Occurrence and fate of antibiotic resistance genes and their potential hosts during anaerobic fermentation of napier grass silage with the addition of different lactic acid bacteria | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Occurrence and fate of antibiotic resistance genes and their potential hosts during anaerobic fermentation of napier grass silage with the addition of different lactic acid bacteria Dandan Chen, Yuxin Zhou, Tianxin Guo, Luyao Liu, Qing Zhang, Ruiqi Pian, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-8493015/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Silage, as the primary forage for ruminants, could serve as a reservoir for antibiotic resistance genes (ARGs) and mobile genetic elements (MGEs). These genes gained access to the animals' systems via host bacteria, causing a latent health risk. This study aimed to investigate the fate and transmission mechanism of ARGs in napier grass silage treated with either Lactiplantibacillus plantarum (LP) or Enterococcus faecalis (E). The results indicated that Ensilied storage could effectively reduce ARGs abundance. Concurrently, bacterial community exhibited obviously difference by different treatments in silage. Firmicutes and Protebacteria could be the potential hosts, which were high abundance before and after ensiling. The abundance of ermB and Tn916/145 in the E group was the lowest in the fermented process. The inoculation of LP and E effectively down-regulated the expression of qnrD after 30 days fermentation, and also significantly decreased the bacteria of positive correlation with this gene, such as Pantoea_sp_PSNIH1, Pseudomonas_psychrotolerans and Pantoea_ananatis_PA13. The LP remain inhibiting effect to the expression of sul1 during ensiling, compared with the CK group. In conclusion, adding LP or E could markedly improve fermentation quality of napier grass silage and decrease some ARGs and MGEs. The decline in ARGs and MGEs was linked to a decrease in harmful bacterial populations. Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 1. Introduction Excessive use of antibiotics in disease prevention and treatment for both humans and animals had resulted in antibiotic resistance which is associated with approximately 7 million deaths worldwide each year and is considered one of the major threats to human health in the 21st century(Chen et al. 2023). The root and molecular basis of resistance is the production and spread of antibiotic resistance genes (ARGs)(Jian et al. 2021). It implies that drugs are ineffective(Gabutti 2022). Currently, ARGs as a new type of environmental contaminants, has generated widespread interest and attracted extensive attention around the world, which are detected in different environment media such as water, soil, plant, silage, composting, and urine, as well as animal feces(Zhang et al. 2023). According to estimates, ARGs may be having a more detrimental impact on the environment than the antibiotics themselves, it was widely recognized as posing a serious hazard to ecosystems and global health(Larsson and Flach 2022). Especially, the existence of abundant ARGs induced the more and more emergence of antibiotic resistant bacteria (ARBs)(Zhou et al. 2023). ARBs can grow and reproduce rapidly, adapt to diverse environments, enabling them to swiftly and invisibly spread to other areas. Admittedly, as ARGs carriers, they also contain a large number of mobile genetic elements (MGEs) and play a crucial part in facilitating ARGs transmission via horizontal gene transfer (HGT)(Jian et al. 2021) With the delivery of food chain, ARBs may be ingested by plant or attached to feed, then transferred to animals gut, who finally transmit them to humans through dietary intake(Darby et al. 2023). Therefore, the existence of ARGs is universally related to ARBs. With the sustainable growth of the world population, the global demand for meat, dairy, and animal feed is increasing each year(Liu et al. 2022). Around 2025, the consumption may be raised 60-70% worldwide(Xue et al. 2020). It meaning that need continuously supply of abundant feed. The prior study indicated that an average dairy cow consumes 0.025-0.027 ton of napier grass silage per day in intensive cattle farming, reaching up to a napier grass silage consumption of 12.5 ton per lactation(Nagy et al. 2022). Obviously, napier grass is a economically important species and potential energy grasses. The study suggests that napier grass is extensive planted in tropical and subtropical regions of Asia, Africa and America, and is processed into silage to continue the imbalanced supply of forage year-round(Zong et al. 2022). silage is generally produced from fresh plant materials by the handling of anaerobic fermentation. The process involves bacterial fermentation, especially lactic acid bacteria(Hou et al. 2021). The acidification of lactic acid bacteria determines the fermentation quality of silage. Because it could alter bacterial structure and abundance, thereby inhibiting the growth and reproduction of harmful microorganisms, such as molds, yeasts, clostridium, etc(You et al. 2022). Therefore, the addition of exogenous lactic acid bacteria is a common way to improve silage quality. Given that ARGs may be transmitted from a contaminated environment (manure, water and soil) to plant system by microbiomes, silage may be polluted and become a potential reservoir for ARGs and MGEs(Xie et al. 2018). Therefore, it is essential to detect the abundance and variation of ARGs, as well as their relationship with bacteria in silage, when evaluating fermentation quality during ensiling. However, the relatively few studies have evaluated the safety of silage and whether silage is contaminated with ARGs and MGEs and transmission mechanism involved.Theoretically, the process of silage maturation is accompanied by changes in the bacterial community structure. This implies that may be effective to remove the ARGs and MGEs by reducing ARBs. Recent research has focused on ARGs types and reducing ARGs method by adding external additives to achieve safe production of silage(Wu et al. 2020; Zhang et al. 2023). However, there were only a few additives that exhibited a fine effect on improving fermentation characteristics and reducing the abundance of ARGs and MGEs. Especially, the study indicated that the prolonged time of anaerobic fermentation would increase ARGs enrichment, and formic acid bactericide was unuseful to remove the ARGs in high-moisture alfalfa silage(Zhang et al. 2022; Zhang et al. 2023). Therefore, the present study respectively applied Lactiplantibacillus plantarum and Enterococcus faecalis to napier grass silage, evaluating possible risks of ARGs and dynamic regulations on fermentation quality, ARGs and bacterial community. We tried to clarify the occurrence and fate of ARGs and their potential hosts. 2. Materials and methods 2.1. Materials collection and preparation The fresh napier grass was randomly growth at the experimental plot of South China Agricultural University without application of chemical fertilizers and insecticides. During establishment, the seed stem was buried a density with row width of 0.6 m and an intrarow spacing of 0.4 m, subsequently, the field was allowed to grow naturally. The napier grass fields were already five-years old. During each growing season, napier grass was mowed 2 times to ensure fresh regrowth. In October 2023, napier grass was harvested approximately 75% moisture content and conveyed into the laboratory immediately to cut into 1-2 cm(Tian et al. 2024). The material was sufficient mixed with three additives, in which the lactic acid bacteria ( Lactiplantibacillus plantarum and Enterococcus faecalis ) were screened in prior study: (1) distilled water (CK, 1% g/Kg fresh sample); (2) Lactiplantibacillus plantarum (LP, 1×10 6 cfu/g fresh sample); (3) Enterococcus faecalis (E, 1×10 6 cfu/g fresh sample)(Guo et al. 2025). In each polyethylene plastic bag (40 × 25 cm), 400 g napier grass were packed and sealed by a vacuum packing machine. Totally of 72 bags (3 treatments × 4 days × 6 replicates) were placed in a room with ambient temperature (25-30℃). 6 bags of these were randomly opened after 3, 7, 14, 30 days of fermentation. 2.2 Physical and biochemical indicators and microbial counts The sealed samples were opened and fully mixed for the determination of the silage quality after 3, 7, 14,30 days of fermentation. 120 g sample of each bag was taken by five-spot-sampling method and dried at 65℃ for 48h. The dry matter content (DM) was measured by the proportion dried to fresh weight(You et al. 2022). These dried samples were applied subsequently to calculate protein fractions (crude protein, true protein, and non-protein nitrogen), neutral detergent fiber (NDF), acid detergent fiber (ADF) and water soluble carbohydrates (WSC) contents according to Zhao et al. (2024). Briefly, protein fractions were detected by the specific standard according to methods described by Association of Official Agricultural Chemists(Feldsine et al. 2002). NDF and ADF were analyzed using methods of ANKOM 2000 fiber analyzer (Ankom Technologies, Macedon, NY, USA) based on the company supplied procedure. WSC content was measured using the anthrone method. In addition, taking 10 g fresh material and 90 mL distilled water were blender to make silage extract and placed at 4 ℃ refrigerator for 24 h. The mixed liquid was filtered through 4 layers medical gauze and filter paper, and then its pH was immediately detected using a glass electrode pH meter (PHS-3C, INESA Scientific Instrument, Shanghai, China)(Li et al. 2023). The fraction of filtrate (approximately 300 μL) through pretreatment was injected into high-performance liquid chromatography (HPLC) to test the ingredients and content of organic acids (such as lactic acid, acetic acid, propionic acid, etc)(Zhang et al. 2025). The remained filtrate was used to determine the ammonia nitrogen (NH 3 -N) by phenol-hypochlorite method. Microorganisms at silage were also inoculated and cultured by the different agar and temperatures(Lu et al. 2022). The lactic acid bacteria and coliform bacteria were counted on de man, rogosa and sharpe agar (MRSA) plate and violet red bile agar (VRBA) plate, respectively, which were placed in a 37°C incubator for 48h. Yeasts and molds were cultured on rose bengal chloramphenicol agar (RBC) plate after being incubated at 28°C for 48h under aerobic condition 2.3 DNA extraction and quantitative determination of genes The extraction of DNA from napier grass silages was performed by HiPure Bacterial DNA Kit (Guangzhou Magen Biotechnology Co., Ltd.)(Tang et al. 2023). Each sample was frozen at -20°C refrigerator and stored for PCR and 16S rRNA sequencing. Total six ARGs and two MGEs, including sulfonamide resistance genes ( sul1 and sul2 ), macrolide resistance gene ( ermB ), quinolone resistance gene ( qnrD ), rifampicin resistance gene ( rob2 ), aminoglycoside resistance gene ( acrD ) and MGEs ( intl1 and Tn916/1545 ), were detected by standard PCR and verified the length of the PCR products by agarose electrophoresis. Each 20 μL PCR system includes 1 μL DNA from napier grass silage, 10 μL 2 × PCR Mix and 0.5 μL corresponding primer for each detected gene. PCR amplification was under following procedure: 95°C for 3 min, 36 cycle including 94°C for 25 s, 60°C for 25 s, 72°C for 12 s, followed by 72°C for 5 min(Liang et al. 2020). Triplicate PCR products was recovered and purified using the NanoDrop ND-2000 spectrophotometer (Thermo Fisher Scientific, USA), and a recombinant plasmid was constructed and identified. Genes were quantitatively determined using qPCR (LightCycler 480II). The qPCR process was as follow: 95°C for 30 s, then 40 cycles containing 95°C for 10 s, annealing , and 60°C for 30 s. The PCR and qPCR primers were specifically enumerated in table 1(Luo et al. 2010; Gaze et al. 2011; Chen et al. 2015; Zhou et al. 2023). Table 1. The specific primer sequences and annealing temperatures for ARGs and MGEs Gene Primer(5’→3’) bp Tm qnrD GCTGGAATGGCACTGTGATA 149 55 AGTTCGTCTTGCATCAAGCT sul1 CACCGGAAACATCGCTGCA 158 55 AAGTTCCGCCGCAAGGCT sul2 CTCCGATGGAGGCCGGTAT 190 55 GGGAATGCCATCTGCCTTGA rpoB2 GACGACATCGACCACTTCGG 365 54 GGGGTCTCGATCGGGCACAT Tn916/1545 TCCTACAGCGACAGCCAGTGA 174 54 TGCGTTGCTTTGGTCTGCTGGT acrD TTAGTAAAGCAGCTGCCAAA 130 56 CAGCCAGACACAGGACTACC ermB AAAACTTACCCGCCATACCA 139 53 TTTGGCGTGTTTCATTGCTT Intl1 CTGGATTTCGATCACGGCACG 473 60 ACATGCGTGTAAATCATCGTCG 16s rRNA CGGTGAATACGTTCYCGG 143 53 GGWTACCTTGTTACGACTT 2.4 16S rRNA gene high-throughput sequencing To analyze the interrelationships between bacteria and genes (ARGs and MGEs) during anaerobic fermentation, the extracted DNA was used to amplify V3-V4 regions of 16S rRNA with universal primers 341F (CCTACGGGNGGCWGCAG) and 806R (GGACTACHVGGGTATCTAAT). The bacterial 16S rRNA gene was detected by high-throughput sequencing on Illumina HiSeq 2500. The analysis steps of raw sequences were winnowed by Trimmomatic for quality filtering and merged with FLASH, and then was optimized through Mothur v.1.39.5. These sequences were statistically analyzed the bioinformatics, if 97% similar operational taxonomic units were similar. 2.5 Data and statistical analysis All data was evaluated using two-way analysis of variance (ANOVA) on the platform of IBM SPSS20.0. The significance level of P- value was set below 0.05 or 0.01. Boxplot and line chart abundance using the software of Origin 2018 64 Bit and Graphpad prism 10.1.2. The relevant figures of bacterial communities come from Omicsmart online platform and were beautified by Adobe Illustrator 2023. The network analysis graph were made using Gehpi soft. 3. Results 3.1 Chemical characterization, microorganism counts, and ARGs residues of fresh napier grass To investigate the quality and ARGs contamination of fresh napier grass, the chemical compositions, microbial populations, ARGs and MGEs abundance before fermentation were shown in Figure 1. The fresh napier grass contained 104.65 g/kg DM CP and 96.48 g/kg DM TP (Fig.1a). And NPN was also detected, the content of which was around 8.14 g/kg DM. The NDF content was the higher than ADF in fresh napier grass. Meanwhile the WSC content was only estimated around 29.46 g/kg DM. Among these attached microorganisms, molds had the highest count (4.43 lg cfu·g -1 FM ), while LAB were the lowest number (3.40 lg cfu·g -1 FM) (Fig. 1b). As for yeasts and CB, the number of them were evaluated about 4.12 and 3.73 lg cfu·g -1 FM, respectively. A total of six ARGs ( rob2 , sul2 , acrD , emB , qnrD , sul1 ) and two MGEs ( intl1 , Tn916/415 ) were found in fresh napier grass (Fig. 1c). Among them, the average abundance were 31.14, 28.73, 21.23, 21.27, 21.47, 23.74, and 30.33 logs, respectively. the expression of ermB accompanied by highest absolute abundance, while the opposite was true for acrD . 3.2 Physical and biochemical indicators and microbial counts during dynamic anaerobic fermentation To comprehensively evaluate the impact of LP and E additives on napier grass silage, the fermentation characteristics and chemical composition in different ensiling period were assessed and shown in Fig. 2. Although the inoculation of LAB unchanged the dry matter and true protein, increased only the crude protein and non protein nitrogen after 3 days fermentation( P <0.01). The addition of LP and E effectively reduced the pH value after 3 and 30 days ensiling. Compared with the other groups, LP group significantly decreased the pH, and simultaneously increased lactic acid during dynamic fermentation( P <0.01). There were undetected acetic acid and propionic acid in all treated group before 14 days fermentation. However, acetic acid and propionic acid were determined in CK and E groups after 30 days fermentation. And propionic acid was relatively high content in E treated group than in that of CK group. During dynamic fermentation, the change of main microorganism were also more pronounced. Compared with the other groups, the inoculation of LP increased markedly the lactic acid bacteria, and helped maintain the low count of coliform bacteria in whole fermentation period. Moreover, LP group undetected yeasts after 7 days. Regarding molds, all treated groups were only subtle change before 14 days. However, the count of molds in LP and E treated groups showed significant decrease compared to the CK group. 3.3 The variations of ARGs and MGEs during dynamic anaerobic fermentation In the study, the effect of LP and E on ARGs and MGEs were determined during dynamic fermentation (Fig. 3). During fermentation process, the abundance of all ARGs and MGEs remained below 10 logs in all groups, which was lower than before ensiling (Fig. 1c). Among them, the absolute abundance of Intl1 , sul1 and sul2 was significantly lower in LP group than that in the other groups after 3 days fermentation. However, the CK and E groups showed a markedly reduction in the absolute abundance of Intl1 , sul1 , and sul2 at the end of ensiling compared to the initial abundance, whereas the LP group remained unchanged. The expression of ermB , qnrD ,and Tn916/145 in E group significantly down-regulated than in other group after 30 days. It is noteworthy that the abundance of ermB in the E group was the lowest in the fermented process, exhibiting a significant reduction compared to that of the other groups, with the exception of day 7. Although the inoculation of LP also effectively down-regulated the expression of qnrD after 30 daysfermentation, the abundance of ermB and Tn916/145 unchanged in fermented process and hold much greater level in LP group than that of other groups. Regarding of the expression of rpob2 and acrD , neither the LP nor the CE application exhibited any significant alteration, compared with CK group. Nevertheless, the inoculation of lactic acid bacteria resulted in a significant reduction the expression levels of rpob2 and acrD in the later stage relative to the initial period. 3.4.1 Bacterial diversity of silages during dynamic fermentation Bacterial diversity of silages was conducted on the contigs assembled from each sample using the MetaGeneMark software. The results are presented in Fig. 4. The Chao index, Ace index, and Son index suggest that E group exhibited a lower number of species; however, this reduction was not statistically significant compared to the other two groups ( P >0.05). These indices also indicate that there was an insignificant difference in the number of OTUs (Operational Taxonomic Units) across all groups, whereas the inoculation of LP resulted in an increase in the number of species as fermentation time extends. The Shannon, Simpson, and Pielou index show that the addition of LP led to a reduction between the diversity and richness of silage relative to CK group. Conversely, the E group exhibited no statistically significant difference in these indices. The enhanced diversity in LP group was observed by pd index, which was significant increase in the later fermentation stage than that of the initial period. To further assess the differences in bacterial diversity distribution in different treatments, the analysis of beta diversity was conducted at bacterial community (Fig.5). the variance value of Principal Component 1 (PC1) and Principal Component 2 (PC2) was 71.89% and 18.04%, respectively, which indicated a good fit between the calculated results and the observed data about Principal Component Analysis (PCA). Utilizing various algorithms, including PCA, Principal Coordinates Analysis (PCoA), and Non-metric Multidimensional Scaling (NMDS), it is demonstrated that the distribution of samples within each group exhibits relative uniformity. There were significant differences in bacterial community structure between before and after ensiling in silage. This pattern further suggested that LAB treatment and duration could markedly influence bacterial community succession in ensiled napier grass. Furthermore, the application of PCA, PCoA, NMDS revealed a distinct separation in the bacterial community structure between the CK and LP groups, while E group exhibited no significant separation compared to CK group. Ensiling duration does not seem to have altered the bacterial communities in each treatment, which does not lead to substantial changes. The bacterial composition in silage is illustrated in Fig.5. The total relative abundance of Proteobacteria and Firmicutes at the phylum level accounted for 97.52% and 1.93% before ensiling, respectively, which were also main bacteria in the bacterial communities before and after fermentation. But the community structure had obviously changed. Firmicutes increased significantly in all groups after ensiling. Especially, it became the dominant phylum in LP group, and hold an increasing trend after ensiling reached maturity. The change tread of Proteobacteria was opposite to that of Firmicutes. At the species level, the dominant bacteria were not consistent. Lactobacillus plantarum accompanied with high number in LP group during ensiling, its abundance was in the range of 75.15%-83.90%. there were abundant the unclassified bacteria in CK and E group after ennsiling. Theses bacteria were found in significantly large amounts between 81.19%-90.76%. In these identifiable bacteria, Lactobacillus plantarum , and Weissella_oryzae increased significantly becoming the dominant species in CK and E groups, while Pantoea_sp_PSNIHI and Pantea_ananatis__PA13 decreased significantly with the prolonged fermentation time. The highest abundance bacteria were different in E and CK groups, which were Lactobacillus plantarum and Weissella_oryzae , respectively. The addition of E increased significantly the count of Lactobacillus plantarum , and reduced significantly Weissella_oryzae , Pantoea_sp_PSNIHI , and Pantea_ananatis__PA13, compared to CK group. The correlations between bacteria and ARGs and MGEs were assessed using the Mantel test. According to Fig. (S1), Lactobacillus plantarum exhibited a negative correlation with the other bacteria, including Weissella_oryzae , Pantoea_sp_PSNIHI , Pantea_ananatis__PA13 , Curtobacterium_luteum , Oryza_sativa_Indica_Group_long-grained_rice , Quadrisphaera_granulorum , Sphingomonas_roseiflava , Devosia_sp_I507 , Herbaspirillum_huttiense , Methylobacterium_radiotolerans_JCM_2831 . Methylobacterium_aerolatum , Sphingomonas_azotifigens , Lactococcus_garvieae_ATCC_49156 , Nocardioides_oleivorans . In addition, there were obviously a positive correlation between bacteria, except Lactobacillus plantarum . These bacteria were also related with ARGs and MGEs. The results indicated that the abundance of MGEs was significantly related with Lactobacillus_plantarum , Pantoea_sp_PSNIH1 , Pantoea_ananatis_PA13 , Weissella_oryzae, Empedobacter_brevis , Methylobacterium_aerolatum , and Methylobacterium_radiotolerans_JCM_2831 .Similarly, the abundance of ARGs was significantly related with Lactobacillus_plantarum , Pantoea_sp_PSNIH1 , Pseudomonas_psychrotolerans , Weissella_oryzae , Methylobacterium_aerolatum and Pantoea_ananatis_PA13 . To determine the potential hosts of ARGs and MGEs in napier grass silage, the specific correlations with bacteria were analyzed, which was obtained by performing screening (0<|R|<1, P <0.05) (Fig 6). The positive correlation was between ermB and Nocardioides_oleivorans, Deinococcus_gobiensis_I-0 , Leifsonia_shinshuensis , Lactobacillus_plantarum , Methylobacterium_komagatae , Myroides_odoratus_CIP_103059 . The high abundance of Tn916/1545 was related with Lactobacillus_plantarum , Deinococcus_gobiensis_I-0 , Flavobacterium_ceti , Devosia_sp_I507 , Myroides_odoratus_CIP_103059 , and Nocardioides_oleivorans , while the exist of qnrD was inevitably linked to Lactobacillus_plantarum , Acidovorax_avenae , Lactococcus_garvieae_ATCC_49156 , and Sphingomonas_roseiflava . Pantoea_sp_PSNIH1 , Weissella_oryzae , and Pantoea_ananatis_PA13 were effectively promoted sul1 expression. Similarly, Pantoea_sp_PSNIH1 , Weissella_oryzae , Pseudomonas_psychrotolerans , and Pantoea_ananatis_PA13 played a positive role in the expression of intl1 . there were 4 species of bacteria (including Pantoea_sp_PSNIH1 , Weissella_oryzae , Pantoea_ananatis_PA13 , and Sphingomonas_roseiflava ) related with the increased abundance of sul1. Pantoea_sp_PSNIH1 , Pseudomonas_psychrotolerans and Pantoea_ananatis_PA13 were positive effect about the expression of acrD and sul2 . The abundance of rpob2 were only related positively with Pseudomonas_psychrotolerans and Pantoea_sp_PSNIH1 . It is worth mentioning that some bacteria (such as Clostridium_algidixylanolyticum , Lactococcus_raffinolactis and Weissella_hellenica , etc) were only negative effect with the abundance of ARGs and MGEs. Moreover, Lactobacillus_plantarum had significant inhibitory effect to the expression of acrD and ropb2 . 4 Discussion The nutritional value and safety of feed are crucial to high-quality ruminant products. Napier grass is extensively planted in tropical and subtropical regions, mainly used for manufacturing biofuel and animal production(Yan et al. 2021). Due to its short growth cycle, high biomass, as well as strong adaptability, it is deeply popular with smallholder livestock farmers and generally accounts for 80% of dairy cattle diet(Habte et al. 2022). Generally, fresh napier grasses were harvested and fed directly animals in the stage of vigorous growth. Meanwhile some of them also ensilied commonly to maintain feed supply during periods of insufficient grass growth(Chen et al. 2022). It widely known that high-quality silage is directly related to the epiphytic microorganisms (mainly lactic acid bacteria) of plant(Nazar et al. 2021). Ensiling is an anaerobic fermentation process, in which lactic acid bacteria (LAB) produce acids to inhibit microbial activities thereby reducing nutrition loss and obtaining high quality silage(Wang et al. 2020). In present study, the number of lactic acid bacteria was low and did not occupy a dominant position in initial community. Therefore, it was unable to meet the basic requirement (5.00 lg cfu/g FM) to guarantee gaining high-quality silage(Wang et al. 2023). Moreover, the undesirable microorganisms (such as yeasts, moulds) were relatively high abundance in silage. As resistance gene carrier, these microorganisms could be also related to estimate the absolute abundance of ARGs and MGEs. Sulfonamide resistance gene, macrolide resistance gene, quinolone resistance gene, rifampicin resistance gene, and aminoglycoside resistance gene, are common types of resistance genes in nature that have a significant impact on the environment, while MGEs is important in the horizontal gene transfer (HGT) of ARGs. In our study, napier grass has also been contaminated with a certain degree of ARGs. Total six types ARGs and two types MGEs were detected the high absolute abundance in fresh napier grass. Among of them, the abundance of ermB was the highest around 31.49 logs, while the abundance of acrD was the lowest about 21.23 logs. To improve silage, Both LP and E additives are popularly applied to modulate the fermentation quality of silage. As an exogenous microbial agent, their existence may adjust the microbial community structure and influence the distribution and transmission of ARGs. Therefore, we added two different types LAB into napier grass silage to asses the specific change and potential relationships of ARGs and MGEs , respectively. Antibacterial activity of LAB was estimated by the capacity of producing acids, and pH value is the most visual evaluation(Zhang et al. 2022). Compared with the early stage of ensiling, all treatments markedly reduced the pH value after 30 days fermentation. It was partially explained by the rapid accumulation of organic acid content(Strauber et al. 2016; Gharechahi et al. 2017). Especially, the LP treated group was significantly decreased the pH value with the extension of fermentation time. It had lowest pH value and highest lactic acid content in different fermentation period relative to the other groups. This result was reasonably explained that Exogenous LP inoculation induced rapid homofermentation under insufficient WSC during the initial stage of ensiling, thus producing significantly increased lactic acid(Zhao et al. 2019). As a key metabolite of lactic acid bacteria, high concentration of lactic acid had shown the strong antibacterial ability(Reuben et al. 2019). Both homofermentative and heterofermentative LAB are main type of LAB and are universal used as microbial inoculants in silage(Blajman et al. 2018). Theoretically, LP and E were representative of homofermentative LAB, which contribute to accelerating the process of WSC conversion and increasing the levels of lactic acid (LA) and acetic acid (AA), thereby achieving antibacterial effect(Hisham et al. 2022). However, their effect were different. Although the E addition could significantly inhibited the growth of yeasts after 7 days aerobic fermentation, compared with CK group. The undesirable microorganism (such as coliform bacteria) was still maintain high abundance. This could be because although it may improve lactic acid level, the effect was subtle relative to the CK group ( P >0.05). Despite all this, after 30 days fermentation, the E application may be because of the accumulation of acetic acid and lactic acid concentration thereby inducing the undetected molds counts. In contrast, the coliform bacteria had the lower number in LP treated than that of CK group ( P< 0.05). Simultaneously, yeasts and molds were undetected in LP group after 7 days and 30 days fermentation, respectively. Regarding protein components, two species of LAB application appeared higher crude protein and non protein nitrogen after 3 days fermentation, compared to the CK group. Notablely, inoculation LAB were unuseful to maintained the crude protein and true protein retention of silage, as well as decreasing non protein nitrogen after later stage. It could be the content of protein was low in napier grass silage. Chen et al. (2023) was similar result. Zhang et al. (2023) suggested that ensiling is useful and can significantly lower the abundance of ARGs and MGEs in alfalfa, which is consistent with the results of this study. There were relatively lower the abundance of ARGs and MGEs in napier grass silage than fresh napier grass. The fermented process of ensiling is accompanied by the rapid acidfication of fresh forage, which may lead to a part of bacterial cell death(Oliveira et al. 2017). As the potential hosts, the number of bacterial cell is directly related to the remove of ARGs and MGEs(Deng et al. 2022). The external LAB addition is conducive to rapid acid accumulation and may cause fine effect of bacteriostasis(Oliveira et al. 2017). In present study, the addition of different LAB shown the variation the abundance of ARGs and MGEs during dynamic fermentation, as following Fig. 3. The LP inoculation seemed to show the fine effect to remove intl1 , sul2 and sul1. The abundance of intl1 , sul2 and sul1 was significantly lowered in the LP treated group than that other treated groups after 3 days of ensiling. Meanwhile, during fermentation, it remained stable in LP treated silage, with only a slight fluctuation at the end of ensiling compared to the initial abundance. However, the LP addition was ineffective to remove the ermB and Tn916/545 , the abundance of both ermB and Tn916/545 was found to be significantly higher in LP group compared to the other groups during ensiling. In contrast, the E treated silage shown significantly lower abundance of ermB and Tn916/545 than the other groups after 30 days ensiling. Although the change of qnrD abundance was fluctuate among different treatments during ensiling, the LAB inoculation was notably lower the abundance of ermB than CK group at the ending of ensiling. Compared the ending of ensiling to the initial fermentation stage, the fermentation process was tended to enhance the abundance of acrD in CK group, but the absolute abundance of acrD and rpob2 was notably decreased in LAB treated groups. 3.4 Changes in the bacterial diversity and bacterial community structure during dynamic fermentation 3.4.1 Bacterial diversity of silages during dynamic fermentation The diversity of bacterial community was used to estimate the interspecific difference and intraspecific difference among different treated silage(Ren et al. 2019). And it was analyzed by next-generation sequencing of the full-length 16S rRNA gene(Peng et al. 2024). the α diversity of bacterial community was related with Sob, Chao1, Ace, Simpson, Shannon, Pielou, and pd. The index of Sob, Chao1, and Ace is a way of estimating the total number of species that can be found in a sample from a community. When The index of Sob, Chao1, and Ace are high, it indicates that there are likely many low-abundance species present in the community(Zhou et al. 2023). The indexes of Sob, Chao1, and Ace suggested that there were no difference in the number of harbors among treatments during anaerobic fermentation. However, the indexes of Shannon, Simpson, and pielou showed that LP group decreased the species diversity of silage. These indexes demonstrated that LP group had more high-adundance bacteria, and less species were observed. Simpson and pielou, meanwhile, indicated that more high-adundance bacteria, and more species were observed, compared with CK group. Beta diversity may evaluate the species difference among different communities, which the more distinct separation reveal more difference(Li et al. 2022). In the analysis of beta diversity, the stress value of the Non-metric Multidimensional Scaling (NMDS) is 0.023, indicating a good fit between the calculated results and the observed data. NMDS and PCA illustrates that ensiling significantly alter the beta diversity of the fresh napier grass. There were obviously separated between before and after fermentation. The inclusion of E did not lead to substantial changes in the β diversity of the bacterial community in the process of dynamic fermentation, suggesting that bacterial community of β diversity remained stable. However, the addition of LP could rebuild the bacterial community. There were the differences between the CK and LP groups during anaerobic fermentation, while the difference were not statistically significant in CK and E groups. 3.4.2 The structure of bacterial community in silages during dynamic fermentation Bacterial community structure is a an important factor affecting the change of fermentation quality and ARGs in silage(Wang et al. 2020). Firmicutes and Proteobacteria were the dominant phyla in the silage. Firmicutes were found in significantly larger amounts in LP group than in the other groups, whereas Proteobacteria was significantly more prevalent in CK and E groups than in that of LP group. Similarly, Yang et al. (2024) also found that Firmicutes and Proteobacteria were dominant bacteria in corn stover silage, and the addition of exogenous LP alters the microbial structural composition within the silage, resulting in a reduction in the proportion of Proteobacteria and an increase in the proportion of Firmicutes. The high abundance of Proteobacteria and Firmicutes could suggest that are main potential host bacteria for ARGs. Pantoea_sp_PSNIHI , Pseudomonas_psychrotolerans and Pantoea_ananatis_PA13 werehigh abundance in fresh napier grass. These bacteria were found in significantly less amounts after anaerobic fermentation. Therefore, it may be reasonably inferred that the reduction of ARGs was related to the abundance of Pantoea_sp_PSNIHI, Pseudomonas_psychrotolerans and Pantoea_ananatis_PA13 after than before ensiling. The dominant genera in the CK and LP groups were ambiguous during the anaerobic fermentation process, because the identifiable bacterial was only low range (9.24%-8.81%) during anaerobic fermentation. In these identifiable bacteria, Weissella_oryzae wasthe predominant species in the CK group. It is common lactic acid-producing cooi and relates with lactic acid fermentation in silage(Yang et al. 2019). Similarly, both Weissella_oryzae and Lactobacillus plantarum were dominant in E group. The study indicated that Weissella_oryzae is mainly producing lactic acid ininitiate lactic fermentation in the early ensiling process, whereas Lactobacillus plantarum plays a critical role in acid increase at the later stage(Li et al. 2022). Therefore, it could reasonably explain that the significant pH reduction in E group may be caused by the shift in domain species from Weissella_oryzae to Lactobacillus plantarum after 30 days ensiling, compared with CK group. The addition of E may be conducive to the preservation and avoiding nutrient loss of silage. As fermentation time prolongs, it reduced significantly the undesirable bacteria, including Pantoea_sp_PSNIHI and Pantea_ananatis__PA13 (Sun et al. 2024). Regarding as LP group, it showed a better effect in increasing lactic acid production, decreasing pH and improving silage than the other group, all of which were associated with greater abundance of Lactobacillus plantarum . 3.5 Bacterial community and ARGs with binning analysis Bacteria are considered carriers of ARGs and MGEs(Zhou et al. 2023). Based on the strong and significant correlations between ARGs and coexisting bacterial groups, nonrandom cooccurrence patterns of ARGs and bacterial groups can be used to gain new insights into ARGs and their possible hosts. To further insight the symbiotic relationship between the bacterial community and the expression level of ARGs and MGEs, 0.1%> species in abundance were selected to conduct network analysis with TRGs through the whole ensiling process. The significantly positive correlation between Lactobacillus_plantarum and the abundance of ermB , qnrD , and Tn916/1545 indicating that Lactobacillus_plantarum may be the potential host bacteria of these ARGs and MGEs. The high count of Lactobacillus_plantarum in LP group could cause the obviously greater logs of ermB and Tn916/1545 than in that CK and E group. Similarly, Pantoea_sp_PSNIH1 , Pseudomonas_psychrotolerans and Pantoea_ananatis_PA13 were the potential host bacteria for acrD . The inoculation of LP and E significantly decreased these bacteria, thereby significantly decreasing the abundance of acrD . The parallel result also displayed that Lactobacillus_plantarum was negative correlation. It might be Lactobacillus_plantarum significantly decreased the potential host bacteria causing the upregulated of acrD . Pantoea_ananatis_PA13 , Pantoea_sp_PSNIH1 and Weissella_oryzae , were useful to upregulate the expression of intl1 and sul1 . Simultaneously, Sphingomonas_roseiflava and Pseudomonas_psychrotolerans were also effectively increased the expression of sul1 and intl1 . As the potential host bacteria, the change of these bacteria may also effectively explain that the abundance of sul1 and intl1 were a greater number in CK and E group after 30 days ensiling, while showed a relative lower number in LP group. Pantoea_ananatis_PA13 , Pantoea_sp_PSNIH1 , and Pseudomonas_psychrotolerans were high counts in CK and E group than in that of LP group, those bacteria of which were positive related with sul2 . However, there were not significantly changed the expression the sul2 among these groups. It might be because Clostridium_algidixylanolyticum , Nocardioides_oleivorans , and Leifsonia_shinshuensis also were significantly greater amounts in CK and E groups than LP group during ensiling, which were negative effect to the expression of sul2 , thereby causing inapparent impact. Similarly, the change of sul2 could also explain the expression difference of rpob2 among all groups. 5 Conclusion Anaerobic fermentation of silage could effectively reduce the ARGs and MGEs abundance. After 30 days fermentation, the addition of E could decrease the abundance of ermB and Tn916/545 ,while LP was useful to inhibit the expression of of qnrD and sul1 . Both E and LP were effectively to inhibit the growth of undesirable microorganisms (yeasts and molds), which could improve fermentation quality of napier grass silage. Especially, LP could also reduce coliform bacteria and bacterial abundance. However, Lactobacillus_plantarum could bepolluted by ermB and Tn916/1545 . It was positive correlated with the expression of these genes . Declarations CRediT authorship contribution statement Dandan Chen: Writing–original draft, Formal analysis, Data curation, Conceptualization. Yuxin Zhou: Writing–review & editing, Data curation, Software. Tianxin Guo and Luyao Liu: Writing–review & editing, Data curation. Qing Zhang: Formal analysis, Methodology. Ruiqi Pan: Investigation, Supervision, Resources, writing–review & editing. Xuan Yao: Validation, Visualization, Supervision, Project administration. Funding This work was supported by the Meizhou Science and Technology Plan Project (2024A0301041) and (2024A0301046). Declaration of competing interest The authors declare that they have no conflict of interest. Ethical statements This research did not involve animal ethics experiments. Data availability Data will be made available on request. Acknowledgments The authors thank the support of Meizhou Science and Technology Plan Project (2024A0301041) and (2024A0301046). References Blajman J E, Paez R B, Vinderola C G, Lingua M S, Signorini M L. 2018. A meta-analysis on the effectiveness of homofermentative and heterofermentative lactic acid bacteria for corn silage. Journal of Applied Microbiology . 125 , 1655-1669. doi: 10.1111/jam.14084. Chen B, Liang X, Nie X, Huang X, Zou S, Li X. 2015. The role of class I integrons in the dissemination of sulfonamide resistance genes in the Pearl River and Pearl River Estuary, South China. Journal of Hazardous Materials , 282 , 61-67. https://doi.org/10.1016/j.jhazmat.2014.06.010. Chen D, Zheng M, Zhou Y, Gao L, Zhou W, Xu W, Wang M, Zhu Y. 2022. Improving the quality of napier grass silage with pyroligneous acid: fermentation, aerobic stability, and microbial communities. Frontiers in Microbiology , 13 , 1034198. https://doi.org/10.3389/fmicb.2022.1034198. Chen D, Zhou Y, Yang D, Zhou W, Chen X, Zhang Q. 2023. Exploring Lactobacillus plantarum on fermentation quality, gas emissions, and in vitro digestibility of different varieties of litchi leaves silage. Fermentation , 9 , 651. https://doi.org/10.3390/fermentation9070651. Chen T, Zhao M X, Tang X Y, Wei W X, Wen X, Zhou S Z, Ma B H, Zou Y D, Zhang N, Mi J D, Wang Y, Liao X D, Wu Y B. 2023. The tigecycline resistance gene tetX has an expensive fitness cost based on increased outer membrane permeability and metabolic burden in Escherichia coli . Journal of Hazardous Materials , 458 , 131889. https://doi.org/10.1016/j.jhazmat.2023.131889. Darby E M, Trampari E, Siasat P, Gaya M S, Alav I, Webber M A, Blair J M A. 2023. Molecular mechanisms of antibiotic resistance revisited. Nature Reviews Microbiology , 21 , 280-295. https://doi.org/10.1038/s41579-022-00820-y. Deng S, Li P, Wu Y, Tang H, Cheng S, Thunders M, Qiu J, Li Y. 2022. Eco-risk management of tylosin fermentation residues using vermicomposting. Journal of Environmental Management , 303 , 114126. https://doi.org/10.1016/j.jenvman.2021.114126. Feldsine P, Abeyta C, Andrews W H. 2002. AOAC International methods committee guidelines for validation of qualitative and quantitative food microbiological official methods of analysis. Journal of Aoac International , 85 , 1187-1200. doi: 10.1093/jaoac/85.5.1187 Gabutti G. 2022. Available evidence and potential for vaccines for reduction in antibiotic prescriptions. Human Vaccines & Immunotherapeutics , 18 , 2151291. doi: 10.1080/21645515.2022.2151291. Gaze W H, Zhang L, Abdouslam N A, Hawkey P M, Calvo-Bado L, Royle J, Brown H, Davis S, Kay P, Boxall A B A, Wellington E M H. 2011. Impacts of anthropogenic activity on the ecology of class 1 integrons and integron-associated genes in the environment. International Society for Microbial Ecology Journal , 5 , 1253-1261. https://www.nature.com/articles/ismej201115. Gharechahi J, Kharazian Z A, Sarikhan S, Jouzani G S, Aghdasi M, Hosseini Salekdeh G. 2017. The dynamics of the bacterial communities developed in maize silage. Microbial Biotechnology , 10 , 1663-1676. doi: 10.1111/1751-7915.12751. Guo X, Chen D, Huang P, Gao L, Zhou W, Zhang J, Zhang Q. 2025. Effects of tannin-tolerant lactic acid bacteria in combination with tannic acid on the fermentation quality, protease activity and bacterial community of stylo silage. Journal of the Science of Food and Agriculture , 105 , 2540-2551. doi: 10.1002/jsfa.14027. Habte E, Teshome A, Muktar M S, Assefa Y, Negawo A T, Machado J C, Ledo F, Jones C S. 2022. Productivity and feed quality performance of napier grass ( Cenchrus purpureus ) genotypes growing under different soil moisture levels. Plants , 11 , 2549. https://doi.org/10.3390/plants11192549. Hisham M B, Hashim A M, Hanafi N M, Rahman N A, Mutalib N E A, Tan C K, Nazli M H, Yusoff N F M. 2022. Bacterial communities associated with silage of different forage crops in Malaysian climate analysed using 16S amplicon metagenomics. Scientific Reports , 12 . https://doi.org/10.1038/s41598-022-08819-4. Hou Z, Liu J, Cai M, Liu Y, Mu L, Gao Y, Wanapat M, Huang B. 2021. Enriching the nutritive value of marigold ( Tagetes erecta L) crop residues as a ruminant feed by lactic acid bacteria during ensilage. BMC Veterinary Research , 17 , 74. https://doi.org/10.1186/s12917-021-02762-8. Jian Z, Zeng L, Xu T, Sun S, Yan S, Yang L, Huang Y, Jia J, Dou T. 2021. Antibiotic resistance genes in bacteria: Occurrence, spread, and control. Journal of Basic Microbiology , 61 , 1049-1070. doi: 10.1002/jobm.202100201. Larsson D G J, Flach C. 2022. Antibiotic resistance in the environment. Nature Reviews Microbiology , 20 , 257-269. https://doi.org/10.1038/s41579-021-00649-x. Li F, Usman S, Huang W, Jia M, Kharazian Z A, Ran T, Li F, Ding Z, Guo X. 2023. Correction: Effects of inoculating feruloyl esterase-producing Lactiplantibacillus plantarum A1 on ensiling characteristics, in vitro ruminal fermentation and microbiota of alfalfa silage. Journal of Animal Science and Biotechnology , 14 , 53. doi: 10.1186/s40104-023-00871-y. Li Y, Du S, Sun L, Cheng Q, Hao J, Lu Q, Ge G, Wang Z, Jia Y. 2022. Effects of lactic acid bacteria and molasses additives on dynamic fermentation quality and microbial community of native grass silage. Frontiers in Microbiology , 13 , 830121. doi: 10.3389/fmicb.2022.830121. Liang J, Jin Y, Wen X, Mi J, Wu Y. 2020. Adding a complex microbial agent twice to the composting of laying-hen manure promoted doxycycline degradation with a low risk on spreading tetracycline resistance genes. Environmental Pollution , 265 , 114202. https://doi.org/10.1016/j.envpol.2020.114202. Liu F, Bai J, Huang W, Li F, Ke W, Zhang Y, Xie D, Zhang B, Guo X. 2022. Characterization of a novel beta-cypermethrin-degrading strain of Lactobacillus pentosus 3-27 and its effects on bioremediation and the bacterial community of contaminated alfalfa silage. Journal of Hazardous Materials , 423 , 127101. doi: 10.1016/j.jhazmat.2021.127101. Lu Y, Li P, Bai S, Chen S, Zhao M, Gou W, You M, Cheng Q. 2022. Effect of phenyllactic acid on silage fermentation and bacterial community of reed canary grass on the Qinghai Tibetan Plateau. Bmc Microbiology , 22 , 83. https://doi.org/10.1186/s12866-022-02499-w. Luo Y, Mao D, Rysz M, Zhou Q, Zhang H, Xu L, J J Alvarez P. 2010. Trends in antibiotic resistance genes occurrence in the Haihe River, China. Environmental Science & Technology , 44 , 7220-7225. Nagy S A, Toth A G, Papp M, Kaplan S, Solymosi N. 2022. Antimicrobial resistance determinants in silage. Scientific Reports , 12 , 5243. doi: 10.1021/es100233w. Nazar M, Wang S, Zhao J, Dong Z, Li J, Kaka N A, Shao T. 2021. Effects of various epiphytic microbiota inoculation on the fermentation quality and microbial community dynamics during the ensiling of sterile Napier grass. Journal of Applied Microbiology , 130 , 1466-1480. doi: 10.1111/jam.14896. Oliveira A S, Weinberg Z G, Ogunade I M, Cervantes A, Arriola K G, Jiang Y, Kim D, Li X, Goncalves M, Vyas D, Adesogan A T. 2017. Meta-analysis of effects of inoculation with homofermentative and facultative heterofermentative lactic acid bacteria on silage fermentation, aerobic stability, and the performance of dairy cows. Journal of Dairy Science , 100 , 4587-4603. https://doi.org/10.3168/jds.2016-11815. Peng S, Xie L, Cheng Y, Wang Q, Feng L, Li Y, Lei Y, Sun Y. 2024. Effect of Lactiplantibacillus and sea buckthorn pomace on the fermentation quality and microbial community of paper mulberry silage. Frontiers in Plant Science , 15 , 1412759. https://doi.org/10.3389/fpls.2024.1412759. Ren F, He R, Zhou X, Gu Q, Xia Z, Liang M, Zhou J, Lin B, Zou C. 2019. Dynamic changes in fermentation profiles and bacterial community composition during sugarcane top silage fermentation: a preliminary study. Bioresource Technology , 285 , 121315. doi: 10.1016/j.biortech.2019.121315. Reuben R C, Roy P C, Sarkar S L, Alam R, Jahid I K. 2019. Isolation, characterization, and assessment of lactic acid bacteria toward their selection as poultry probiotics. Bmc Microbiology , 19 , 253. https://doi.org/10.1186/s12866-019-1626-0. Strauber H, Lucas R, Kleinsteuber S. 2016. Metabolic and microbial community dynamics during the anaerobic digestion of maize silage in a two-phase process. Applied Microbiology and Biotechnology , 100 , 479-491. doi: 10.1007/s00253-015-6996-0. Sun P, Ge G, Sun L, Du S, Liu Y, Yan X, Zhang J, Zhang Y, Wang Z, Jia Y. 2024. Correction: effects of selenium enrichment on fermentation characteristics, selenium content and microbial community of alfalfa silage. Bmc Plant Biology , 24 , 630. doi: 10.1186/s12870-024-05308-w. Tang Z, Huang C, Li W, Li W, Tan W, Xi B, Tian Y, Zhu L. 2023. Horizontal transfer of intracellular and extracellular ARGs in sludge compost under sulfamethoxazole stress. Chemical Engineering Journal , 454 , 10. https://doi.org/10.1016/j.cej.2022.139968. Tian J, Tian R, Wu J, Huang L, Zhang J. 2024. Gas production characteristics of oats and tritical silages and techniques for reducing gas emissions1. Journal of Integrative Agriculture . https://doi.org/10.1016/j.jia.2024.09.023. Wang Q, Gu J, Wang X, Ma J, Hu T, Peng H, Bao J, Zhang R. 2020. Effects of nano-zerovalent iron on antibiotic resistance genes and mobile genetic elements during swine manure composting. Environmental Pollution , 258 , 113654. https://doi.org/10.1016/j.envpol.2019.113654. Wang Y, Zhou W, Wang C, Yang F, Chen X, Zhang Q. 2020. Effect on the ensilage performance and microbial community of adding Neolamarckia cadamba leaves to corn stalks. Microbial Biotechnology , 13 , 1502-1514. doi: 10.1111/1751-7915.13588. Wang Z, Tan Z, Wu G, Wang L, Qin G, Wang Y, Pang H. 2023. Investigation on fermentation characteristics and microbial communities of wheat straw silage with different proportion Artemisia argyi . Toxins , 15 , 330. https://doi.org/10.3390/toxins15050330. Wu Z, Luo Y, Bao J, Luo Y, Yu Z. 2020. Additives affect the distribution of metabolic profile, microbial communities and antibiotic resistance genes in high-moisture sweet corn kernel silage. Bioresource Technology , 315 , 123821. https://doi.org/10.1016/j.biortech.2020.123821. Xie W Y, Shen Q, Zhao F J. 2018. Antibiotics and antibiotic resistance from animal manures to soil: a review. European Journal of Soil Science , 69 , 181-195. doi:10.1111/ejss.12494. Xue Z, Mu L, Cai M, Zhang Y, Wanapat M, Huang B. 2020. Effect of using banana by-products and other agricultural residues for beef cattle in southern China. Tropical Animal Health and Production , 52 , 489-496. doi: 10.1007/s11250-019-02031-9. Yan Q, Wu F, Xu P, Sun Z, Li J, Gao L, Lu L, Chen D, Muktar M, Jones C, Yi X, Zhang J. 2021. The elephant grass ( Cenchrus purpureus ) genome provides insights into anthocyanidin accumulation and fast growth. Molecular Ecology Resources , 21 , 526-542. https://doi.org/10.1111/1755-0998.13271. Yang C, Huang B, Lin J, Yang Q, Guo Y, Liu D, Sun B. 2024. Isolation and screening of high biofilm producing lactic acid bacteria, and exploration of its effects on the microbial hazard in corn straw silage. Journal of Hazardous Materials , 480 , 136009. https://doi.org/10.1016/j.jhazmat.2024.136009. Yang L, Yuan X, Li J, Dong Z, Shao T. 2019. Dynamics of microbial community and fermentation quality during ensiling of sterile and nonsterile alfalfa with or without Lactobacillus plantarum inoculant. Bioresource Technology , 275 , 280-287. https://doi.org/10.1016/j.biortech.2018.12.067. You L, Bao W, Yao C, Zhao F, Jin H, Huang W, Li B, Kwok L, Liu W. 2022. Changes in chemical composition, structural and functional microbiome during alfalfa ( Medicago sativa ) ensilage with Lactobacillus plantarum PS-8. Animal Nutrition , 9 , 100-109. https://doi.org/10.1016/j.aninu.2021.12.004. Zhang Q, Zou X, Wu S, Wu N, Chen X, Zhou W. 2022a. Effects of pyroligneous acid on diversity and dynamics of antibiotic resistance genes in alfalfa silage. Microbiology Spectrum , 10 , e155422. https://doi.org/10.1128/spectrum.01554-22. Zhang X, Ding Z, Usman S, Zhang J, Chen M, Guo X. 2023. Metagenomics insights into the effects of lactic acid bacteria inoculation on the biological reduction of antibiotic resistance genes in alfalfa silage. Journal of Hazardous Materials , 443 , 130329. https://doi.org/10.1016/j.ijfoodmicro.2026.111622. Zhang X, Usman S, Bature I, Xu D, Guo X. 2023. Occurrence and fate of antibiotic-resistance genes and their potential hosts in high-moisture alfalfa silage treated with or without formic acid bactericide. Journal of Environmental Management , 347 , 119235. https://doi.org/10.1016/j.jenvman.2023.119235. Zhang Y, Wang P, Tang Y, Liao C, Tang X, Hou P, Chen C, Huang X, Lu G, Li L, Zhang M, Li F, Mei S, Chen C, Li P. 2025. Cooperation of Lactoplantibacillus plantarum and polyethylene microplastics facilitated the disappearance of tetracycline during anaerobic fermentation of whole plant maize. Journal of Hazardous Materials , 487 , 137172. https://doi.org/10.1016/j.jhazmat.2025.137172. Zhao C, Li Y, Chen Q, Guo Y, Sun B, Liu D. 2024. Effect of organic acids on fermentation quality and microbiota of horseshoe residue and corn protein powder. AMB Express , 14 , 58. doi: 10.1186/s13568-024-01686-4. Zhao J, Dong Z, Li J, Chen L, Bai Y, Jia Y, Shao T. 2019. Evaluation of Lactobacillus plantarum MTD1 and waste molasses as fermentation modifier to increase silage quality and reduce ruminal greenhouse gas emissions of rice straw. Science of the Total Environment , 688 , 143-152. https://doi.org/10.1016/j.scitotenv.2019.06.236. Zhou S, Li H, Wu Z, Li S, Cao Z, Ma B, Zou Y, Zhang N, Liu Z, Wang Y, Liao X, Wu Y. 2023. The addition of nano zero-valent iron during compost maturation effectively removes intracellular and extracellular antibiotic resistance genes by reducing the abundance of potential host bacteria. Bioresource Technology , 384 , 129350. https://doi.org/10.1016/j.biortech.2023.129350. Zong C, Wu Q, Dong Z, Wu A, Wu J, Shao T, Liu Q. 2022. Recycling deteriorated silage to remove hazardous mycotoxins and produce a value-added product. Journal of Hazardous Materials , 424 , 127627. https://doi.org/10.1016/j.jhazmat.2021.127627. Additional Declarations No competing interests reported. Supplementary Files Graphicalabstract2.png S1.png S1. mantel tests show the relationship among bacteriabacteria with the compositions of ARGs, MGEs. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-8493015","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":585301701,"identity":"5b18f78c-bce0-4578-b503-b8f34f74449a","order_by":0,"name":"Dandan Chen","email":"","orcid":"","institution":"South China Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Dandan","middleName":"","lastName":"Chen","suffix":""},{"id":585301702,"identity":"37b31aef-07ce-4333-b86d-40acd2d79fc2","order_by":1,"name":"Yuxin Zhou","email":"","orcid":"","institution":"Qingdao Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Yuxin","middleName":"","lastName":"Zhou","suffix":""},{"id":585301703,"identity":"39fce884-977c-4b80-be2b-9eee9e825866","order_by":2,"name":"Tianxin Guo","email":"","orcid":"","institution":"South China Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Tianxin","middleName":"","lastName":"Guo","suffix":""},{"id":585301704,"identity":"e6663215-673c-467d-acae-4fa7d2bc2bdb","order_by":3,"name":"Luyao Liu","email":"","orcid":"","institution":"South China Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Luyao","middleName":"","lastName":"Liu","suffix":""},{"id":585301705,"identity":"1437c815-ef59-4e52-8b53-957cc1c61c70","order_by":4,"name":"Qing Zhang","email":"","orcid":"","institution":"Qingdao Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Qing","middleName":"","lastName":"Zhang","suffix":""},{"id":585301706,"identity":"b83d2342-f181-432e-aa57-2bf1c67adc86","order_by":5,"name":"Ruiqi Pian","email":"","orcid":"","institution":"South China Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Ruiqi","middleName":"","lastName":"Pian","suffix":""},{"id":585301707,"identity":"ee14b940-39e2-426e-b013-ed393cd4fd64","order_by":6,"name":"Xuan Yao","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA0UlEQVRIiWNgGAWjYBADOSjNTLwWY9K1JDYQrcXg+OFj0jw1d9Lntx9+JsFQYZ3YwH72AH4tZ9KSjXmOPcvdcCbNTILhTHpiA09eAn4tB3IMH/OwHc7dIMFgJsHYdjixQYLHAL+W828MDvP8O5wuP4P9mwTjP2K03ADawtt2OIHhBg/QlgYitEjeeJZsOLfvsOGGMznFFgnH0o3beHLwa+E7n3xM4s23w/Ly7cc33vhQYy3bz34GvxaFA8i8BCBmw6seCOQbCKkYBaNgFIyCUQAAEsFFDzNTo/IAAAAASUVORK5CYII=","orcid":"","institution":"South China Agricultural University","correspondingAuthor":true,"prefix":"","firstName":"Xuan","middleName":"","lastName":"Yao","suffix":""}],"badges":[],"createdAt":"2026-01-01 04:08:28","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-8493015/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-8493015/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":101836113,"identity":"84f857f3-3a33-4ffd-ac67-db29b5e418c7","added_by":"auto","created_at":"2026-02-04 07:37:35","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":1101563,"visible":true,"origin":"","legend":"\u003cp\u003enutritional composition, microorganism counts, and potential ARGs of fresh napier grass.CP, crude protein; TP, true protein; NPN, non protein nitrogen; NDF, neutral detergent fiber; ADF, acid detergent fiber; WSC, water-soluble carbohydrate; LAB, lactic acid bacteria; CB, coliform bacteria; ARGs, antibiotic resistance genes; MGEs, mobile genetic elements.\u003c/p\u003e","description":"","filename":"Fig1.png","url":"https://assets-eu.researchsquare.com/files/rs-8493015/v1/33f04d7fba53cc4886ffe3a8.png"},{"id":101836108,"identity":"9c7d48de-d6af-4122-a34a-c1d7e3698894","added_by":"auto","created_at":"2026-02-04 07:37:34","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":3024525,"visible":true,"origin":"","legend":"\u003cp\u003ePhysical and biochemical indicators and microbial counts during dynamic anaerobic fermentation. D3, Day 3, D7,day 7; D14, day 14; D30, day 30; CK, the control; E, \u003cem\u003eEnterococcus Faecium; \u003c/em\u003eLP, \u003cem\u003eLactiplantibacillus plantarum.\u003c/em\u003e\u003c/p\u003e","description":"","filename":"Fig2.png","url":"https://assets-eu.researchsquare.com/files/rs-8493015/v1/136689157cfda76fe120ecb4.png"},{"id":101836115,"identity":"ffab000c-96f7-4962-8b31-611181b68afa","added_by":"auto","created_at":"2026-02-04 07:37:37","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":13707146,"visible":true,"origin":"","legend":"\u003cp\u003eChanges in the absolute abundances of intracellular ARGs and MGEs during dynamic anaerobic fermentation. D3, Day 3, D7,day 7; D14, day 14; D30, day 30; CK, the control; E, \u003cem\u003eEnterococcus Faecium; \u003c/em\u003eLP, \u003cem\u003eLactiplantibacillus plantarum\u003c/em\u003e;\u003c/p\u003e","description":"","filename":"Fig3.png","url":"https://assets-eu.researchsquare.com/files/rs-8493015/v1/6cc95b2dfa9d9533ebf01256.png"},{"id":101836109,"identity":"bffe9fe7-637d-4842-9020-35afbf93a3b7","added_by":"auto","created_at":"2026-02-04 07:37:34","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":3301043,"visible":true,"origin":"","legend":"\u003cp\u003eα diversity of bacterial community in napier grass silage during dynamic anaerobic fermentation. D3, Day 3, D7,day 7; D14, day 14; D30, day 30; CK, the control; E, \u003cem\u003eEnterococcus Faecium; \u003c/em\u003eLP, \u003cem\u003eLactiplantibacillus plantarum\u003c/em\u003e;\u003c/p\u003e","description":"","filename":"Fig4.png","url":"https://assets-eu.researchsquare.com/files/rs-8493015/v1/b7615387bceb1e4ee1cf7c5d.png"},{"id":101836116,"identity":"e719c6d3-2be1-4f57-af42-bb032b4b4ed0","added_by":"auto","created_at":"2026-02-04 07:37:38","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":19165077,"visible":true,"origin":"","legend":"\u003cp\u003eβ diversity and bacterial composition in napier grass silage during dynamic anaerobic fermentation. (a) Principal component analysis (PCA), Principal coordinates analysis (PCoA), and Non-metric multidimensional scaling (NMDS); (b) bacterial community structure in the phylum level; (c)(d) bacterial community structure in species level,\u003c/p\u003e","description":"","filename":"Fig5.png","url":"https://assets-eu.researchsquare.com/files/rs-8493015/v1/56af85d19b23bf233d8ef57b.png"},{"id":101836110,"identity":"f5aa31b0-0a64-4ed3-a11b-e54f5b8d890b","added_by":"auto","created_at":"2026-02-04 07:37:34","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":2881415,"visible":true,"origin":"","legend":"\u003cp\u003eNetwork co-occurrence pattern among ARGs, MGEs, and bacterial communities\u003c/p\u003e","description":"","filename":"Fig6.png","url":"https://assets-eu.researchsquare.com/files/rs-8493015/v1/2b8302d9dddba71462962ae8.png"},{"id":106961762,"identity":"b3b0fd59-91fa-4f85-a5a8-4836cae8b5b9","added_by":"auto","created_at":"2026-04-15 09:26:56","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":63161914,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8493015/v1/2ca90d33-fb9b-49d2-95dc-80cfd2d68469.pdf"},{"id":101836112,"identity":"7fe049ab-6dca-4e6a-8894-2d4361cf4cbb","added_by":"auto","created_at":"2026-02-04 07:37:35","extension":"png","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":71056531,"visible":true,"origin":"","legend":"","description":"","filename":"Graphicalabstract2.png","url":"https://assets-eu.researchsquare.com/files/rs-8493015/v1/4fc66864dab916e9e134b307.png"},{"id":101836114,"identity":"c32dae59-34cb-4f8f-b993-12e4b9eb2672","added_by":"auto","created_at":"2026-02-04 07:37:37","extension":"png","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":87925738,"visible":true,"origin":"","legend":"\u003cp\u003eS1. mantel tests show the relationship among bacteriabacteria with the compositions of ARGs, MGEs.\u003c/p\u003e","description":"","filename":"S1.png","url":"https://assets-eu.researchsquare.com/files/rs-8493015/v1/20ec5c32875ba1fd9b4e8aae.png"}],"financialInterests":"No competing interests reported.","formattedTitle":"Occurrence and fate of antibiotic resistance genes and their potential hosts during anaerobic fermentation of napier grass silage with the addition of different lactic acid bacteria","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eExcessive use of antibiotics in disease prevention and treatment for both humans and animals had resulted in antibiotic resistance which is associated with approximately 7 million deaths worldwide each year and is considered one of the major threats to human health in the 21st century(Chen\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e 2023). The root and molecular basis of resistance is the production and spread of antibiotic resistance genes (ARGs)(Jian\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e 2021). It implies that drugs are ineffective(Gabutti 2022). Currently, ARGs as a new type of environmental contaminants, has generated widespread interest and attracted extensive\u0026nbsp;attention around the world, which are detected in different environment media such as water, soil, plant, silage, composting, and urine, as well as animal feces(Zhang\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e 2023). According to estimates, ARGs may be having a more detrimental impact on the environment than the antibiotics themselves, it was widely recognized as posing a serious hazard to ecosystems and global health(Larsson and Flach 2022). Especially, the existence of abundant ARGs\u0026nbsp;induced the more and more emergence of antibiotic resistant bacteria (ARBs)(Zhou\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e 2023).\u0026nbsp;ARBs can grow and reproduce rapidly, adapt to diverse environments, enabling them to swiftly and invisibly spread to other areas. Admittedly, as ARGs carriers, they also contain a large number of mobile genetic elements (MGEs) and play a crucial part in facilitating ARGs transmission via horizontal gene transfer (HGT)(Jian\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e 2021)\u0026nbsp;With the delivery of food chain, ARBs may be\u0026nbsp;ingested by plant or attached to feed, then transferred to animals gut, who finally transmit them to humans through dietary intake(Darby\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e 2023). Therefore, the existence of ARGs is universally related to ARBs.\u003c/p\u003e\n\u003cp\u003eWith the sustainable growth of the world population, the global demand for meat, dairy, and animal feed is increasing each year(Liu\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e 2022). Around 2025, the consumption may be raised 60-70% worldwide(Xue\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e 2020). It meaning that need continuously supply of abundant feed. The prior study indicated that an average dairy cow consumes 0.025-0.027 ton of napier grass silage per day in intensive cattle farming, reaching up to a napier grass silage consumption of 12.5 ton per lactation(Nagy\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e 2022). Obviously, napier grass is a economically important species and potential energy grasses. The study suggests that napier grass is extensive planted\u0026nbsp;in tropical and subtropical regions of Asia, Africa and America, and is processed into silage to continue the imbalanced supply of forage year-round(Zong\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e 2022). silage is generally produced from fresh plant materials by the handling of anaerobic fermentation. The process involves bacterial fermentation, especially lactic acid bacteria(Hou\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e 2021). The acidification of lactic acid bacteria determines the fermentation quality of silage. Because it could alter bacterial structure and abundance, thereby inhibiting the growth and reproduction of harmful microorganisms, such as molds, yeasts, clostridium, etc(You\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e 2022). Therefore, the addition of exogenous lactic acid bacteria is a common way to improve silage quality. Given that ARGs may be transmitted from a contaminated environment (manure, water and soil) to plant system by microbiomes, silage may be polluted and become a potential reservoir for ARGs and MGEs(Xie\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e 2018). Therefore, it is essential to detect the abundance and variation of ARGs, as well as their relationship with bacteria in silage, when evaluating fermentation quality during ensiling. However, the relatively few studies have evaluated the safety of silage and whether silage is contaminated with ARGs and MGEs and transmission mechanism involved.Theoretically, the process of silage maturation is accompanied by changes in the bacterial community structure. This implies that may be effective to remove the ARGs and MGEs by reducing ARBs. Recent research has focused on ARGs types and reducing ARGs method by adding external additives to achieve safe production of silage(Wu\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e 2020; Zhang\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e 2023).\u0026nbsp;However, there were only a few additives that exhibited a fine effect on improving fermentation characteristics and reducing the abundance of ARGs and MGEs.\u0026nbsp;Especially, the study indicated that the prolonged time of anaerobic fermentation would increase ARGs enrichment, and formic acid bactericide was unuseful to remove the ARGs in high-moisture alfalfa silage(Zhang\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e 2022; Zhang\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e 2023).\u003c/p\u003e\n\u003cp\u003eTherefore, the present study respectively applied \u003cem\u003eLactiplantibacillus plantarum\u0026nbsp;\u003c/em\u003eand \u003cem\u003eEnterococcus faecalis\u0026nbsp;\u003c/em\u003eto napier grass silage, evaluating possible risks of ARGs and dynamic regulations on fermentation quality, ARGs and bacterial community. We tried to clarify the occurrence and fate of ARGs and their potential hosts.\u003c/p\u003e"},{"header":"2. Materials and methods","content":"\u003ch3\u003e2.1. Materials collection and preparation\u003c/h3\u003e\n\u003cp\u003eThe fresh napier grass was randomly growth at the experimental plot of South China Agricultural University without application of chemical fertilizers and insecticides. During establishment, the seed stem was buried a density with row width of 0.6 m and an intrarow spacing of 0.4 m, subsequently, the field was allowed to grow naturally. The napier grass fields were already five-years old. During each growing season, napier grass was mowed 2 times to ensure fresh regrowth. In October 2023, napier grass was harvested approximately 75% moisture content and conveyed into the laboratory immediately to cut into 1-2 cm(Tian\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e 2024). The material was sufficient mixed with three additives, in which\u0026nbsp;the lactic acid bacteria (\u003cem\u003eLactiplantibacillus plantarum\u0026nbsp;\u003c/em\u003eand\u003cem\u003e\u0026nbsp;Enterococcus faecalis\u0026nbsp;\u003c/em\u003e) were screened in prior study: (1) distilled water (CK, 1% g/Kg fresh sample); (2) \u003cem\u003eLactiplantibacillus plantarum\u0026nbsp;\u003c/em\u003e(LP, 1\u0026times;10\u003csup\u003e6\u0026nbsp;\u003c/sup\u003ecfu/g fresh sample); (3) \u003cem\u003eEnterococcus faecalis\u0026nbsp;\u003c/em\u003e(E, 1\u0026times;10\u003csup\u003e6\u003c/sup\u003e cfu/g fresh sample)(Guo\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e 2025). In each polyethylene plastic bag (40 \u0026times; 25 cm), 400 g napier grass were packed and sealed by a vacuum packing machine. Totally of 72 bags (3 treatments \u0026times; 4 days \u0026times; 6 replicates) were placed in a room with ambient temperature (25-30℃). 6 bags of these were randomly opened after 3, 7, 14, 30 days of fermentation.\u003c/p\u003e\n\u003ch3\u003e2.2 Physical and biochemical indicators and microbial counts\u003c/h3\u003e\n\u003cp\u003eThe sealed samples were opened and fully mixed for the determination of the silage quality after 3, 7, 14,30 days of fermentation. 120 g sample of each bag was taken by five-spot-sampling method and dried at 65℃ for 48h. The dry matter content (DM) was measured by the proportion dried to fresh weight(You\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e 2022). These dried samples were applied subsequently to calculate protein fractions (crude protein, true protein, and non-protein nitrogen), neutral detergent fiber (NDF), acid detergent fiber (ADF) and water soluble carbohydrates (WSC) contents according to\u0026nbsp;Zhao\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e (2024). Briefly, protein fractions were detected by the specific standard according to methods described by Association of Official Agricultural Chemists(Feldsine\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e 2002). NDF and ADF were analyzed using methods of ANKOM 2000 fiber analyzer (Ankom Technologies, Macedon, NY, USA) based on the company supplied procedure. WSC content was measured using the anthrone method. In addition, taking 10 g fresh material and 90 mL distilled water were blender to make silage extract and placed at 4 ℃ refrigerator for 24 h. The mixed liquid was filtered through 4 layers medical gauze and filter paper, and then its pH was immediately detected using a glass electrode pH meter (PHS-3C, INESA Scientific Instrument, Shanghai, China)(Li\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e 2023). The fraction of filtrate (approximately 300 \u0026mu;L) through pretreatment was injected into high-performance liquid chromatography (HPLC) to test the ingredients and content of organic acids (such as lactic acid, acetic acid, propionic acid, etc)(Zhang\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e 2025). The remained filtrate was used to determine the ammonia nitrogen (NH\u003csub\u003e3\u003c/sub\u003e-N) by phenol-hypochlorite method. Microorganisms at silage were also inoculated and cultured by the different agar and temperatures(Lu\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e 2022). The lactic acid bacteria and coliform bacteria were counted on de man, rogosa and sharpe agar (MRSA) plate and violet red bile agar (VRBA) plate, respectively, which were placed in a 37\u0026deg;C incubator for 48h. Yeasts and molds were cultured on rose bengal chloramphenicol agar (RBC) plate after being incubated at 28\u0026deg;C for 48h under aerobic condition\u003c/p\u003e\n\u003cp\u003e2.3 DNA extraction and quantitative determination of genes\u003c/p\u003e\n\u003cp\u003eThe extraction of DNA from napier grass silages was performed by HiPure Bacterial DNA Kit (Guangzhou Magen Biotechnology Co., Ltd.)(Tang\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e 2023). Each sample was frozen at -20\u0026deg;C refrigerator and stored for PCR and 16S rRNA sequencing. Total six ARGs and two MGEs, including sulfonamide resistance genes (\u003cem\u003esul1\u003c/em\u003e and \u003cem\u003esul2\u003c/em\u003e), macrolide resistance gene (\u003cem\u003eermB\u003c/em\u003e), quinolone resistance gene (\u003cem\u003eqnrD\u003c/em\u003e), rifampicin resistance gene (\u003cem\u003erob2\u003c/em\u003e), aminoglycoside resistance gene (\u003cem\u003eacrD\u003c/em\u003e) and MGEs (\u003cem\u003eintl1\u003c/em\u003e and \u003cem\u003eTn916/1545\u003c/em\u003e), were detected by standard PCR and verified the length of the PCR products by agarose electrophoresis. Each 20 \u0026mu;L PCR system includes 1 \u0026mu;L DNA from napier grass silage, 10 \u0026mu;L 2 \u0026times; PCR Mix and 0.5 \u0026mu;L corresponding primer for each detected gene. PCR amplification was under following procedure: 95\u0026deg;C for 3 min, 36 cycle including 94\u0026deg;C for 25 s, 60\u0026deg;C for 25 s, 72\u0026deg;C for 12 s, followed by 72\u0026deg;C for 5 min(Liang\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e 2020). Triplicate PCR products was recovered and purified using the NanoDrop ND-2000 spectrophotometer (Thermo Fisher Scientific, USA), and a recombinant plasmid was constructed and identified. Genes were quantitatively determined using qPCR (LightCycler 480II). The qPCR process was as follow: 95\u0026deg;C for 30 s, then 40 cycles containing 95\u0026deg;C for 10 s, annealing , and 60\u0026deg;C for 30 s. The PCR and qPCR primers were specifically enumerated in table 1(Luo\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e 2010; Gaze\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e 2011; Chen\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e 2015; Zhou\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e 2023).\u003c/p\u003e\n\u003cp\u003eTable 1. The specific primer sequences and annealing temperatures for ARGs and MGEs\u003c/p\u003e\n\u003cdiv align=\"center\"\u003e\n \u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" align=\"left\" width=\"528\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 111px;\"\u003e\n \u003cp\u003eGene\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 256px;\"\u003e\n \u003cp\u003ePrimer(5\u0026rsquo;\u0026rarr;3\u0026rsquo;)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 79px;\"\u003e\n \u003cp\u003ebp\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 82px;\"\u003e\n \u003cp\u003eTm\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" style=\"width: 111px;\"\u003e\n \u003cp\u003e\u003cem\u003eqnrD\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 256px;\"\u003e\n \u003cp\u003eGCTGGAATGGCACTGTGATA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" style=\"width: 79px;\"\u003e\n \u003cp\u003e149\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" style=\"width: 82px;\"\u003e\n \u003cp\u003e55\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 256px;\"\u003e\n \u003cp\u003eAGTTCGTCTTGCATCAAGCT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" style=\"width: 111px;\"\u003e\n \u003cp\u003e\u003cem\u003esul1\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 256px;\"\u003e\n \u003cp\u003eCACCGGAAACATCGCTGCA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" style=\"width: 79px;\"\u003e\n \u003cp\u003e158\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" style=\"width: 82px;\"\u003e\n \u003cp\u003e55\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 256px;\"\u003e\n \u003cp\u003eAAGTTCCGCCGCAAGGCT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" style=\"width: 111px;\"\u003e\n \u003cp\u003e\u003cem\u003esul2\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 256px;\"\u003e\n \u003cp\u003eCTCCGATGGAGGCCGGTAT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" style=\"width: 79px;\"\u003e\n \u003cp\u003e190\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" style=\"width: 82px;\"\u003e\n \u003cp\u003e55\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 256px;\"\u003e\n \u003cp\u003eGGGAATGCCATCTGCCTTGA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" style=\"width: 111px;\"\u003e\n \u003cp\u003e\u003cem\u003erpoB2\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 256px;\"\u003e\n \u003cp\u003eGACGACATCGACCACTTCGG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" style=\"width: 79px;\"\u003e\n \u003cp\u003e365\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" style=\"width: 82px;\"\u003e\n \u003cp\u003e54\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 256px;\"\u003e\n \u003cp\u003eGGGGTCTCGATCGGGCACAT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" style=\"width: 111px;\"\u003e\n \u003cp\u003e\u003cem\u003eTn916/1545\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 256px;\"\u003e\n \u003cp\u003eTCCTACAGCGACAGCCAGTGA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" style=\"width: 79px;\"\u003e\n \u003cp\u003e174\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" style=\"width: 82px;\"\u003e\n \u003cp\u003e54\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 256px;\"\u003e\n \u003cp\u003eTGCGTTGCTTTGGTCTGCTGGT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" style=\"width: 111px;\"\u003e\n \u003cp\u003e\u003cem\u003eacrD\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 256px;\"\u003e\n \u003cp\u003eTTAGTAAAGCAGCTGCCAAA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" style=\"width: 79px;\"\u003e\n \u003cp\u003e130\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" style=\"width: 82px;\"\u003e\n \u003cp\u003e56\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 256px;\"\u003e\n \u003cp\u003eCAGCCAGACACAGGACTACC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" style=\"width: 111px;\"\u003e\n \u003cp\u003e\u003cem\u003eermB\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 256px;\"\u003e\n \u003cp\u003eAAAACTTACCCGCCATACCA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" style=\"width: 79px;\"\u003e\n \u003cp\u003e139\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" style=\"width: 82px;\"\u003e\n \u003cp\u003e53\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 256px;\"\u003e\n \u003cp\u003eTTTGGCGTGTTTCATTGCTT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" style=\"width: 111px;\"\u003e\n \u003cp\u003e\u003cem\u003eIntl1\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 256px;\"\u003e\n \u003cp\u003eCTGGATTTCGATCACGGCACG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" style=\"width: 79px;\"\u003e\n \u003cp\u003e473\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" style=\"width: 82px;\"\u003e\n \u003cp\u003e60\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 256px;\"\u003e\n \u003cp\u003eACATGCGTGTAAATCATCGTCG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" style=\"width: 111px;\"\u003e\n \u003cp\u003e16s rRNA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 256px;\"\u003e\n \u003cp\u003eCGGTGAATACGTTCYCGG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" style=\"width: 79px;\"\u003e\n \u003cp\u003e143\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" style=\"width: 82px;\"\u003e\n \u003cp\u003e53\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 256px;\"\u003e\n \u003cp\u003eGGWTACCTTGTTACGACTT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n\u003c/div\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e2.4 16S rRNA gene high-throughput sequencing\u003c/p\u003e\n\u003cp\u003eTo analyze the interrelationships between bacteria and genes (ARGs and MGEs) during anaerobic fermentation, the extracted DNA was used to amplify V3-V4 regions of 16S rRNA with universal primers 341F (CCTACGGGNGGCWGCAG) and 806R (GGACTACHVGGGTATCTAAT). The bacterial 16S rRNA gene was detected by high-throughput sequencing on Illumina HiSeq 2500. The analysis steps of raw sequences were winnowed by Trimmomatic for quality filtering and merged with FLASH, and then was optimized through Mothur v.1.39.5. These sequences were statistically analyzed the bioinformatics, if 97% similar operational taxonomic units were similar.\u003c/p\u003e\n\u003cp\u003e2.5 Data and statistical analysis\u003c/p\u003e\n\u003cp\u003eAll data was evaluated using two-way analysis of variance (ANOVA) on the platform of IBM SPSS20.0. The significance level of\u003cem\u003e\u0026nbsp;P-\u003c/em\u003evalue\u003cem\u003e\u0026nbsp;\u003c/em\u003ewas set below 0.05 or 0.01. Boxplot and line chart abundance using the software of Origin 2018 64 Bit and Graphpad prism 10.1.2. The relevant figures of bacterial communities come from Omicsmart online platform and were beautified by Adobe Illustrator 2023. The network analysis graph were made using Gehpi soft.\u003c/p\u003e"},{"header":"3. Results","content":"\u003cp\u003e3.1 Chemical characterization, microorganism counts, and ARGs residues of fresh napier grass\u003c/p\u003e\n\u003cp\u003eTo investigate the quality and ARGs contamination of fresh napier grass, the chemical compositions, microbial populations, ARGs and MGEs abundance before fermentation were shown in Figure 1. The fresh napier grass contained 104.65 g/kg DM CP and 96.48 g/kg DM TP (Fig.1a). And NPN was also detected, the content of which was around 8.14 g/kg DM. The NDF content was the higher than ADF in fresh napier grass. Meanwhile the WSC content was only estimated around 29.46 g/kg DM. Among these attached microorganisms, molds had the highest count (4.43 lg cfu\u0026middot;g\u003csup\u003e-1\u003c/sup\u003e FM ), while LAB were the lowest number (3.40 lg cfu\u0026middot;g\u003csup\u003e-1\u003c/sup\u003e FM) (Fig. 1b). As for yeasts and CB, the number of them were evaluated about 4.12 and 3.73 lg cfu\u0026middot;g\u003csup\u003e-1\u003c/sup\u003e FM, respectively. A total of six ARGs (\u003cem\u003erob2\u003c/em\u003e,\u003cem\u003e\u0026nbsp;sul2\u003c/em\u003e,\u003cem\u003e\u0026nbsp;acrD\u003c/em\u003e,\u003cem\u003e\u0026nbsp;emB\u003c/em\u003e,\u003cem\u003e\u0026nbsp;qnrD\u003c/em\u003e, \u003cem\u003esul1\u003c/em\u003e) and two MGEs (\u003cem\u003eintl1\u003c/em\u003e, \u003cem\u003eTn916/415\u003c/em\u003e) were found in fresh napier grass (Fig. 1c). Among them, the average abundance were 31.14, 28.73, 21.23, 21.27, 21.47, 23.74, and 30.33 logs, respectively. the expression of \u003cem\u003eermB\u0026nbsp;\u003c/em\u003eaccompanied by highest absolute abundance, while the opposite was true for \u003cem\u003eacrD\u003c/em\u003e.\u003c/p\u003e\n\u003cp\u003e3.2 Physical and biochemical indicators and microbial counts during dynamic anaerobic fermentation\u003c/p\u003e\n\u003cp\u003eTo comprehensively evaluate the impact of LP and E additives on napier grass silage, the fermentation characteristics and chemical composition in different ensiling period were assessed and shown in Fig. 2. Although the inoculation of LAB unchanged the dry matter and true protein, increased only the crude protein and non protein nitrogen after 3 days fermentation(\u003cem\u003eP\u003c/em\u003e\u0026lt;0.01). The addition of LP and E effectively reduced the pH value after 3 and 30 days ensiling. Compared with the other groups, LP group significantly decreased the pH, and simultaneously increased lactic acid during dynamic fermentation(\u003cem\u003eP\u003c/em\u003e\u0026lt;0.01). There were undetected acetic acid and propionic acid in all treated group before 14 days fermentation. However, acetic acid and propionic acid were determined in CK and E groups after 30 days fermentation. And propionic acid was relatively high content in E treated group than in that of CK group. During dynamic fermentation, the change of main microorganism were also more pronounced. Compared with the other groups, the inoculation of LP increased markedly the lactic acid bacteria, and helped maintain the low count of coliform bacteria in whole fermentation period. Moreover, LP group undetected yeasts after 7 days. Regarding molds, all treated groups were only subtle change before 14 days. However, the count of molds in LP and E treated groups showed significant decrease compared to the CK group.\u003c/p\u003e\n\u003cp\u003e3.3 The variations of ARGs and MGEs during dynamic anaerobic fermentation\u003c/p\u003e\n\u003cp\u003eIn the study, the effect of LP and E on ARGs and MGEs were determined during dynamic fermentation (Fig. 3). During fermentation process, the abundance of all ARGs and MGEs remained below 10 logs in all groups, which was lower than before ensiling (Fig. 1c). Among them, the absolute abundance of \u003cem\u003eIntl1\u003c/em\u003e, \u003cem\u003esul1\u003c/em\u003e and \u003cem\u003esul2\u0026nbsp;\u003c/em\u003ewas significantly lower in LP group than that in the other groups after 3 days fermentation. However, the CK and E groups showed a markedly reduction in the absolute abundance of \u003cem\u003eIntl1\u003c/em\u003e, \u003cem\u003esul1\u003c/em\u003e, and \u003cem\u003esul2\u003c/em\u003e at the end of ensiling compared to the initial abundance, whereas the LP group remained unchanged. The expression of \u003cem\u003eermB\u003c/em\u003e,\u003cem\u003e\u0026nbsp;qnrD\u003c/em\u003e,and\u003cem\u003e\u0026nbsp;Tn916/145\u0026nbsp;\u003c/em\u003ein E group significantly down-regulated than in other group after 30 days. It is noteworthy that the abundance of \u003cem\u003eermB\u003c/em\u003e in the E group was the lowest in the fermented process, exhibiting a significant reduction compared to that of the other groups, with the exception of day 7. Although the inoculation of LP also effectively down-regulated the expression of \u003cem\u003eqnrD\u0026nbsp;\u003c/em\u003eafter 30 daysfermentation, the abundance of \u003cem\u003eermB\u0026nbsp;\u003c/em\u003eand\u003cem\u003e\u0026nbsp;Tn916/145\u003c/em\u003e unchanged in fermented process and hold much greater level in LP group than that of other groups. Regarding of the expression of \u003cem\u003erpob2\u003c/em\u003e and \u003cem\u003eacrD\u003c/em\u003e, neither the LP nor the CE application exhibited any significant alteration, compared with CK group. Nevertheless, the inoculation of lactic acid bacteria resulted in a significant reduction the expression levels of \u003cem\u003erpob2\u003c/em\u003e and \u003cem\u003eacrD\u003c/em\u003e in the later stage relative to the initial period.\u003c/p\u003e\n\u003cp\u003e3.4.1 Bacterial diversity of silages during dynamic fermentation\u003c/p\u003e\n\u003cp\u003eBacterial diversity of silages was conducted on the contigs assembled from each sample using the MetaGeneMark software. The results are presented in Fig. 4. The Chao index, Ace index, and Son index suggest that E group exhibited a lower number of species; however, this reduction was not statistically significant compared to the other two groups (\u003cem\u003eP\u003c/em\u003e\u0026gt;0.05). These indices also indicate that there was an insignificant difference in the number of OTUs (Operational Taxonomic Units) across all groups, whereas the inoculation of LP resulted in an increase in the number of species as fermentation time extends. The Shannon, Simpson, and Pielou index show that the addition of LP led to a reduction between the diversity and richness of silage relative to CK group. Conversely, the E group exhibited no statistically significant difference in these indices. The enhanced diversity in LP group was observed by pd index, which was significant increase in the later fermentation stage than that of the initial period.\u003c/p\u003e\n\u003cp\u003eTo further assess the differences in bacterial diversity distribution in different treatments, the analysis of beta diversity was conducted at bacterial community (Fig.5). the variance value of Principal Component 1 (PC1) and Principal Component 2 (PC2) was 71.89% and 18.04%, respectively, which indicated a good fit between the calculated results and the observed data about Principal Component Analysis (PCA). Utilizing various algorithms, including PCA, Principal Coordinates Analysis (PCoA), and Non-metric Multidimensional Scaling (NMDS), it is demonstrated that the distribution of samples within each group exhibits relative uniformity. There were significant differences in bacterial community structure between before and after ensiling in silage. This pattern further suggested that LAB treatment and duration could markedly influence bacterial community succession in ensiled napier grass. Furthermore, the application of PCA, PCoA, NMDS revealed a distinct separation in the bacterial community structure between the CK and LP groups, while E group exhibited no significant separation compared to CK group. Ensiling duration does not seem to have altered the bacterial communities in each treatment, which does not lead to substantial changes.\u003c/p\u003e\n\u003cp\u003eThe bacterial composition in silage is illustrated in Fig.5. The total relative abundance of Proteobacteria and Firmicutes at the phylum level accounted for 97.52% and 1.93% before ensiling, respectively, which were also main bacteria in the bacterial communities before and after fermentation. But the community structure had obviously changed. Firmicutes increased significantly in all groups after ensiling. Especially, it became the dominant phylum in LP group, and hold an increasing trend after ensiling reached maturity. The change tread of Proteobacteria was opposite to that of Firmicutes. At the species level, the dominant bacteria were not consistent. \u003cem\u003eLactobacillus plantarum\u003c/em\u003e accompanied with high number in LP group during ensiling, its abundance was in the range of 75.15%-83.90%. there were abundant the unclassified bacteria in CK and E group after ennsiling. Theses bacteria were found in significantly large amounts between 81.19%-90.76%. In these identifiable bacteria, \u003cem\u003eLactobacillus plantarum\u003c/em\u003e, and \u003cem\u003eWeissella_oryzae\u0026nbsp;\u003c/em\u003eincreased significantly becoming the dominant species in CK and E groups, while \u003cem\u003ePantoea_sp_PSNIHI\u0026nbsp;\u003c/em\u003eand \u003cem\u003ePantea_ananatis__PA13\u003c/em\u003e decreased significantly with the prolonged fermentation time. The highest abundance bacteria were different in E and CK groups, which were \u003cem\u003eLactobacillus plantarum\u0026nbsp;\u003c/em\u003eand\u003cem\u003e\u0026nbsp;Weissella_oryzae\u003c/em\u003e, respectively. The addition of E increased significantly the count of \u003cem\u003eLactobacillus plantarum\u003c/em\u003e, and reduced significantly \u003cem\u003eWeissella_oryzae\u003c/em\u003e,\u003cem\u003e\u0026nbsp;Pantoea_sp_PSNIHI\u003c/em\u003e, and \u003cem\u003ePantea_ananatis__PA13,\u0026nbsp;\u003c/em\u003ecompared to CK group.\u003c/p\u003e\n\u003cp\u003eThe correlations between bacteria and ARGs and MGEs were assessed using the Mantel test. According to Fig. (S1),\u0026nbsp;\u003cem\u003eLactobacillus plantarum\u003c/em\u003e exhibited a negative correlation with the other bacteria, including \u003cem\u003eWeissella_oryzae\u003c/em\u003e, \u003cem\u003ePantoea_sp_PSNIHI\u003c/em\u003e, \u003cem\u003ePantea_ananatis__PA13\u003c/em\u003e, \u003cem\u003eCurtobacterium_luteum\u003c/em\u003e, \u003cem\u003eOryza_sativa_Indica_Group_long-grained_rice\u003c/em\u003e, \u003cem\u003eQuadrisphaera_granulorum\u003c/em\u003e, \u003cem\u003eSphingomonas_roseiflava\u003c/em\u003e, \u003cem\u003eDevosia_sp_I507\u003c/em\u003e, \u003cem\u003eHerbaspirillum_huttiense\u003c/em\u003e, \u003cem\u003eMethylobacterium_radiotolerans_JCM_2831\u003c/em\u003e. \u003cem\u003eMethylobacterium_aerolatum\u003c/em\u003e, \u003cem\u003eSphingomonas_azotifigens\u003c/em\u003e, \u003cem\u003eLactococcus_garvieae_ATCC_49156\u003c/em\u003e, \u003cem\u003eNocardioides_oleivorans\u003c/em\u003e. In addition, there were obviously a positive correlation between bacteria, except\u003cem\u003e\u0026nbsp;Lactobacillus plantarum\u003c/em\u003e. These bacteria were also related with ARGs and MGEs. The results indicated that the abundance of MGEs was significantly related with \u003cem\u003eLactobacillus_plantarum\u003c/em\u003e, \u003cem\u003ePantoea_sp_PSNIH1\u003c/em\u003e, \u003cem\u003ePantoea_ananatis_PA13\u003c/em\u003e, \u003cem\u003eWeissella_oryzae, Empedobacter_brevis\u003c/em\u003e, \u003cem\u003eMethylobacterium_aerolatum\u003c/em\u003e, and \u003cem\u003eMethylobacterium_radiotolerans_JCM_2831\u003c/em\u003e.Similarly, the abundance of ARGs was significantly related with \u003cem\u003eLactobacillus_plantarum\u003c/em\u003e, \u003cem\u003ePantoea_sp_PSNIH1\u003c/em\u003e, \u003cem\u003ePseudomonas_psychrotolerans\u003c/em\u003e,\u0026nbsp;\u003cem\u003eWeissella_oryzae\u003c/em\u003e, \u003cem\u003eMethylobacterium_aerolatum\u003c/em\u003e and \u003cem\u003ePantoea_ananatis_PA13\u003c/em\u003e.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eTo determine the potential hosts of ARGs and MGEs in napier grass silage, the specific correlations with bacteria were analyzed, which was obtained by performing screening (0\u0026lt;|R|\u0026lt;1, \u003cem\u003eP\u003c/em\u003e\u0026lt;0.05) (Fig 6). The positive correlation was between \u003cem\u003eermB\u003c/em\u003e and \u003cem\u003eNocardioides_oleivorans, Deinococcus_gobiensis_I-0\u003c/em\u003e, \u003cem\u003eLeifsonia_shinshuensis\u003c/em\u003e, \u003cem\u003eLactobacillus_plantarum\u003c/em\u003e, \u003cem\u003eMethylobacterium_komagatae\u003c/em\u003e, \u003cem\u003eMyroides_odoratus_CIP_103059\u003c/em\u003e. The high abundance of \u003cem\u003eTn916/1545\u0026nbsp;\u003c/em\u003ewas related with \u003cem\u003eLactobacillus_plantarum\u003c/em\u003e, \u003cem\u003eDeinococcus_gobiensis_I-0\u003c/em\u003e, \u003cem\u003eFlavobacterium_ceti\u003c/em\u003e, \u003cem\u003eDevosia_sp_I507\u003c/em\u003e, \u003cem\u003eMyroides_odoratus_CIP_103059\u003c/em\u003e, and \u003cem\u003eNocardioides_oleivorans\u003c/em\u003e, while the exist of \u003cem\u003eqnrD\u0026nbsp;\u003c/em\u003ewas inevitably linked to \u003cem\u003eLactobacillus_plantarum\u003c/em\u003e, \u003cem\u003eAcidovorax_avenae\u003c/em\u003e, \u003cem\u003eLactococcus_garvieae_ATCC_49156\u003c/em\u003e, and \u003cem\u003eSphingomonas_roseiflava\u003c/em\u003e. \u003cem\u003ePantoea_sp_PSNIH1\u003c/em\u003e, \u003cem\u003eWeissella_oryzae\u003c/em\u003e, and \u003cem\u003ePantoea_ananatis_PA13\u0026nbsp;\u003c/em\u003ewere effectively promoted \u003cem\u003esul1\u003c/em\u003e expression. Similarly, \u003cem\u003ePantoea_sp_PSNIH1\u003c/em\u003e, \u003cem\u003eWeissella_oryzae\u003c/em\u003e, \u003cem\u003ePseudomonas_psychrotolerans\u003c/em\u003e, and \u003cem\u003ePantoea_ananatis_PA13\u003c/em\u003e played a positive role in the expression of \u003cem\u003eintl1\u003c/em\u003e. there were 4 species of bacteria (including \u003cem\u003ePantoea_sp_PSNIH1\u003c/em\u003e, \u003cem\u003eWeissella_oryzae\u003c/em\u003e, \u003cem\u003ePantoea_ananatis_PA13\u003c/em\u003e, and \u003cem\u003eSphingomonas_roseiflava\u003c/em\u003e) related with the increased abundance of \u003cem\u003esul1.\u003c/em\u003e \u003cem\u003ePantoea_sp_PSNIH1\u003c/em\u003e, \u003cem\u003ePseudomonas_psychrotolerans\u003c/em\u003e and \u003cem\u003ePantoea_ananatis_PA13\u003c/em\u003e were positive effect about the expression of \u003cem\u003eacrD\u0026nbsp;\u003c/em\u003eand\u003cem\u003e\u0026nbsp;sul2\u003c/em\u003e. The abundance of \u003cem\u003erpob2\u003c/em\u003e were only related positively with \u003cem\u003ePseudomonas_psychrotolerans\u003c/em\u003e and \u003cem\u003ePantoea_sp_PSNIH1\u003c/em\u003e. It is worth mentioning that some bacteria (such as \u003cem\u003eClostridium_algidixylanolyticum\u003c/em\u003e, \u003cem\u003eLactococcus_raffinolactis\u003c/em\u003e and \u003cem\u003eWeissella_hellenica\u003c/em\u003e, etc) were only negative effect with the abundance of ARGs and MGEs. Moreover, \u003cem\u003eLactobacillus_plantarum\u003c/em\u003e had significant inhibitory effect to the expression of \u003cem\u003eacrD\u003c/em\u003e and \u003cem\u003eropb2\u003c/em\u003e.\u003c/p\u003e"},{"header":"4 Discussion","content":"\u003cp\u003eThe nutritional value and safety of feed are crucial to high-quality ruminant products. Napier grass is extensively planted in tropical and subtropical regions, mainly used for manufacturing biofuel and animal production(Yan\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e 2021). Due\u0026nbsp;to\u0026nbsp;its short growth cycle, high biomass, as well as strong adaptability, it is deeply popular with smallholder livestock farmers and generally accounts for 80% of dairy cattle diet(Habte\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e 2022). Generally, fresh napier grasses were harvested and fed directly animals in the stage of vigorous growth. Meanwhile some of them also ensilied commonly to maintain feed supply during periods of insufficient grass growth(Chen\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e 2022). It widely known that high-quality silage is directly related to the\u0026nbsp;epiphytic microorganisms\u0026nbsp;(mainly lactic acid bacteria) of plant(Nazar\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e 2021). Ensiling is an anaerobic fermentation process, in which lactic acid bacteria (LAB) produce acids to inhibit microbial activities thereby reducing nutrition loss and obtaining high quality silage(Wang\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e 2020). In present study, the number of lactic acid bacteria was low and did not occupy a dominant position in initial community. Therefore, it was unable to meet the basic requirement (5.00 lg cfu/g FM) to guarantee gaining high-quality silage(Wang\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e 2023). Moreover, the undesirable\u0026nbsp;microorganisms\u0026nbsp;(such as yeasts, moulds) were relatively high abundance in silage. As resistance gene carrier, these\u0026nbsp;microorganisms\u0026nbsp;could be also related to estimate the absolute abundance of ARGs and MGEs. Sulfonamide resistance gene, macrolide resistance gene, quinolone resistance gene, rifampicin resistance gene, and aminoglycoside resistance gene, are common types of resistance genes in nature that have a significant impact on the environment, while MGEs is important in the horizontal gene transfer (HGT) of ARGs. In our study, napier grass has also been contaminated with a certain degree of ARGs. Total six types ARGs and two types MGEs were detected the high absolute abundance in fresh napier grass. Among of them, the abundance of \u003cem\u003eermB\u003c/em\u003e was the highest around 31.49 logs, while the abundance of \u003cem\u003eacrD\u003c/em\u003e was the lowest about 21.23 logs. To improve silage, Both LP and E additives are popularly applied to modulate the fermentation quality of silage. As an exogenous microbial agent, their existence may adjust the microbial community structure and influence the distribution and transmission of ARGs. Therefore, we added two different types LAB into napier grass silage to asses the specific change and potential relationships of ARGs and MGEs , respectively.\u003c/p\u003e\n\u003cp\u003eAntibacterial activity of LAB was estimated by the capacity of producing acids, and pH value is the most visual evaluation(Zhang\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e 2022). Compared with the early stage of ensiling, all treatments markedly reduced the pH value after 30 days fermentation. It was partially explained by the rapid accumulation of organic acid content(Strauber\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e 2016; Gharechahi\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e 2017). Especially, the LP treated group was significantly decreased the pH value with the extension of fermentation time. It had lowest pH value and highest lactic acid content in different fermentation period relative to the other groups. This result was reasonably explained that Exogenous LP inoculation induced rapid homofermentation under insufficient WSC during the initial stage of ensiling, thus producing significantly increased lactic acid(Zhao\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e 2019). As a key metabolite of lactic acid bacteria, high concentration of lactic acid had shown the strong antibacterial ability(Reuben\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e 2019). Both homofermentative and heterofermentative LAB are main type of LAB and are universal used as microbial inoculants in silage(Blajman\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e 2018). Theoretically, LP and E were representative of homofermentative LAB, which contribute to accelerating the process of WSC conversion and increasing the levels of lactic acid (LA) and acetic acid (AA), thereby achieving antibacterial effect(Hisham\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e 2022). However, their effect were different. Although the E addition could significantly inhibited the growth of yeasts after 7 days aerobic fermentation, compared with CK group. The undesirable microorganism (such as coliform bacteria) was still maintain high abundance. This could be because although it may improve lactic acid level, the effect was subtle relative to the CK group (\u003cem\u003eP\u003c/em\u003e\u0026gt;0.05). Despite all this, after 30 days fermentation, the E application may be because of the accumulation of acetic acid and lactic acid concentration thereby inducing the undetected molds counts. In contrast, the coliform bacteria had the lower number in LP treated than that of CK group (\u003cem\u003eP\u0026lt;\u003c/em\u003e0.05). Simultaneously, yeasts and molds were undetected in LP group after 7 days and 30 days fermentation, respectively. Regarding protein components, two species of LAB application appeared higher crude protein and non protein nitrogen after 3 days fermentation, compared to the CK group. Notablely, inoculation LAB were unuseful to maintained the crude protein and true protein retention of silage, as well as decreasing non protein nitrogen after later stage. It could be the content of protein was low in napier grass silage.\u0026nbsp;Chen\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e (2023)\u0026nbsp;was similar result.\u003c/p\u003e\n\u003cp\u003eZhang et al. (2023) suggested that ensiling is useful and can significantly lower the abundance of ARGs and MGEs in alfalfa, which is consistent with the results of this study. There were relatively lower the abundance of ARGs and MGEs in napier grass silage than fresh napier grass. The fermented process of ensiling is accompanied by the rapid acidfication of fresh forage, which may lead to a part of bacterial cell death(Oliveira\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e 2017). As the potential hosts, the number of bacterial cell is directly related to the remove of ARGs and MGEs(Deng\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e 2022). The external LAB addition is conducive to rapid acid accumulation and may cause fine effect of bacteriostasis(Oliveira\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e 2017). In present study, the addition of different LAB shown the variation the abundance of ARGs and MGEs during dynamic fermentation, as following Fig. 3. The LP inoculation seemed to show the fine effect to remove \u003cem\u003eintl1\u003c/em\u003e, \u003cem\u003esul2\u003c/em\u003e and \u003cem\u003esul1.\u003c/em\u003e The abundance of \u003cem\u003eintl1\u003c/em\u003e, \u003cem\u003esul2\u003c/em\u003e and \u003cem\u003esul1\u003c/em\u003e was significantly lowered in the LP treated group than that other treated groups after 3 days of ensiling. Meanwhile, during fermentation, it remained stable in LP treated silage, with only a slight fluctuation at the end of ensiling compared to the initial abundance. However, the LP addition was ineffective to remove the \u003cem\u003eermB\u003c/em\u003e and \u003cem\u003eTn916/545\u003c/em\u003e, the abundance of both \u003cem\u003eermB\u003c/em\u003e and \u003cem\u003eTn916/545\u003c/em\u003e was found to be significantly higher in LP group compared to the other groups during ensiling. In contrast, the E treated silage shown significantly lower abundance of \u003cem\u003eermB\u003c/em\u003e and \u003cem\u003eTn916/545\u003c/em\u003e than the other groups after 30 days ensiling. Although the change of \u003cem\u003eqnrD\u003c/em\u003e abundance was fluctuate among different treatments during ensiling, the LAB inoculation was notably lower the abundance of \u003cem\u003eermB\u003c/em\u003e than CK group at the ending of ensiling. Compared the ending of ensiling to the initial fermentation stage, the fermentation process was tended to enhance the abundance of\u003cem\u003e\u0026nbsp;acrD\u003c/em\u003e in CK group, but the absolute abundance of \u003cem\u003eacrD\u003c/em\u003e and \u003cem\u003erpob2\u003c/em\u003e was notably decreased in LAB treated groups.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e3.4 Changes in the bacterial diversity and bacterial community structure during dynamic fermentation\u003c/p\u003e\n\u003cp\u003e3.4.1 Bacterial diversity of silages during dynamic fermentation\u003c/p\u003e\n\u003cp\u003eThe diversity of bacterial community was used to estimate the interspecific difference and intraspecific difference among different treated silage(Ren\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e 2019). And it was analyzed by next-generation sequencing of the full-length 16S rRNA gene(Peng\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e 2024). the α diversity of bacterial community was related with Sob, Chao1, Ace, Simpson, Shannon, Pielou, and pd. The index of Sob, Chao1, and Ace is a way of estimating the total number of species that can be found in a sample from a community. When The index of Sob, Chao1, and Ace are high, it indicates that there are likely many low-abundance species present in the community(Zhou\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e 2023). The indexes of Sob, Chao1, and Ace suggested that there were no difference in the number of harbors among treatments during anaerobic fermentation. However, the indexes of Shannon, Simpson, and pielou showed that LP group decreased the species diversity of silage. These indexes demonstrated that LP group had more high-adundance bacteria, and less species were observed. Simpson and pielou, meanwhile, indicated that more high-adundance bacteria, and more species were observed, compared with CK group. Beta diversity may evaluate the species difference among different communities, which the more distinct separation reveal more difference(Li\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e 2022). In the analysis of beta diversity, the stress value of the Non-metric Multidimensional Scaling (NMDS) is 0.023, indicating a good fit between the calculated results and the observed data. NMDS and PCA illustrates that ensiling significantly alter the beta diversity of the fresh napier grass. There were obviously separated between before and after fermentation. The inclusion of E did not lead to substantial changes in the β diversity of the bacterial community in the process of dynamic fermentation, suggesting that bacterial community of β diversity remained stable. However, the addition of LP could rebuild the bacterial community.\u0026nbsp;There were the differences between the CK and LP groups during anaerobic fermentation, while the difference were not statistically significant in CK and E groups.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e3.4.2 The structure of bacterial community in silages during dynamic fermentation\u003c/p\u003e\n\u003cp\u003eBacterial community structure is a an important factor affecting the change of fermentation quality and ARGs in silage(Wang\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e 2020). Firmicutes and Proteobacteria were the dominant phyla in the silage. Firmicutes were found in significantly larger amounts in LP group than in the other groups, whereas Proteobacteria was significantly more prevalent in CK and E groups than in that of LP group. Similarly, Yang et al. (2024) also found that Firmicutes and Proteobacteria were dominant bacteria in corn stover silage, and the addition of exogenous LP alters the microbial structural composition within the silage, resulting in a reduction in the proportion of Proteobacteria and an increase in the proportion of Firmicutes. The high abundance of Proteobacteria and Firmicutes could suggest that are main potential host bacteria for ARGs. \u003cem\u003ePantoea_sp_PSNIHI\u003c/em\u003e, \u003cem\u003ePseudomonas_psychrotolerans\u003c/em\u003e and \u003cem\u003ePantoea_ananatis_PA13\u0026nbsp;\u003c/em\u003ewerehigh abundance in fresh napier grass. These bacteria were found in significantly less amounts after anaerobic fermentation. Therefore, it may be reasonably inferred that the reduction of ARGs was related to the abundance of \u003cem\u003ePantoea_sp_PSNIHI, Pseudomonas_psychrotolerans and Pantoea_ananatis_PA13\u003c/em\u003e after than before ensiling. The dominant genera in the CK and LP groups were ambiguous during the anaerobic fermentation process, because the identifiable bacterial was only low range (9.24%-8.81%) during anaerobic fermentation. In these identifiable bacteria, \u003cem\u003eWeissella_oryzae\u0026nbsp;\u003c/em\u003ewasthe predominant species in the CK group. It is common lactic acid-producing \u003cem\u003ecooi\u003c/em\u003e and relates with lactic acid fermentation in silage(Yang\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e 2019). Similarly, both \u003cem\u003eWeissella_oryzae\u0026nbsp;\u003c/em\u003eand \u003cem\u003eLactobacillus plantarum\u0026nbsp;\u003c/em\u003ewere dominant in E group. The study indicated that \u003cem\u003eWeissella_oryzae\u0026nbsp;\u003c/em\u003eis mainly producing lactic acid ininitiate lactic fermentation in the early ensiling process, whereas \u003cem\u003eLactobacillus plantarum\u0026nbsp;\u003c/em\u003eplays a critical role in acid increase at the later stage(Li\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e 2022). Therefore, it could reasonably explain that the significant pH reduction in E group may be caused by the shift in domain species from \u003cem\u003eWeissella_oryzae\u003c/em\u003e to \u003cem\u003eLactobacillus plantarum\u0026nbsp;\u003c/em\u003eafter 30 days ensiling, compared with CK group. The addition of E may be conducive to the preservation and avoiding nutrient loss of silage. As fermentation time prolongs, it reduced significantly the undesirable bacteria, including\u003cem\u003e\u0026nbsp;Pantoea_sp_PSNIHI\u0026nbsp;\u003c/em\u003eand \u003cem\u003ePantea_ananatis__PA13\u003c/em\u003e(Sun\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e 2024). Regarding as LP group, it showed a better effect in increasing lactic acid production, decreasing pH and improving silage than the other group, all of which were associated with greater abundance of \u003cem\u003eLactobacillus plantarum\u003c/em\u003e.\u003c/p\u003e\n\u003cp\u003e3.5 Bacterial community and ARGs with binning analysis\u003c/p\u003e\n\u003cp\u003eBacteria are considered carriers of ARGs and MGEs(Zhou\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e 2023). Based on the strong and significant correlations between ARGs and coexisting bacterial groups, nonrandom cooccurrence patterns of ARGs and bacterial groups can be used to gain new insights into ARGs and their possible hosts. To further insight the symbiotic relationship between the bacterial community and the expression level of ARGs and MGEs, 0.1%\u0026gt; species in abundance were selected to conduct network analysis with TRGs through the whole ensiling process. The significantly positive correlation between\u0026nbsp;\u003cem\u003eLactobacillus_plantarum\u0026nbsp;\u003c/em\u003eand the abundance of \u003cem\u003eermB\u003c/em\u003e, \u003cem\u003eqnrD\u003c/em\u003e, and \u003cem\u003eTn916/1545\u003c/em\u003e indicating that \u003cem\u003eLactobacillus_plantarum\u0026nbsp;\u003c/em\u003emay be the potential host bacteria of these ARGs and MGEs. The high count of \u003cem\u003eLactobacillus_plantarum\u0026nbsp;\u003c/em\u003ein LP group could cause the obviously greater logs of \u003cem\u003eermB\u003c/em\u003e and \u003cem\u003eTn916/1545\u003c/em\u003e than in that CK and E group. Similarly, \u003cem\u003ePantoea_sp_PSNIH1\u003c/em\u003e, \u003cem\u003ePseudomonas_psychrotolerans\u003c/em\u003e and \u003cem\u003ePantoea_ananatis_PA13\u003c/em\u003e were the potential host bacteria for \u003cem\u003eacrD\u003c/em\u003e. The inoculation of LP and E significantly decreased these bacteria, thereby significantly decreasing the abundance of \u003cem\u003eacrD\u003c/em\u003e. The parallel result also displayed that \u003cem\u003eLactobacillus_plantarum\u0026nbsp;\u003c/em\u003ewas negative correlation. It might be \u003cem\u003eLactobacillus_plantarum\u0026nbsp;\u003c/em\u003esignificantly decreased the potential host bacteria causing the upregulated of \u003cem\u003eacrD\u003c/em\u003e. \u003cem\u003ePantoea_ananatis_PA13\u003c/em\u003e,\u003cem\u003e\u0026nbsp;Pantoea_sp_PSNIH1\u0026nbsp;\u003c/em\u003eand \u003cem\u003eWeissella_oryzae\u003c/em\u003e, were useful to upregulate the expression of \u003cem\u003eintl1\u003c/em\u003e and \u003cem\u003esul1\u003c/em\u003e. Simultaneously, \u003cem\u003eSphingomonas_roseiflava\u0026nbsp;\u003c/em\u003eand\u003cem\u003e\u0026nbsp;Pseudomonas_psychrotolerans\u0026nbsp;\u003c/em\u003ewere also effectively increased the expression of \u003cem\u003esul1\u003c/em\u003e and \u003cem\u003eintl1\u003c/em\u003e. As the potential host bacteria, the change of these bacteria may also effectively explain that the abundance of \u003cem\u003esul1\u003c/em\u003e and \u003cem\u003eintl1\u003c/em\u003e were a greater number in CK and E group after 30 days ensiling, while showed a relative lower number in LP group. \u003cem\u003ePantoea_ananatis_PA13\u003c/em\u003e,\u003cem\u003e\u0026nbsp;Pantoea_sp_PSNIH1\u003c/em\u003e, and \u003cem\u003ePseudomonas_psychrotolerans\u003c/em\u003e were high counts in CK and E group than in that of LP group, those bacteria of which were positive related with \u003cem\u003esul2\u003c/em\u003e. However, there were not significantly changed the expression the \u003cem\u003esul2\u0026nbsp;\u003c/em\u003eamong these groups. It might be because \u003cem\u003eClostridium_algidixylanolyticum\u003c/em\u003e, \u003cem\u003eNocardioides_oleivorans\u003c/em\u003e, and \u003cem\u003eLeifsonia_shinshuensis\u0026nbsp;\u003c/em\u003ealso were significantly greater amounts in CK and E groups than LP group during ensiling, which were negative effect to the expression of \u003cem\u003esul2\u003c/em\u003e, thereby causing inapparent impact. Similarly, the change of \u003cem\u003esul2\u0026nbsp;\u003c/em\u003ecould also explain the expression difference of\u003cem\u003e\u0026nbsp;rpob2\u0026nbsp;\u003c/em\u003eamong all groups.\u0026nbsp;\u003c/p\u003e"},{"header":"5 Conclusion","content":"\u003cp\u003eAnaerobic fermentation of silage could effectively reduce the ARGs and MGEs abundance. After 30 days fermentation, the addition of E could decrease the abundance of\u0026nbsp;\u003cem\u003eermB\u003c/em\u003e and \u003cem\u003eTn916/545\u003c/em\u003e,while LP was useful to inhibit the expression of of \u003cem\u003eqnrD\u003c/em\u003e and \u003cem\u003esul1\u003c/em\u003e. Both E and LP were effectively to inhibit the growth of undesirable microorganisms (yeasts and molds), which could improve fermentation quality of napier grass silage. Especially, LP could also reduce coliform bacteria and bacterial abundance. However,\u0026nbsp;\u003cem\u003eLactobacillus_plantarum\u0026nbsp;\u003c/em\u003ecould bepolluted by \u003cem\u003eermB\u003c/em\u003e and \u003cem\u003eTn916/1545\u003c/em\u003e. It was\u0026nbsp;positive correlated with the expression of these genes\u003cem\u003e.\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003e\u003cbr\u003e\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003eCRediT authorship contribution statement\u003c/p\u003e\n\u003cp\u003eDandan Chen: Writing–original draft, Formal analysis, Data curation, Conceptualization. Yuxin Zhou: Writing–review \u0026amp; editing, Data curation, Software. Tianxin Guo and Luyao Liu: Writing–review \u0026amp; editing, Data curation. Qing Zhang: Formal analysis, Methodology. Ruiqi Pan: Investigation, Supervision, Resources, writing–review \u0026amp; editing. Xuan Yao: Validation, Visualization, Supervision, Project administration.\u003c/p\u003e\n\u003cp\u003eFunding\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThis work was supported by the Meizhou Science and Technology Plan Project (2024A0301041) and (2024A0301046).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eDeclaration of competing interest\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no conflict of interest.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eEthical statements\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThis research did not involve animal ethics experiments.\u003c/p\u003e\n\u003cp\u003eData availability\u003c/p\u003e\n\u003cp\u003eData will be made available on request.\u003c/p\u003e\n\u003cp\u003eAcknowledgments\u003c/p\u003e\n\u003cp\u003eThe authors thank the support of Meizhou Science and Technology Plan Project (2024A0301041) and (2024A0301046).\u0026nbsp;\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eBlajman J E, Paez R B, Vinderola C G, Lingua M S, Signorini M L. 2018. A meta-analysis on the effectiveness of homofermentative and heterofermentative lactic acid bacteria for corn silage. \u003cem\u003eJournal of Applied Microbiology\u003c/em\u003e. \u003cstrong\u003e125\u003c/strong\u003e, 1655-1669.\u0026nbsp; doi: 10.1111/jam.14084.\u003c/li\u003e\n\u003cli\u003eChen B, Liang X, Nie X, Huang X, Zou S, Li X. 2015. The role of class I integrons in the dissemination of sulfonamide resistance genes in the Pearl River and Pearl River Estuary, South China. \u003cem\u003eJournal of Hazardous Materials\u003c/em\u003e, \u003cstrong\u003e282\u003c/strong\u003e, 61-67. https://doi.org/10.1016/j.jhazmat.2014.06.010.\u003c/li\u003e\n\u003cli\u003eChen D, Zheng M, Zhou Y, Gao L, Zhou W, Xu W, Wang M, Zhu Y. 2022. Improving the quality of napier grass silage with pyroligneous acid: fermentation, aerobic stability, and microbial communities. \u003cem\u003eFrontiers in Microbiology\u003c/em\u003e, \u003cstrong\u003e13\u003c/strong\u003e, 1034198. https://doi.org/10.3389/fmicb.2022.1034198.\u003c/li\u003e\n\u003cli\u003eChen D, Zhou Y, Yang D, Zhou W, Chen X, Zhang Q. 2023. Exploring \u003cem\u003eLactobacillus plantarum\u003c/em\u003e on fermentation quality, gas emissions, and in vitro digestibility of different varieties of litchi leaves silage. \u003cem\u003eFermentation\u003c/em\u003e, \u003cstrong\u003e9\u003c/strong\u003e, 651. https://doi.org/10.3390/fermentation9070651.\u003c/li\u003e\n\u003cli\u003eChen T, Zhao M X, Tang X Y, Wei W X, Wen X, Zhou S Z, Ma B H, Zou Y D, Zhang N, Mi J D, Wang Y, Liao X D, Wu Y B. 2023. The tigecycline resistance gene \u003cem\u003etetX\u003c/em\u003e has an expensive fitness cost based on increased outer membrane permeability and metabolic burden in \u003cem\u003eEscherichia coli\u003c/em\u003e. \u003cem\u003eJournal of Hazardous Materials\u003c/em\u003e, \u003cstrong\u003e458\u003c/strong\u003e, 131889. https://doi.org/10.1016/j.jhazmat.2023.131889.\u003c/li\u003e\n\u003cli\u003eDarby E M, Trampari E, Siasat P, Gaya M S, Alav I, Webber M A, Blair J M A. 2023. Molecular mechanisms of antibiotic resistance revisited. \u003cem\u003eNature Reviews Microbiology\u003c/em\u003e, \u003cstrong\u003e21\u003c/strong\u003e, 280-295. https://doi.org/10.1038/s41579-022-00820-y.\u003c/li\u003e\n\u003cli\u003eDeng S, Li P, Wu Y, Tang H, Cheng S, Thunders M, Qiu J, Li Y. 2022. Eco-risk management of tylosin fermentation residues using vermicomposting. \u003cem\u003eJournal of Environmental Management\u003c/em\u003e, \u003cstrong\u003e303\u003c/strong\u003e, 114126. https://doi.org/10.1016/j.jenvman.2021.114126.\u003c/li\u003e\n\u003cli\u003eFeldsine P, Abeyta C, Andrews W H. 2002. AOAC International methods committee guidelines for validation of qualitative and quantitative food microbiological official methods of analysis. \u003cem\u003eJournal of Aoac International\u003c/em\u003e, \u003cstrong\u003e85\u003c/strong\u003e, 1187-1200. doi: 10.1093/jaoac/85.5.1187\u003c/li\u003e\n\u003cli\u003eGabutti G. 2022. Available evidence and potential for vaccines for reduction in antibiotic\u0026nbsp; prescriptions. \u003cem\u003eHuman Vaccines \u0026amp; Immunotherapeutics\u003c/em\u003e, \u003cstrong\u003e18\u003c/strong\u003e, 2151291.\u0026nbsp; doi: 10.1080/21645515.2022.2151291.\u003c/li\u003e\n\u003cli\u003eGaze W H, Zhang L, Abdouslam N A, Hawkey P M, Calvo-Bado L, Royle J, Brown H, Davis S, Kay P, Boxall A B A, Wellington E M H. 2011. Impacts of anthropogenic activity on the ecology of class 1 integrons and integron-associated genes in the environment.\u003cem\u003e International Society for Microbial Ecology Journal\u003c/em\u003e, \u003cstrong\u003e5\u003c/strong\u003e, 1253-1261. https://www.nature.com/articles/ismej201115.\u003c/li\u003e\n\u003cli\u003eGharechahi J, Kharazian Z A, Sarikhan S, Jouzani G S, Aghdasi M, Hosseini Salekdeh G. 2017. The dynamics of the bacterial communities developed in maize silage. \u003cem\u003eMicrobial Biotechnology\u003c/em\u003e, \u003cstrong\u003e10\u003c/strong\u003e, 1663-1676.\u0026nbsp; doi: 10.1111/1751-7915.12751.\u003c/li\u003e\n\u003cli\u003eGuo X, Chen D, Huang P, Gao L, Zhou W, Zhang J, Zhang Q. 2025. Effects of tannin-tolerant lactic acid bacteria in combination with tannic acid on the fermentation quality, protease activity and bacterial community of stylo silage. \u003cem\u003eJournal of the Science of Food and Agriculture\u003c/em\u003e, \u003cstrong\u003e105\u003c/strong\u003e, 2540-2551. doi: 10.1002/jsfa.14027.\u003c/li\u003e\n\u003cli\u003eHabte E, Teshome A, Muktar M S, Assefa Y, Negawo A T, Machado J C, Ledo F, Jones C S. 2022. Productivity and feed quality performance of napier grass (\u003cem\u003eCenchrus purpureus\u003c/em\u003e) genotypes growing under different soil moisture levels. \u003cem\u003ePlants\u003c/em\u003e, \u003cstrong\u003e11\u003c/strong\u003e, 2549. https://doi.org/10.3390/plants11192549.\u003c/li\u003e\n\u003cli\u003eHisham M B, Hashim A M, Hanafi N M, Rahman N A, Mutalib N E A, Tan C K, Nazli M H, Yusoff N F M. 2022. Bacterial communities associated with silage of different forage crops in Malaysian climate analysed using 16S amplicon metagenomics. \u003cem\u003eScientific Reports\u003c/em\u003e, \u003cstrong\u003e12\u003c/strong\u003e. https://doi.org/10.1038/s41598-022-08819-4.\u003c/li\u003e\n\u003cli\u003eHou Z, Liu J, Cai M, Liu Y, Mu L, Gao Y, Wanapat M, Huang B. 2021. Enriching the nutritive value of marigold (\u003cem\u003eTagetes erecta\u003c/em\u003e L) crop residues as a ruminant feed by lactic acid bacteria during ensilage. \u003cem\u003eBMC Veterinary Research\u003c/em\u003e, \u003cstrong\u003e17\u003c/strong\u003e, 74. https://doi.org/10.1186/s12917-021-02762-8.\u003c/li\u003e\n\u003cli\u003eJian Z, Zeng L, Xu T, Sun S, Yan S, Yang L, Huang Y, Jia J, Dou T. 2021. Antibiotic resistance genes in bacteria: Occurrence, spread, and control. \u003cem\u003eJournal of Basic Microbiology\u003c/em\u003e, \u003cstrong\u003e61\u003c/strong\u003e, 1049-1070. doi: 10.1002/jobm.202100201.\u0026nbsp;\u003c/li\u003e\n\u003cli\u003eLarsson D G J, Flach C. 2022. Antibiotic resistance in the environment. \u003cem\u003eNature Reviews Microbiology\u003c/em\u003e, \u003cstrong\u003e20\u003c/strong\u003e, 257-269. https://doi.org/10.1038/s41579-021-00649-x.\u003c/li\u003e\n\u003cli\u003eLi F, Usman S, Huang W, Jia M, Kharazian Z A, Ran T, Li F, Ding Z, Guo X. 2023. Correction: Effects of inoculating feruloyl esterase-producing \u003cem\u003eLactiplantibacillus plantarum\u003c/em\u003e A1 on ensiling characteristics, in vitro ruminal fermentation and microbiota of alfalfa silage. \u003cem\u003eJournal of Animal Science and Biotechnology\u003c/em\u003e, \u003cstrong\u003e14\u003c/strong\u003e, 53. doi: 10.1186/s40104-023-00871-y.\u003c/li\u003e\n\u003cli\u003eLi Y, Du S, Sun L, Cheng Q, Hao J, Lu Q, Ge G, Wang Z, Jia Y. 2022. Effects of lactic acid bacteria and molasses additives on dynamic fermentation quality and microbial community of native grass silage. \u003cem\u003eFrontiers in Microbiology\u003c/em\u003e, \u003cstrong\u003e13\u003c/strong\u003e, 830121. doi: 10.3389/fmicb.2022.830121.\u003c/li\u003e\n\u003cli\u003eLiang J, Jin Y, Wen X, Mi J, Wu Y. 2020. Adding a complex microbial agent twice to the composting of laying-hen manure promoted doxycycline degradation with a low risk on spreading tetracycline resistance genes. \u003cem\u003eEnvironmental Pollution\u003c/em\u003e, \u003cstrong\u003e265\u003c/strong\u003e, 114202. https://doi.org/10.1016/j.envpol.2020.114202.\u003c/li\u003e\n\u003cli\u003eLiu F, Bai J, Huang W, Li F, Ke W, Zhang Y, Xie D, Zhang B, Guo X. 2022. Characterization of a novel beta-cypermethrin-degrading strain of \u003cem\u003eLactobacillus pentosus\u003c/em\u003e 3-27 and its effects on bioremediation and the bacterial community of contaminated alfalfa silage. \u003cem\u003eJournal of Hazardous Materials\u003c/em\u003e, \u003cstrong\u003e423\u003c/strong\u003e, 127101. doi: 10.1016/j.jhazmat.2021.127101.\u003c/li\u003e\n\u003cli\u003eLu Y, Li P, Bai S, Chen S, Zhao M, Gou W, You M, Cheng Q. 2022. Effect of phenyllactic acid on silage fermentation and bacterial community of reed canary grass on the Qinghai Tibetan Plateau. \u003cem\u003eBmc Microbiology\u003c/em\u003e, \u003cstrong\u003e22\u003c/strong\u003e, 83. https://doi.org/10.1186/s12866-022-02499-w.\u003c/li\u003e\n\u003cli\u003eLuo Y, Mao D, Rysz M, Zhou Q, Zhang H, Xu L, J J Alvarez P. 2010. Trends in antibiotic resistance genes occurrence in the Haihe River, China. \u003cem\u003eEnvironmental Science \u0026amp; Technology\u003c/em\u003e, \u003cstrong\u003e44\u003c/strong\u003e, 7220-7225.\u003c/li\u003e\n\u003cli\u003eNagy S A, Toth A G, Papp M, Kaplan S, Solymosi N. 2022. Antimicrobial resistance determinants in silage. \u003cem\u003eScientific Reports\u003c/em\u003e, \u003cstrong\u003e12\u003c/strong\u003e, 5243.\u0026nbsp; doi: 10.1021/es100233w.\u003c/li\u003e\n\u003cli\u003eNazar M, Wang S, Zhao J, Dong Z, Li J, Kaka N A, Shao T. 2021. Effects of various epiphytic microbiota inoculation on the fermentation quality and microbial community dynamics during the ensiling of sterile Napier grass. \u003cem\u003eJournal of Applied Microbiology\u003c/em\u003e, \u003cstrong\u003e130\u003c/strong\u003e, 1466-1480. doi: 10.1111/jam.14896.\u003c/li\u003e\n\u003cli\u003eOliveira A S, Weinberg Z G, Ogunade I M, Cervantes A, Arriola K G, Jiang Y, Kim D, Li X, Goncalves M, Vyas D, Adesogan A T. 2017. Meta-analysis of effects of inoculation with homofermentative and facultative heterofermentative lactic acid bacteria on silage fermentation, aerobic stability, and the performance of dairy cows. \u003cem\u003eJournal of Dairy Science\u003c/em\u003e, \u003cstrong\u003e100\u003c/strong\u003e, 4587-4603. https://doi.org/10.3168/jds.2016-11815.\u003c/li\u003e\n\u003cli\u003ePeng S, Xie L, Cheng Y, Wang Q, Feng L, Li Y, Lei Y, Sun Y. 2024. Effect of \u003cem\u003eLactiplantibacillus\u003c/em\u003e and sea buckthorn pomace on the fermentation quality and microbial community of paper mulberry silage. \u003cem\u003eFrontiers in Plant Science\u003c/em\u003e, \u003cstrong\u003e15\u003c/strong\u003e, 1412759.\u0026nbsp; https://doi.org/10.3389/fpls.2024.1412759.\u003c/li\u003e\n\u003cli\u003eRen F, He R, Zhou X, Gu Q, Xia Z, Liang M, Zhou J, Lin B, Zou C. 2019. Dynamic changes in fermentation profiles and bacterial community composition during sugarcane top silage fermentation: a preliminary study. \u003cem\u003eBioresource Technology\u003c/em\u003e, \u003cstrong\u003e285\u003c/strong\u003e, 121315. doi: 10.1016/j.biortech.2019.121315.\u003c/li\u003e\n\u003cli\u003eReuben R C, Roy P C, Sarkar S L, Alam R, Jahid I K. 2019. Isolation, characterization, and assessment of lactic acid bacteria toward their selection as poultry probiotics. \u003cem\u003eBmc Microbiology\u003c/em\u003e, \u003cstrong\u003e19\u003c/strong\u003e, 253. https://doi.org/10.1186/s12866-019-1626-0.\u003c/li\u003e\n\u003cli\u003eStrauber H, Lucas R, Kleinsteuber S. 2016. Metabolic and microbial community dynamics during the anaerobic digestion of maize silage in a two-phase process. \u003cem\u003eApplied Microbiology and Biotechnology\u003c/em\u003e, \u003cstrong\u003e100\u003c/strong\u003e, 479-491. doi: 10.1007/s00253-015-6996-0.\u003c/li\u003e\n\u003cli\u003eSun P, Ge G, Sun L, Du S, Liu Y, Yan X, Zhang J, Zhang Y, Wang Z, Jia Y. 2024. Correction: effects of selenium enrichment on fermentation characteristics, selenium content and microbial community of alfalfa silage. \u003cem\u003eBmc Plant Biology\u003c/em\u003e, \u003cstrong\u003e24\u003c/strong\u003e, 630. doi: 10.1186/s12870-024-05308-w.\u003c/li\u003e\n\u003cli\u003eTang Z, Huang C, Li W, Li W, Tan W, Xi B, Tian Y, Zhu L. 2023. Horizontal transfer of intracellular and extracellular ARGs in sludge compost under sulfamethoxazole stress. \u003cem\u003eChemical Engineering Journal\u003c/em\u003e, \u003cstrong\u003e454\u003c/strong\u003e, 10. https://doi.org/10.1016/j.cej.2022.139968.\u003c/li\u003e\n\u003cli\u003eTian J, Tian R, Wu J, Huang L, Zhang J. 2024. Gas production characteristics of oats and tritical silages and techniques for reducing gas emissions1. \u003cem\u003eJournal of Integrative Agriculture\u003c/em\u003e. https://doi.org/10.1016/j.jia.2024.09.023.\u003c/li\u003e\n\u003cli\u003eWang Q, Gu J, Wang X, Ma J, Hu T, Peng H, Bao J, Zhang R. 2020. Effects of nano-zerovalent iron on antibiotic resistance genes and mobile genetic elements during swine manure composting. \u003cem\u003eEnvironmental Pollution\u003c/em\u003e, \u003cstrong\u003e258\u003c/strong\u003e, 113654. https://doi.org/10.1016/j.envpol.2019.113654.\u003c/li\u003e\n\u003cli\u003eWang Y, Zhou W, Wang C, Yang F, Chen X, Zhang Q. 2020. Effect on the ensilage performance and microbial community of adding \u003cem\u003eNeolamarckia cadamba\u003c/em\u003e leaves to corn stalks. \u003cem\u003eMicrobial Biotechnology\u003c/em\u003e, \u003cstrong\u003e13\u003c/strong\u003e, 1502-1514. doi: 10.1111/1751-7915.13588.\u003c/li\u003e\n\u003cli\u003eWang Z, Tan Z, Wu G, Wang L, Qin G, Wang Y, Pang H. 2023. Investigation on fermentation characteristics and microbial communities of wheat straw silage with different proportion \u003cem\u003eArtemisia argyi\u003c/em\u003e. \u003cem\u003eToxins\u003c/em\u003e, \u003cstrong\u003e15\u003c/strong\u003e, 330.\u0026nbsp; https://doi.org/10.3390/toxins15050330.\u003c/li\u003e\n\u003cli\u003eWu Z, Luo Y, Bao J, Luo Y, Yu Z. 2020. Additives affect the distribution of metabolic profile, microbial communities and antibiotic resistance genes in high-moisture sweet corn kernel silage. \u003cem\u003eBioresource Technology\u003c/em\u003e, \u003cstrong\u003e315\u003c/strong\u003e, 123821. https://doi.org/10.1016/j.biortech.2020.123821.\u003c/li\u003e\n\u003cli\u003eXie W Y, Shen Q, Zhao F J. 2018. Antibiotics and antibiotic resistance from animal manures to soil: a review. \u003cem\u003eEuropean Journal of Soil Science\u003c/em\u003e, \u003cstrong\u003e69\u003c/strong\u003e, 181-195. doi:10.1111/ejss.12494.\u003c/li\u003e\n\u003cli\u003eXue Z, Mu L, Cai M, Zhang Y, Wanapat M, Huang B. 2020. Effect of using banana by-products and other agricultural residues for beef cattle in southern China. \u003cem\u003eTropical Animal Health and Production\u003c/em\u003e, \u003cstrong\u003e52\u003c/strong\u003e, 489-496. doi: 10.1007/s11250-019-02031-9.\u003c/li\u003e\n\u003cli\u003eYan Q, Wu F, Xu P, Sun Z, Li J, Gao L, Lu L, Chen D, Muktar M, Jones C, Yi X, Zhang J. 2021. The elephant grass (\u003cem\u003eCenchrus purpureus\u003c/em\u003e) genome provides insights into anthocyanidin accumulation and fast growth. \u003cem\u003eMolecular Ecology Resources\u003c/em\u003e, \u003cstrong\u003e21\u003c/strong\u003e, 526-542.\u0026nbsp; https://doi.org/10.1111/1755-0998.13271.\u003c/li\u003e\n\u003cli\u003eYang C, Huang B, Lin J, Yang Q, Guo Y, Liu D, Sun B. 2024. Isolation and screening of high biofilm producing lactic acid bacteria, and exploration of its effects on the microbial hazard in corn straw silage. \u003cem\u003eJournal of Hazardous Materials\u003c/em\u003e, \u003cstrong\u003e480\u003c/strong\u003e, 136009. https://doi.org/10.1016/j.jhazmat.2024.136009.\u003c/li\u003e\n\u003cli\u003eYang L, Yuan X, Li J, Dong Z, Shao T. 2019. Dynamics of microbial community and fermentation quality during ensiling of sterile and nonsterile alfalfa with or without \u003cem\u003eLactobacillus plantarum\u003c/em\u003e inoculant. \u003cem\u003eBioresource Technology\u003c/em\u003e, \u003cstrong\u003e275\u003c/strong\u003e, 280-287. https://doi.org/10.1016/j.biortech.2018.12.067.\u003c/li\u003e\n\u003cli\u003eYou L, Bao W, Yao C, Zhao F, Jin H, Huang W, Li B, Kwok L, Liu W. 2022. Changes in chemical composition, structural and functional microbiome during alfalfa (\u003cem\u003eMedicago sativa\u003c/em\u003e) ensilage with \u003cem\u003eLactobacillus plantarum\u003c/em\u003e PS-8. \u003cem\u003eAnimal Nutrition\u003c/em\u003e, \u003cstrong\u003e9\u003c/strong\u003e, 100-109. https://doi.org/10.1016/j.aninu.2021.12.004.\u003c/li\u003e\n\u003cli\u003eZhang Q, Zou X, Wu S, Wu N, Chen X, Zhou W. 2022a. Effects of pyroligneous acid on diversity and dynamics of antibiotic resistance genes in alfalfa silage. \u003cem\u003eMicrobiology Spectrum\u003c/em\u003e, \u003cstrong\u003e10\u003c/strong\u003e, e155422. https://doi.org/10.1128/spectrum.01554-22.\u003c/li\u003e\n\u003cli\u003eZhang X, Ding Z, Usman S, Zhang J, Chen M, Guo X. 2023. Metagenomics insights into the effects of lactic acid bacteria inoculation on the biological reduction of antibiotic resistance genes in alfalfa silage. \u003cem\u003eJournal of Hazardous Materials\u003c/em\u003e, \u003cstrong\u003e443\u003c/strong\u003e, 130329. https://doi.org/10.1016/j.ijfoodmicro.2026.111622.\u003c/li\u003e\n\u003cli\u003eZhang X, Usman S, Bature I, Xu D, Guo X. 2023. Occurrence and fate of antibiotic-resistance genes and their potential hosts in high-moisture alfalfa silage treated with or without formic acid bactericide. \u003cem\u003eJournal of Environmental Management\u003c/em\u003e, \u003cstrong\u003e347\u003c/strong\u003e, 119235. https://doi.org/10.1016/j.jenvman.2023.119235.\u003c/li\u003e\n\u003cli\u003eZhang Y, Wang P, Tang Y, Liao C, Tang X, Hou P, Chen C, Huang X, Lu G, Li L, Zhang M, Li F, Mei S, Chen C, Li P. 2025. Cooperation of \u003cem\u003eLactoplantibacillus plantarum\u003c/em\u003e and polyethylene microplastics facilitated the disappearance of tetracycline during anaerobic fermentation of whole plant maize. \u003cem\u003eJournal of Hazardous Materials\u003c/em\u003e, \u003cstrong\u003e487\u003c/strong\u003e, 137172. https://doi.org/10.1016/j.jhazmat.2025.137172.\u003c/li\u003e\n\u003cli\u003eZhao C, Li Y, Chen Q, Guo Y, Sun B, Liu D. 2024. Effect of organic acids on fermentation quality and microbiota of horseshoe residue and corn protein powder. \u003cem\u003eAMB Express\u003c/em\u003e, \u003cstrong\u003e14\u003c/strong\u003e, 58. doi: 10.1186/s13568-024-01686-4.\u003c/li\u003e\n\u003cli\u003eZhao J, Dong Z, Li J, Chen L, Bai Y, Jia Y, Shao T. 2019. Evaluation of \u003cem\u003eLactobacillus plantarum\u003c/em\u003e MTD1 and waste molasses as fermentation modifier to increase silage quality and reduce ruminal greenhouse gas emissions of rice straw. \u003cem\u003eScience of the Total Environment\u003c/em\u003e, \u003cstrong\u003e688\u003c/strong\u003e, 143-152. https://doi.org/10.1016/j.scitotenv.2019.06.236.\u003c/li\u003e\n\u003cli\u003eZhou S, Li H, Wu Z, Li S, Cao Z, Ma B, Zou Y, Zhang N, Liu Z, Wang Y, Liao X, Wu Y. 2023. The addition of nano zero-valent iron during compost maturation effectively removes intracellular and extracellular antibiotic resistance genes by reducing the abundance of potential host bacteria. \u003cem\u003eBioresource Technology\u003c/em\u003e, \u003cstrong\u003e384\u003c/strong\u003e, 129350. https://doi.org/10.1016/j.biortech.2023.129350.\u003c/li\u003e\n\u003cli\u003eZong C, Wu Q, Dong Z, Wu A, Wu J, Shao T, Liu Q. 2022. Recycling deteriorated silage to remove hazardous mycotoxins and produce a value-added product. \u003cem\u003eJournal of Hazardous Materials\u003c/em\u003e, \u003cstrong\u003e424\u003c/strong\u003e, 127627. https://doi.org/10.1016/j.jhazmat.2021.127627.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"","lastPublishedDoi":"10.21203/rs.3.rs-8493015/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-8493015/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"Silage, as the primary forage for ruminants, could serve as a reservoir for antibiotic resistance genes (ARGs) and mobile genetic elements (MGEs). These genes gained access to the animals' systems via host bacteria, causing a latent health risk. This study aimed to investigate the fate and transmission mechanism of ARGs in napier grass silage treated with either Lactiplantibacillus plantarum (LP) or Enterococcus faecalis (E). The results indicated that Ensilied storage could effectively reduce ARGs abundance. Concurrently, bacterial community exhibited obviously difference by different treatments in silage. Firmicutes and Protebacteria could be the potential hosts, which were high abundance before and after ensiling. The abundance of ermB and Tn916/145 in the E group was the lowest in the fermented process. The inoculation of LP and E effectively down-regulated the expression of qnrD after 30 days fermentation, and also significantly decreased the bacteria of positive correlation with this gene, such as Pantoea_sp_PSNIH1, Pseudomonas_psychrotolerans and Pantoea_ananatis_PA13. The LP remain inhibiting effect to the expression of sul1 during ensiling, compared with the CK group. In conclusion, adding LP or E could markedly improve fermentation quality of napier grass silage and decrease some ARGs and MGEs. The decline in ARGs and MGEs was linked to a decrease in harmful bacterial populations.","manuscriptTitle":"Occurrence and fate of antibiotic resistance genes and their potential hosts during anaerobic fermentation of napier grass silage with the addition of different lactic acid bacteria","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2026-02-04 07:37:29","doi":"10.21203/rs.3.rs-8493015/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"7120add4-0d34-4241-832b-4145004c8e2c","owner":[],"postedDate":"February 4th, 2026","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2026-04-15T06:11:14+00:00","versionOfRecord":[],"versionCreatedAt":"2026-02-04 07:37:29","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-8493015","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-8493015","identity":"rs-8493015","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.