Insights from Multigene Analysis: First Report of a Southeast Asian Mosquito, Aedes (Mucidus) laniger (Diptera: Culicidae) from Korea

Insights from Multigene Analysis: First Report of a Southeast Asian Mosquito, Aedes (Mucidus) laniger (Diptera: Culicidae) from Korea | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Insights from Multigene Analysis: First Report of a Southeast Asian Mosquito, Aedes (Mucidus) laniger (Diptera: Culicidae) from Korea Woo Jun Bang, Ara Seol, Seunggwan Shin This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-3974400/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 12 Sep, 2024 Read the published version in Parasites & Vectors → Version 1 posted 7 You are reading this latest preprint version Abstract Background Mosquitoes are dominant vectors worldwide and transmit infectious diseases. The expansion of mosquito habitats due to climate change and increased human activities poses a significant health threat by facilitating the spread of various non-native infectious diseases. This study focused on the detection of the Southeast Asian mosquito species, Aedes laniger on Jeju Island, the southernmost region of the Republic of Korea (ROK), highlighting the potential risks associated with the spread of vector-borne diseases, particularly emphasizing the elevated likelihood of invasion by Southeast Asian mosquitoes. Methods Field surveys were conducted in August 2023 on Jeju Island. Adult mosquitoes were collected using BG-sentinel traps and identified to the species level using taxonomic keys. Morphological and molecular analyses were employed to confirm species designations. Molecular data, including mitochondrial and nuclear genes, were used for phylogenetic analysis, which was performed to compare and identify among recorded subgenera in ROK. Species distribution modeling for Ae . laniger was performed to predict potential habitats using R package ‘BIOMOD2’. Results The two specimens of Aedes laniger were collected for the first time on Jeju Island. Morphological and molecular analyses confirmed the identity of this species within the subgenus Mucidus and validated the first record of this species in the ROK. We employed a simple multigene phylogenetic analysis to confirm a new mosquito record at the genus and subgenus levels, finally validating the consistency between morphological identification and molecular phylogenetic outcomes. Furthermore, we have updated the taxonomic keys for the genus Aedes in the ROK, and revised mosquito lists for Jeju Island, incorporating the inclusion of Ae . laniger . On the basis of species distribution modeling, the area of suitable habitat for Ae . laniger is expected to expand due to climate change, but this change did not appear to be meaningful in East Asia. Conclusion This case offers the first report of the Southeast Asian mosquito, Ae . laniger , in the ROK. The detection of this species on Jeju Island suggests the potential establishment of a breeding population their habitat and raises concerns about further expansion into the Korean Peninsula. Considering the annual occurrence of mosquito-borne disease cases in the Southeast Asia, it is essential to conduct monitoring not only in Jeju Island, where Ae . laniger has been identified, but also across the entire Korean Peninsula. Aedes laniger Culicidae non-native mosquito Jeju Island species distribution modelling Figures Figure 1 Figure 2 Figure 3 Figure 4 Background Mosquitoes are dominant vectors worldwide and drive the spread of infectious diseases through their well-developed piercing mouthparts during the blood-feeding process [ 1 ]. Mosquito species can transmit various diseases, such as malaria and dengue fever, leading to more than 700,000 deaths worldwide annually [ 2 ]. Factors such as climate change, increased anthropogenic activities and material exchanges among countries have led to recent expansions in mosquito habitats [ 3 , 4 , 5 , 6 ]. Mosquitoes that are spreading globally predominantly belong to the genus Aedes , and the majority of these species have a strong ability to adapt to changing environments [ 7 , 8 ]. In addition, some species have also been listed on the Invasive Species Specialist Group [ 8 , 9 ]. The most studied invasive species is Aedes albopictus , which is reported to possess greater heat and stress tolerance than other aedine species [ 10 ]. There are several examples of invasive mosquitoes moving or being transported between countries: In the 1990s and 2010s, the ranges of Aedes japonicus and Aedes koreicus expanded from East Asia to North America and Europe, respectively [ 11 , 12 , 13 , 14 , 15 , 16 , 17 , 18 , 19 , 20 , 21 ]. Additionally, in 2019, Aedes flavopictus was detected for the first time in Europe [ 22 ]. Moreover, the spread of invasive mosquitos is not limited to species belonging to Aedes ; Anopheles and Culex species have also been reported in locations outside their native ranges [ 23 , 24 , 25 ]. Many invasive mosquito species are known to have the ability to transmit infectious diseases, and there have been cases where endemic diseases have been transmitted between continents during the expansion of mosquito range [ 26 , 27 ]. For example, Anopheles arabiensis , the primary malaria vector in Africa, invaded Brazil from Senegal, resulting in a malaria pandemic that caused 16,000 deaths over a decade [ 28 ]. Based on the previous studies, it can be inferred that if non-native mosquitoes are introduced, there is a potential for the concurrent emergence of mosquito-borne diseases. In total, 59 species, 11 genera, and two subfamilies of mosquitoes have been recorded in the Republic of Korea (ROK) [ 29 ]. Among these, 14 species from four genera are considered potential vectors in the Korean Peninsula due to their reported ability to transmit diseases [ 30 ]. Except for endemic diseases (Japanese encephalitis and malaria), there have been no outbreaks of exogenous mosquito-borne diseases in the ROK to date. The changing climate pattern in the Korean peninsula, which is causing a shift from temperate conditions to subtropical conditions, makes it possible for invasive species to become established in ROK, leading to the potential introduction of infectious diseases [ 31 , 32 , 33 , 34 ]. Jeju Island, located in the southernmost part of the ROK (central GPS coordinates: 33°23′N, 126°34′E), is expected to be the first region to report invasive mosquitoes. This island is the warmest region in the ROK, even in winter; furthermore, it is already classified as having a humid-subtropical climate [ 35 ]. Due to its distinct climate and geographic location, several nonnative insects have been reported recently on Jeju Island, including Anoplophora horsfieldii (Hope, 1843) (Coleoptera: Cerambycidae) in 2023 [ 36 ] and Spodoptera frugiperda (Smith, 1797) (Lepidoptera: Noctuidae) in 2019 [ 37 ]; These cases highlight the Jeju Island's potential as a susceptible site for the invasion of non-native insect species. In this study, we report the first record of Aedes ( Mucidus ) laniger on Jeju Island, with taxonomic details and molecular evidence using phylogenetic method. Additionally, updates have been made on the mosquito species lists in Jeju Island and the taxonomic keys for genus Aedes in Korea. Furthermore, species distribution modeling analysis was conducted to explore the potential implications concerning this species and about other invasive mosquitoes on the Korean Peninsula. Methods Sample collection and identification Field surveys were carried out twice near Dongbaek-dong wetland, Jeju Island, in August 2023 (Fig. 1 A–B). Adult specimens were collected using BG-sentinel™ (BGS) traps (Biogents, Regensburg, Germany) with BG–lure (lactic acid) and dry ice as attractants (Fig. 1 C–D). The collected specimens were stored at − 80°C and subsequently identified using the taxonomic keys of Tanaka et al. [ 38 ] and Ree [ 39 ], which for the mosquito species of East Asia (Korea and Japan). For the mosquitoes that could not be identified using these keys, the taxonomic keys of Southeast Asian mosquitoes were used [ 40 , 41 , 42 ]. Remained specimen was used for molecular analysis. Taxonomy The collected specimens were examined under a stereoscopic microscope (Leica M205 FCA, Germany). Photographs were taken with a Canon 90D camera with an MP-E 65 mm lens mounted on a Stackshot Macro Rail (Cognisys, Inc., USA). All the microphotographic layers were combined and retouched with Helicon Focus software v8.1.1 (HeliconSoft, Ltd., Ukraine); then, the merged image was edited using Photoshop v.2023 (Adobe). The morphological terms used in the descriptions follow those of Rattanarithikul et al. [ 40 ] and Harbach & Knight [ 43 ]. One female adult was pinned and deposited at Seoul National University in the Laboratory of Evolution and Phylogenomics (SNUE). Molecular data acquisition Table 1 Four sets of primers used in this study Marker Primer name Primer sequence (5’ to 3’) Reference COI LCO1490 GGTCAACAAATCATAAAGATATTGG Folmer et al ., 1994 HCO2198 TAAACTTCAGGGTGACCAAAAAATCA Folmer et al ., 1994 ITS2 MS_ITS2_F CTCGTGGATCGATGAAGACC This study MS_ITS2_R CTCGCAGCTACTCAGGGAAT This study 28S ms28S_F CCGTGAGGGAAAGTTGAAAA This study ms28S_R TTTCCCCTGACTTCAACCTG This study Enolase enoR2_F AGRATYTGGTTGTACTTGGC Soghigian et al ., 2017 enoF_R ATGCAGGAGTTCATGATCCTG Soghigian et al ., 2017 DNA was extracted from one grounded leg of the pinned specimen, using an OmniPrep™ for Tissue Kit (Cat. #786–395; G–Biosciences®, USA). A total of four partial gene regions—mitochondrial cytochrome c oxidase I (COI), internal transcribed spacer 2 (ITS2), large subunit ribosomal RNA (28S) and the nuclear protein-coding gene enolase—were used in the construction of a phylogenetic tree. Detailed information on the genes and primer sets used is provided in Table 1 . All PCR amplifications were conducted in a reaction mixture containing a total volume of 25 µL: 1× PCR buffer, 0.4 µM each primer, 1.5 mM MgCl 2 , 0.2 mM each dNTP, 0.5 units of Taq DNA polymerase (R001AM; Takara Bio, Kusatsu, Shiga, Japan), and 1.0 ~ 2.0 ng of extracted DNA. The PCR procedure was as follows: 94°C for 5 min for denaturation; 35 cycles of 94°C for 30 s, 50–60°C (50°C for enolase and 28S, 52°C for COI, and 60°C for ITS2) for 30 s, and 72°C for 30 s; with a final extension for 5 min at 72°C. The products were visualized on 1.5% (wt/vol) agarose gels stained with Midori Green Advanced DNA Stain (Nippon Genetics Europe, Düren, Germany) and then sequenced in both directions by Bionics Corp. (Seoul, Republic of Korea). The sequencing data were assembled and trimmed using BioEdit software v7.2.6.1 [ 44 ] and were deposited in GenBank under the following accessions: Ae . laniger – PP097195 for COI, PP095639 for ITS2 and PP095638 for 28S; Ae . hatorii – PP095640 for 28S and PP215381 for enolase; Ae . koreicus – PP095641 for 28S and PP215377 for enolase; Ae . albopictus – PP215379 for enolase; Ae . japonicus – PP215378 for enolase; Ae . nipponicu s – PP095642 for 28S; Ae . togoi – PP215380 for enolase. Additional sequences for the four gene regions of other species were downloaded from GenBank and used to construct the phylogenetic tree. Detailed information about the sequences used is provided in Additional file 1: Table S1 . Molecular analysis We performed a cross-check of the phylogenetic tree with the morphological identification results to assess the distinctiveness of the sample DNA from the subgenera recorded in the ROK, which include Aedes , Aedimorphus , Bruceharrisonius , Collessius , Downsiomyia , Edwardsaedes , Hulecoeteomyia , Neomelaniconion , Ochlerotatus , Stegomyia , and Tanakaius ; except for Hopkinsius , no sequence data were registered in the National Center for Biotechnology Information (NCBI). We further sought to confirm the position of the sample within the subgenus Mucidus ; our analyses were not intended to establish accurate and robust phylogenetic positions of all related subgenera of Aedes . All the sequences were aligned using MAFFT v7.475 software [ 45 ] with the --auto option and subsequently manually trimmed in Aliview v. 1.26 [ 46 ]. The concatenated alignments were subsequently constructed with FASconCAT-G v1.02 software [ 47 ], and PartitionFinder 2 software [ 48 ] was used to determine the best partition scheme and substitution models according to codon position. We used IQ-tree v2.1.2 software to construct the maximum likelihood tree and applied the ultrafast option with 1,000 replicates for bootstrapping [ 49 , 50 ]. To provide additional branch support, the SH-like approximate likelihood ratio test (SH-aLRT) was applied with 1,000 replications to ensure that our data were not biased due to taxa with limited marker coverage [ 51 ]. We rooted the phylogeny along the branch leading to the genus Psorophora , which is known as the most ancestral clade of Aedini [ 52 , 53 , 54 , 55 ]. Finally, the constructed tree was visualized in iTol v5 [ 56 ] and enhanced for clarity using Photoshop v.2023 (Adobe). Species distribution modelling Georeferenced Ae . laniger occurrence data were compiled from various resources, including previously published studies [ 41 , 42 , 57 , 58 , 59 , 60 ], the Global Biodiversity Information Facility [ 61 ], which contains global occurrence records of thousands of species, and the iNaturalist database [ 62 ]. The keywords used to search the GBIF and iNaturalist databases were species “ Ae . laniger ” or “ Mucidus laniger ” and “ Ae . laniger ”, respectively. Records within 20 km of each other were eliminated to reduce spatial autocorrelation, and duplicate records were removed, resulting in a total of 25 occurrence data points for further analysis. The longitudes and latitudes of the points were transformed to Universal Transverse Mercator (UTM) coordinates and projected to zone 52N. In addition, 5,000 pseudoabsence points were randomly generated around the distribution points to account for the sampling probability at each occurrence point. Species distribution modeling was conducted using the R package ‘BIOMOD2’ to project the current and future distributions of Ae. laniger based on occurrence data and pseudoabsence points [ 63 , 64 ]. Climate data were acquired from WorldClim 2.1 using the R packages 'raster' [ 65 ], 'rgeos' [ 66 ], and 'rgdal' [ 67 ]. Subsequently, ten algorithms were applied using the 'BIOMOD2' package: generalized linear model (GLM), generalized boosted model (GBM), classification tree analysis (CTA), artificial neural network (ANN), surface range envelope (SRE), flexible discriminant analysis (FDA), multiple adaptive regression splines (MARS), random forest (RF), extreme gradient boosting (XGBoost) and MaxEnt [ 68 ]. Each algorithm was executed five times, for a cumulative total of 150 runs to enhance statistical robustness. During these trials, 80% of the points were used for calibration, while the remaining 20% were reserved for evaluation. Model accuracy was evaluated by the true kill statistic (TSS), and scores that surpassed the threshold of 0.75 were considered indicative of satisfactory performance [ 69 ]. Finally, ensemble modelling was performed to optimize the prediction of Ae . laniger occurrence by combining several diverse models [ 70 ]. Furthermore, to predict the future distribution of Ae. laniger , three climate models included in the CMIP5 multimodel ensemble, considering two representative concentration pathways (RCP 2.6 and 8.5) were selected. RCP 2.6 anticipates a future characterized by ambitious climate policies, striving to constrain global warming to less than 2°C. In contrast, RCP 8.5 portrays a worse scenario marked by high greenhouse gas emissions, lacking substantial climate mitigation measures. These climate models were subsequently applied to create projections of the distribution of Ae. laniger for 2050 and 2070. These projections were subsequently compared with the current distribution maps. The R code used in this study generally follows the methods proposed by Kim et al . [ 71 ] with minor modifications. Results Taxonomic accounts Family Culicidae, Meigen, 1818 [ 72 ] Subfamily Culicinae, Meigen, 1818 [ 72 ] Genus Aedes Meigen, 1818 [ 72 ] Subgenus Mucidus Theobald, 1901 [ 73 ] Diagnosis. Female adult. See Tyson [ 41 ] and Mattingly [ 42 ] for morphological detailed characters of subgenus Mucidus . Characteristic scaling patterns: combinations of yellow, white, and brown, especially in mesonotum and legs, comparing to other subgenera in Aedes . Maxillary palpus more than half length of proboscis. Scutum with highly modified. Wings with distinctive patterns; wing membrane pigmented in the region along the radiomedial cross–vein (rm), the base of vein R 4 + 5 , and the medio cubital cross–vein (mcu). Aedes ( Mucidus ) laniger (Wiedemann, 1820) [ 57 ] Culex laniger Wiedemann, 1820: 9 [ 57 ] Mucidus laniger (Wiedemann): Theobald 1901: 279 [ 73 ]. Edwards 1913: 224 [ 58 ]; Barraud 1929: 1053 [ 74 ]; Brug & Edwards 1931: 257 [ 75 ]. Reinert 2004: 360 [ 76 ]; Reinert 2006: 93 [ 77 ]; Reinert 2008: 63 [ 52 ]; Reinert 2009: 706 [ 53 ]. Mucidus mucidus (nec Karsch): Banks 1906: 983 [ 78 ]; Leicester 1908: 69 [ 79 ]; Brunetti 1912: 440 [ 80 ]. Aedes ( Mucidus ) laniger (Wiedemann): Barraud 1934: 147 [ 81 ]; Bohart 1945: 51 [ 82 ]; Knight 1947: 320 [ 83 ]; Knight & Hull 1951: 225 [ 84 ]; Bonne-Wepster 1954: 59 [ 85 ]; Mattingly 1961: 31 [ 42 ]. We follow Wilkerson et al. [ 86 ] for generic classification. Examined material. One female adult (SNUE), 19.VIII.2023, Jocheon-eup, Jeju–si, Jeju–do, Republic of Korea, 33°31'05.9"N, 126°42'56.0"E, BG-sentinel traps with dry ice, Woo Jun Bang; one female adult (SNUE), same data, but 30.VIII.2023, Woo Jun Bang and Heungmin Kim. In total of two female adults collected; One female pinned and another preserved in − 80℃ freezer for further molecular studies. Diagnosis. Female adult . See Mattingly [ 42 ] for morphological details. We stated that this diagnosis is for Indomalayan and Australian species, not for Afrotropical species. Habitus yellow-brownish. Tarsi without bands, except on tarsomere I at base. Fore tibia with narrowly white scales at base; largely white scales at apex about 0.3 the length of the tibia. Scutum and scutellum with narrow white scales and setae mostly. Tergites mostly with yellowish scales at margin, and white scales mostly at median, but tergites VII–VIII with white scales extremely clothed. Description. Female adult ( Fig. 2 A ). Head : Generally brown. Antennae light brown; basal segments brighter than distal segments; pedical with a few flat white scales; white bands on joints between each flagellum. Clypeus brown with no scales. Gena dark brown with no scales. Maxillary palpus light brown with white, dark and bicolored scales; slightly more than 2/3 rds of the length of the proboscis; palpomeres I–II mostly bicolored scales scattered: dark tipped with white scales; palpomere III mostly white, few scales and 0.5 the length of palpomere I. Proboscis light brown with white ring behind labellum, same scaling patterns with palpus, brown or dark yellow at apical. Labellum dark. Eyes continuous. Vertex with white narrow and semi-erected scales; inner sides with several hair-like yellowish setae. Thorax ( Fig. 2 A–B ) . Generally brown with pale scales. Scutum and scutellum brown with pale narrow or semi-erected scales, but most scales lost in this specimen, see Fig. 2 in Tyson et al . [ 41 ] for more details on scaling patterns. Postspiracular- subspiracular area, mesepisterum, mesomeron and lower mesepimeron mostly dark-brown. Postpronotum, antepronotum, proepistenum, mesokatepimeron, upper mesepimeron, metaepimeron and metaepisternum pale brown. Postnotum without scales or setae. Fossa, prespiracular area, postpronotum, mesepimeron, antepronotum, propleuron, supraalar area with brown setae. Lateral and medial pleurons with several long scutellar setae. Halters pale. Legs (Fig. 2 A) Mostly light brown, most segments with white, dark and bicolored semi-erected scales and brown or dark setae placed randomly. Coxae with narrow yellowish setae and white scales. Femora with white bands at base and apex; fore femora scattered with faintly white scales, but mid and hind femora with two intermediate white bands. Tibiae with white bands at base and apex; fore tibia with large apical white band, about 0.3 the total length of tibia; hind tibia with one intermediate white band (Fig. 2 C). Tarsi mostly yellowish; tarsomere I with white scales at base; tarsomeres III–V with white scales at apex. Wings : Squama with numerous pale and hair-like scales. Veins mostly yellowish with pale, dark and bicolored scales scattered accordingly; costa with numerous pale scales and patches; R s with dark scales at base; from rm, the base of R 4 + 5 , to m-cu with dark scales markedly (Fig. 2 B). Abdomen : Tergites with yellow and white scales orderly scattered; tergites I–VI with yellow scales at marginal and white scales in median; tergites VII–VIII with white scales extremely (Fig. 2 A–B). Distribution. Cambodia, India, Indonesia, Korea (new record in Jeju Island), Malaysia, Philippines, Singapore, Thailand and Vietnam. Bionomics. The specimens were collected in highly humidity and shaded forest near the wetland. There were many puddles around the wetland, and aquatic plants were abundant. Only two adult females were attracted by dry ice. The larvae are definitely predacious to larvae of other mosquito species and adults have been observed feeding on humans [ 40 ]. Updated list of mosquito species on Jeju Island Table 2 The updated checklist of mosquitoes found on Jeju Island, Republic of Korea: A total of 33 mosquito species belonging to 7 genera have been recorded in Jeju Island. Species Oh 1957 Chun 1968 Lien 1969 5th PMU 1966-69 Tanaka et al ., 1979 Lee 1994 Ko 1996 Kim 2005 Seo & Chung 2019 Chattejee 2021 Seo et al ., 2021 This study Remarks Anopheles sinensis O O O O O O O O O O* Anopheles lesteri O Anopheles lindesayi japonicus O O O O Anopheles sineroides O O O O O O O Armigeres subalbatus O O O O O O O O O Aedes albopictus O O O O O O O O O O O O Aedes flavopictus O O Aedes lineatopennis O Aedes niponii O O O O O O O O O Aedes hatorii O O O O O O O O Aedes japonicus O O O O O Aedes koreicus O O O O Aedes nipponicus O Aedes togoi O O O O O O O O O O O Aedes dorsalis O Aedes laniger O New record Culex bitaeniorhynchus O O O O O O Culex hayashii O O O O O Culex infantulus O O O Culex inatomii O Culex kyotoensis O O O O O O Culex sasai O Culex mimeticus O Culex orientalis O O O O Culex pipiens * O O O O O O O O O O O Culex pseudovishnui O Culex tritaeniorhynchus O O O O O O O O O O O Culex vagans O O O O O O Lutzia fuscanus O O O O Lutzia halifaxi O O O Tripteroides bambusa O O O Mansonia uniformis O O Total number of species 8 13 15 16 14 19 15 18 11 13 8* 4 Black asterisk indicates the species labeled as 'sp.' in the reference. A total of four species were captured using BG-sentinel traps at three trapping sites during field surveys in the Dongbaek-dong wetland, Jeju Island, in August 2023. The collected specimens belonged to two genera, Armigeres and Aedes , and were identified as Armigeres subalbatus (Coquillett, 1898), Ae. albopictus (Skuse, 1895), Ae. koreicus (Edwards, 1917), and Ae. laniger (Wiedemann, 1821)–a novel record for Jeju Island. Following the initial survey on Jeju Island conducted by Oh in 1957, this study provides an updated list with combining previous studies that includes 32 mosquito species belonging to 7 genera [ 87 , 88 , 89 , 90 , 91 , 92 , 93 , 94 , 95 , 96 ] (Table 2 ). We also updated the taxonomic keys for the genus Aedes in the ROK, including Ae . laniger ( Additional file 2) . Molecular phylogeny We employed a phylogenetic method to confirm a new record at the subgenus and species levels in the ROK. COI sequences, usually used for DNA barcoding, are not available from the NCBI for Ae . laniger . For this reason, multigene molecular phylogenetic analysis was used to assess the phylogenetic position of Ae. laniger within the subgenus Mucidus with existing data for Aedes alternans and Aedes sudanensis . In addition, we aimed to investigate whether the collected specimen belong to 11 subgenera recorded in the ROK. On the basis of the four molecular markers, the concatenated matrix consisted of 2,741 nucleotide sequences from 42 species of Aedes , and the five best partitioning schemes (GTR + G, GTR + I + G, TVM + I + G, TIM + I + G and TVM + I) were assigned to eight subsets. The phylogenetic tree showed that the collected specimen was not assigned to the clades of subgenera recorded in the ROK but rather was grouped with Ae . alternans and Ae . sudanensis , which are species of subgenus Mucidus with high support values (SH-aLRT > 85, UFB > 95) (Fig. 3 ). Furthermore, the subgenera recorded in the ROK each formed a distinct clade, and two paraphyletic clades were found in the genus Aedes , consistent with numerous studies of mosquito phylogenetics based on morphological traits or molecular phylogeny [ 52 , 53 , 97 ]. We initially identified the collected specimen as Ae . laniger through the morphological keys at the species level, and molecular analysis also showed that the specimen forms a distinct clade with the subgenus Mucidus , which means a new record within the subgenus Mucidus and the species in the ROK. Finally, the outcomes of this study confirmed the concordance between morphological and molecular species identification results. Species distribution modelling The results of the species distribution models suggest that within Southeast Asia, Ae . laniger is most likely to be found in Indonesia, Malaysia, and the Philippines, all of which were identified as areas with highly suitable climate spaces for this species (Fig. 4 ). In contrast, the modeling results indicate that among East Asian countries, including South Korea and China, Jeju Island has suboptimal conditions for this species. Models were created based on climate modeling data for 2050 and 2070 considering RCP2.6 and RCP8.5 to assess the potential for Ae . laniger to spread beyond its current distribution. The results of these models revealed that the suitable climate space of Ae. laniger could increase, extending from Taiwan to southern Myanmar and the northern regions of Thailand. These results suggest the potential for the expansion of Ae . laniger habitat by 2050 and 2070 in response to climate change. In summary, we identified Ae . laniger on Jeju Island through morphological and molecular analysis. Subsequently, species distribution modeling was performed under both current and future climate scenarios. The results indicate a subtle expansion of Ae . laniger from Taiwan to the Indomalayan regions, attributed to ongoing climate changes. Discussion New record of a Southeast Asian mosquito species in Korea Based on the morphological identification and molecular analysis, the collected specimen was identified as Ae. laniger , a Southeast Asian mosquito species, representing a new record in the ROK. We readily identified the collected specimen as belonging to the subgenus Mucidus due to their distinctive wing pigmentations and the scaling patterns observed across their bodies. Furthermore, molecular phylogeny also supported the position of the specimens within the Mucidus clade, distinct from previously recorded subgenera in Korea. These results confirmed the presence of a new nonnative subgenus and species in the ROK. Thus, we report that a total of 60 species, 11 genera, and two subfamilies of mosquitoes have been recorded in the ROK. This study also suggests that even in the absence of COI sequence, commonly used as a DNA barcode, the application of multigene phylogeny could facilitate the detection of non-native species at the genus or subgenus levels for pest control purposes. Specifically, for poorly studied species with limited morphological and molecular data, the workflow used in this study enables the identification for non-native species without relying on COI sequences. Invasion pathway scenarios for Ae . laniger and their importance Ae. laniger occurs in subtropical or tropical regions of Southeast Asia, Australia, and Africa; it is not native to East Asia [ 38 , 40 , 41 , 42 ]. For this perspective, the occurrence of Ae. laniger suggests that subtropical or tropical mosquitoes have the potential to expand their habitats to the ROK. In same context, it showed that more vector species, such as Aedes aegypti , which can transmit viruses responsible for dengue fever, Zika, and yellow fever, could invade the Korean Peninsula, increasing the risk of mosquito-borne diseases in future. Lee et al. [ 98 ] also reported that the strain of Ae. albopictus on Jeju Island is genetically closely related to specimens from Southeast Asia, which have a high transmission capability for dengue fever, thereby raising concerns regarding its potential risks. The confirmation of Southeast Asian mosquito species on Jeju Island aligns with predictions reported in prior studies, as well as with reports of other non-native species. However, the results of the species distribution modeling do not indicate a strong propensity for Ae . laniger to inhabit the Korean Peninsula; this discrepancy may be due to the lack of species occurrence data. Nevertheless, on the basis of the available data, a discernible pattern emerged, indicating that Ae. laniger is likely to be predominantly found in coastal areas or on islands characterized by high humidity and temperature. Given these characteristics and the recognition that Jeju Island has coastal areas with a subtropical climate, it is plausible that Ae. laniger could establish breeding populations on this environment. Furthermore, there was a recent outbreak of love bugs, Plecia longiforceps , in the ROK [ 99 ], and the nonnative species A . horsfieldii was identified on Jeju Island in 2019 [ 36 ]; these species are distributed mainly in southern China, Taiwan, and the Okinawa archipelago. These cases suggest the potential for provisional or temporary spread of nonnative species to the ROK. The species distribution models of Ae . laniger revealed a range extending from southern China to Taiwan under both the current and future climate conditions. Jung et al . [ 100 ] also suggested the potential emergence of Ae . aegypti in the coastal areas of Jeju Island starting in 2040 due to climate change using species distribution modeling. In addition to climate factors, invasion can be influenced by ‘wind'. In the ROK, Nilaparvata lugens and Spodoptera frugiperda are known to spread to the island by riding westerlies in the spring or tropical cyclones in the summer [ 37 , 101 , 102 ]. Typhoons typically affect the Korean Peninsula to the greatest extent in July and August [ 103 ]. The two specimens captured in this study were collected in August, suggesting that their presence on the island may have been influenced by wind patterns in that period. Studies have shown that mosquitoes can spread through various means, including winds, airplanes, or watercraft, indicating the potential for provisional spread of the species [ 3 , 6 ]. Notably, Jeju Island has also been identified as a bridgehead for the introduction of tropical or subtropical insects into the Korean Peninsula [ 37 , 104 , 105 ]. The results of this study and those of other investigations suggest that there is potential for the continued presence of Southeast Asian mosquito species on Jeju Island in the future. Limitation and future works The species distribution models applied in this study did not yield strong predictions for Ae . laniger to East Asia. The constraints imposed by the limited availability of occurrence data, along with the concentration of coordinates in Southeast Asia, probably led to nonsignificant outcomes [ 106 , 107 ]. Given the tropical and subtropical climates in Taiwan and the Okinawa archipelago, further investigations to confirm the habitat of Ae. laniger in these regions would enhance the resolution of our analysis. This study was confined to a limited area of Jeju Island, and further investigations across various regions are needed to expand our understanding of the broader ecological implications and potential range of Ae . laniger . The Dongbaek-dong wetland is characterized by a distinctive hot and humid environment, with numerous swampy areas and temporary pools, consistent with the habitat characteristics of Ae. laniger [ 41 , 42 ]. The presence of this species in the Dongbaek-dong wetland suggests its potential to inhabit similar habitats on Jeju Island. Additionally, it remains unclear whether the presence of Ae. laniger on Jeju Island is temporary or if it has established a breeding population on the island. To determine whether permanent populations of Ae . laniger have been established, multiyear monitoring surveys seem to be needed. Most subtropical or tropical mosquitoes face challenges in surviving cold winters; therefore, it is recommended that both adult and larval collections be conducted in subsequent monitoring surveys. The key outcome of this study is the initial identification of mosquitoes adapted to the Southeast Asian climate in the ROK. Despite the uncertainty of the vector competence of Ae. laniger , this finding is significant, as it indicates the potential for future occurrences of vector species capable of transmitting the viruses responsible for dengue fever and Zika virus on the Korean Peninsula. Conclusion Invasive species from tropical or subtropical regions are becoming common on Jeju Island, and the results of this study were consistent with that pattern. This study represents the initial confirmation of a Southeast Asian mosquito species in Korea and indicates the potential for the spread of other vector mosquitoes from subtropical areas in the future. The proposed workflow in this study also showed that, even without the COI sequence, detection of non-native or pest species at the genus or subgenus is possible through the application of a multigene phylogeny approach with a limited number of markers. Abbreviations ROK: Republic of Korea SNUE: Seoul National University in the Laboratory of Evolution and Phylogenomics COI: Cytochrome c oxidase subunit I ITS2: Internal transcribed spacer 2 NCBI: National Center for Biotechnology Information UTM: Universal Transverse Mercator Declarations Ethics approval and consent to participate Not applicable. Consent for publication Not applicable. Competing interests The authors declare that they have no competing interests. Availability of data and materials The datasets produced in this study are incorporated in the article ( Additional file 1 ), and the sequences utilized have been deposited in the NCBI database. Funding This research was supported by the National Research Foundation of Korea (NRF) grants funded by the Korean government (MEST, No. 2019R1A6A1A10073437; MSIT, No. 2021R1C1C1003452; Comparative medicine Disease Research Center, SRC, No. 2021R1A5A1033157). This work is also supported by Seoul National University (Creative-Pioneering Researchers Program; the New Faculty Startup Fund; Laying the Groundwork for Peace and Unification, the Institute for Peace and Unification Studies, No. 3344-20230031). Author’s contributions WJB designed the study and conduct as follows: collecting mosquitoes, analyzing the data, and drafted the manuscript. SA provided the collection sites in the Dongbaek-dong wetland and assisted in mosquito collection. SS assisted with analysis of the data, and revised and improved the manuscript. All authors approved the final manuscript. Acknowledgements We thank to the Sangjin Han and Jihoon Kim for providing guidance and technical assistance for taxonomic studies, and Heungmin Kim for helping us collecting the mosquitoes. Special thanks to Liam G. Wolff, a researcher at the Harte Research Institute for Gulf of Mexico Studies, Texas A&M University-Corpus Christi, for providing guidance on identifying mosquito species, and to Do-yoon Kim for his assistance in revising the figures for this paper. The authors also would like to express our gratitude to officials who granted permission for specimen collections in the Dongbaek-dong wetland. Authors’ information 1 School of Biological Sciences, Seoul National University, Seoul 08826, Republic of Korea (Woo Jun Bang, Seunggwan Shin) 2 Comparative Medicine Disease Research Center, Seoul National University, Seoul 08826, Republic of Korea (Woo Jun Bang, Seunggwan Shin) 3 Warm Temperate and Subtropical Forest Research Center, National Institute of Forest Science, Jeju 63582,Republic of Korea (Ara Seol) References Clements AN. Biology of mosquitoes: transmission of viruses and interactions with bacteria, vol. 3. Wallingford: CABI Publishing; 2012. World Health Organization. https://www.who.int/en/news-room/fact-sheets/detail/vector-borne-diseases . Accessed 5 October, 2023. Reiter P, Sprenger D. The used tire trade: a mechanism for the worldwide dispersal of container breeding mosquitoes. J Am Mosq Control Assoc. 1987;3:494–501. Mouchet J, Giacomini T, Julvez J. Human diffusion of arthropod disease vectors throughout the world. Cahiers Santé. 1995;5:293–8. Reiter P. Climate change and mosquito-borne disease. Environ Health Perspect. 2001;109:141–61. Reiter P. Yellow fever and dengue: a threat to Europe?. Euro Surveill. 2010;15:pii = 19509. Gratz NG. Critical review of the vector status of Aedes albopictus . Med Vet Entomol. 2004;18:215–27. Medlock JM, Hansford KM, Schaffner F, Versteirt V, Hendrickx G, Zeller H, et al. A review of the invasive mosquitoes in Europe: Ecology, public health risks, and control options. Vector-Borne Zoonotic Dis. 2012;12:435–47. ISSG. Global Invasive species database – Aedes . The Invasive Species Specialist Group. http://www.iucngisd.org/gisd/search.php . Accessed 5 October, 2023. Lwande OW, Obanda V, Lindström A, Ahlm C, Evander M, Näslund J, et al. Globe-Trotting Aedes aegypti and Aedes albopictus : Risk Factors for Arbovirus Pandemics. Vector-Borne Zoonotic Dis. 2020;20:71–81. Peyton EL, Campbell SR, Candeletti TM, Romanowski M, Crans WJ. Aedes ( Finlaya ) japonicus japonicus (Theobald), a new introduction into the United States. J Am Mosq Control Assoc. 1999;15:238–241. Falco RC, Daniels TJ, Slamecka MC. Prevalence and distribution of Ochlerotatus japonicus (Diptera: Culicidae) in two counties in Southern New York State. J Med Entomol. 2002;39:920–5. Capelli G, Drago A, Martini S, Montarsi F, Soppelsa M, Delai N, et al. First report in Italy of the exotic mosquito species Aedes ( Finlaya ) koreicus , a potential vector of arboviruses and filariae. Parasit Vectors. 2011;4:1–5. Versteirt V, Pecor JE, Fonseca DM, Coosemans M, Van Bortel W. Confirmation of Aedes koreicus (Diptera:Culicidae) in Belgium and description of morphological differences between Korean and Belgian specimens validated by molecular identification. Zootaxa. 2012;32:21–32. Huber K, Pluskota B, Jöst A, Hoffmann K, Becker N. Status of the invasive species Aedes japonicus japonicus (Diptera: Culicidae) in southwest Germany in 2011. J Vector Ecol.2012;37:462–5. Kampen H, Werner D. Out of the bush: the Asian bush mosquito Aedes japonicus japonicus (Theobald, 1901) (Dipter, Culicidae) becomes invasive. Parasit Vectors. 2014;7:59. Riles MT, Smith JP, Burkett-Cadena N, Connelly CR, Morse GW, Byrd BD. First Record of Aedes japonicus in Florida. J Am Mosq Control Assoc. 2017;33:340–4. Montarsi F, Martini S, Michelutti A, Da Rold G, Mazzucato M, Qualizza D, et al. The invasive mosquito Aedes japonicus japonicus is spreading in northeastern Italy. Parasit Vectors 2019;12:1–8. Ballardini M, Ferretti S, Chiaranz G, Pautasso A, Riina MV, Triglia G, et al. First report of the invasive mosquito Aedes koreicus (Diptera: Culicidae) and of its establishment in Liguria, northwest Italy. Parasit Vectors. 2019;12:334. Vojtíšek J, Janssen N, Šikutová S, Šebesta O, Kampen H, Rudolf I. Emergence of the invasive Asian bush mosquito Aedes ( Hulecoeteomyia ) japonicus (Theobald, 1901) in the Czech Republic. Parasit Vectors. 2022;15:250. Teekema S, Stroo A, Uiterwijk M, van de Vossenberg B, Jacobs F, Ibáñez-Justicia A. First finding of Aedes koreicus (Diptera: Culicidae) in the Netherlands. JEMCA. 2022;40:3–9 Ibáñez-Justicia A, van de Vossenberg B, van den Biggelaar R, Voogd J, Metz E, Jacobs F, et al. Detection of Aedes flavopictus (Yamada, 1921), netherlands, June 2019. Euro Surveill. 2019;24:1900433. Rodhain F, Problems posed by the spread of Aedes albopictus . Bull Soc Pathol Exot.1996;89(2):137–40. Gratz NG, Steffen R, Cocksedge W. Why aircraft disinsection?. Bull World Health Organ. 2000;78:995–1004. Lessard BD, Kurucz N, Rodriguez J, Carter J, Hardy CM. Detection of the Japanese encephalitis vector mosquito Culex tritaeniorhynchus in Australia using molecular diagnostics and morphology. Parasit Vectors. 2021;14:411. Bhatt S, Gething PW, Brady OJ, Messina JP, Farlow AW, Moyes CL, et al. The global distribution and burden of dengue. Nature; 2013;496:504–7. Srisawat R, Phanitchat T, Komalamisra N, Tamori N, Runtuwene L, Noguchi K, et al. Susceptibility of Aedes flavopictus miyarai and Aedes galloisi mosquito species in Japan to dengue type 2 virus. Asian Pac J Trop Biomed. 2016;6:446–50. Killeen GF, Fillinger U, Kiche I, Gouagna LC, Knols BG. Eradication of Anopheles gambiae from Brazil: lessons for malaria control in Africa?. Lancet Infect Dis. 2002;10:618–27. Han HY. 2021. Diptera. In: Park JK, Lee JE., et al., editors. Check list of Insects from Korea. Korean Society of Applied Entomology & The Entomological Society of Korea. Daegu: Paper and Pencil, 391–483. Lee DK. Ecological characteristics and current status of infectious disease vectors in South Korea. J Korean Med Assoc. 2017;60:458–67. Dengue: Guidelines for diagnosis, treatment, prevention and control-new edition. Geneva. World Health Organization. 2009. https://www.who.int/publications/i/item/9789241547871 . Accessed 5 October, 2023 Khormi HM, Kumar L. Future malaria spatial pattern based on the potential global warming impact in South and Southeast Asia. Geospat Health. 2016;11:416. Lee JS, Farlow A. The threat of climate change to non-dengue-endemic countries: increasing risk of dengue transmission potential using climate and non-climate datasets. BMC Public Health. 2019;19:934. Ministry of Environment of Republic of Korea. http://m.me.go.kr/ . Accessed 5 October, 2023. Beck HE, Zimmermann NE, McVicar TR, Vergopolan N, Berg A, Wood EF. Present and future Köppen-Geiger climate classification maps at 1-km resolution. Sci Data. 2018;5:180214. Lee S, Choi J, Jand H, Choi W, Kwon W, Kim D, et al. Establishment of non-native Anoplophora horsfieldii (Coleoptera: Cerambycidae) in South Korea. J. Integr. Pest Manag. 2023;14:9. Lee GS, Seo BY, Lee J, Kim H, Song JH, Lee W. First Report of the Fall Armyworm, Spodoptera frugiperda (Smith, 1797) (Lepidoptera, Noctuidae), a New Migratory Pest in Korea. Korean J. Appl. Entomol. 2020;59:73–8. Tanaka K, Mizusawa K, Saugstad ES, et al. A Revision of the adult and larval mosquitoes of Japan (including the Ryukyu Archipelago and the Ogasawara islands) and Korea (Diptera: Culicidae). Contrib Am Entomol Inst, U.S.A. 1979;16:1–987. Ree HI. Taxonomic Review and Revised Keys of the Korean Mosquitoes (Diptera: Culicidae). Entomol Res. 2003;33:39–52. Rattanarithikul R, Harbach RE, Harrison BA, Panthusiri P, Coleman RE, Richardson JH. Illustrated keys to the mosquitoes of Thailand. VI. Tribe Aedini. Southeast Asian J Trop Med Public Health. 2010;41 Suppl 1:1–225. Tyson WH. Contributions to the Mosquito Fauna of Southeast Asia. VIII. Genus Aedes , Subgenus Mucidus Theobald in Southeast Asia. Contrib Am Entomol Inst, U.S.A. 1970;6:28–80. Mattingly PF. The culicine mosquitoes of the Indomalayan Area. Part V: Genus Aedes Meigen, subgenera Mucidus Theobald, Ochlerotatus Lynch Arribalzaga and Neomelaniconion Newstead. Brit Mus Nat Hist London, UK. 1961 Harbach RE, Knight KL. Taxonomists’ glossary of mosquito anatomy, annotated with corrections and additions Plexus Publishing Inc. Marlton, New Jersey. 2021. Hall, T.A. BioEdit: A User-Friendly Biological Sequence Alignment Editor and Analysis Program for Windows 95/98/NT. Nucleic Acids Symposium Series. 1999;41:95–8. Katoh K, Standley DM. MAFFT multiple sequence alignment software version 7: improvements in performance and usability. Mol Biol Evol. 2013;30:772–80. Larsson A. AliView: a fast and lightweight alignment viewer and editor for large datasets. Bioinformatics. 2014;30:3276–8. Kück P, Longo GC. FASconCAT-G: extensive functions for multiple sequence alignment preparations concerning phylogenetic studies. Front Zool. 2014;11:81. Lanfear R, Frandsen PB, Wright AM, Senfeld T, Calcott B. PartitionFinder 2: New Methods for Selecting Partitioned Models of Evolution for Molecular and Morphological Phylogenetic Analyses. Mol Biol Evol. 2017;34:772–3. Hoang DT, Chernomor O, von Haeseler A, Minh BQ, Vinh LS. UFBoot2: Improving the Ultrafast Bootstrap Approximation. Mol Biol Evol. 2018;35:518–22. Minh BQ, Schmidt HA, Chernomor O, et al. IQ-TREE 2: New Models and Efficient Methods for Phylogenetic Inference in the Genomic Era. Mol Biol Evol. 2020;37:1530–4. Guindon S, Dufayard JF, Lefort V, Anisimova M, Hordijk W, Gascuel O. New algorithms and methods to estimate maximum-likelihood phylogenies: assessing the performance of PhyML 3.0. Syst Biol. 2010;59:307–21. Reinert JF, Harbach RE, Kitching IJ. Phylogeny and classification of Ochlerotatus and allied taxa (Diptera: Culicidae: Aedini) based on morphological data from all life stages. Zool. J. Linn. Soc. 2008;153:29–114. Reinert JF, Harbach RE, Kitching IJ. Phylogeny and classification of tribe Aedini (Diptera: Culicidae). Zool. J. Linn. Soc. 2009;157:700–94. Reidenbach KR, Cook S, Bertone MA, Harbach RE, Wiegmann BM, Besansky NJ. Phylogenetic analysis and temporal diversification of mosquitoes (Diptera: Culicidae) based on nuclear genes and morphology. BMC Evol Biol. 2009;9:298. Soghigian J, Sither C, Justi SA, Morinaga G, Cassel BK, Vitek CJ, et al. Phylogenomics reveals the history of host use in mosquitoes. Nat. Commun. 2023;14:6252. Letunic I, Bork P. Interactive Tree Of Life (iTOL) v5: an online tool for phylogenetic tree display and annotation. Nucleic Acids Res. 2021;49(W1):W293–6. Wiedemann, C.R.G. Diptera exotica. Sectio I. antennis multiarticulatis. 1820;1:244 pp. Edwards, F. W. New Synonymy in oriental Culicidae. Bull. ent. Res. 1913;IV: 221–42. Radda AC, Auer H, Escalona TG, Hartnett I, Aspöck H. Seroepidemiological Studies in Oriental Mindoro (Philippines) - Prevalence of Mosquito-borne Parasitoses. Mitt. Österr. Ges. Tropenmed. Parasitol. 1995;17:159–68 Gama ZP, Nakagoshi N, Islamiyah M. Distribution patterns and relationship between elevation and the abundance of Aedes aegypti in Mojokerto city 2012. Open J. Anim. Sci. 2013;3:11–6 GBIF: Global Biodiversity Information Facility. https://www.gbif.org/species/1651940 . Accessed on 12 October 2023. iNat: iNaturalist. https://www.inaturalist.org/observations?taxon_id=1144437 . Accessed on 14 October 2023 Thuiller W, Lafourcade B, Engler R, Araújo MB. BIOMOD – a platform for ensemble forecasting of species distributions. Ecography. 2009;32:369–73 Thuiller W, Georges D, Gueguen M, Engler R, Breiner F, Lafourcade B, Patin R. Biomod2: Ensemble Platform for Species Distribution Modeling. 2023. R package version 4.2-5. Hijmans, R.J. Raster: Geographic Data Analysis and Modeling. https://cran.rproject.org/web/packages/raster/index.html . 2023. R package version 3.6–23 Bivand R, Rundel C. rgeos: Interface to Geometry Engine. http://rgeos.r-forge.r-project.org/index.html . 2023. R package version 0.6-4. Bivand R, Keitt T, Rowlingson B. rgdal: Bindings for the 'Geospatial' Data Abstraction Library. https://r-forge.r-project.org/projects/rgdal/ . 2023. R package version 1.6-7. Phillips SJ, Anderson RP, Schapire RE. Maximum entropy modeling of species geographic distributions. Ecol Modell. 2006;190:231–59 Changjun G, Yanli T, Linshan L, Bo W, Yili Z, Haibin Y, et al. Predicting the potential global distribution of Ageratina adenophora under current and future climate change scenarios. Ecol Evol. 2021;11:12092–113. Hao T, Elith J, Guillera-Arroita G, JJ Lahoz‐Monfort. A review of evidence about use and performance of species distribution modelling ensembles like BIOMOD. Divers. Distrib. 2019;25:839–52 Kim S, de Medeiros BAS, Byun BK, Lee S, Kang JH, Lee B, et al. West meets East: How do rainforest beetles become circum-Pacific? Evolutionary origin of Callipogon relictus and allied species (Cerambycidae: Prioninae) in the New and Old Worlds. Mol Phylogenet Evol. 2018;125:163–76. Meigen JW. Systematische Beschreibung der bekannten europäischen zweiflügeligen Insekten. Aachen . 1818;1: xxxvi + 1, 332 pp. Theobald FV. A monograph of the Culicidae or mosquitoes. British Museum. 1901;1:424 pp. Barraud PJ. A revision of the Culicine mosquitoes of India. XXV. The genera Mucidus , Mimomyia , Ficalbia , Rachionotomyia , and Hodgesia . Indian J. med. Res. 1929;16:1052–63. Brug SL, Edwards FW. Fauna Sumatrensis. (Bijdrage Nr. 68), Culicidae (Diptera). Tijdschr. Ent. 1931;74:251–61. Reinert JF, Harbach RE, Kitching IJ. Phylogeny and classification of Aedini (Diptera: Culicidae), based on morphological characters of all life stages. Zool. J. Linn. Soc. 2004;142:289–368. Reinert JF, Harbach RE, Kitching IJ. Phylogeny and classification of Finlaya and allied taxa (Diptera: Culicidae: Aedini) based on morphological data from all life stages. Zool. J. Linn. Soc. 2006;148:1–101. Banks CS. A List of Philippine Culicidae with descriptions of some new species. Philipp J. Sci. 1906;1:977–1005 Leicester GF. The Culicidae of Malaya . Studies Inst. Med. Res. Federated Malay States. 1908;3:18–261 Brunetti E. Annotated Catalogue of Oriental Culicidae–Supplement. Rec. Indian Museum. 1912;4:403–517. Barraud PJ. The fauna of British India, including Ceylon and Burma. Diptera. Volume V. Family Culicidae. Tribes Megarhinini and Culicini. Taylor and Francis. 1934:463 pp. Bohart RM. A synopsis of the Philippine mosquitoes. U.S. NavMed. 1945;580:88 pp. Knight KL. The Aedes ( Mucidus ) mosquitoes of the Pacific (Diptera; Culicidae). J Wash Acad Sci. 1947;37:315–25. Knight K, Hull W. The Aedes Mosquitoes of the Philippine Islands. I Keys to Species. Subgenera Mucidus , Ochlerotatus , and Finlaya (Diptera, Culicidae). Pac. Sci. 1951;5:211–51. Bonne-Wepster J. Synopsis of a hundred common non-anopheline mosquitoes of the Greater and Lesser Sundas, the Moluccas and New Guinea. Roy. trop. Inst. Armst. Spec. Pub. III. 1954:147 pp. Wilkerson RC, Linton YM, Fonseca DM, Schultz TR, Price DC, Strickman DA. Making Mosquito Taxonomy Useful: A Stable Classification of Tribe Aedini that Balances Utility with Current Knowledge of Evolutionary Relationships. PLoS One. 2015;10:e0133602. Oh IS, Bin SD, Yu YH. Mosquitoes on Cheju-do. New Med. 1961;4: 83–86. Chun SR. A preliminary survey of mosquito of Cheju-Do. -related to filariasis on species, biology and infection status. Korean J. Pubulic Heath. 1968;5:113–21. Lien JC. Preliminary observations on the mosquitoes of Korea and recommendations developed for the WHO Japanese Encephalitis Vector Research Unit. WHO/VBC/69.175, 1969:31 pp. Barrett JE. Annual mosquito report, 1969-with summary eighth year mosquito survey. 5th Preventive Medicine Unit, U.S.Army. 1969:48 pp. Lee KW. Systematic survey of mosquitoes (Culicidae; Diptera) on Cheju Island. Korean J. Entomol. 1994; 24:253–8. Ko YG. Studies in vector species of Japanese encephalitis, Culex tritaeniorhynchus (Diptera: Culicidae) in Cheju Island. Incheon University PhD. Thesis.1996:78 pp. Kim HC, Wilkerson RC, Pecor JE, Lee WJ, Lee JS, O’Guinn ML, et al. New records and reference collection of mosquitoes (Diptera: Culicidae) on Jeju Island, Republic of Korea. Entomol Res. 2005;35:55–66. Seo MY, Chung KA. Density and Distribution of the Mosquito Population Inhabiting Jeju Region, 2018. Korean J Clin Lab Sci. 2019;51:336–43. Chatterjee S, Kim CM, Yun NR, Kim DM, Song HJ, Chung KA. Molecular detection and identification of Culex flavivirus in mosquito species from Jeju, Republic of Korea. Virol J. 2021;18:150. Seo MG, Lee HS, Yang SC, Noh BE, Kim TK, Lee WG et al. National Monitoring of Mosquito Populations and Molecular Analysis of Flavivirus in the Republic of Korea in 2020. Microorganisms. 2021;9:2085. Soghigian J, Andreadis TG, Livdahl TP. From ground pools to treeholes: convergent evolution of habitat and phenotype in Aedes mosquitoes. BMC Evol Biol. 2017;17:262. Lee SH, Nam KW, Jeong JY, Yoo SJ, Koh YS, Lee S, et al. The effects of climate change and globalization on mosquito vectors: evidence from Jeju island, South Korea on the potential for Asian tiger mosquito ( Aedes albopictus ) influxes and survival from Vietnam rather than Japan. PLoS one. 2013;8:e68512. Kim S, Jung S, Choi J, Tsai C, Farrell BD, Shin S. History Does Not Repeat Itself; It Rhymes: Range Expansion and Outbreak of Plecia longiforceps (Diptera: Bibionidae) in East Asia. J. Integr. Pest Manag. 2022;13:1–6 Jung JM, Lee JW, Kim C, Jung S, Lee WH. CLIMEX-based Analysis of Potential Geographical Distribution of Aedes albopictus and Aedes aegypti in South Korea. J. of Biosystems Eng. 2017. 42:217–26. Kim YW, Choi SY, Park JS. Studies on the Mechanism of Varietal Resistance of Rice to the Brown Planthopper ( Nilaparvata Lugens STAL). Kor. J. Plant Prot. 1985;24:51–60. Wu MF, Qi GJ, Chen H, Ma J, Liu J, Jiang YY, et al. Overseas immigration of fall armyworm, Spodoptera frugiperda (Lepidoptera: Noctuidae), invading Korea and Japan in 2019. Insect Sci. 2022;29:505–20 Korea Meteorological Administration, https://www.weather.go.kr/w/typhoon/typ-stat.do . Accessed on 27, November, 2023. Ahn S. New pests of the greenhouse, western flower thrips and melon thrips first discovered last year, crisis of nationwide spread urgent need to develop applied drugs and control systems. Agric. Inf. 1994;15:38–41. Ritchie SA, Rochester W. Wind-blown mosquitoes and introduction of Japanese encephalitis into Australia. Emerg Infect Dis. 2001;7:900–903. Hernandez PA, Graham CH, Master LL, Albert DL. The effect of sample size and species characteristics on performance of different species distribution modeling methods. Ecography. 2006;29:773–85. Fernandes RF, Scherrer D, Guisan A. Effects of simulated observation errors on the performance of species distribution models. Divers. Distrib. 2018;25:400–13. Additional Declarations No competing interests reported. Supplementary Files JejuMSwjbangAdditionalFile1TableS1.xls Additional file 1: Table S1. The gene dataset and sequences used for the phylogenetic analysis. JejuMSwjbangAdditionalfile2KeytothespeciesofgenusAedesinRepublicofKorea.pdf Additional file 2. Taxonomic key to the species of the genus Aedes in the Republic of Korea. Cite Share Download PDF Status: Published Journal Publication published 12 Sep, 2024 Read the published version in Parasites & Vectors → Version 1 posted Editorial decision: Revision requested 17 Mar, 2024 Reviews received at journal 07 Mar, 2024 Reviewers agreed at journal 22 Feb, 2024 Reviewers invited by journal 22 Feb, 2024 Editor assigned by journal 21 Feb, 2024 Submission checks completed at journal 21 Feb, 2024 First submitted to journal 20 Feb, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-3974400","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":274399866,"identity":"db1a08f2-93f3-4933-bd57-b27d8f67c018","order_by":0,"name":"Woo Jun Bang","email":"","orcid":"","institution":"Seoul National University","correspondingAuthor":false,"prefix":"","firstName":"Woo","middleName":"Jun","lastName":"Bang","suffix":""},{"id":274399867,"identity":"333242ca-c323-4f05-b689-6f4373336d7c","order_by":1,"name":"Ara Seol","email":"","orcid":"","institution":"Warm Temperate and Subtropical Forest Research Center, National Institute of Forest Science","correspondingAuthor":false,"prefix":"","firstName":"Ara","middleName":"","lastName":"Seol","suffix":""},{"id":274399868,"identity":"85d90350-e255-4c60-bdcc-ae321ca086b2","order_by":2,"name":"Seunggwan Shin","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAsElEQVRIiWNgGAWjYDACHubDDz5A2YwNxGlhSzOcQaIWHgNpHpK0yPccSzC2+XMnsYH98APGmXuI0GJwtvnA49y2Z4kNPGkGjBueEaOFny3BOLfhcGIDQw4D44MDxDisH+gXiz9ALfxviNTCcLbHQJqBDahFAmjLBmK0GJw5lmbY23bYuE3imcHBGUQ5rCf58IMffw7L9vMnP3zYQ5TDYIANiEnSMApGwSgYBaMADwAAbQo5oKJYm7MAAAAASUVORK5CYII=","orcid":"","institution":"Seoul National University","correspondingAuthor":true,"prefix":"","firstName":"Seunggwan","middleName":"","lastName":"Shin","suffix":""}],"badges":[],"createdAt":"2024-02-21 03:35:51","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-3974400/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-3974400/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1186/s13071-024-06373-8","type":"published","date":"2024-09-12T15:57:40+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":51562600,"identity":"612c6aea-d418-4611-98c4-99039efd4ee0","added_by":"auto","created_at":"2024-02-23 18:32:15","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":1070983,"visible":true,"origin":"","legend":"\u003cp\u003eCollection site on Jeju Island. A) Location of Jeju Island in the Republic of Korea, indicated by red box. B) Location of the Dongbaek-dong wetland, indicated by red dot. C) BG-sentinel trap used for collecting mosquitoes. D) \u003cem\u003eAe\u003c/em\u003e. \u003cem\u003elaniger\u003c/em\u003e specimen collected by using a BG-sentinel trap.\u003c/p\u003e","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-3974400/v1/b8b54676e6de0ac530811e9d.png"},{"id":51562971,"identity":"55ff8d8a-8ebe-4984-9e8f-c9f19e8865b4","added_by":"auto","created_at":"2024-02-23 18:40:15","extension":"jpeg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":225586,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003eAedes laniger\u003c/em\u003e adult female habitus in the A) lateral view B) and dorsal view and C) fore tibia (scale bar 1.0 mm).\u003c/p\u003e","description":"","filename":"floatimage2.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-3974400/v1/11be00f09c48de36664d4f61.jpeg"},{"id":51562602,"identity":"a3851bc3-62c9-4a3c-9111-a633b7c739ec","added_by":"auto","created_at":"2024-02-23 18:32:15","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":341669,"visible":true,"origin":"","legend":"\u003cp\u003eMaximum likelihood phylogeny of the Aedini species, comprising three genera, 22 subgenera, and 40 species (including 11 belonging to subgenera present in Korea). The tree is based on four marker genes (COI, ITS2, 28S, and enolase) and includes 11 newly sequenced data, with two species of \u003cem\u003ePsorophora\u003c/em\u003e for outgroups. The substitution models were selected using PartitionFinder2, and 2,000 bootstrap replicates were performed with 1,000 SH-aLRT tests. The black asterisk indicates a genus, not a subgenus. The blue texts and lines indicate the recorded subgenera in the ROK. The red texts and lines indicate the subgenus \u003cem\u003eMucidus\u003c/em\u003e, which showed the key points of this study.\u003c/p\u003e","description":"","filename":"floatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-3974400/v1/caa86ad9a954ae0d532839ff.png"},{"id":51562604,"identity":"d7b559a7-2461-4458-8bce-f6119fc294ae","added_by":"auto","created_at":"2024-02-23 18:32:15","extension":"jpeg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":230903,"visible":true,"origin":"","legend":"\u003cp\u003eProjected distributions of \u003cem\u003eAe\u003c/em\u003e. \u003cem\u003elaniger\u003c/em\u003e under the current climate conditions and in 2050 and 2070 based on ensemble species distribution modeling. The closer the color is to green, the higher the probability for species to inhabit the corresponding region. The red circles indicate occurrence records, and the plots are presented as ‘weighted mean results’ generated using the R package BIOMOD2.\u003c/p\u003e","description":"","filename":"floatimage4.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-3974400/v1/85e6ae01c39c0698809d2cec.jpeg"},{"id":64619107,"identity":"cbddd635-250f-42ba-baca-69f75d78ea7d","added_by":"auto","created_at":"2024-09-16 16:11:30","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2916546,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-3974400/v1/7baf8aa9-d061-44d4-92e0-e871bd083928.pdf"},{"id":51562599,"identity":"42b079ee-8b2d-4064-8d17-9282ba847b2c","added_by":"auto","created_at":"2024-02-23 18:32:15","extension":"xls","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":35840,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eAdditional file 1\u003c/strong\u003e: \u003cstrong\u003eTable S1\u003c/strong\u003e. The gene dataset and sequences used for the phylogenetic analysis.\u003c/p\u003e","description":"","filename":"JejuMSwjbangAdditionalFile1TableS1.xls","url":"https://assets-eu.researchsquare.com/files/rs-3974400/v1/e94b7e5d8859b71fe36acd15.xls"},{"id":51562601,"identity":"117c6f91-da68-43ba-bcca-128d83b04a7e","added_by":"auto","created_at":"2024-02-23 18:32:15","extension":"pdf","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":151532,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eAdditional file 2\u003c/strong\u003e. Taxonomic key to the species of the genus \u003cem\u003eAedes\u003c/em\u003e in the Republic of Korea.\u003c/p\u003e","description":"","filename":"JejuMSwjbangAdditionalfile2KeytothespeciesofgenusAedesinRepublicofKorea.pdf","url":"https://assets-eu.researchsquare.com/files/rs-3974400/v1/9810a6c70730d3b3cc5402cc.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Insights from Multigene Analysis: First Report of a Southeast Asian Mosquito, Aedes (Mucidus) laniger (Diptera: Culicidae) from Korea","fulltext":[{"header":"Background","content":"\u003cp\u003eMosquitoes are dominant vectors worldwide and drive the spread of infectious diseases through their well-developed piercing mouthparts during the blood-feeding process [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. Mosquito species can transmit various diseases, such as malaria and dengue fever, leading to more than 700,000 deaths worldwide annually [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. Factors such as climate change, increased anthropogenic activities and material exchanges among countries have led to recent expansions in mosquito habitats [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e, \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e, \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eMosquitoes that are spreading globally predominantly belong to the genus \u003cem\u003eAedes\u003c/em\u003e, and the majority of these species have a strong ability to adapt to changing environments [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. In addition, some species have also been listed on the Invasive Species Specialist Group [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. The most studied invasive species is \u003cem\u003eAedes albopictus\u003c/em\u003e, which is reported to possess greater heat and stress tolerance than other aedine species [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. There are several examples of invasive mosquitoes moving or being transported between countries: In the 1990s and 2010s, the ranges of \u003cem\u003eAedes japonicus\u003c/em\u003e and \u003cem\u003eAedes koreicus\u003c/em\u003e expanded from East Asia to North America and Europe, respectively [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e, \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e, \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e, \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e, \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e, \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. Additionally, in 2019, \u003cem\u003eAedes flavopictus\u003c/em\u003e was detected for the first time in Europe [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. Moreover, the spread of invasive mosquitos is not limited to species belonging to \u003cem\u003eAedes\u003c/em\u003e; \u003cem\u003eAnopheles\u003c/em\u003e and \u003cem\u003eCulex\u003c/em\u003e species have also been reported in locations outside their native ranges [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e, \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e, \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. Many invasive mosquito species are known to have the ability to transmit infectious diseases, and there have been cases where endemic diseases have been transmitted between continents during the expansion of mosquito range [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e, \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. For example, \u003cem\u003eAnopheles arabiensis\u003c/em\u003e, the primary malaria vector in Africa, invaded Brazil from Senegal, resulting in a malaria pandemic that caused 16,000 deaths over a decade [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. Based on the previous studies, it can be inferred that if non-native mosquitoes are introduced, there is a potential for the concurrent emergence of mosquito-borne diseases.\u003c/p\u003e \u003cp\u003eIn total, 59 species, 11 genera, and two subfamilies of mosquitoes have been recorded in the Republic of Korea (ROK) [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. Among these, 14 species from four genera are considered potential vectors in the Korean Peninsula due to their reported ability to transmit diseases [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. Except for endemic diseases (Japanese encephalitis and malaria), there have been no outbreaks of exogenous mosquito-borne diseases in the ROK to date.\u003c/p\u003e \u003cp\u003eThe changing climate pattern in the Korean peninsula, which is causing a shift from temperate conditions to subtropical conditions, makes it possible for invasive species to become established in ROK, leading to the potential introduction of infectious diseases [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e, \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e, \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e, \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. Jeju Island, located in the southernmost part of the ROK (central GPS coordinates: 33\u0026deg;23\u0026prime;N, 126\u0026deg;34\u0026prime;E), is expected to be the first region to report invasive mosquitoes. This island is the warmest region in the ROK, even in winter; furthermore, it is already classified as having a humid-subtropical climate [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]. Due to its distinct climate and geographic location, several nonnative insects have been reported recently on Jeju Island, including \u003cem\u003eAnoplophora horsfieldii\u003c/em\u003e (Hope, 1843) (Coleoptera: Cerambycidae) in 2023 [\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e] and \u003cem\u003eSpodoptera frugiperda\u003c/em\u003e (Smith, 1797) (Lepidoptera: Noctuidae) in 2019 [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]; These cases highlight the Jeju Island's potential as a susceptible site for the invasion of non-native insect species.\u003c/p\u003e \u003cp\u003eIn this study, we report the first record of \u003cem\u003eAedes\u003c/em\u003e (\u003cem\u003eMucidus\u003c/em\u003e) \u003cem\u003elaniger\u003c/em\u003e on Jeju Island, with taxonomic details and molecular evidence using phylogenetic method. Additionally, updates have been made on the mosquito species lists in Jeju Island and the taxonomic keys for genus \u003cem\u003eAedes\u003c/em\u003e in Korea. Furthermore, species distribution modeling analysis was conducted to explore the potential implications concerning this species and about other invasive mosquitoes on the Korean Peninsula.\u003c/p\u003e"},{"header":"Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eSample collection and identification\u003c/h2\u003e \u003cdiv id=\"Sec4\" class=\"Section3\"\u003e \u003ch2\u003e\u0026lt; Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e \u0026gt;\u003c/h2\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eField surveys were carried out twice near Dongbaek-dong wetland, Jeju Island, in August 2023 (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA\u0026ndash;B). Adult specimens were collected using BG-sentinel\u0026trade; (BGS) traps (Biogents, Regensburg, Germany) with BG\u0026ndash;lure (lactic acid) and dry ice as attractants (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC\u0026ndash;D). The collected specimens were stored at \u0026minus;\u0026thinsp;80\u0026deg;C and subsequently identified using the taxonomic keys of Tanaka \u003cem\u003eet al.\u003c/em\u003e [\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e] and Ree [\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e], which for the mosquito species of East Asia (Korea and Japan). For the mosquitoes that could not be identified using these keys, the taxonomic keys of Southeast Asian mosquitoes were used [\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e, \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e, \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e]. Remained specimen was used for molecular analysis.\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eTaxonomy\u003c/h2\u003e \u003cp\u003eThe collected specimens were examined under a stereoscopic microscope (Leica M205 FCA, Germany). Photographs were taken with a Canon 90D camera with an MP-E 65 mm lens mounted on a Stackshot Macro Rail (Cognisys, Inc., USA). All the microphotographic layers were combined and retouched with Helicon Focus software v8.1.1 (HeliconSoft, Ltd., Ukraine); then, the merged image was edited using Photoshop v.2023 (Adobe). The morphological terms used in the descriptions follow those of Rattanarithikul \u003cem\u003eet al.\u003c/em\u003e [\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e] and Harbach \u0026amp; Knight [\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e]. One female adult was pinned and deposited at Seoul National University in the Laboratory of Evolution and Phylogenomics (SNUE).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eMolecular data acquisition\u003c/h2\u003e \u003cdiv id=\"Sec7\" class=\"Section3\"\u003e \u003ch2\u003e\u0026lt; Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e \u0026gt;\u003c/h2\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eFour sets of primers used in this study\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMarker\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePrimer name\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003ePrimer sequence (5\u0026rsquo; to 3\u0026rsquo;)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eReference\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCOI\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eLCO1490\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGGTCAACAAATCATAAAGATATTGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eFolmer \u003cem\u003eet al\u003c/em\u003e., 1994\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eHCO2198\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTAAACTTCAGGGTGACCAAAAAATCA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eFolmer \u003cem\u003eet al\u003c/em\u003e., 1994\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eITS2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMS_ITS2_F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCTCGTGGATCGATGAAGACC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eThis study\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMS_ITS2_R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCTCGCAGCTACTCAGGGAAT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eThis study\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e28S\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ems28S_F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCCGTGAGGGAAAGTTGAAAA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eThis study\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ems28S_R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTTTCCCCTGACTTCAACCTG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eThis study\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eEnolase\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eenoR2_F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAGRATYTGGTTGTACTTGGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eSoghigian \u003cem\u003eet al\u003c/em\u003e., 2017\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eenoF_R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eATGCAGGAGTTCATGATCCTG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eSoghigian \u003cem\u003eet al\u003c/em\u003e., 2017\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eDNA was extracted from one grounded leg of the pinned specimen, using an OmniPrep\u0026trade; for Tissue Kit (Cat. #786\u0026ndash;395; G\u0026ndash;Biosciences\u0026reg;, USA). A total of four partial gene regions\u0026mdash;mitochondrial cytochrome c oxidase I (COI), internal transcribed spacer 2 (ITS2), large subunit ribosomal RNA (28S) and the nuclear protein-coding gene enolase\u0026mdash;were used in the construction of a phylogenetic tree. Detailed information on the genes and primer sets used is provided in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. All PCR amplifications were conducted in a reaction mixture containing a total volume of 25 \u0026micro;L: 1\u0026times; PCR buffer, 0.4 \u0026micro;M each primer, 1.5 mM MgCl\u003csub\u003e2\u003c/sub\u003e, 0.2 mM each dNTP, 0.5 units of Taq DNA polymerase (R001AM; Takara Bio, Kusatsu, Shiga, Japan), and 1.0\u0026thinsp;~\u0026thinsp;2.0 ng of extracted DNA. The PCR procedure was as follows: 94\u0026deg;C for 5 min for denaturation; 35 cycles of 94\u0026deg;C for 30 s, 50\u0026ndash;60\u0026deg;C (50\u0026deg;C for enolase and 28S, 52\u0026deg;C for COI, and 60\u0026deg;C for ITS2) for 30 s, and 72\u0026deg;C for 30 s; with a final extension for 5 min at 72\u0026deg;C. The products were visualized on 1.5% (wt/vol) agarose gels stained with Midori Green Advanced DNA Stain (Nippon Genetics Europe, D\u0026uuml;ren, Germany) and then sequenced in both directions by Bionics Corp. (Seoul, Republic of Korea). The sequencing data were assembled and trimmed using BioEdit software v7.2.6.1 [\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e] and were deposited in GenBank under the following accessions: \u003cem\u003eAe\u003c/em\u003e. \u003cem\u003elaniger\u003c/em\u003e \u0026ndash; PP097195 for COI, PP095639 for ITS2 and PP095638 for 28S; \u003cem\u003eAe\u003c/em\u003e. \u003cem\u003ehatorii\u003c/em\u003e \u0026ndash; PP095640 for 28S and PP215381 for enolase; \u003cem\u003eAe\u003c/em\u003e. \u003cem\u003ekoreicus\u003c/em\u003e \u0026ndash; PP095641 for 28S and PP215377 for enolase; \u003cem\u003eAe\u003c/em\u003e. \u003cem\u003ealbopictus\u003c/em\u003e \u0026ndash; PP215379 for enolase; \u003cem\u003eAe\u003c/em\u003e. \u003cem\u003ejaponicus\u003c/em\u003e \u0026ndash; PP215378 for enolase; \u003cem\u003eAe\u003c/em\u003e. \u003cem\u003enipponicu\u003c/em\u003es \u0026ndash; PP095642 for 28S; \u003cem\u003eAe\u003c/em\u003e. \u003cem\u003etogoi\u003c/em\u003e \u0026ndash; PP215380 for enolase. Additional sequences for the four gene regions of other species were downloaded from GenBank and used to construct the phylogenetic tree. Detailed information about the sequences used is provided in \u003cb\u003eAdditional file 1: Table \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e\u003c/b\u003e.\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eMolecular analysis\u003c/h2\u003e \u003cp\u003eWe performed a cross-check of the phylogenetic tree with the morphological identification results to assess the distinctiveness of the sample DNA from the subgenera recorded in the ROK, which include \u003cem\u003eAedes\u003c/em\u003e, \u003cem\u003eAedimorphus\u003c/em\u003e, \u003cem\u003eBruceharrisonius\u003c/em\u003e, \u003cem\u003eCollessius\u003c/em\u003e, \u003cem\u003eDownsiomyia\u003c/em\u003e, \u003cem\u003eEdwardsaedes\u003c/em\u003e, \u003cem\u003eHulecoeteomyia\u003c/em\u003e, \u003cem\u003eNeomelaniconion\u003c/em\u003e, \u003cem\u003eOchlerotatus\u003c/em\u003e, \u003cem\u003eStegomyia\u003c/em\u003e, and \u003cem\u003eTanakaius\u003c/em\u003e; except for \u003cem\u003eHopkinsius\u003c/em\u003e, no sequence data were registered in the National Center for Biotechnology Information (NCBI). We further sought to confirm the position of the sample within the subgenus \u003cem\u003eMucidus\u003c/em\u003e; our analyses were not intended to establish accurate and robust phylogenetic positions of all related subgenera of \u003cem\u003eAedes\u003c/em\u003e.\u003c/p\u003e \u003cp\u003eAll the sequences were aligned using MAFFT v7.475 software [\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e] with the --auto option and subsequently manually trimmed in Aliview v. 1.26 [\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e]. The concatenated alignments were subsequently constructed with FASconCAT-G v1.02 software [\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e], and PartitionFinder 2 software [\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e] was used to determine the best partition scheme and substitution models according to codon position. We used IQ-tree v2.1.2 software to construct the maximum likelihood tree and applied the ultrafast option with 1,000 replicates for bootstrapping [\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e, \u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e]. To provide additional branch support, the SH-like approximate likelihood ratio test (SH-aLRT) was applied with 1,000 replications to ensure that our data were not biased due to taxa with limited marker coverage [\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e]. We rooted the phylogeny along the branch leading to the genus \u003cem\u003ePsorophora\u003c/em\u003e, which is known as the most ancestral clade of Aedini [\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e, \u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e, \u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e, \u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e55\u003c/span\u003e]. Finally, the constructed tree was visualized in iTol v5 [\u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e] and enhanced for clarity using Photoshop v.2023 (Adobe).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eSpecies distribution modelling\u003c/h2\u003e \u003cp\u003eGeoreferenced \u003cem\u003eAe\u003c/em\u003e. \u003cem\u003elaniger\u003c/em\u003e occurrence data were compiled from various resources, including previously published studies [\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e, \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e, \u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e57\u003c/span\u003e, \u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e58\u003c/span\u003e, \u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e59\u003c/span\u003e, \u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e60\u003c/span\u003e], the Global Biodiversity Information Facility [\u003cspan citationid=\"CR61\" class=\"CitationRef\"\u003e61\u003c/span\u003e], which contains global occurrence records of thousands of species, and the iNaturalist database [\u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e62\u003c/span\u003e]. The keywords used to search the GBIF and iNaturalist databases were species \u0026ldquo;\u003cem\u003eAe\u003c/em\u003e. \u003cem\u003elaniger\u003c/em\u003e\u0026rdquo; or \u0026ldquo;\u003cem\u003eMucidus laniger\u003c/em\u003e\u0026rdquo; and \u0026ldquo;\u003cem\u003eAe\u003c/em\u003e. \u003cem\u003elaniger\u003c/em\u003e\u0026rdquo;, respectively.\u003c/p\u003e \u003cp\u003eRecords within 20 km of each other were eliminated to reduce spatial autocorrelation, and duplicate records were removed, resulting in a total of 25 occurrence data points for further analysis. The longitudes and latitudes of the points were transformed to Universal Transverse Mercator (UTM) coordinates and projected to zone 52N. In addition, 5,000 pseudoabsence points were randomly generated around the distribution points to account for the sampling probability at each occurrence point.\u003c/p\u003e \u003cp\u003eSpecies distribution modeling was conducted using the R package \u0026lsquo;BIOMOD2\u0026rsquo; to project the current and future distributions of \u003cem\u003eAe. laniger\u003c/em\u003e based on occurrence data and pseudoabsence points [\u003cspan citationid=\"CR63\" class=\"CitationRef\"\u003e63\u003c/span\u003e, \u003cspan citationid=\"CR64\" class=\"CitationRef\"\u003e64\u003c/span\u003e]. Climate data were acquired from WorldClim 2.1 using the R packages 'raster' [\u003cspan citationid=\"CR65\" class=\"CitationRef\"\u003e65\u003c/span\u003e], 'rgeos' [\u003cspan citationid=\"CR66\" class=\"CitationRef\"\u003e66\u003c/span\u003e], and 'rgdal' [\u003cspan citationid=\"CR67\" class=\"CitationRef\"\u003e67\u003c/span\u003e]. Subsequently, ten algorithms were applied using the 'BIOMOD2' package: generalized linear model (GLM), generalized boosted model (GBM), classification tree analysis (CTA), artificial neural network (ANN), surface range envelope (SRE), flexible discriminant analysis (FDA), multiple adaptive regression splines (MARS), random forest (RF), extreme gradient boosting (XGBoost) and MaxEnt [\u003cspan citationid=\"CR68\" class=\"CitationRef\"\u003e68\u003c/span\u003e]. Each algorithm was executed five times, for a cumulative total of 150 runs to enhance statistical robustness. During these trials, 80% of the points were used for calibration, while the remaining 20% were reserved for evaluation. Model accuracy was evaluated by the true kill statistic (TSS), and scores that surpassed the threshold of 0.75 were considered indicative of satisfactory performance [\u003cspan citationid=\"CR69\" class=\"CitationRef\"\u003e69\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eFinally, ensemble modelling was performed to optimize the prediction of \u003cem\u003eAe\u003c/em\u003e. \u003cem\u003elaniger\u003c/em\u003e occurrence by combining several diverse models [\u003cspan citationid=\"CR70\" class=\"CitationRef\"\u003e70\u003c/span\u003e]. Furthermore, to predict the future distribution of \u003cem\u003eAe. laniger\u003c/em\u003e, three climate models included in the CMIP5 multimodel ensemble, considering two representative concentration pathways (RCP 2.6 and 8.5) were selected. RCP 2.6 anticipates a future characterized by ambitious climate policies, striving to constrain global warming to less than 2\u0026deg;C. In contrast, RCP 8.5 portrays a worse scenario marked by high greenhouse gas emissions, lacking substantial climate mitigation measures. These climate models were subsequently applied to create projections of the distribution of \u003cem\u003eAe. laniger\u003c/em\u003e for 2050 and 2070. These projections were subsequently compared with the current distribution maps. The R code used in this study generally follows the methods proposed by Kim \u003cem\u003eet al\u003c/em\u003e. [\u003cspan citationid=\"CR71\" class=\"CitationRef\"\u003e71\u003c/span\u003e] with minor modifications.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eTaxonomic accounts\u003c/h2\u003e \u003cp\u003eFamily Culicidae, Meigen, 1818 [\u003cspan citationid=\"CR72\" class=\"CitationRef\"\u003e72\u003c/span\u003e]\u003c/p\u003e \u003cp\u003eSubfamily Culicinae, Meigen, 1818 [\u003cspan citationid=\"CR72\" class=\"CitationRef\"\u003e72\u003c/span\u003e]\u003c/p\u003e \u003cp\u003eGenus \u003cem\u003eAedes\u003c/em\u003e Meigen, 1818 [\u003cspan citationid=\"CR72\" class=\"CitationRef\"\u003e72\u003c/span\u003e]\u003c/p\u003e \u003cp\u003eSubgenus \u003cem\u003eMucidus\u003c/em\u003e Theobald, 1901 [\u003cspan citationid=\"CR73\" class=\"CitationRef\"\u003e73\u003c/span\u003e]\u003c/p\u003e \u003cp\u003e \u003cb\u003eDiagnosis. Female adult.\u003c/b\u003e See Tyson [\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e] and Mattingly [\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e] for morphological detailed characters of subgenus \u003cem\u003eMucidus\u003c/em\u003e. Characteristic scaling patterns: combinations of yellow, white, and brown, especially in mesonotum and legs, comparing to other subgenera in \u003cem\u003eAedes\u003c/em\u003e. Maxillary palpus more than half length of proboscis. Scutum with highly modified. Wings with distinctive patterns; wing membrane pigmented in the region along the radiomedial cross\u0026ndash;vein (rm), the base of vein R\u003csub\u003e4\u0026thinsp;+\u0026thinsp;5\u003c/sub\u003e, and the medio cubital cross\u0026ndash;vein (mcu).\u003c/p\u003e \u003cp\u003e \u003cb\u003eAedes\u003c/b\u003e \u003cb\u003e(\u003c/b\u003e\u003cb\u003eMucidus\u003c/b\u003e\u003cb\u003e)\u003c/b\u003e \u003cb\u003elaniger\u003c/b\u003e \u003cb\u003e(Wiedemann, 1820)\u003c/b\u003e [\u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e57\u003c/span\u003e]\u003c/p\u003e \u003cp\u003e \u003cem\u003eCulex laniger\u003c/em\u003e Wiedemann, 1820: 9 [\u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e57\u003c/span\u003e]\u003c/p\u003e \u003cp\u003e \u003cem\u003eMucidus laniger\u003c/em\u003e (Wiedemann): Theobald 1901: 279 [\u003cspan citationid=\"CR73\" class=\"CitationRef\"\u003e73\u003c/span\u003e]. Edwards 1913: 224 [\u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e58\u003c/span\u003e]; Barraud 1929: 1053 [\u003cspan citationid=\"CR74\" class=\"CitationRef\"\u003e74\u003c/span\u003e]; Brug \u0026amp; Edwards 1931: 257 [\u003cspan citationid=\"CR75\" class=\"CitationRef\"\u003e75\u003c/span\u003e]. Reinert 2004: 360 [\u003cspan citationid=\"CR76\" class=\"CitationRef\"\u003e76\u003c/span\u003e]; Reinert 2006: 93 [\u003cspan citationid=\"CR77\" class=\"CitationRef\"\u003e77\u003c/span\u003e]; Reinert 2008: 63 [\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e]; Reinert 2009: 706 [\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e].\u003c/p\u003e \u003cp\u003e \u003cem\u003eMucidus mucidus\u003c/em\u003e (nec Karsch): Banks 1906: 983 [\u003cspan citationid=\"CR78\" class=\"CitationRef\"\u003e78\u003c/span\u003e]; Leicester 1908: 69 [\u003cspan citationid=\"CR79\" class=\"CitationRef\"\u003e79\u003c/span\u003e]; Brunetti 1912: 440 [\u003cspan citationid=\"CR80\" class=\"CitationRef\"\u003e80\u003c/span\u003e].\u003c/p\u003e \u003cp\u003e \u003cem\u003eAedes\u003c/em\u003e (\u003cem\u003eMucidus\u003c/em\u003e) \u003cem\u003elaniger\u003c/em\u003e (Wiedemann): Barraud 1934: 147 [\u003cspan citationid=\"CR81\" class=\"CitationRef\"\u003e81\u003c/span\u003e]; Bohart 1945: 51 [\u003cspan citationid=\"CR82\" class=\"CitationRef\"\u003e82\u003c/span\u003e]; Knight 1947: 320 [\u003cspan citationid=\"CR83\" class=\"CitationRef\"\u003e83\u003c/span\u003e]; Knight \u0026amp; Hull 1951: 225 [\u003cspan citationid=\"CR84\" class=\"CitationRef\"\u003e84\u003c/span\u003e]; Bonne-Wepster 1954: 59 [\u003cspan citationid=\"CR85\" class=\"CitationRef\"\u003e85\u003c/span\u003e]; Mattingly 1961: 31 [\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e]. We follow Wilkerson \u003cem\u003eet al.\u003c/em\u003e [\u003cspan citationid=\"CR86\" class=\"CitationRef\"\u003e86\u003c/span\u003e] for generic classification.\u003c/p\u003e \u003cp\u003e \u003cb\u003eExamined material.\u003c/b\u003e One female adult (SNUE), 19.VIII.2023, Jocheon-eup, Jeju\u0026ndash;si, Jeju\u0026ndash;do, Republic of Korea, 33\u0026deg;31'05.9\"N, 126\u0026deg;42'56.0\"E, BG-sentinel traps with dry ice, Woo Jun Bang; one female adult (SNUE), same data, but 30.VIII.2023, Woo Jun Bang and Heungmin Kim. In total of two female adults collected; One female pinned and another preserved in \u0026minus;\u0026thinsp;80℃ freezer for further molecular studies.\u003c/p\u003e \u003cp\u003e \u003cb\u003eDiagnosis. Female adult\u003c/b\u003e. See Mattingly [\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e] for morphological details. We stated that this diagnosis is for Indomalayan and Australian species, not for Afrotropical species. Habitus yellow-brownish. Tarsi without bands, except on tarsomere I at base. Fore tibia with narrowly white scales at base; largely white scales at apex about 0.3 the length of the tibia. Scutum and scutellum with narrow white scales and setae mostly. Tergites mostly with yellowish scales at margin, and white scales mostly at median, but tergites VII\u0026ndash;VIII with white scales extremely clothed.\u003c/p\u003e \u003cp\u003e \u003cb\u003eDescription.\u003c/b\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003e\u0026lt; Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e \u0026gt;\u003c/h2\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eFemale adult (\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA\u003cb\u003e). Head\u003c/b\u003e: Generally brown. Antennae light brown; basal segments brighter than distal segments; pedical with a few flat white scales; white bands on joints between each flagellum. Clypeus brown with no scales. Gena dark brown with no scales. Maxillary palpus light brown with white, dark and bicolored scales; slightly more than 2/3 rds of the length of the proboscis; palpomeres I\u0026ndash;II mostly bicolored scales scattered: dark tipped with white scales; palpomere III mostly white, few scales and 0.5 the length of palpomere I. Proboscis light brown with white ring behind labellum, same scaling patterns with palpus, brown or dark yellow at apical. Labellum dark. Eyes continuous. Vertex with white narrow and semi-erected scales; inner sides with several hair-like yellowish setae.\u003c/p\u003e \u003cp\u003e \u003cb\u003eThorax (\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA\u0026ndash;B\u003cb\u003e)\u003c/b\u003e. Generally brown with pale scales. Scutum and scutellum brown with pale narrow or semi-erected scales, but most scales lost in this specimen, see Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e in Tyson \u003cem\u003eet al\u003c/em\u003e. [\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e] for more details on scaling patterns. Postspiracular- subspiracular area, mesepisterum, mesomeron and lower mesepimeron mostly dark-brown. Postpronotum, antepronotum, proepistenum, mesokatepimeron, upper mesepimeron, metaepimeron and metaepisternum pale brown. Postnotum without scales or setae. Fossa, prespiracular area, postpronotum, mesepimeron, antepronotum, propleuron, supraalar area with brown setae. Lateral and medial pleurons with several long scutellar setae. Halters pale.\u003c/p\u003e \u003cp\u003e \u003cstrong\u003eLegs (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA)\u003c/strong\u003e \u003cp\u003eMostly light brown, most segments with white, dark and bicolored semi-erected scales and brown or dark setae placed randomly. Coxae with narrow yellowish setae and white scales. Femora with white bands at base and apex; fore femora scattered with faintly white scales, but mid and hind femora with two intermediate white bands. Tibiae with white bands at base and apex; fore tibia with large apical white band, about 0.3 the total length of tibia; hind tibia with one intermediate white band (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC). Tarsi mostly yellowish; tarsomere I with white scales at base; tarsomeres III\u0026ndash;V with white scales at apex.\u003c/p\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eWings\u003c/b\u003e: Squama with numerous pale and hair-like scales. Veins mostly yellowish with pale, dark and bicolored scales scattered accordingly; costa with numerous pale scales and patches; R\u003csub\u003es\u003c/sub\u003e with dark scales at base; from rm, the base of R\u003csub\u003e4\u0026thinsp;+\u0026thinsp;5\u003c/sub\u003e, to m-cu with dark scales markedly (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB). \u003cb\u003eAbdomen\u003c/b\u003e: Tergites with yellow and white scales orderly scattered; tergites I\u0026ndash;VI with yellow scales at marginal and white scales in median; tergites VII\u0026ndash;VIII with white scales extremely (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA\u0026ndash;B).\u003c/p\u003e \u003cp\u003e \u003cb\u003eDistribution.\u003c/b\u003e Cambodia, India, Indonesia, Korea (new record in Jeju Island), Malaysia, Philippines, Singapore, Thailand and Vietnam.\u003c/p\u003e \u003cp\u003e \u003cb\u003eBionomics.\u003c/b\u003e The specimens were collected in highly humidity and shaded forest near the wetland. There were many puddles around the wetland, and aquatic plants were abundant. Only two adult females were attracted by dry ice. The larvae are definitely predacious to larvae of other mosquito species and adults have been observed feeding on humans [\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e].\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eUpdated list of mosquito species on Jeju Island\u003c/h2\u003e \u003cdiv id=\"Sec14\" class=\"Section3\"\u003e \u003ch2\u003e\u0026lt; Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e \u0026gt;\u003c/h2\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eThe updated checklist of mosquitoes found on Jeju Island, Republic of Korea: A total of 33 mosquito species belonging to 7 genera have been recorded in Jeju Island.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"14\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c8\" colnum=\"8\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c9\" colnum=\"9\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c10\" colnum=\"10\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c11\" colnum=\"11\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c12\" colnum=\"12\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c13\" colnum=\"13\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c14\" colnum=\"14\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSpecies\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eOh 1957\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eChun 1968\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eLien 1969\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003e5th PMU 1966-69\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eTanaka \u003cem\u003eet al\u003c/em\u003e., 1979\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e \u003cp\u003eLee 1994\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c8\"\u003e \u003cp\u003eKo 1996\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c9\"\u003e \u003cp\u003eKim 2005\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c10\"\u003e \u003cp\u003eSeo \u0026amp; Chung 2019\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c11\"\u003e \u003cp\u003eChattejee 2021\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c12\"\u003e \u003cp\u003eSeo \u003cem\u003eet al\u003c/em\u003e., 2021\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c13\"\u003e \u003cp\u003eThis study\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c14\"\u003e \u003cp\u003eRemarks\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eAnopheles sinensis\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003eO*\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eAnopheles lesteri\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eAnopheles lindesayi japonicus\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eAnopheles sineroides\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eArmigeres subalbatus\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eAedes albopictus\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eAedes flavopictus\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eAedes lineatopennis\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eAedes niponii\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eAedes hatorii\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eAedes japonicus\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eAedes koreicus\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eAedes nipponicus\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eAedes togoi\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eAedes dorsalis\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eAedes laniger\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e \u003cp\u003e\u003cb\u003eNew record\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eCulex bitaeniorhynchus\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eCulex hayashii\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eCulex infantulus\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eCulex inatomii\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eCulex kyotoensis\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eCulex sasai\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eCulex mimeticus\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eCulex orientalis\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eCulex pipiens\u003c/em\u003e*\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eCulex pseudovishnui\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eCulex tritaeniorhynchus\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eCulex vagans\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eLutzia fuscanus\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eLutzia halifaxi\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eTripteroides bambusa\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eMansonia uniformis\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTotal number of species\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e19\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e18\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e8*\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"14\"\u003eBlack asterisk indicates the species labeled as 'sp.' in the reference.\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eA total of four species were captured using BG-sentinel traps at three trapping sites during field surveys in the Dongbaek-dong wetland, Jeju Island, in August 2023. The collected specimens belonged to two genera, \u003cem\u003eArmigeres\u003c/em\u003e and \u003cem\u003eAedes\u003c/em\u003e, and were identified as \u003cem\u003eArmigeres subalbatus\u003c/em\u003e (Coquillett, 1898), \u003cem\u003eAe. albopictus\u003c/em\u003e (Skuse, 1895), \u003cem\u003eAe. koreicus\u003c/em\u003e (Edwards, 1917), and \u003cem\u003eAe. laniger\u003c/em\u003e (Wiedemann, 1821)\u0026ndash;a novel record for Jeju Island. Following the initial survey on Jeju Island conducted by Oh in 1957, this study provides an updated list with combining previous studies that includes 32 mosquito species belonging to 7 genera [\u003cspan citationid=\"CR87\" class=\"CitationRef\"\u003e87\u003c/span\u003e, \u003cspan citationid=\"CR88\" class=\"CitationRef\"\u003e88\u003c/span\u003e, \u003cspan citationid=\"CR89\" class=\"CitationRef\"\u003e89\u003c/span\u003e, \u003cspan citationid=\"CR90\" class=\"CitationRef\"\u003e90\u003c/span\u003e, \u003cspan citationid=\"CR91\" class=\"CitationRef\"\u003e91\u003c/span\u003e, \u003cspan citationid=\"CR92\" class=\"CitationRef\"\u003e92\u003c/span\u003e, \u003cspan citationid=\"CR93\" class=\"CitationRef\"\u003e93\u003c/span\u003e, \u003cspan citationid=\"CR94\" class=\"CitationRef\"\u003e94\u003c/span\u003e, \u003cspan citationid=\"CR95\" class=\"CitationRef\"\u003e95\u003c/span\u003e, \u003cspan citationid=\"CR96\" class=\"CitationRef\"\u003e96\u003c/span\u003e] (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). We also updated the taxonomic keys for the genus \u003cem\u003eAedes\u003c/em\u003e in the ROK, including \u003cem\u003eAe\u003c/em\u003e. \u003cem\u003elaniger\u003c/em\u003e (\u003cb\u003eAdditional file 2)\u003c/b\u003e.\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eMolecular phylogeny\u003c/h2\u003e \u003cdiv id=\"Sec16\" class=\"Section3\"\u003e \u003ch2\u003e\u0026lt; Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e \u0026gt;\u003c/h2\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eWe employed a phylogenetic method to confirm a new record at the subgenus and species levels in the ROK. COI sequences, usually used for DNA barcoding, are not available from the NCBI for \u003cem\u003eAe\u003c/em\u003e. \u003cem\u003elaniger\u003c/em\u003e. For this reason, multigene molecular phylogenetic analysis was used to assess the phylogenetic position of \u003cem\u003eAe. laniger\u003c/em\u003e within the subgenus \u003cem\u003eMucidus\u003c/em\u003e with existing data for \u003cem\u003eAedes alternans\u003c/em\u003e and \u003cem\u003eAedes sudanensis\u003c/em\u003e. In addition, we aimed to investigate whether the collected specimen belong to 11 subgenera recorded in the ROK.\u003c/p\u003e \u003cp\u003eOn the basis of the four molecular markers, the concatenated matrix consisted of 2,741 nucleotide sequences from 42 species of \u003cem\u003eAedes\u003c/em\u003e, and the five best partitioning schemes (GTR\u0026thinsp;+\u0026thinsp;G, GTR\u0026thinsp;+\u0026thinsp;I\u0026thinsp;+\u0026thinsp;G, TVM\u0026thinsp;+\u0026thinsp;I\u0026thinsp;+\u0026thinsp;G, TIM\u0026thinsp;+\u0026thinsp;I\u0026thinsp;+\u0026thinsp;G and TVM\u0026thinsp;+\u0026thinsp;I) were assigned to eight subsets.\u003c/p\u003e \u003cp\u003eThe phylogenetic tree showed that the collected specimen was not assigned to the clades of subgenera recorded in the ROK but rather was grouped with \u003cem\u003eAe\u003c/em\u003e. \u003cem\u003ealternans\u003c/em\u003e and \u003cem\u003eAe\u003c/em\u003e. \u003cem\u003esudanensis\u003c/em\u003e, which are species of subgenus \u003cem\u003eMucidus\u003c/em\u003e with high support values (SH-aLRT\u0026thinsp;\u0026gt;\u0026thinsp;85, UFB\u0026thinsp;\u0026gt;\u0026thinsp;95) (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). Furthermore, the subgenera recorded in the ROK each formed a distinct clade, and two paraphyletic clades were found in the genus \u003cem\u003eAedes\u003c/em\u003e, consistent with numerous studies of mosquito phylogenetics based on morphological traits or molecular phylogeny [\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e, \u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e, \u003cspan citationid=\"CR97\" class=\"CitationRef\"\u003e97\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eWe initially identified the collected specimen as \u003cem\u003eAe\u003c/em\u003e. \u003cem\u003elaniger\u003c/em\u003e through the morphological keys at the species level, and molecular analysis also showed that the specimen forms a distinct clade with the subgenus \u003cem\u003eMucidus\u003c/em\u003e, which means a new record within the subgenus \u003cem\u003eMucidus\u003c/em\u003e and the species in the ROK. Finally, the outcomes of this study confirmed the concordance between morphological and molecular species identification results.\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003eSpecies distribution modelling\u003c/h2\u003e \u003cp\u003eThe results of the species distribution models suggest that within Southeast Asia, \u003cem\u003eAe\u003c/em\u003e. \u003cem\u003elaniger\u003c/em\u003e is most likely to be found in Indonesia, Malaysia, and the Philippines, all of which were identified as areas with highly suitable climate spaces for this species (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e). In contrast, the modeling results indicate that among East Asian countries, including South Korea and China, Jeju Island has suboptimal conditions for this species.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eModels were created based on climate modeling data for 2050 and 2070 considering RCP2.6 and RCP8.5 to assess the potential for \u003cem\u003eAe\u003c/em\u003e. \u003cem\u003elaniger\u003c/em\u003e to spread beyond its current distribution. The results of these models revealed that the suitable climate space of \u003cem\u003eAe. laniger\u003c/em\u003e could increase, extending from Taiwan to southern Myanmar and the northern regions of Thailand. These results suggest the potential for the expansion of \u003cem\u003eAe\u003c/em\u003e. \u003cem\u003elaniger\u003c/em\u003e habitat by 2050 and 2070 in response to climate change.\u003c/p\u003e \u003cp\u003eIn summary, we identified \u003cem\u003eAe\u003c/em\u003e. \u003cem\u003elaniger\u003c/em\u003e on Jeju Island through morphological and molecular analysis. Subsequently, species distribution modeling was performed under both current and future climate scenarios. The results indicate a subtle expansion of \u003cem\u003eAe\u003c/em\u003e. \u003cem\u003elaniger\u003c/em\u003e from Taiwan to the Indomalayan regions, attributed to ongoing climate changes.\u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003eNew record of a Southeast Asian mosquito species in Korea\u003c/h2\u003e \u003cp\u003eBased on the morphological identification and molecular analysis, the collected specimen was identified as \u003cem\u003eAe. laniger\u003c/em\u003e, a Southeast Asian mosquito species, representing a new record in the ROK. We readily identified the collected specimen as belonging to the subgenus \u003cem\u003eMucidus\u003c/em\u003e due to their distinctive wing pigmentations and the scaling patterns observed across their bodies. Furthermore, molecular phylogeny also supported the position of the specimens within the \u003cem\u003eMucidus\u003c/em\u003e clade, distinct from previously recorded subgenera in Korea. These results confirmed the presence of a new nonnative subgenus and species in the ROK. Thus, we report that a total of 60 species, 11 genera, and two subfamilies of mosquitoes have been recorded in the ROK.\u003c/p\u003e \u003cp\u003eThis study also suggests that even in the absence of COI sequence, commonly used as a DNA barcode, the application of multigene phylogeny could facilitate the detection of non-native species at the genus or subgenus levels for pest control purposes. Specifically, for poorly studied species with limited morphological and molecular data, the workflow used in this study enables the identification for non-native species without relying on COI sequences.\u003c/p\u003e \u003cp\u003e \u003cb\u003eInvasion pathway scenarios for\u003c/b\u003e \u003cb\u003eAe\u003c/b\u003e. \u003cb\u003elaniger\u003c/b\u003e \u003cb\u003eand their importance\u003c/b\u003e\u003c/p\u003e \u003cp\u003e \u003cem\u003eAe. laniger\u003c/em\u003e occurs in subtropical or tropical regions of Southeast Asia, Australia, and Africa; it is not native to East Asia [\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e, \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e, \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e, \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e]. For this perspective, the occurrence of \u003cem\u003eAe. laniger\u003c/em\u003e suggests that subtropical or tropical mosquitoes have the potential to expand their habitats to the ROK. In same context, it showed that more vector species, such as \u003cem\u003eAedes aegypti\u003c/em\u003e, which can transmit viruses responsible for dengue fever, Zika, and yellow fever, could invade the Korean Peninsula, increasing the risk of mosquito-borne diseases in future. Lee \u003cem\u003eet al.\u003c/em\u003e [\u003cspan citationid=\"CR98\" class=\"CitationRef\"\u003e98\u003c/span\u003e] also reported that the strain of \u003cem\u003eAe. albopictus\u003c/em\u003e on Jeju Island is genetically closely related to specimens from Southeast Asia, which have a high transmission capability for dengue fever, thereby raising concerns regarding its potential risks.\u003c/p\u003e \u003cp\u003eThe confirmation of Southeast Asian mosquito species on Jeju Island aligns with predictions reported in prior studies, as well as with reports of other non-native species. However, the results of the species distribution modeling do not indicate a strong propensity for \u003cem\u003eAe\u003c/em\u003e. \u003cem\u003elaniger\u003c/em\u003e to inhabit the Korean Peninsula; this discrepancy may be due to the lack of species occurrence data. Nevertheless, on the basis of the available data, a discernible pattern emerged, indicating that \u003cem\u003eAe. laniger\u003c/em\u003e is likely to be predominantly found in coastal areas or on islands characterized by high humidity and temperature. Given these characteristics and the recognition that Jeju Island has coastal areas with a subtropical climate, it is plausible that \u003cem\u003eAe. laniger\u003c/em\u003e could establish breeding populations on this environment.\u003c/p\u003e \u003cp\u003eFurthermore, there was a recent outbreak of love bugs, \u003cem\u003ePlecia longiforceps\u003c/em\u003e, in the ROK [\u003cspan citationid=\"CR99\" class=\"CitationRef\"\u003e99\u003c/span\u003e], and the nonnative species \u003cem\u003eA\u003c/em\u003e. \u003cem\u003ehorsfieldii\u003c/em\u003e was identified on Jeju Island in 2019 [\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]; these species are distributed mainly in southern China, Taiwan, and the Okinawa archipelago. These cases suggest the potential for provisional or temporary spread of nonnative species to the ROK. The species distribution models of \u003cem\u003eAe\u003c/em\u003e. \u003cem\u003elaniger\u003c/em\u003e revealed a range extending from southern China to Taiwan under both the current and future climate conditions. Jung \u003cem\u003eet al\u003c/em\u003e. [\u003cspan citationid=\"CR100\" class=\"CitationRef\"\u003e100\u003c/span\u003e] also suggested the potential emergence of \u003cem\u003eAe\u003c/em\u003e. \u003cem\u003eaegypti\u003c/em\u003e in the coastal areas of Jeju Island starting in 2040 due to climate change using species distribution modeling.\u003c/p\u003e \u003cp\u003eIn addition to climate factors, invasion can be influenced by \u0026lsquo;wind'. In the ROK, \u003cem\u003eNilaparvata lugens\u003c/em\u003e and \u003cem\u003eSpodoptera frugiperda\u003c/em\u003e are known to spread to the island by riding westerlies in the spring or tropical cyclones in the summer [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e, \u003cspan citationid=\"CR101\" class=\"CitationRef\"\u003e101\u003c/span\u003e, \u003cspan citationid=\"CR102\" class=\"CitationRef\"\u003e102\u003c/span\u003e]. Typhoons typically affect the Korean Peninsula to the greatest extent in July and August [\u003cspan citationid=\"CR103\" class=\"CitationRef\"\u003e103\u003c/span\u003e]. The two specimens captured in this study were collected in August, suggesting that their presence on the island may have been influenced by wind patterns in that period. Studies have shown that mosquitoes can spread through various means, including winds, airplanes, or watercraft, indicating the potential for provisional spread of the species [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eNotably, Jeju Island has also been identified as a bridgehead for the introduction of tropical or subtropical insects into the Korean Peninsula [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e, \u003cspan citationid=\"CR104\" class=\"CitationRef\"\u003e104\u003c/span\u003e, \u003cspan citationid=\"CR105\" class=\"CitationRef\"\u003e105\u003c/span\u003e]. The results of this study and those of other investigations suggest that there is potential for the continued presence of Southeast Asian mosquito species on Jeju Island in the future.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003eLimitation and future works\u003c/h2\u003e \u003cp\u003eThe species distribution models applied in this study did not yield strong predictions for \u003cem\u003eAe\u003c/em\u003e. \u003cem\u003elaniger\u003c/em\u003e to East Asia. The constraints imposed by the limited availability of occurrence data, along with the concentration of coordinates in Southeast Asia, probably led to nonsignificant outcomes [\u003cspan citationid=\"CR106\" class=\"CitationRef\"\u003e106\u003c/span\u003e, \u003cspan citationid=\"CR107\" class=\"CitationRef\"\u003e107\u003c/span\u003e]. Given the tropical and subtropical climates in Taiwan and the Okinawa archipelago, further investigations to confirm the habitat of \u003cem\u003eAe. laniger\u003c/em\u003e in these regions would enhance the resolution of our analysis.\u003c/p\u003e \u003cp\u003eThis study was confined to a limited area of Jeju Island, and further investigations across various regions are needed to expand our understanding of the broader ecological implications and potential range of \u003cem\u003eAe\u003c/em\u003e. \u003cem\u003elaniger\u003c/em\u003e. The Dongbaek-dong wetland is characterized by a distinctive hot and humid environment, with numerous swampy areas and temporary pools, consistent with the habitat characteristics of \u003cem\u003eAe. laniger\u003c/em\u003e [\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e, \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e]. The presence of this species in the Dongbaek-dong wetland suggests its potential to inhabit similar habitats on Jeju Island.\u003c/p\u003e \u003cp\u003eAdditionally, it remains unclear whether the presence of \u003cem\u003eAe. laniger\u003c/em\u003e on Jeju Island is temporary or if it has established a breeding population on the island. To determine whether permanent populations of \u003cem\u003eAe\u003c/em\u003e. \u003cem\u003elaniger\u003c/em\u003e have been established, multiyear monitoring surveys seem to be needed. Most subtropical or tropical mosquitoes face challenges in surviving cold winters; therefore, it is recommended that both adult and larval collections be conducted in subsequent monitoring surveys.\u003c/p\u003e \u003cp\u003eThe key outcome of this study is the initial identification of mosquitoes adapted to the Southeast Asian climate in the ROK. Despite the uncertainty of the vector competence of \u003cem\u003eAe. laniger\u003c/em\u003e, this finding is significant, as it indicates the potential for future occurrences of vector species capable of transmitting the viruses responsible for dengue fever and Zika virus on the Korean Peninsula.\u003c/p\u003e \u003c/div\u003e"},{"header":"Conclusion","content":"\u003cp\u003eInvasive species from tropical or subtropical regions are becoming common on Jeju Island, and the results of this study were consistent with that pattern. This study represents the initial confirmation of a Southeast Asian mosquito species in Korea and indicates the potential for the spread of other vector mosquitoes from subtropical areas in the future. The proposed workflow in this study also showed that, even without the COI sequence, detection of non-native or pest species at the genus or subgenus is possible through the application of a multigene phylogeny approach with a limited number of markers.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cp\u003eROK: Republic of Korea\u003c/p\u003e\n\u003cp\u003eSNUE: Seoul National University in the Laboratory of Evolution and Phylogenomics\u003c/p\u003e\n\u003cp\u003eCOI: Cytochrome c oxidase subunit I\u003c/p\u003e\n\u003cp\u003eITS2: Internal transcribed spacer 2\u003c/p\u003e\n\u003cp\u003eNCBI: National Center for Biotechnology Information\u003c/p\u003e\n\u003cp\u003eUTM: Universal Transverse Mercator\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe datasets produced in this study are incorporated in the article (\u003cstrong\u003eAdditional file 1\u003c/strong\u003e), and the sequences utilized have been deposited in the NCBI database.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis research was supported by the National Research Foundation of Korea (NRF) grants funded by the Korean government (MEST, No. 2019R1A6A1A10073437; MSIT, No. 2021R1C1C1003452; Comparative medicine Disease Research Center, SRC, No. 2021R1A5A1033157). This work is also supported by Seoul National University (Creative-Pioneering Researchers Program; the New Faculty Startup Fund; Laying the Groundwork for Peace and Unification, the Institute for Peace and Unification Studies, No. 3344-20230031).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor’s contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWJB designed the study and conduct as follows: collecting mosquitoes, analyzing the data, and drafted the manuscript. SA provided the collection sites in the Dongbaek-dong wetland and assisted in mosquito collection. SS assisted with analysis of the data, and revised and improved the manuscript. All authors approved the final manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe thank to the Sangjin Han and Jihoon Kim for providing guidance and technical assistance for taxonomic studies, and Heungmin Kim for helping us collecting the mosquitoes. Special thanks to Liam G. Wolff, a researcher at the Harte Research Institute for Gulf of Mexico Studies, Texas A\u0026amp;M University-Corpus Christi, for providing guidance on identifying mosquito species, and to Do-yoon Kim for his assistance in revising the figures for this paper. The authors also would like to express our gratitude to officials who granted permission for specimen collections in the Dongbaek-dong wetland.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors’ information\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003csup\u003e1\u003c/sup\u003eSchool of Biological Sciences, Seoul National University, Seoul 08826, Republic of Korea (Woo Jun Bang, Seunggwan Shin)\u003c/p\u003e\n\u003cp\u003e\u003csup\u003e2\u003c/sup\u003eComparative Medicine Disease Research Center, Seoul National University, Seoul 08826, Republic of Korea (Woo Jun Bang, Seunggwan Shin)\u003c/p\u003e\n\u003cp\u003e\u003csup\u003e3\u003c/sup\u003eWarm Temperate and Subtropical Forest Research Center, National Institute of Forest Science, Jeju 63582,Republic of Korea (Ara Seol)\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eClements AN. Biology of mosquitoes: transmission of viruses and interactions with bacteria, vol. 3. Wallingford: CABI Publishing; 2012.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWorld Health Organization. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.who.int/en/news-room/fact-sheets/detail/vector-borne-diseases\u003c/span\u003e\u003cspan address=\"https://www.who.int/en/news-room/fact-sheets/detail/vector-borne-diseases\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Accessed 5 October, 2023.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eReiter P, Sprenger D. The used tire trade: a mechanism for the worldwide dispersal of container breeding mosquitoes. J Am Mosq Control Assoc. 1987;3:494\u0026ndash;501.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMouchet J, Giacomini T, Julvez J. Human diffusion of arthropod disease vectors throughout the world. Cahiers Sant\u0026eacute;. 1995;5:293\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eReiter P. Climate change and mosquito-borne disease. Environ Health Perspect. 2001;109:141\u0026ndash;61.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eReiter P. Yellow fever and dengue: a threat to Europe?. Euro Surveill. 2010;15:pii\u0026thinsp;=\u0026thinsp;19509.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGratz NG. Critical review of the vector status of \u003cem\u003eAedes albopictus\u003c/em\u003e. Med Vet Entomol. 2004;18:215\u0026ndash;27.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMedlock JM, Hansford KM, Schaffner F, Versteirt V, Hendrickx G, Zeller H, et al. A review of the invasive mosquitoes in Europe: Ecology, public health risks, and control options. Vector-Borne Zoonotic Dis. 2012;12:435\u0026ndash;47.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eISSG. Global Invasive species database \u0026ndash; \u003cem\u003eAedes\u003c/em\u003e. The Invasive Species Specialist Group. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://www.iucngisd.org/gisd/search.php\u003c/span\u003e\u003cspan address=\"http://www.iucngisd.org/gisd/search.php\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Accessed 5 October, 2023.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLwande OW, Obanda V, Lindstr\u0026ouml;m A, Ahlm C, Evander M, N\u0026auml;slund J, et al. Globe-Trotting \u003cem\u003eAedes aegypti\u003c/em\u003e and \u003cem\u003eAedes albopictus\u003c/em\u003e: Risk Factors for Arbovirus Pandemics. Vector-Borne Zoonotic Dis. 2020;20:71\u0026ndash;81.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePeyton EL, Campbell SR, Candeletti TM, Romanowski M, Crans WJ. \u003cem\u003eAedes\u003c/em\u003e (\u003cem\u003eFinlaya\u003c/em\u003e) \u003cem\u003ejaponicus japonicus\u003c/em\u003e (Theobald), a new introduction into the United States. J Am Mosq Control Assoc. 1999;15:238\u0026ndash;241.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFalco RC, Daniels TJ, Slamecka MC. Prevalence and distribution of \u003cem\u003eOchlerotatus japonicus\u003c/em\u003e (Diptera: Culicidae) in two counties in Southern New York State. J Med Entomol. 2002;39:920\u0026ndash;5.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCapelli G, Drago A, Martini S, Montarsi F, Soppelsa M, Delai N, et al. First report in Italy of the exotic mosquito species \u003cem\u003eAedes\u003c/em\u003e (\u003cem\u003eFinlaya\u003c/em\u003e) \u003cem\u003ekoreicus\u003c/em\u003e, a potential vector of arboviruses and filariae. Parasit Vectors. 2011;4:1\u0026ndash;5.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVersteirt V, Pecor JE, Fonseca DM, Coosemans M, Van Bortel W. Confirmation of \u003cem\u003eAedes koreicus\u003c/em\u003e (Diptera:Culicidae) in Belgium and description of morphological differences between Korean and Belgian specimens validated by molecular identification. Zootaxa. 2012;32:21\u0026ndash;32.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHuber K, Pluskota B, J\u0026ouml;st A, Hoffmann K, Becker N. Status of the invasive species \u003cem\u003eAedes japonicus japonicus\u003c/em\u003e (Diptera: Culicidae) in southwest Germany in 2011. J Vector Ecol.2012;37:462\u0026ndash;5.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKampen H, Werner D. Out of the bush: the Asian bush mosquito \u003cem\u003eAedes japonicus japonicus\u003c/em\u003e (Theobald, 1901) (Dipter, Culicidae) becomes invasive. Parasit Vectors. 2014;7:59.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRiles MT, Smith JP, Burkett-Cadena N, Connelly CR, Morse GW, Byrd BD. First Record of \u003cem\u003eAedes japonicus\u003c/em\u003e in Florida. J Am Mosq Control Assoc. 2017;33:340\u0026ndash;4.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMontarsi F, Martini S, Michelutti A, Da Rold G, Mazzucato M, Qualizza D, et al. The invasive mosquito \u003cem\u003eAedes japonicus japonicus\u003c/em\u003e is spreading in northeastern Italy. Parasit Vectors 2019;12:1\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBallardini M, Ferretti S, Chiaranz G, Pautasso A, Riina MV, Triglia G, et al. First report of the invasive mosquito \u003cem\u003eAedes koreicus\u003c/em\u003e (Diptera: Culicidae) and of its establishment in Liguria, northwest Italy. Parasit Vectors. 2019;12:334.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVojt\u0026iacute;šek J, Janssen N, Šikutov\u0026aacute; S, Šebesta O, Kampen H, Rudolf I. Emergence of the invasive Asian bush mosquito \u003cem\u003eAedes\u003c/em\u003e (\u003cem\u003eHulecoeteomyia\u003c/em\u003e) \u003cem\u003ejaponicus\u003c/em\u003e (Theobald, 1901) in the Czech Republic. Parasit Vectors. 2022;15:250.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTeekema S, Stroo A, Uiterwijk M, van de Vossenberg B, Jacobs F, Ib\u0026aacute;\u0026ntilde;ez-Justicia A. First finding of \u003cem\u003eAedes koreicus\u003c/em\u003e (Diptera: Culicidae) in the Netherlands. JEMCA. 2022;40:3\u0026ndash;9\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eIb\u0026aacute;\u0026ntilde;ez-Justicia A, van de Vossenberg B, van den Biggelaar R, Voogd J, Metz E, Jacobs F, et al. Detection of \u003cem\u003eAedes flavopictus\u003c/em\u003e (Yamada, 1921), netherlands, June 2019. Euro Surveill. 2019;24:1900433.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRodhain F, Problems posed by the spread of \u003cem\u003eAedes albopictus\u003c/em\u003e. Bull Soc Pathol Exot.1996;89(2):137\u0026ndash;40.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGratz NG, Steffen R, Cocksedge W. Why aircraft disinsection?. Bull World Health Organ. 2000;78:995\u0026ndash;1004.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLessard BD, Kurucz N, Rodriguez J, Carter J, Hardy CM. Detection of the Japanese encephalitis vector mosquito \u003cem\u003eCulex tritaeniorhynchus\u003c/em\u003e in Australia using molecular diagnostics and morphology. Parasit Vectors. 2021;14:411.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBhatt S, Gething PW, Brady OJ, Messina JP, Farlow AW, Moyes CL, et al. The global distribution and burden of dengue. Nature; 2013;496:504\u0026ndash;7.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSrisawat R, Phanitchat T, Komalamisra N, Tamori N, Runtuwene L, Noguchi K, et al. Susceptibility of \u003cem\u003eAedes flavopictus miyarai\u003c/em\u003e and \u003cem\u003eAedes galloisi\u003c/em\u003e mosquito species in Japan to dengue type 2 virus. Asian Pac J Trop Biomed. 2016;6:446\u0026ndash;50.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKilleen GF, Fillinger U, Kiche I, Gouagna LC, Knols BG. Eradication of \u003cem\u003eAnopheles gambiae\u003c/em\u003e from Brazil: lessons for malaria control in Africa?. Lancet Infect Dis. 2002;10:618\u0026ndash;27.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHan HY. 2021. Diptera. In: Park JK, Lee JE., et al., editors. Check list of Insects from Korea. Korean Society of Applied Entomology \u0026amp; The Entomological Society of Korea. Daegu: Paper and Pencil, 391\u0026ndash;483.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLee DK. Ecological characteristics and current status of infectious disease vectors in South Korea. J Korean Med Assoc. 2017;60:458\u0026ndash;67.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDengue: Guidelines for diagnosis, treatment, prevention and control-new edition. Geneva. World Health Organization. 2009. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.who.int/publications/i/item/9789241547871\u003c/span\u003e\u003cspan address=\"https://www.who.int/publications/i/item/9789241547871\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Accessed 5 October, 2023\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKhormi HM, Kumar L. Future malaria spatial pattern based on the potential global warming impact in South and Southeast Asia. Geospat Health. 2016;11:416.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLee JS, Farlow A. The threat of climate change to non-dengue-endemic countries: increasing risk of dengue transmission potential using climate and non-climate datasets. BMC Public Health. 2019;19:934.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMinistry of Environment of Republic of Korea. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://m.me.go.kr/\u003c/span\u003e\u003cspan address=\"http://m.me.go.kr/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Accessed 5 October, 2023.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBeck HE, Zimmermann NE, McVicar TR, Vergopolan N, Berg A, Wood EF. Present and future K\u0026ouml;ppen-Geiger climate classification maps at 1-km resolution. Sci Data. 2018;5:180214.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLee S, Choi J, Jand H, Choi W, Kwon W, Kim D, et al. Establishment of non-native \u003cem\u003eAnoplophora horsfieldii\u003c/em\u003e (Coleoptera: Cerambycidae) in South Korea. J. Integr. Pest Manag. 2023;14:9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLee GS, Seo BY, Lee J, Kim H, Song JH, Lee W. First Report of the Fall Armyworm, \u003cem\u003eSpodoptera frugiperda\u003c/em\u003e (Smith, 1797) (Lepidoptera, Noctuidae), a New Migratory Pest in Korea. Korean J. Appl. Entomol. 2020;59:73\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTanaka K, Mizusawa K, Saugstad ES, et al. A Revision of the adult and larval mosquitoes of Japan (including the Ryukyu Archipelago and the Ogasawara islands) and Korea (Diptera: Culicidae). Contrib Am Entomol Inst, U.S.A. 1979;16:1\u0026ndash;987.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRee HI. Taxonomic Review and Revised Keys of the Korean Mosquitoes (Diptera: Culicidae). Entomol Res. 2003;33:39\u0026ndash;52.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRattanarithikul R, Harbach RE, Harrison BA, Panthusiri P, Coleman RE, Richardson JH. Illustrated keys to the mosquitoes of Thailand. VI. Tribe Aedini. Southeast Asian J Trop Med Public Health. 2010;41 Suppl 1:1\u0026ndash;225.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTyson WH. Contributions to the Mosquito Fauna of Southeast Asia. VIII. Genus \u003cem\u003eAedes\u003c/em\u003e, Subgenus \u003cem\u003eMucidus\u003c/em\u003e Theobald in Southeast Asia. Contrib Am Entomol Inst, U.S.A. 1970;6:28\u0026ndash;80.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMattingly PF. The culicine mosquitoes of the Indomalayan Area. Part V: Genus \u003cem\u003eAedes\u003c/em\u003e Meigen, subgenera \u003cem\u003eMucidus\u003c/em\u003e Theobald, \u003cem\u003eOchlerotatus\u003c/em\u003e Lynch Arribalzaga and \u003cem\u003eNeomelaniconion\u003c/em\u003e Newstead. Brit Mus Nat Hist London, UK. 1961\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHarbach RE, Knight KL. Taxonomists\u0026rsquo; glossary of mosquito anatomy, annotated with corrections and additions Plexus Publishing Inc. Marlton, New Jersey. 2021.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHall, T.A. BioEdit: A User-Friendly Biological Sequence Alignment Editor and Analysis Program for Windows 95/98/NT. Nucleic Acids Symposium Series. 1999;41:95\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKatoh K, Standley DM. MAFFT multiple sequence alignment software version 7: improvements in performance and usability. Mol Biol Evol. 2013;30:772\u0026ndash;80.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLarsson A. AliView: a fast and lightweight alignment viewer and editor for large datasets. Bioinformatics. 2014;30:3276\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eK\u0026uuml;ck P, Longo GC. FASconCAT-G: extensive functions for multiple sequence alignment preparations concerning phylogenetic studies. Front Zool. 2014;11:81.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLanfear R, Frandsen PB, Wright AM, Senfeld T, Calcott B. PartitionFinder 2: New Methods for Selecting Partitioned Models of Evolution for Molecular and Morphological Phylogenetic Analyses. Mol Biol Evol. 2017;34:772\u0026ndash;3.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHoang DT, Chernomor O, von Haeseler A, Minh BQ, Vinh LS. UFBoot2: Improving the Ultrafast Bootstrap Approximation. Mol Biol Evol. 2018;35:518\u0026ndash;22.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMinh BQ, Schmidt HA, Chernomor O, et al. IQ-TREE 2: New Models and Efficient Methods for Phylogenetic Inference in the Genomic Era. Mol Biol Evol. 2020;37:1530\u0026ndash;4.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGuindon S, Dufayard JF, Lefort V, Anisimova M, Hordijk W, Gascuel O. New algorithms and methods to estimate maximum-likelihood phylogenies: assessing the performance of PhyML 3.0. Syst Biol. 2010;59:307\u0026ndash;21.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eReinert JF, Harbach RE, Kitching IJ. Phylogeny and classification of \u003cem\u003eOchlerotatus\u003c/em\u003e and allied taxa (Diptera: Culicidae: Aedini) based on morphological data from all life stages. Zool. J. Linn. Soc. 2008;153:29\u0026ndash;114.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eReinert JF, Harbach RE, Kitching IJ. Phylogeny and classification of tribe Aedini (Diptera: Culicidae). Zool. J. Linn. Soc. 2009;157:700\u0026ndash;94.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eReidenbach KR, Cook S, Bertone MA, Harbach RE, Wiegmann BM, Besansky NJ. Phylogenetic analysis and temporal diversification of mosquitoes (Diptera: Culicidae) based on nuclear genes and morphology. BMC Evol Biol. 2009;9:298.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSoghigian J, Sither C, Justi SA, Morinaga G, Cassel BK, Vitek CJ, et al. Phylogenomics reveals the history of host use in mosquitoes. Nat. Commun. 2023;14:6252.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLetunic I, Bork P. Interactive Tree Of Life (iTOL) v5: an online tool for phylogenetic tree display and annotation. Nucleic Acids Res. 2021;49(W1):W293\u0026ndash;6.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWiedemann, C.R.G. Diptera exotica. Sectio I. antennis multiarticulatis. 1820;1:244 pp.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEdwards, F. W. New Synonymy in oriental Culicidae. Bull. ent. Res. 1913;IV: 221\u0026ndash;42.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRadda AC, Auer H, Escalona TG, Hartnett I, Asp\u0026ouml;ck H. Seroepidemiological Studies in Oriental Mindoro (Philippines) - Prevalence of Mosquito-borne Parasitoses. Mitt. \u0026Ouml;sterr. Ges. Tropenmed. Parasitol. 1995;17:159\u0026ndash;68\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGama ZP, Nakagoshi N, Islamiyah M. Distribution patterns and relationship between elevation and the abundance of \u003cem\u003eAedes aegypti\u003c/em\u003e in Mojokerto city 2012. Open J. Anim. Sci. 2013;3:11\u0026ndash;6\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGBIF: Global Biodiversity Information Facility. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.gbif.org/species/1651940\u003c/span\u003e\u003cspan address=\"https://www.gbif.org/species/1651940\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Accessed on 12 October 2023.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eiNat: iNaturalist. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.inaturalist.org/observations?taxon_id=1144437\u003c/span\u003e\u003cspan address=\"https://www.inaturalist.org/observations?taxon_id=1144437\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Accessed on 14 October 2023\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eThuiller W, Lafourcade B, Engler R, Ara\u0026uacute;jo MB. BIOMOD \u0026ndash; a platform for ensemble forecasting of species distributions. Ecography. 2009;32:369\u0026ndash;73\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eThuiller W, Georges D, Gueguen M, Engler R, Breiner F, Lafourcade B, Patin R. Biomod2: Ensemble Platform for Species Distribution Modeling. 2023. R package version 4.2-5.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHijmans, R.J. Raster: Geographic Data Analysis and Modeling. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://cran.rproject.org/web/packages/raster/index.html\u003c/span\u003e\u003cspan address=\"https://cran.rproject.org/web/packages/raster/index.html\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. 2023. R package version 3.6\u0026ndash;23\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBivand R, Rundel C. rgeos: Interface to Geometry Engine. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://rgeos.r-forge.r-project.org/index.html\u003c/span\u003e\u003cspan address=\"http://rgeos.r-forge.r-project.org/index.html\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. 2023. R package version 0.6-4.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBivand R, Keitt T, Rowlingson B. rgdal: Bindings for the 'Geospatial' Data Abstraction Library. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://r-forge.r-project.org/projects/rgdal/\u003c/span\u003e\u003cspan address=\"https://r-forge.r-project.org/projects/rgdal/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. 2023. R package version 1.6-7.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePhillips SJ, Anderson RP, Schapire RE. Maximum entropy modeling of species geographic distributions. Ecol Modell. 2006;190:231\u0026ndash;59\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChangjun G, Yanli T, Linshan L, Bo W, Yili Z, Haibin Y, et al. Predicting the potential global distribution of \u003cem\u003eAgeratina adenophora\u003c/em\u003e under current and future climate change scenarios. Ecol Evol. 2021;11:12092\u0026ndash;113.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHao T, Elith J, Guillera-Arroita G, JJ Lahoz‐Monfort. A review of evidence about use and performance of species distribution modelling ensembles like BIOMOD. Divers. Distrib. 2019;25:839\u0026ndash;52\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKim S, de Medeiros BAS, Byun BK, Lee S, Kang JH, Lee B, et al. West meets East: How do rainforest beetles become circum-Pacific? Evolutionary origin of \u003cem\u003eCallipogon relictus\u003c/em\u003e and allied species (Cerambycidae: Prioninae) in the New and Old Worlds. Mol Phylogenet Evol. 2018;125:163\u0026ndash;76.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMeigen JW. Systematische Beschreibung der bekannten europ\u0026auml;ischen zweifl\u0026uuml;geligen Insekten. \u003cem\u003eAachen\u003c/em\u003e. 1818;1: xxxvi\u0026thinsp;+\u0026thinsp;1, 332 pp.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTheobald FV. A monograph of the Culicidae or mosquitoes. British Museum. 1901;1:424 pp.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBarraud PJ. A revision of the Culicine mosquitoes of India. XXV. The genera \u003cem\u003eMucidus\u003c/em\u003e, \u003cem\u003eMimomyia\u003c/em\u003e, \u003cem\u003eFicalbia\u003c/em\u003e, \u003cem\u003eRachionotomyia\u003c/em\u003e, and \u003cem\u003eHodgesia\u003c/em\u003e. Indian J. med. Res. 1929;16:1052\u0026ndash;63.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBrug SL, Edwards FW. Fauna Sumatrensis. (Bijdrage Nr. 68), Culicidae (Diptera). Tijdschr. Ent. 1931;74:251\u0026ndash;61.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eReinert JF, Harbach RE, Kitching IJ. Phylogeny and classification of Aedini (Diptera: Culicidae), based on morphological characters of all life stages. Zool. J. Linn. Soc. 2004;142:289\u0026ndash;368.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eReinert JF, Harbach RE, Kitching IJ. Phylogeny and classification of \u003cem\u003eFinlaya\u003c/em\u003e and allied taxa (Diptera: Culicidae: Aedini) based on morphological data from all life stages. Zool. J. Linn. Soc. 2006;148:1\u0026ndash;101.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBanks CS. A List of Philippine Culicidae with descriptions of some new species. Philipp J. Sci. 1906;1:977\u0026ndash;1005\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLeicester GF. The Culicidae of \u003cem\u003eMalaya\u003c/em\u003e. Studies Inst. Med. Res. Federated Malay States. 1908;3:18\u0026ndash;261\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBrunetti E. Annotated Catalogue of Oriental Culicidae\u0026ndash;Supplement. Rec. Indian Museum. 1912;4:403\u0026ndash;517.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBarraud PJ. The fauna of British India, including Ceylon and Burma. Diptera. Volume V. Family Culicidae. Tribes Megarhinini and Culicini. Taylor and Francis. 1934:463 pp.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBohart RM. A synopsis of the Philippine mosquitoes. U.S. NavMed. 1945;580:88 pp.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKnight KL. The \u003cem\u003eAedes\u003c/em\u003e (\u003cem\u003eMucidus\u003c/em\u003e) mosquitoes of the Pacific (Diptera; Culicidae). J Wash Acad Sci. 1947;37:315\u0026ndash;25.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKnight K, Hull W. The \u003cem\u003eAedes\u003c/em\u003e Mosquitoes of the Philippine Islands. I Keys to Species. Subgenera \u003cem\u003eMucidus\u003c/em\u003e, \u003cem\u003eOchlerotatus\u003c/em\u003e, and \u003cem\u003eFinlaya\u003c/em\u003e (Diptera, Culicidae). Pac. Sci. 1951;5:211\u0026ndash;51.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBonne-Wepster J. Synopsis of a hundred common non-anopheline mosquitoes of the Greater and Lesser Sundas, the Moluccas and New Guinea. Roy. trop. Inst. Armst. Spec. Pub. III. 1954:147 pp.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWilkerson RC, Linton YM, Fonseca DM, Schultz TR, Price DC, Strickman DA. Making Mosquito Taxonomy Useful: A Stable Classification of Tribe Aedini that Balances Utility with Current Knowledge of Evolutionary Relationships. PLoS One. 2015;10:e0133602.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOh IS, Bin SD, Yu YH. Mosquitoes on Cheju-do. New Med. 1961;4: 83\u0026ndash;86.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChun SR. A preliminary survey of mosquito of Cheju-Do. -related to filariasis on species, biology and infection status. Korean J. Pubulic Heath. 1968;5:113\u0026ndash;21.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLien JC. Preliminary observations on the mosquitoes of Korea and recommendations developed for the WHO Japanese Encephalitis Vector Research Unit. WHO/VBC/69.175, 1969:31 pp.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBarrett JE. Annual mosquito report, 1969-with summary eighth year mosquito survey. 5th Preventive Medicine Unit, U.S.Army. 1969:48 pp.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLee KW. Systematic survey of mosquitoes (Culicidae; Diptera) on Cheju Island. Korean J. Entomol. 1994; 24:253\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKo YG. Studies in vector species of Japanese encephalitis, \u003cem\u003eCulex tritaeniorhynchus\u003c/em\u003e (Diptera: Culicidae) in Cheju Island. Incheon University PhD. Thesis.1996:78 pp.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKim HC, Wilkerson RC, Pecor JE, Lee WJ, Lee JS, O\u0026rsquo;Guinn ML, et al. New records and reference collection of mosquitoes (Diptera: Culicidae) on Jeju Island, Republic of Korea. Entomol Res. 2005;35:55\u0026ndash;66.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSeo MY, Chung KA. Density and Distribution of the Mosquito Population Inhabiting Jeju Region, 2018. Korean J Clin Lab Sci. 2019;51:336\u0026ndash;43.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChatterjee S, Kim CM, Yun NR, Kim DM, Song HJ, Chung KA. Molecular detection and identification of \u003cem\u003eCulex\u003c/em\u003e flavivirus in mosquito species from Jeju, Republic of Korea. Virol J. 2021;18:150.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSeo MG, Lee HS, Yang SC, Noh BE, Kim TK, Lee WG et al. National Monitoring of Mosquito Populations and Molecular Analysis of Flavivirus in the Republic of Korea in 2020. Microorganisms. 2021;9:2085.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSoghigian J, Andreadis TG, Livdahl TP. From ground pools to treeholes: convergent evolution of habitat and phenotype in \u003cem\u003eAedes\u003c/em\u003e mosquitoes. BMC Evol Biol. 2017;17:262.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLee SH, Nam KW, Jeong JY, Yoo SJ, Koh YS, Lee S, et al. The effects of climate change and globalization on mosquito vectors: evidence from Jeju island, South Korea on the potential for Asian tiger mosquito (\u003cem\u003eAedes albopictus\u003c/em\u003e) influxes and survival from Vietnam rather than Japan. PLoS one. 2013;8:e68512.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKim S, Jung S, Choi J, Tsai C, Farrell BD, Shin S. History Does Not Repeat Itself; It Rhymes: Range Expansion and Outbreak of Plecia longiforceps (Diptera: Bibionidae) in East Asia. J. Integr. Pest Manag. 2022;13:1\u0026ndash;6\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJung JM, Lee JW, Kim C, Jung S, Lee WH. CLIMEX-based Analysis of Potential Geographical Distribution of \u003cem\u003eAedes albopictus\u003c/em\u003e and \u003cem\u003eAedes aegypti\u003c/em\u003e in South Korea. J. of Biosystems Eng. 2017. 42:217\u0026ndash;26.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKim YW, Choi SY, Park JS. Studies on the Mechanism of Varietal Resistance of Rice to the Brown Planthopper (\u003cem\u003eNilaparvata Lugens\u003c/em\u003e STAL). Kor. J. Plant Prot. 1985;24:51\u0026ndash;60.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWu MF, Qi GJ, Chen H, Ma J, Liu J, Jiang YY, et al. Overseas immigration of fall armyworm, \u003cem\u003eSpodoptera frugiperda\u003c/em\u003e (Lepidoptera: Noctuidae), invading Korea and Japan in 2019. Insect Sci. 2022;29:505\u0026ndash;20\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKorea Meteorological Administration, \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.weather.go.kr/w/typhoon/typ-stat.do\u003c/span\u003e\u003cspan address=\"https://www.weather.go.kr/w/typhoon/typ-stat.do\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Accessed on 27, November, 2023.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAhn S. New pests of the greenhouse, western flower thrips and melon thrips first discovered last year, crisis of nationwide spread urgent need to develop applied drugs and control systems. Agric. Inf. 1994;15:38\u0026ndash;41.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRitchie SA, Rochester W. Wind-blown mosquitoes and introduction of Japanese encephalitis into Australia. Emerg Infect Dis. 2001;7:900\u0026ndash;903.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHernandez PA, Graham CH, Master LL, Albert DL. The effect of sample size and species characteristics on performance of different species distribution modeling methods. Ecography. 2006;29:773\u0026ndash;85.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFernandes RF, Scherrer D, Guisan A. Effects of simulated observation errors on the performance of species distribution models. Divers. Distrib. 2018;25:400\u0026ndash;13.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"parasites-and-vectors","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"parv","sideBox":"Learn more about [Parasites \u0026 Vectors](http://parasitesandvectors.biomedcentral.com/)","snPcode":"13071","submissionUrl":"https://submission.nature.com/new-submission/13071/3","title":"Parasites \u0026 Vectors","twitterHandle":"@bugbittentweets","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Aedes laniger, Culicidae, non-native mosquito, Jeju Island, species distribution modelling","lastPublishedDoi":"10.21203/rs.3.rs-3974400/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-3974400/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBackground\u003c/h2\u003e \u003cp\u003eMosquitoes are dominant vectors worldwide and transmit infectious diseases. The expansion of mosquito habitats due to climate change and increased human activities poses a significant health threat by facilitating the spread of various non-native infectious diseases. This study focused on the detection of the Southeast Asian mosquito species, \u003cem\u003eAedes laniger\u003c/em\u003e on Jeju Island, the southernmost region of the Republic of Korea (ROK), highlighting the potential risks associated with the spread of vector-borne diseases, particularly emphasizing the elevated likelihood of invasion by Southeast Asian mosquitoes.\u003c/p\u003e\u003ch2\u003eMethods\u003c/h2\u003e \u003cp\u003eField surveys were conducted in August 2023 on Jeju Island. Adult mosquitoes were collected using BG-sentinel traps and identified to the species level using taxonomic keys. Morphological and molecular analyses were employed to confirm species designations. Molecular data, including mitochondrial and nuclear genes, were used for phylogenetic analysis, which was performed to compare and identify among recorded subgenera in ROK. Species distribution modeling for \u003cem\u003eAe\u003c/em\u003e. \u003cem\u003elaniger\u003c/em\u003e was performed to predict potential habitats using R package \u0026lsquo;BIOMOD2\u0026rsquo;.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e \u003cp\u003eThe two specimens of \u003cem\u003eAedes laniger\u003c/em\u003e were collected for the first time on Jeju Island. Morphological and molecular analyses confirmed the identity of this species within the subgenus \u003cem\u003eMucidus\u003c/em\u003e and validated the first record of this species in the ROK. We employed a simple multigene phylogenetic analysis to confirm a new mosquito record at the genus and subgenus levels, finally validating the consistency between morphological identification and molecular phylogenetic outcomes. Furthermore, we have updated the taxonomic keys for the genus \u003cem\u003eAedes\u003c/em\u003e in the ROK, and revised mosquito lists for Jeju Island, incorporating the inclusion of \u003cem\u003eAe\u003c/em\u003e. \u003cem\u003elaniger\u003c/em\u003e. On the basis of species distribution modeling, the area of suitable habitat for \u003cem\u003eAe\u003c/em\u003e. \u003cem\u003elaniger\u003c/em\u003e is expected to expand due to climate change, but this change did not appear to be meaningful in East Asia.\u003c/p\u003e\u003ch2\u003eConclusion\u003c/h2\u003e \u003cp\u003eThis case offers the first report of the Southeast Asian mosquito, \u003cem\u003eAe\u003c/em\u003e. \u003cem\u003elaniger\u003c/em\u003e, in the ROK. The detection of this species on Jeju Island suggests the potential establishment of a breeding population their habitat and raises concerns about further expansion into the Korean Peninsula. Considering the annual occurrence of mosquito-borne disease cases in the Southeast Asia, it is essential to conduct monitoring not only in Jeju Island, where \u003cem\u003eAe\u003c/em\u003e. \u003cem\u003elaniger\u003c/em\u003e has been identified, but also across the entire Korean Peninsula.\u003c/p\u003e","manuscriptTitle":"Insights from Multigene Analysis: First Report of a Southeast Asian Mosquito, Aedes (Mucidus) laniger (Diptera: Culicidae) from Korea","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-02-23 18:32:10","doi":"10.21203/rs.3.rs-3974400/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2024-03-17T12:41:12+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-03-07T07:31:18+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"18be38a9-eae9-4d6c-8e17-e917b73c87fe","date":"2024-02-23T00:44:04+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2024-02-22T13:04:27+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-02-21T16:38:34+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2024-02-21T16:31:52+00:00","index":"","fulltext":""},{"type":"submitted","content":"Parasites \u0026 Vectors","date":"2024-02-21T03:28:32+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"parasites-and-vectors","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"parv","sideBox":"Learn more about [Parasites \u0026 Vectors](http://parasitesandvectors.biomedcentral.com/)","snPcode":"13071","submissionUrl":"https://submission.nature.com/new-submission/13071/3","title":"Parasites \u0026 Vectors","twitterHandle":"@bugbittentweets","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"d6966df9-24e1-407f-a7f8-ff955d5380bd","owner":[],"postedDate":"February 23rd, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2024-09-16T16:02:27+00:00","versionOfRecord":{"articleIdentity":"rs-3974400","link":"https://doi.org/10.1186/s13071-024-06373-8","journal":{"identity":"parasites-and-vectors","isVorOnly":false,"title":"Parasites \u0026 Vectors"},"publishedOn":"2024-09-12 15:57:40","publishedOnDateReadable":"September 12th, 2024"},"versionCreatedAt":"2024-02-23 18:32:10","video":"","vorDoi":"10.1186/s13071-024-06373-8","vorDoiUrl":"https://doi.org/10.1186/s13071-024-06373-8","workflowStages":[]},"version":"v1","identity":"rs-3974400","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-3974400","identity":"rs-3974400","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}