrity in PCOS-associated GC dysfunction. It has been shown that SIRT3 has a significant effect on the maintenance of ROS homeostasis in mitochondria [ 40 ]. Overexpression of SIRT3 leads to deacetylation and activation of superoxide dismutase 2, which reduces ROS levels and protects the cells from oxidative damage in mitochondria [ 41 ]. It has been suggested that SIRT3 deficiency in the GCs of PCOS patients may lead to elevated oxidative stress, mitochondrial dysfunction and defective glucose metabolism, which may induce oocyte damage in PCOS [ 42 ]. In a previous study, overexpression of SIRT3 was also found to ameliorate DHT-induced mitochondrial dysfunction in KGN cells through the FOXO1/PGC-1α signaling pathway in vitro [ 25 ]. Compared to SIRT3, the role of SIRT5 in PCOS is less well characterized. However, SIRT5 is known to participate in metabolic regulation and antioxidant defense. SIRT5 activates NADPH-producing enzymes via desuccinylation, which enhances cellular antioxidant defenses, increases NADPH levels, promotes glutathione production, and reduces reactive oxygen species, protecting cells from oxidative stress [ 43 ]. However, there are no studies contributing to the association of SIRT5 with PCOS-related oxidative stress and mitochondrial dysfunction. For the first time, we report a positive correlation between SIRT5 expression and both CAT and MTTFA levels in follicular fluid GCs of PCOS patients, suggesting that SIRT5 may participate in PCOS pathophysiology by enhancing antioxidant capacity and mitochondrial biogenesis. Taken together, the downregulation of SIRT3 and SIRT5 may exacerbate oxidative stress and mitochondrial dysfunction, thereby promoting GC apoptosis, disrupting the follicular microenvironment, and ultimately contributing to the reproductive and metabolic disturbances observed in PCOS. However, this study has several limitations. First, the analysis was primarily based on samples from peripheral blood mononuclear cells and follicular fluid granulosa cells, without inclusion of other relevant tissues or cell types. This may limit our comprehensive understanding of the role of SIRT3 and SIRT5 in the pathophysiology of PCOS. Second, due to the observational nature of the study, we have not yet validated the causal relationship between the aberrant expression of SIRT3/SIRT5 and the development of PCOS through in vivo or in vitro functional experiments, leading to a lack of mechanistic insight. Third, this study did not fully control for potential confounding factors such as genetic background, lifestyle, and dietary habits, which may have influenced gene expression levels and the overall results. These limitations collectively weaken the generalizability of our findings and warrant caution in interpreting the mechanistic significance. Future studies should involve larger and more diverse populations, integrate multi-omics analyses, and conduct systematic functional experiments to further clarify the specific biological functions and molecular mechanisms of SIRT3 and SIRT5 in PCOS. More importantly, targeting SIRT3 and SIRT5 holds promise as a potential therapeutic strategy for restoring metabolic balance and improving reproductive outcomes, offering new avenues for clinical intervention in PCOS.

Polycystic ovary syndrome (PCOS) is a common reproductive endocrine disorder that affects approximately 10% of women of reproductive age globally, resulting in a huge health and economic burden [ 1 ]. PCOS is characterized by hyperandrogenemia, insulin resistance (IR), and polycystic ovarian morphology [ 2 ]. It is associated with a higher risk of complications such as type 2 diabetes mellitus, coronary heart disease, metabolic syndrome, cervical cancer, and psychiatric disorders [ 3 , 4 ]. Although its etiology has not been fully elucidated, PCOS is considered a multifactorial disorder involving a combination of genetic and environmental abnormalities. Current research suggests that specific genes, gene–gene interactions, and gene–environment interactions may influence an individual’s susceptibility to developing PCOS [ 5 ]. Current clinical treatments primarily focus on symptom management, including regulation of menstrual cycles, induction of ovulation, reduction of androgen levels, and improvement of insulin sensitivity [ 6 ]. However, these therapies address only the symptoms rather than the underlying disease itself. Comprehensive efforts are needed to thoroughly investigate the syndrome to develop more effective treatments and mitigate its serious long-term health consequences for patients. Emerging evidence implicates mitochondrial dysfunction in PCOS-related IR, obesity, hyperandrogenism, and metabolic syndrome [ 7 , 8 ]. In PCOS patients, GCs exhibit altered mitochondrial morphology—with increased mitochondrial number but impaired function and dynamics [ 9 ]. In addition, enhanced mitochondrial biosynthesis may improve the pathological manifestations of PCOS by decreasing the level of reactive oxygen species (ROS) within GCs [ 10 ]. Therefore, improving mitochondrial function may be a promising treatment to optimise overall recovery in PCOS patients. SIRTs (Silent information regulators) are a family of nicotinamide adenine dinucleotide (NAD) + dependent protein deacetylases [ 11 ]. In mammals, there are seven sirtuin family members (SIRT1-7), which are widely involved in regulating metabolic homeostasis, oxidative stress response, and cellular stress adaptation. They are primarily classified based on their subcellular localization: SIRT1, SIRT6, and SIRT7 are predominantly nuclear; SIRT3, SIRT4, and SIRT5 are mitochondrial; while SIRT2 is mainly cytoplasmic but can translocate to the nucleus during mitosis [ 12 ]. It is precisely their mitochondrial localization that leads SIRT3, SIRT4, and SIRT5 to be commonly referred to as mitochondrial SIRTs [ 13 ]. SIRT3 is the most extensively studied mitochondrial SIRT, primarily regulating the activity of key mitochondrial enzymes through deacetylation. It influences processes such as ATP production, ROS homeostasis, β-oxidation, apoptosis, and ketogenesis. SIRT3 significantly affects ROS generation and clearance by modulating the acetylation status of SOD2, thereby alleviating mitochondrial oxidative stress [ 14 ]. Studies have shown that SIRT3 expression is significantly associated with age-related oxidative stress and infertility, suggesting its potential role in reproductive health [ 15 – 17 ]. SIRT4 is localized in mitochondria and possesses ADP-ribosyltransferase activity and a unique lipoamidase activity that reduces insulin secretion in response to amino acids [ 18 ]. Inhibition of SIRT4 has been reported to result in increased inhibition of insulin secretion thereby helping to prevent the onset of type 2 diabetes mellitus [ 19 ]. SIRT5 is a NAD+-dependent protein lysine deacylase primarily located in mitochondria [ 20 ]. SIRT5 enhances glycolysis through activation of GAPDH and inhibition of PDC, and also protects the cell from oxidative stress by inhibiting pyruvate kinase M2 (PKM2) activity [ 21 ]. In conclusion, mitochondrial SIRTs play important roles in maintaining mitochondrial homeostasis. Therefore, we hypothesized that there may be some associations between PCOS and SIRTs, especially in terms of insulin resistance and disorders of glucolipid metabolism. The aim of this study was to investigate the expression changes of mitochondrial SIRTs in a larger sample volume of PCOS patients, including peripheral blood mononuclear cells and follicular fluid GCs. Furthermore, the relationship between the expression levels of mitochondrial SIRTs and various clinical parameters was further analysed to provide a theoretical basis for elucidating the pathophysiological mechanisms of PCOS.