Rehydration rescues Il22-/- mice from lethal Citrobacter rodentium infection

preprint OA: gold CC-BY-4.0
📄 Open PDF Full text JSON View at publisher
Full text 143,825 characters · extracted from preprint-html · click to expand
Rehydration rescues Il22-/- mice from lethal Citrobacter rodentium infection | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Rehydration rescues Il22-/- mice from lethal Citrobacter rodentium infection Gad Frankel, Vishwas Mishra, Priyanka Biswas, Joshua Wong, Zuza Kozik, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6122641/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 08 Dec, 2025 Read the published version in Nature Communications → Version 1 posted You are reading this latest preprint version Abstract Interleukin-22 (IL-22) is considered indispensable for host defence against Citrobacter rodentium (CR), with 100% mortality of Il22 −/− mice post infection. While IL-22 promotes epithelial barrier integrity and antimicrobial peptide production, the precise mechanism underlying Il22 −/− lethality remains unclear. Here, we show that Il22 −/− mice succumb to CR infection due to dehydration rather than uncontrolled bacterial burden or inability to regenerate intestinal epithelium. Proteomic analysis at 9 days post infection (dpi) revealed significant downregulation of ion transporters (Slc26a3, Aqp8, Ca2, Ca4, Slc5a8, Slc15a1) in Il22 −/− colonic epithelial cells, suggesting an association between IL-22 deficiency and impaired fluid-electrolyte balance. Fluid therapy (FT), initiated at 5 dpi and lasted for 2 weeks, fully rescued Il22 −/− mice, restoring survival without affecting bacterial burden, immune responses, or epithelial integrity. Recovered Il22 −/− mice exhibited epithelial regeneration and protection against reinfection, demonstrating that IL-22-independent pathways support long-term mucosal recovery. These findings overturn the long-standing paradigm that IL-22 is indispensable for host survival from CR infection, revealing that dehydration is the primary cause of mortality. Importantly, this study underscores the necessity of incorporating supportive therapies into preclinical infection models to better reflect physiological conditions and enhance translational relevance. Biological sciences/Microbiology/Bacteria/Bacterial host response Biological sciences/Immunology/Infectious diseases/Bacterial infection Biological sciences/Immunology/Infection Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Significance Statement IL-22 is considered essential for host survival during C. rodentium infection, yet the cause of mortality was inconclusive. Here, we show that Il22 -/- mice succumb due to dehydration, and that Fluid therapy prevents mortality, revealing IL-22-independent recovery mechanisms. These findings overturn the prevailing paradigm that IL-22 is indispensable for host survival, redefining its role in mucosal immunity. Introduction Citrobacter rodentium (CR) is the aetiological agent of transmissible murine colonic crypt hyperplasia 1 . CR is an extracellular Gram-negative mouse-specific pathogen; it causes self-limiting infection in C57BL/6 mice, which develop colitis and mild diarrhoea 2 . Infection of mice with CR serves as a robust preclinical model for studying enteric infections (e.g. pathogenic E. coli ), colitis and gut recovery following epithelial damage 2 – 4 . CR infection disrupts intestinal homeostasis by subverting signalling in intestinal epithelial cells (IECs), compromising barrier integrity, and inducing inflammatory responses 1 , 2 , 4 . Host defence mechanisms against CR rely on type 3 immunity, characterised by production of interleukin (IL)-17 and IL-22, which plays a critical role in mucosal immunity 5 – 8 . Perturbation of the gut barrier, either chemically via dextran sulphate sodium (DSS) or by CR, Salmonella Typhimurium , or Clostridioides difficile infection, triggers secretion of IL-22 9–11 . IL-22, a member of the IL-10 family of cytokines, is produced primarily by group 3 innate lymphoid cells (ILC3s) and Th17/Th22 cells 8 , 10 , 12 . ILC3s serve as the primary source of IL-22 during the early phase of CR infection where it targets superficial IECs 6 . Recent findings showed that a brief ciprofloxacin treatment administered 4 days post infection (dpi) induces persistent ILC3 activation 13 . These "trained" ILC3s exhibit an enhanced capacity to produce IL-22, conferring greater protection against subsequent infections 8 , 13 . As the infection burden increases and CR colonizes a large surface of the colonic mucosa, IL-22 production shifts from ILC3s to CD4 + T cells. CD4 + T cell-derived IL-22 plays a crucial role in preventing bacterial invasion of colonic crypts and limiting systemic dissemination 6 , 7 . IL-22 exerts its effects on IECs through binding to the IL-22 receptor, composed of an IL-22R1 and IL-10R2 heterodimer 10 , 14 . Binding to the IL-22R triggers activation of the Jak kinase Stat transcription factor pathway, predominantly Jak1, Tyk2 and STAT3 8,10,15 . Upon phosphorylation, STAT3 dimers translocate to the nucleus where they function as transcriptional activators, regulating expression of antimicrobial proteins (AMPs) and multiple cellular functions, including chemotaxis, proliferation, acute-phase responses, innate immunity, inflammation and tissue healing 10 , 12 . Amongst the STAT3 regulated proteins are calprotectin (S100A8/S100A9 heterodimer) 16 , a metal (Mn- and Zn)-sequestering complex, LCN-2 17 , which inhibits bacterial growth by sequestering the siderophore enterobactin, and Reg family of AMPs 18 . The IL-22-STAT3 axis enhances epithelial barrier integrity by upregulating tight junction proteins (e.g., claudins and occludins) and mucins (e.g., MUC1 and MUC2) 10 , 12 . Expression of claudins, calprotectin, LCN-2 and Reg3g are detected as early as 2- to 4-days post infection (dpi) during the CR infection cycle 19 , 20 . A seminal publication by Zheng et al. showed that IL-22 is vital for protecting mice against CR infection, where 100% mortality of Il22 −/− mice was recorded 5 . Since then, there has been a concerted scientific effort aimed at determining the mechanism underpinning this phenotype 6 , 7 , 21 – 25 . Germ-free Il22 −/− mice succumb to CR infection similarly to specific pathogen free Il22 −/− mice, suggesting that mortality is independent of gut microbiota 24 . Moreover, Stat3 -deficient mice also succumb to CR infection 26 . However, mice deficient in several IL-22/STAT3 regulated proteins individually survive and clear the infection 25 . While Il22 −/− mice survive infection with CRΔ espF (EspF is an effector that disrupts TJ) 27 , the precise cause of death of CR-infected Il22 −/− mice remains unknown. Notably, CR infection induces severe diarrheal symptoms in Il22 −/− mice 5,24,27 , raising the possibility that dehydration, rather than direct bacterial invasion or inflammation, may be the primary cause of mortality. This study aimed to determine the cause of death of Il22 −/− mice infected with CR. We demonstrate that severe dehydration, rather than uncontrolled bacterial burden or inability to restore the gut barrier functions, is the primary cause of fatality. Furthermore, we show that fluid therapy (FT) alone is sufficient to rescue Il22 −/− mice, challenging the prevailing notion that IL-22 is indispensable for survival following CR infection. Our findings suggest the existence of IL-22-independent mechanisms that can take over bacterial clearance and tissue repair functions. Results Il22 −/− mice display signs of diarrhoea post CR infection To investigate the cause of death in Il22 −/− mice, we infected Il22 −/− and Il22 +/+ C57BL/6 mice with CR by oral gavage. As expected, Il22 −/− mice exhibited significant temporal weight loss (Fig. 1A) and reached 100% mortality by 14 dpi (Fig. 1B). Prior to reaching the endpoint, the Il22 −/− mice developed severe diarrhoea, characterized by visibly loose stool and faecal matter adhering to the cage walls (Fig. 1C). To quantitatively assess diarrhoea severity, we measured faecal water content, which was significantly higher in infected Il22 −/− compared to Il22 +/+ mice at 6 dpi (Fig. 1D). Additionally, infected Il22 −/− mice exhibited sodium and potassium ion losses in faecal samples, suggesting electrolyte imbalance as a contributing factor to disease severity (Fig. 1E-F). Given the severe diarrheal phenotype observed in Il22 −/− mice, we next sought to identify epithelial cell perturbations contributing to fluid and electrolyte imbalance. To this end, we performed deep quantitative proteomics analysis on colonic IECs isolated from infected Il22 +/+ and Il22 −/− mice at 9 dpi. Among the 7,730 quantified proteins, 861 were differentially expressed between Il22 +/+ and Il22 −/− mice post-infection (p 0.5) (Fig. 2A). Gene set enrichment analysis of these differentially regulated proteins revealed significant downregulation of pathways associated with ion transport (Fig. 2B). Il22 −/− mice exhibited a notable dysregulation of key ion transporters and regulators involved in electrolyte and water absorption in the colon (Fig. 2C). We validated the downregulation of key ion transporters implicated in electrolyte and water absorption 28 by qRT-PCR (Fig. 2D), including Chloride anion exchanger ( Slc26a3 ), a chloride-bicarbonate exchanger essential for chloride absorption, Carbonic anhydrases 2 ( Ca2 ) and 4 ( Ca4 ) involved in bicarbonate absorption, Aquaporin-8 ( Aqp8 ) which facilitates water absorption, Slc5a8 which functions as a sodium-coupled transporter for short-chain fatty acids, D-lactate, and monocarboxylates and Slc15a1 ( Pept1 ) a proton-dependent peptide transporter that absorbs di-/tripeptides. The combined downregulation of these transporters provides a mechanistic basis for the severe diarrhoea phenotype observed in infected Il22 −/− mice. Dehydration is the primary cause of mortality in Il22 −/− mice post-CR infection Since Il22 −/− mice exhibited significant downregulation of key ion transporters responsible for electrolyte absorption, we hypothesized that dehydration was the primary cause of mortality. To test this hypothesis, we implemented a fluid therapy (FT) regimen aimed at restoring hydration status and assessing its impact on survival (Fig. 3A). Starting at 5 dpi, coinciding with the onset of diarrhoea, infected Il22 −/− mice received daily subcutaneous injections of a balanced salt solution along with wet food until 20 dpi (Fig. 3A, see methods and Table S1 for details). While treated mice continued to present diarrhoea (Fig. 3B), FT successfully normalized serum dehydration parameters in Il22 −/− mice 29 . Compared to the untreated Il22 −/− mice, FT-treated Il22 −/− mice exhibited significantly lower total serum protein concentration (Fig. 3C). Il22 −/− mice exhibited significantly elevated serum renin and corticosterone levels compared to Il22 +/+ mice; however, FT treatment normalized these levels to those of Il22 +/+ mice (Fig. 3D-E). Moreover, clinical assessment revealed a substantial improvement in hydration status in FT-treated mice, with reductions in ruffled coat appearance, increased skin turgor, improved posture, and enhanced mobility compared to untreated Il22 −/− mice (Table S2). These findings suggest FT reverses the dehydration observed in infected Il22 −/− mice. Acute renal failure is a key consequence of dehydration 30 , 31 . To assess renal function, we measured cystatin C levels and found them significantly elevated in Il22 −/− mice, which was reversed by FT treatment (Fig. 3F). Importantly, administration of FT resulted in complete survival of CR-infected Il22 −/− mice, indicating that dehydration is the primary driver of mortality (Fig. 3G). While FT did not prevent weight loss during the early phase of infection (Fig. 3H), FT-treated Il22 −/− mice began to recover from 9 dpi, ultimately regaining body weight comparable to that of Il22 +/+ mice by 20 dpi (Fig. 3H). Additionally, faecal bacterial loads were similar between FT-treated and untreated Il22 −/− mice during the early infection phase, however, FT-treated mice successfully cleared CR at rates comparable to the Il22 +/+ mice during the later infection phase (Fig. 3I). Furthermore, recovered Il22 −/− mice were protected from secondary CR challenge (Fig. S1 A), as evidenced by no weight loss (Fig. S1 B), absence of diarrhoea (Fig. S1 C), and efficient clearance of CR by 6 dpi (Fig. S1 D). FT does not mitigate CR-mediated pathology in Il22 −/− mice While FT successfully prevented mortality in Il22 −/− mice, it remained unclear whether it mitigated underlying tissue pathology caused by the infection. We therefore examined CR-mediated pathology in both FT-treated and untreated Il22 −/− mice. Necropsy analysis at 9 dpi revealed that FT did not reduce systemic bacterial dissemination, as comparable levels of CR were detected in the liver (Fig. 4A) and spleen (Fig. 4B) of both FT-treated and untreated Il22 −/− mice. Immunohistochemistry analysis of colonic tissue showed no differences in epithelial barrier disruption, with both groups displaying a similar loss of E-cadherin expression (Fig. 4C). Deep quantitative proteomic analysis of colonic IECs from infected Il22 +/+ and Il22 −/− mice, with or without FT, compared to uninfected mice revealed no global differences in protein expression between FT-treated and untreated Il22 −/− mice (Fig. 4D). These findings suggest that FT does not directly modulate the epithelial proteome but instead functions as a supportive measure to counteract dehydration. We then examined whether FT had an impact on local inflammatory responses by assessing cytokine levels in the colonic explant cultures. As expected, these showed no detectable IL-22 in Il22 −/− mice (Fig. S2A). IL-22 antagonizes IFNγ-mediated signalling 32 , and consequently, CR-infected Il22 −/− mice display enhanced IFNγ-induced genes and pathways 6 , 7 . Both FT-treated and untreated Il22 −/− mice exhibited significantly higher colonic IFNγ (Fig. 4E) and TNF (Fig. S2B), compared to Il22 +/+ mice. Consistently, FT did not alter IFNγ-regulated proteins in the IECs of Il22 −/− mice (Fig. 4F). Il22 −/− mice, with or without FT treatment, exhibited similar levels of IL-6 (Fig. S2C) and IL-17A secretion post-infection as Il22 +/+ mice (Fig. 4G). However, FT-treated Il22 −/− mice displayed significantly higher levels of IL-17F and IL-10 compared to untreated controls (Fig. 4H-I). In agreement with the proteomics analysis and key pro-inflammatory cytokines levels, further post-mortem analysis confirmed that FT did not alleviate CR-induced colonic damage in the Il22 −/− mice at 9 dpi. Compared to Il22 +/+ -infected controls, CR-infected Il22 −/− mice, regardless of FT administration, exhibited significantly greater colon shortening (Fig. 5A-B) and an increased colon weight-to-length ratio (Fig. 5C), indicative of heightened inflammation and epithelial erosion 33 . Histological examination via haematoxylin and eosin (H&E) staining revealed comparable levels of epithelial damage, crypt loss, mucus layer depletion, mucosal thickening, and immune cell infiltration in both FT-treated and untreated Il22 −/− mice (Fig. 5D). These findings demonstrate that while FT effectively counteracts dehydration, it does not ameliorate the pathological effects of CR infection in the colon of Il22 −/− mice. IL-22 is dispensable for intestinal recovery post-CR infection Despite the persistence of CR-mediated pathology, FT-treated Il22 −/− mice displayed substantial recovery of colonic epithelial integrity over time. By 20 dpi, FT-treated Il22 −/− mice exhibited increased colon length, although still shorter than that of Il22 +/+ mice (Fig. 5A-B). By 48 dpi, further recovery in colon length was observed (Fig. 5A-B). Histological analysis of colonic sections revealed that CR-infected Il22 −/− mice receiving FT exhibited substantial epithelial recovery by 20 dpi, with full restoration by 48 dpi (Fig. 5D), showing no discernible differences compared to Il22 +/+ controls. This recovery was accompanied by normalization of the colon weight-to-length ratio (Fig. 5C), further supporting the notion that epithelial regeneration occurs independently of IL-22. These findings suggest that IL-22 is not required for long-term intestinal recovery. Consistently, the quantitative proteomics analysis of colonic IECs showed that unlike at 9 dpi, FT-treated Il22 −/− mice clustered with Il22 +/+ mice at 20 dpi, indicating comparable recovery at the molecular level (Fig. 5E). These results support the notion that alternative pathways can compensate for the absence of IL-22 in promoting epithelial healing and barrier restoration post-infection. Discussion Our study demonstrates that the cause of death of CR-infected Il22 −/− mice is dehydration rather than an inability to control bacterial proliferation or maintain/recover epithelial barrier integrity (Fig. S3). These findings challenge the prevailing dogma regarding the indispensability of IL-22 during CR infection. Previous studies have established IL-22 as a critical mediator in host defence against CR infection 5 – 7 , 10 . Il22 −/− mice exhibit increased intestinal epithelial damage, higher systemic bacterial burden, and 100% mortality following CR infection. Some studies attributed mortality to IL-22’s role in inducing AMPs such as Reg3β and Reg3γ 6,10 , essential for bacterial control. However, mice lacking these AMPs individually survived CR infection 25 , suggesting that IL-22’s protective effects extend beyond AMPs induction. Our findings indicate that the mortality in Il22 −/− mice is primarily due to diarrhoea, leading to ion loss and subsequent dehydration. Proteomic analyses revealed a marked downregulation of key ion transporters and their regulators, including Slc26a3, Aqp8, Ca2, Ca4, Slc5a8, and Slc15a1, which are vital for electrolyte and water absorption in the colon 28 , 34 . This impairment results in excessive fluid loss, underscoring a previously underappreciated role that IL-22 may play in maintaining electrolyte homeostasis during enteric infections. The role of hydration status in modulating immune responses has recently gained attention 35 , 36 . Water-restricted mice, which exhibit lower faecal water content and constipation, display an impaired ability to eliminate CR and reduced immune cell populations, including B cells, CD4 + , and CD8 + T cells in the colon 35 . Similarly, downregulation of Aqp3 is associated with inflammatory and infectious diarrhoea, and Aqp3 −/− mice exhibit diminished populations of Th17 and Treg cells 35 . Implementing a FT regimen effectively mitigated dehydration in Il22 −/− mice, normalizing serum dehydration parameters and improving clinical signs without directly affecting bacterial load, systemic dissemination, colonic damage, or expression of major pro-inflammatory markers. FT did not influence epithelial barrier breakdown, faecal bacterial load, or systemic dissemination of CR in Il22 −/− mice. However, FT-treated Il22 −/− mice cleared CR infection and survived, demonstrating that bacterial clearance can occur in the absence of IL-22 and that systemic dissemination of CR was not the primary cause of mortality, as previously reported 5 , 24 . Il22ra1 −/− mice were shown to succumb to CR infection due to systemic dissemination of Enterococcus faecalis 23 . However, germ-free Il22 −/− mice continued to succumb to CR infection, suggesting a microbiota-independent mechanism 24 . Notably, germ-free Il22 −/− mice exhibited severe diarrhoea post-CR infection 24 . With adequate treatment of dehydration, Il22 −/− mice demonstrated substantial recovery of colonic architecture and function by 20 dpi, achieving complete restoration by day 48. Recovered Il22 −/− mice were also protected from rechallenge with CR, indicating that mucosal adaptive immunity remains intact in the absence of IL-22. These findings suggest that while IL-22 contributes to epithelial maintenance during infection, it is dispensable and can be compensated by IL-22-independent mechanisms. IL-17A, IL-17F, IL-6, and IL-10 perform overlapping functions when IL-22 is limited 37 – 40 . Il22 −/− mice, with or without FT, displayed induction of IL-17A, IL-17F, and IL-10 upon infection. However, FT-treated Il22 −/− mice exhibited significantly higher IL-17F and IL-10 levels compared to untreated controls, suggesting a plausible mechanism for IL-22-independent recovery. IL-17A and IL-17F, co-produced with IL-22 by Th17 cells, enhance the production of critical AMPs such as Reg3β and Reg3γ 37,40,41 , reinforcing epithelial defence mechanisms. IL-6 signals through the gp130 receptor complex to activate STAT3 in intestinal epithelial cells 38 , promoting cell survival, proliferation, and tissue repair. Additionally, IL-10, known for its potent anti-inflammatory properties 39 , 42 , tempers excessive inflammation and further supports mucosal homeostasis. Collectively, these cytokines form a network that may lead to epithelial recovery in absence of IL-22. Taken together, our data demonstrate that, contrary to prevailing views, IL-22 is dispensable for protecting mice from CR infection. Il22 −/− mice succumb due to dehydration and excessive fluid losses secondary to diarrhoea rather than an inability to restore gut barrier functions. FT rescues Il22 −/− mice by providing physiological support, enabling bacterial clearance and tissue repair via IL-22-independent mechanisms. Although FT did not mitigate initial tissue damage or reduce diarrhoea, it facilitated colonic epithelial recovery over time, underscoring the importance of supportive therapies in enhancing host resilience during enteric infections. Further studies are warranted to elucidate IL-22-independent mechanisms of epithelial regeneration and their therapeutic potential. The administration of supportive therapy is common in clinical care but is rarely applied to animal models of disease. By enhancing the physiological relevance of murine models, our findings offer new avenues for therapeutic interventions that complement host defence mechanisms. Material and methods Mouse experiments. Mouse experiments were performed in accordance with the Animals Scientific Procedures Act of 1986 and were approved by the local Ethical Review Committee according to UK Home Office guidelines. The Il22 +/+ and Il22 −/− mice from same founder mice were maintained in homozygous condition and were housed and bred in dedicated animal facilities of Imperial College London (12h light/dark cycle; 22 ± 2°C; 30 to 40% humidity). Mice were housed in IVC cages with corn cob bedding and enrichments including nesting material, refuges, and gnawing sticks. Mice were fed with RM1(E) rodent diet (SDS Diet) and water ad libitum. Male mice (age 2–4 months, 25 to 30 grams weight) were used for experiments. All mice were genotyped and tested for the presence or absence of iCre using multiplex PCR as described 43 . The sequences of primers (5’ to 3’) used: Forward, CAGGCTCTCCTCTCAGTTATCA; Wildtype reverse, TCCTGAAGGCCAAAATAGG; Mutant reverse, CCTCAGGTTCAGCAGGG AAC. CR infection. CR (strain ICC169) was grown overnight in lysogeny broth at 37°C with shaking at 180 rpm, centrifuged at 2500 x g for 10 min and resuspended in sterile PBS. Mice were infected with approximately 1 x 10 9 CFU in 200 µL sterile PBS using oral gavage, as previously described 1 . Mock infected (uninfected/0 dpi) mice received 200 µL sterile PBS. The inoculum CFU was confirmed by CFU quantification as previously described 1 . Mice were monitored every day for changes in weight and disease severity was scored for four parameters: coat fur, posture, skin turgor and mobility; scores ranged from 0 to 5, wherein 0 scores for a healthy mouse. Humane end points were met if a mouse lost 20% of its body weight or if a disease score of 3 or more was observed for more than 2 consecutive days. Measurement of faecal water, Sodium and Potassium content and CR shedding To determine the faecal water content, faeces were freshly collected in pre-weighed 1.5 mL tubes with punctured cap. The tubes with wet faeces were weighed immediately and incubated at 55°C. The tubes were weighed everyday till the weight did not change and were recorded. The wet weight and dry weight of faeces was determined by subtracting the weight of the tube and faecal water content was estimated using the following equation: $$\:\%\:water\:content=\:\frac{wet\:weight-dry\:weight}{wet\:weight}\:x\:100$$ Faecal sodium and potassium were estimated as described earlier 44 . Briefly, dry faeces were resuspended in autoclaved double distilled water, homogenised and centrifuged at 100 x g for 1 min. The sodium and potassium content in the supernatant was estimated using LAQUAtwin meters (Horiba, Japan) and was normalised to the dry weight of faeces. To determine CR faecal shedding, fresh faecal samples were collected at the specified dpi, homogenised in sterile PBS, serially diluted and plated on LB-agar containing 50 mg/kg of kanamycin. For rechallenge experiments, mice were infected with approximately 1 x 10 9 CFU of CR, orally at 50 dpi post primary infection. Post-mortem pathophysiological analysis Mice were anesthetized via intraperitoneal injection of ketamine (100 mg/kg) and medetomidine (1 mg/kg). Once pedal reflexes were absent, they were positioned in dorsal recumbency. Blood was drawn from the right ventricle using a closed approach, inserting a 25G needle at a 30° angle to the skin until free aspiration into a 1 ml syringe was achieved. Immediately after blood collection, mice were euthanized by cervical dislocation. The collected blood was left to clot at RT for 1 h before centrifugation at 20,000 × g for 3 minutes. Serum was then aliquoted and stored at -80°C until further use. Euthanised mice were dissected and the large intestine of mouse consisting of caecum and colon was harvested and laid down on a clean surface in parallel to a mm scale to estimate the colon length and was captured using a digital camera. Colon was removed from caecum, cleaned and weighed using a digital scale. The weight of the colon was normalised for its length and recorded. From the distal side of colon, 0.5 cm colon was stored in 4% paraformaldehyde for histological studies, next 0.5 cm was stored in RNAlater for total RNA preparation and 3.5 cm was collected for colonic IECs preparation. The liver and spleen were harvested, weighed and homogenised in sterile PBS for estimation of systemic burden of CR. Serum parameters Total protein concentration in serum was estimated using a NanoDrop spectrophotometer (Thermo Scientific). 2 µl of serum sample was used to measure absorbance at 280 nm and the corresponding protein concentration was recorded. Serum renin, corticosterone and Cystatin C concentration were determined using Mouse Renin 1 ELISA Kit (ThermoFischer Scientific; catalogue number EMREN1), Corticosterone Parameter Assay Kit (Bio-techne; catalogue number KGE009) and Mouse Cystatin C DuoSet ELISA (Bio-techne; catalogue number DY1238), respectively according to manufacturer’s protocol. FT protocol Infected Il22 −/− mice were administered with a FT regime 5 to 20 dpi, where they were provided with wet food and three subcutaneous injections of balanced electrolyte solution, daily. To prepare wet food, RM1(E) (SDS Diet) dry food pellets (average weight of 1.1 gram/pellet) were soaked in drinking water in 50 mL tubes for 30 min, excess fluid was drained and one pellet per mouse was provided in sterile 6 cm dishes inside the cage. For subcutaneous injections, balance electrolyte solution 45 (PlasmaLyte 148, Baxter International Inc.) was prewarmed to 37°C and the dose was determined based on dehydration status of mice. The dehydration status of mouse was calculated based on scoring the clinical parameters of Anorexia- a lack of appetite and body weight loss, reduced motility, coat and posture (Supplementary Table S1 ), scores ranged from 0 to 5, wherein 0 scores for a healthy mouse. The dose of injections was calculated using following equation: Body weight (grams) x % Dehydration (as a decimal value) = Fluid volume (ml) The volume of fluid to be administered was divided into 3 injections per day. Histological analysis and immunofluorescence staining Paraformaldehyde-fixed 0.5-cm distal colon samples were processed, paraffin embedded and sectioned at 5 µm. The sections were then stained with either hematoxylin and eosin (H&E) 1 or processed for immunofluorescence. For immunofluorescence staining, tissue sections were dewaxed by sequential submersion in Histo-Clear (2×10 min), 100% ethanol (2×10 min), 95% ethanol (2×10 min), 80% ethanol (2×3 min), and PBS-TS (PBS + 0.1% Tween 20 + 0.1% saponin, 2×3 min). Antigen retrieval was performed by heating sections for 30 min in demasking solution (0.3% trisodium citrate + 0.05% Tween 20, pH 6.0), followed by cooling. Slides were blocked in PBS-TS with 10% normal donkey serum for 1 h in a humid chamber, then incubated overnight at 4°C with E-cadherin primary antibody (Abcam, ab76055; 1:100) in PBS-TS with 10% donkey serum. After rinsing twice (10 min each) in PBS-TS, sections were incubated with Alexa Fluor 488 labelled anti-mouse IgG secondary antibody (Jackson ImmunoResearch; 715-545-150), (1:100) and DAPI (1:1000), followed by additional washes. Slides were mounted using ProLong Gold antifade and cured overnight in the dark. All images were acquired using a Zeiss AxioVision Z1 microscope with a 20X lens objective using an AxioCam MRm camera for H&E and a Hamamatsu C11440 digital camera for immunofluorescence and processed using Zen 2.3 (Blue version; Carl Zeiss MicroImaging GmbH, Germany). Cytokine profiling explants 0.5-cm distal colonic tissue sample without faeces was weighed and incubated for 2 h in RPMI 1640 medium with glutamine (Sigma) with 100 µg/mL of streptomycin and 100 µg/mL of penicillin. Following this, explants were cultured in complete RPMI medium at 1 mL/0.1 g tissue (RPMI 1640 medium with glutamine supplemented with 10% heat-inactivated FBS, 1 mM sodium pyruvate, 100 µg/mL penicillin, 100 µg/mL streptomycin, and 10 mM HEPES) for 24 h at 37°C with 5% CO2. The supernatant was extracted, centrifuged for 10 min at 3,000 x g to remove cellular debris, and stored at − 80°C until further analysis. Explant cytokine levels were assessed from the corresponding samples via LEGENDplex kit (BioLegend, catalogue number 741044) as per manufacturer’s instructions. Cytokine levels were acquired using a FACSCalibur flow cytometer (BD Biosciences), and analyses were performed using LEGENDplex data analysis software (BioLegend). Colonic IECs purification Colonic IECs were isolated from 3.5-cm distal colonic tissue samples, as previously described 1 . Briefly, the 3.5-cm colonic tissue sample was opened longitudinally and washed in 1X Hanks’ balanced salt solution (HBSS) without Magnesium (Mg + 2 ) and Calcium (Ca + 2 ). The tissue sample was incubated at 37°C with shaking for 45 min in enterocyte dissociation buffer (1X HBSS without Mg + 2 and Ca + 2 , containing 10 mM HEPES, 1 mM EDTA, and 5 µL/mL 2-β-mercaptoethanol). The remaining tissue was removed, and lifted enterocytes were subsequently collected by centrifugation (2,000 x g for 10 min), followed by three PBS washes at 4°C. Colonic IEC pellets were stored at -80°C, till further use. Sample Preparation and TMT Labelling Colonic IECs from Il22 +/+ or Il22 -/- (+/- FT) infected mice and corresponding uninfected controls were lysed using probe sonication in TEAB buffer (100 mM TEAB, 1% SDC, 1% isopropanol, 50 mM NaCl) containing protease and phosphatase inhibitors, then sonicated again before protein quantification using the Bradford assay (BioRad). Two to four mice per replicate were pooled in 1:1 ratio per sample, reduced and alkylated with 5 mM TCEP and 10 mM IAA (30 min). Proteins were digested with trypsin (75 ng/µL, 18 hrs, RT) and labelled with TMTpro 18-plex reagents (Thermo Scientific). SDC was precipitated with 2% formic acid and removed by centrifugation (10,000 rpm, 5 min). TMT-labelled peptides were dried using a vacuum concentrator. High-pH RP Fractionation and LC-MS Analysis TMT-labelled peptides were fractionated by high-pH RP-HPLC using a C18 column (Waters XBridge) with a gradient elution (5–80% mobile phase B; 0.1% ammonium hydroxide in acetonitrile) at 200 µL/min. Ninety-two fractions were concatenated into 24, dried, and reconstituted in 0.1% formic acid. Approximately 3 µg of peptides per fraction were analysed on an Orbitrap Ascend mass spectrometer using a Real-Time Search-SPS-MS3 method. Peptides were separated on a nanocapillary column (Acclaim PepMap C18, 75 µm × 50 cm, 2 µm, 100 Å, 120-min gradient) at 50°C. MS1 scans (400–1600 m/z) were acquired at 120,000 resolutions with a dynamic exclusion of 45 s, with standard AGC and auto injection time, and included 2–6 precursor charge states. MS2 scans were acquired in the ion trap using HCD (32% CE). SPS-MS3 scans (HCD CE 55%) were collected at 45,000 resolutions for quantification. These spectra were searched against the Mus musculus and Citrobacter rodentium reviewed proteomes using the Comet search engine, with parameters set for tryptic peptides allowing a maximum of one missed cleavage. Static modifications included cysteine carbamidomethylation (+ 57.0215) and N-terminal/lysine TMTpro (+ 304.2071), with variable modifications including Asn/Gln deamidation (+ 0.984) and Met oxidation (+ 15.9949), allowing up to two variable modifications and a maximum of four peptides per protein. Precursors meeting these criteria were selected for SPS10-MS3 scans, performed at an Orbitrap resolution of 45,000 with normalized HCD collision energy set to 55%, AGC at 200%, and a maximum injection time of 200 ms. The mass spectrometry proteomics data have been deposited to the ProteomeXchange Consortium via the PRIDE 46 partner repository with the dataset identifier PXD061225. Proteomics Data Analysis Proteomic data were median normalized to account for variations in sample loading. Log2 fold changes (log2FC) were calculated by comparing CR-infected samples to their corresponding uninfected controls. To correct for potential batch effects, the data were scaled within each biological group. Missing values in the TMT data were imputed using the minimum intensity observed within the corresponding batch. Differential protein expression between Il22 +/+ and Il22 −/− was assessed using two-sample t-tests ( p < 0.05) or ANOVA for comparisons involving Il22 +/+ and Il22 −/− with and without FT, as implemented in Perseus. Proteins were considered significantly up- or downregulated if they met the statistical threshold ( p < 0.05) and a fold-change cutoff (|log2FC| ≥ 0.5). Principal component analysis (PCA) was performed based on proteins that showed significant changes in expression as determined by ANOVA ( p < 0.05). The PCA plot was generated to visualize the variance in proteomic profiles between experimental conditions. Enrichment analysis of significantly regulated proteins was conducted using Fisher’s exact test, applying Benjamini-Hochberg correction to control the false discovery rate (FDR < 0.05). Visualizations of significant enrichment terms were generated using the Matplotlib library in Python. Quantitative reverse transcription-PCR (qRT-PCR) . 0.5 cm of distal colon was harvested and incubated in RNAlater for 24 h at 4°C. Total RNA extraction was performed using the RNeasy kit (Qiagen) according to the manufacturer’s protocol. Reverse transcription used 2 µg of purified RNA and High-capacity cDNA Reverse Transcription kit. Quantitative PCR was performed using SsoAdvanced Universal SYBR green supermix on a StepOnePlus Real-Time PCR system. Reactions were performed in duplicate, including negative control lacking cDNA. The ΔΔCT method of quantification was performed to give values relative to the expression of the averaged baseline measurement. Expression was normalized to the expression of the housekeeping gene Gapdh . Primer pairs used are listed in supplementary Table S3. Statistical analysis and data plotting No statistical methods were used to determine sample size. Experiments were planned as randomized blocks with 3–5 animals per genotype per experiment, and experiments were repeated independently at least 2 times. The details of number of mice used for all experiments are mentioned in Table S4. Data from all mice in all experiments were pooled and analyzed. Data were plotted as Mean ± SEM. Statistical significance between two normally distributed groups was performed by Student’s t test; when normality had not been achieved, a nonparametric Mann-Whitney test was performed. ANOVA was used to test statistical significance for more than two normally distributed groups. When data were not normally distributed (based on D’Agostino-Pearson or Shapiro-Wilk normality tests), a logarithm transformation was applied, and they were then analysed by ANOVA. Statistical analysis of proteomics data is detailed in the section above. False discovery rate (FDR; Q = 5%) was used to correct for multiple comparisons (Bonferroni correction) as implemented in GraphPad Prism 10.4.0. FDR-adjusted p values > 0.05 were considered non-significant (ns). Data plotting and statistical analysis were performed using Prism 10.4.0 (GraphPad software Inc). Statistical details of experiments are described in the figure legends. Study Approval All animal work was conducted at Imperial College London (Association for Assessment and Accreditation of Laboratory Animal Care accredited unit) under the auspices of the Animals (Scientific Procedures) Act (UK) 1986 47 (PP7392693). The animal work was approved locally by the institutional ethics committee. Experiments were designed in agreement with the ARRIVE 48 guidelines for the reporting and execution of animal experiments. Declarations Data Availability The mass spectrometry proteomics data have been deposited in the ProteomeXchange Consortium via the PRIDE 46 partner repository with the dataset identifier PXD061225. Inclusion and diversity We support inclusive, diverse, and equitable conduct of research. Declaration of competing interest The authors declare that they have no competing interests. Acknowledgments We thank Prof. Brigitta Stockinger, The Francis Crick Institute, for providing the Il22 -/- mice used to establish the colony at Imperial College. We thank Dr. Julia Sanchez-Garrido for careful reading of the paper and critical suggestions and the staff of Central Biomedical Services, Imperial for assistance in maintenance and breeding of animals. This work was supported by Wellcome Trust Investigator Award grants 107057/z/15/z and 224282/Z/21/Z. References Crepin, V. F., Collins, J. W., Habibzay, M. & Frankel, G. Citrobacter rodentium mouse model of bacterial infection. Nat Protoc 11 , 1851-1876 (2016). https://doi.org:10.1038/nprot.2016.100 Collins, J. W. et al. Citrobacter rodentium: infection, inflammation and the microbiota. Nat Rev Microbiol 12 , 612-623 (2014). https://doi.org:10.1038/nrmicro3315 Kayagaki, N. et al. Non-canonical inflammasome activation targets caspase-11. Nature 479 , 117-121 (2011). https://doi.org:10.1038/nature10558 Mundy, R., MacDonald, T. T., Dougan, G., Frankel, G. & Wiles, S. Citrobacter rodentium of mice and man. Cell Microbiol 7 , 1697-1706 (2005). https://doi.org:10.1111/j.1462-5822.2005.00625.x Zheng, Y. et al. Interleukin-22 mediates early host defense against attaching and effacing bacterial pathogens. Nat Med 14 , 282-289 (2008). https://doi.org:10.1038/nm1720 Zindl, C. L. et al. A nonredundant role for T cell-derived interleukin 22 in antibacterial defense of colonic crypts. Immunity 55 , 494-511 e411 (2022). https://doi.org:10.1016/j.immuni.2022.02.003 Zindl, C. L. et al. Distal colonocytes targeted by C. rodentium recruit T-cell help for barrier defence. Nature 629 , 669-678 (2024). https://doi.org:10.1038/s41586-024-07288-1 Serafini, N. & Di Santo, J. P. Group 3 innate lymphoid cells: A trained Gutkeeper. Immunol Rev 323 , 126-137 (2024). https://doi.org:10.1111/imr.13322 Hasegawa, M. et al. Interleukin-22 regulates the complement system to promote resistance against pathobionts after pathogen-induced intestinal damage. Immunity 41 , 620-632 (2014). https://doi.org:10.1016/j.immuni.2014.09.010 Keir, M., Yi, Y., Lu, T. & Ghilardi, N. The role of IL-22 in intestinal health and disease. J Exp Med 217 , e20192195 (2020). https://doi.org:10.1084/jem.20192195 Majumdar, S. et al. Absence of Receptor Guanylyl Cyclase C Enhances Ileal Damage and Reduces Cytokine and Antimicrobial Peptide Production during Oral Salmonella enterica Serovar Typhimurium Infection. Infect Immun 86 (2018). https://doi.org:10.1128/IAI.00799-17 Dudakov, J. A., Hanash, A. M. & van den Brink, M. R. Interleukin-22: immunobiology and pathology. Annu Rev Immunol 33 , 747-785 (2015). https://doi.org:10.1146/annurev-immunol-032414-112123 Serafini, N. et al. Trained ILC3 responses promote intestinal defense. Science 375 , 859-863 (2022). https://doi.org:10.1126/science.aaz8777 Kotenko, S. V. et al. Identification of the functional interleukin-22 (IL-22) receptor complex: the IL-10R2 chain (IL-10Rbeta ) is a common chain of both the IL-10 and IL-22 (IL-10-related T cell-derived inducible factor, IL-TIF) receptor complexes. J Biol Chem 276 , 2725-2732 (2001). https://doi.org:10.1074/jbc.M007837200 Lejeune, D. et al. Interleukin-22 (IL-22) activates the JAK/STAT, ERK, JNK, and p38 MAP kinase pathways in a rat hepatoma cell line. Pathways that are shared with and distinct from IL-10. J Biol Chem 277 , 33676-33682 (2002). https://doi.org:10.1074/jbc.M204204200 Wolk, K. et al. IL-22 regulates the expression of genes responsible for antimicrobial defense, cellular differentiation, and mobility in keratinocytes: a potential role in psoriasis. Eur J Immunol 36 , 1309-1323 (2006). https://doi.org:10.1002/eji.200535503 Raffatellu, M. et al. Lipocalin-2 resistance confers an advantage to Salmonella enterica serotype Typhimurium for growth and survival in the inflamed intestine. Cell Host Microbe 5 , 476-486 (2009). https://doi.org:10.1016/j.chom.2009.03.011 Sonnenberg, G. F. et al. Innate lymphoid cells promote anatomical containment of lymphoid-resident commensal bacteria. Science 336 , 1321-1325 (2012). https://doi.org:10.1126/science.1222551 Tsai, P. Y. et al. IL-22 Upregulates Epithelial Claudin-2 to Drive Diarrhea and Enteric Pathogen Clearance. Cell Host Microbe 21 , 671-681 e674 (2017). https://doi.org:10.1016/j.chom.2017.05.009 Hopkins, E. G. D., Roumeliotis, T. I., Mullineaux-Sanders, C., Choudhary, J. S. & Frankel, G. Intestinal Epithelial Cells and the Microbiome Undergo Swift Reprogramming at the Inception of Colonic Citrobacter rodentium Infection. mBio 10 (2019). https://doi.org:10.1128/mBio.00062-19 Satoh-Takayama, N. et al. Microbial flora drives interleukin 22 production in intestinal NKp46+ cells that provide innate mucosal immune defense. Immunity 29 , 958-970 (2008). https://doi.org:10.1016/j.immuni.2008.11.001 Basu, R. et al. Th22 cells are an important source of IL-22 for host protection against enteropathogenic bacteria. Immunity 37 , 1061-1075 (2012). https://doi.org:10.1016/j.immuni.2012.08.024 Pham, T. A. et al. Epithelial IL-22RA1-mediated fucosylation promotes intestinal colonization resistance to an opportunistic pathogen. Cell Host Microbe 16 , 504-516 (2014). https://doi.org:10.1016/j.chom.2014.08.017 Liu, Y. et al. The gut microbiota-independent virulence of noninvasive bacterial pathogen Citrobacter rodentium. PLoS Pathog 20 , e1012758 (2024). https://doi.org:10.1371/journal.ppat.1012758 Melchior, K. et al. IL-22-dependent responses and their role during Citrobacter rodentium infection. Infect Immun 92 , e0009924 (2024). https://doi.org:10.1128/iai.00099-24 Pickert, G. et al. STAT3 links IL-22 signaling in intestinal epithelial cells to mucosal wound healing. J Exp Med 206 , 1465-1472 (2009). https://doi.org:10.1084/jem.20082683 Xia, X. et al. EspF is crucial for Citrobacter rodentium-induced tight junction disruption and lethality in immunocompromised animals. PLoS Pathog 15 , e1007898 (2019). https://doi.org:10.1371/journal.ppat.1007898 Das, S., Jayaratne, R. & Barrett, K. E. The Role of Ion Transporters in the Pathophysiology of Infectious Diarrhea. Cell Mol Gastroenterol Hepatol 6 , 33-45 (2018). https://doi.org:10.1016/j.jcmgh.2018.02.009 Bekkevold, C. M., Robertson, K. L., Reinhard, M. K., Battles, A. H. & Rowland, N. E. Dehydration parameters and standards for laboratory mice. J Am Assoc Lab Anim Sci 52 , 233-239 (2013). Diaz-Morales, N. et al. Age and Hypertension Synergize With Dehydration to Cause Renal Frailty in Rats and Predispose Them to Intrinsic Acute Kidney Injury. Lab Invest 105 , 102211 (2024). https://doi.org:10.1016/j.labinv.2024.102211 Qasem, A. & Rabbani, S. A. Acute kidney injury associated with cholera. Cureus 15 ,e34101(2023). https://doi.org:10.7759/cureus.34101 Moniruzzaman, M. et al. Interleukin-22 suppresses major histocompatibility complex II in mucosal epithelial cells. J Exp Med 220 , e20230106 (2023). https://doi.org:10.1084/jem.20230106 Kim, S. H. et al. Inflammatory responses of C57BL/6NKorl mice to dextran sulfate sodium-induced colitis: comparison between three C57BL/6 N sub-strains. Lab Anim Res 37 , 8 (2021). https://doi.org:10.1186/s42826-021-00084-2 Prasad, H. & Visweswariah, S. S. Impaired Intestinal Sodium Transport in Inflammatory Bowel Disease: From the Passenger to the Driver's Seat. Cell Mol Gastroenterol Hepatol 12 , 277-292 (2021). https://doi.org:10.1016/j.jcmgh.2021.03.005 Sato, K., Hara-Chikuma, M., Yasui, M., Inoue, J. & Kim, Y. G. Sufficient water intake maintains the gut microbiota and immune homeostasis and promotes pathogen elimination. iScience 27 , 109903 (2024). https://doi.org:10.1016/j.isci.2024.109903 O’May, J. B. et al. WNK1-dependent water influx is required for CD4+ T cell activation and T cell-dependent antibody responses. bioRxiv , 2022.2003. 2016.484637 (2022). https://doi.org/10.1101/2022.03.16.484637 Eyerich, S., Eyerich, K., Cavani, A. & Schmidt-Weber, C. IL-17 and IL-22: siblings, not twins. Trends Immunol 31 , 354-361 (2010). https://doi.org:10.1016/j.it.2010.06.004 Grivennikov, S. et al. IL-6 and Stat3 are required for survival of intestinal epithelial cells and development of colitis-associated cancer. Cancer Cell 15 , 103-113 (2009). https://doi.org:10.1016/j.ccr.2009.01.001 Wei, H. X., Wang, B. & Li, B. IL-10 and IL-22 in Mucosal Immunity: Driving Protection and Pathology. Front Immunol 11 , 1315 (2020). https://doi.org:10.3389/fimmu.2020.01315 Valeri, M. & Raffatellu, M. Cytokines IL-17 and IL-22 in the host response to infection. Pathog Dis 74 , ftw111 (2016). https://doi.org:10.1093/femspd/ftw111 Liang, S. C. et al. Interleukin (IL)-22 and IL-17 are coexpressed by Th17 cells and cooperatively enhance expression of antimicrobial peptides. J Exp Med 203 , 2271-2279 (2006). https://doi.org:10.1084/jem.20061308 Ouyang, W. & O'Garra, A. IL-10 Family Cytokines IL-10 and IL-22: from Basic Science to Clinical Translation. Immunity 50 , 871-891 (2019). https://doi.org:10.1016/j.immuni.2019.03.020 Ahlfors, H. et al. IL-22 fate reporter reveals origin and control of IL-22 production in homeostasis and infection. J Immunol 193 , 4602-4613 (2014). https://doi.org:10.4049/jimmunol.1401244 Mishra, V. et al. Gut-associated cGMP mediates colitis and dysbiosis in a mouse model of an activating mutation in GUCY2C. J Exp Med 218 , e20210479 (2021). https://doi.org:10.1084/jem.20210479 Rizoli, S. PlasmaLyte. J Trauma 70 , S17-18 (2011). https://doi.org:10.1097/TA.0b013e31821a4d89 Perez-Riverol, Y. et al. The PRIDE database at 20 years: 2025 update. Nucleic Acids Research 53 , D543-D553 (2025). Bleby, J. Animals (Scientific Procedures) Act 1986. Vet Rec 119, 22 (1986). https://doi.org:10.1136/vr.119.1.22-a Percie du Sert, N. et al. Reporting animal research: Explanation and elaboration for the ARRIVE guidelines 2.0. PLoS Biol 18, e3000411 (2020). https://doi.org:10.1371/journal.pbio.3000411 Additional Declarations There is NO Competing Interest. Supplementary Files SuppMaterialIL22.pdf Supp Cite Share Download PDF Status: Published Journal Publication published 08 Dec, 2025 Read the published version in Nature Communications → Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-6122641","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":425598755,"identity":"1e958188-e99e-4436-a8ab-33e84e2eaf49","order_by":0,"name":"Gad Frankel","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABD0lEQVRIiWNgGAWjYFACxgdAIoGBj72xAcTlYWCHiBvg1sJsANbCxnMQqoWZaC0SCTABAlrkHZjZPvzckSbHJvm4dXNBxT0Z/mYGxg8/GA4b49JieICZeWbvmRxjNunEttszzhTzSBxmYJbsYThshlNLA/9hBt62isQ2kBbetgQehsMMDNIMDIdtcGthZmb821ZR3yZ5EKjlXwKPPNCW3/i0yDMwMzPztuUksEkwArU0JPAYHGZgA9mC02EGQB3Msm1phm08IL8cS+AxPMzYZtljkI7T+/LtzcyMb9uS5fnZjz+7XVCTYC93vPnwjR8V1oYNuGw5jMSBxghjA96IlEc2ixm3ulEwCkbBKBjJAAARBUr9EDjadQAAAABJRU5ErkJggg==","orcid":"https://orcid.org/0000-0002-0046-1363","institution":"Imperial College London","correspondingAuthor":true,"prefix":"","firstName":"Gad","middleName":"","lastName":"Frankel","suffix":""},{"id":425598756,"identity":"05541fcf-8122-416d-97d4-8770d7a976fb","order_by":1,"name":"Vishwas Mishra","email":"","orcid":"https://orcid.org/0000-0002-7069-4613","institution":"Imperial College London","correspondingAuthor":false,"prefix":"","firstName":"Vishwas","middleName":"","lastName":"Mishra","suffix":""},{"id":425598757,"identity":"9192d190-3ca6-4a8d-970e-d75b4073eee0","order_by":2,"name":"Priyanka Biswas","email":"","orcid":"https://orcid.org/0000-0003-1932-2352","institution":"Imperial College London","correspondingAuthor":false,"prefix":"","firstName":"Priyanka","middleName":"","lastName":"Biswas","suffix":""},{"id":425598758,"identity":"0c37247a-d8ea-4b00-91cd-2ee7a86161dd","order_by":3,"name":"Joshua Wong","email":"","orcid":"https://orcid.org/0000-0001-8437-6731","institution":"Imperial College London","correspondingAuthor":false,"prefix":"","firstName":"Joshua","middleName":"","lastName":"Wong","suffix":""},{"id":425598759,"identity":"b0ebb944-8293-4c65-b507-d5bbbda4cb49","order_by":4,"name":"Zuza Kozik","email":"","orcid":"","institution":"Functional Proteomics Group, Institute of Cancer Research","correspondingAuthor":false,"prefix":"","firstName":"Zuza","middleName":"","lastName":"Kozik","suffix":""},{"id":425598760,"identity":"c749df89-e7cc-422b-9dff-8cc3ca4baffa","order_by":5,"name":"Jyoti Choudhary","email":"","orcid":"https://orcid.org/0000-0003-0881-5477","institution":"Functional Proteomics, Institute of Cancer Research","correspondingAuthor":false,"prefix":"","firstName":"Jyoti","middleName":"","lastName":"Choudhary","suffix":""}],"badges":[],"createdAt":"2025-02-27 16:10:10","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-6122641/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-6122641/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1038/s41467-025-67006-x","type":"published","date":"2025-12-08T05:00:00+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":78110582,"identity":"62701d2a-32bc-4b5a-babd-259842980d8c","added_by":"auto","created_at":"2025-03-10 05:04:03","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":397927,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eCR-infected \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eIl22\u003c/strong\u003e\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u003cstrong\u003e-/-\u003c/strong\u003e\u003c/em\u003e\u003c/sup\u003e\u003cstrong\u003e mice develop diarrhoea.\u0026nbsp; \u003c/strong\u003e(\u003cstrong\u003eA)\u003c/strong\u003e Temporal weight loss of CR-infected \u003cem\u003eIl22\u003c/em\u003e\u003csup\u003e\u003cem\u003e+/+\u003c/em\u003e\u003c/sup\u003e and \u003cem\u003eIl22\u003c/em\u003e\u003csup\u003e\u003cem\u003e-/-\u003c/em\u003e\u003c/sup\u003e mice. \u003cstrong\u003e(B)\u003c/strong\u003e Probability of survival. \u003cstrong\u003e(C)\u003c/strong\u003e representative images of cages housing infected mice at 6 dpi; note the faecal matter on cage wall in \u003cem\u003eIl22\u003c/em\u003e\u003csup\u003e\u003cem\u003e-/-\u003c/em\u003e\u003c/sup\u003e\u003csup\u003e \u003c/sup\u003emice. \u003cstrong\u003e(D)\u003c/strong\u003e Faecal water content at 0 and 6 dpi. \u003cstrong\u003e(E-F)\u003c/strong\u003e Faecal Sodium and Potassium levels at 0 and 6 dpi. Data shown in (A-B) are representative of 2 biological repeats, with 4 and 5 mice each per group, respectively. Each dot in (D-F) represents a mouse and are pooled values from 2 biological repeats, with 4-5 mice per group. Refer to Table S4 for the exact number of mice used for experimental groups. P values were determined on data plotted as Mean ± SEM using Student’s-t-test in (A) and Two-way ANOVA with Bonferroni post-test for multiple comparisons (D-F). **, p \u0026lt; 0.01; ***, p \u0026lt; 0.001; ****, p \u0026lt; 0.0001.\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-6122641/v1/006ecda75a829070ac5ae618.png"},{"id":78110476,"identity":"3854ca19-34a9-429b-b6f6-97aff65a4981","added_by":"auto","created_at":"2025-03-10 04:56:03","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":886908,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eCR-infected \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eIl22\u003c/strong\u003e\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u003cstrong\u003e-/-\u003c/strong\u003e\u003c/em\u003e\u003c/sup\u003e\u003cstrong\u003e mice display dysregulation of colonic ion-channels. (A) \u003c/strong\u003eA volcano plot displaying the differentially regulated proteins in colonic IECs.\u003cstrong\u003e (B) \u003c/strong\u003eGene set enrichment analysis of the differentially up- and downregulated proteins.\u003cstrong\u003e (C)\u003c/strong\u003e Proteomics analysis of colonic IEC transporters and regulators involved in fluid-ion homeostasis. \u003cstrong\u003e(D)\u003c/strong\u003e qRT-PCR analysis of the indicated mRNA isolated from distal colon. \u003cem\u003eGapdh\u003c/em\u003e was used for normalisation. Each point represents an individual mouse in (D) and are pooled values from 2 biological repeats, with 4 mice per group. P values were determined on data plotted as Mean ± SEM using Two-way ANOVA with Bonferroni post-test for multiple comparisons. *, p \u0026lt; 0.05; ns, non-significant.\u0026nbsp;\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-6122641/v1/8dbc9a1de9d26a52c8e80425.png"},{"id":78110473,"identity":"efaaa47e-3a75-45e4-9ab4-edc5ffef9bba","added_by":"auto","created_at":"2025-03-10 04:56:03","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":105192,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eFT rescues \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eIl22\u003c/strong\u003e\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u003cstrong\u003e-/-\u003c/strong\u003e\u003c/em\u003e\u003c/sup\u003e\u003cstrong\u003e mice from CR infection. (A) \u003c/strong\u003eSchematic representation of the FT regimen.\u003cstrong\u003e (B) \u003c/strong\u003eFaecal water content at 6 dpi. \u003cstrong\u003e(C-F)\u003c/strong\u003e serum parameters of dehydration at 9 dpi, total protein concentration in serum \u003cstrong\u003e(C)\u003c/strong\u003e, concentration of serum renin \u003cstrong\u003e(D)\u003c/strong\u003e, serum corticosterone \u003cstrong\u003e(E)\u003c/strong\u003e, and serum cystatin C \u003cstrong\u003e(F)\u003c/strong\u003e.\u0026nbsp; \u003cstrong\u003e(G)\u003c/strong\u003e Probability of survival. \u003cstrong\u003e(H)\u003c/strong\u003e Temporal weight loss of CR-infected mice. \u003cstrong\u003e(I)\u003c/strong\u003e Temporal faecal CR shedding. Data shown are pooled values from 2 (B, I) or 3 (C-F) biological repeats, with 3-5 mice per group. Data shown in (G-H) are representative of 2 biological repeats, with 3-4 mice per group. Refer to Table S4 for the exact number of mice used for experimental groups. Each point represents an individual mouse (B-F, I). P values were determined on data plotted as Mean ± SEM using One-way ANOVA (B-F) and Two-way ANOVA (I) with Bonferroni post-test for multiple comparisons. *, p \u0026lt; 0.05; **, p \u0026lt; 0.01; ***, p \u0026lt; 0.001; ns, non-significant.\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-6122641/v1/05a68828b56a66623209a092.png"},{"id":78110475,"identity":"b050d292-dca7-44d0-a732-2c9697fd86cd","added_by":"auto","created_at":"2025-03-10 04:56:03","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":1340398,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eFT does not mitigate CR-induced disease in \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eIl22\u003c/strong\u003e\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u003cstrong\u003e-/-\u003c/strong\u003e\u003c/em\u003e\u003c/sup\u003e\u003cstrong\u003e mice. (A-B)\u003c/strong\u003e Extraintestinal CR burden in liver \u003cstrong\u003e(A)\u003c/strong\u003e and spleen \u003cstrong\u003e(B)\u003c/strong\u003e. \u003cstrong\u003e(C)\u003c/strong\u003e Representative immunofluorescence staining images of distal colon; note the decreased E-cadherin (green) signal in \u003cem\u003eIl22\u003c/em\u003e\u003csup\u003e\u003cem\u003e-/-\u003c/em\u003e\u003c/sup\u003e mice. DAPI was used to stain nuclei. Scale 200 μm. \u003cstrong\u003e(D)\u003c/strong\u003e Heat-map of significantly differentially regulated 1,104 proteins between \u003cem\u003eIl22\u003c/em\u003e\u003csup\u003e\u003cem\u003e+/+\u003c/em\u003e\u003c/sup\u003e and \u003cem\u003eIl22\u003c/em\u003e\u003csup\u003e\u003cem\u003e-/-\u003c/em\u003e\u003c/sup\u003e mice at 9 dpi. \u003cstrong\u003e(E, G-I)\u003c/strong\u003e cytokines levels from the distal colonic explant cultures, IFNγ \u003cstrong\u003e(E)\u003c/strong\u003e, IL-17A \u003cstrong\u003e(G)\u003c/strong\u003e, IL-17F \u003cstrong\u003e(H)\u003c/strong\u003e and IL-10 \u003cstrong\u003e(I)\u003c/strong\u003e. \u003cstrong\u003e(F)\u003c/strong\u003e Proteomics analysis of IFNγ-mediated proteins in colonic IECs. Each point represents an individual mouse (A-B, E, G-I). Data shown are pooled values from 2 (A-B) or 3 (E, G-I) biological repeats with 3-5 mice per group. Refer to Table S4 for the exact number of mice used for experimental groups. P values were determined on data plotted as Mean ± SEM using One-way ANOVA (A-B) and Two-way ANOVA (E, G-I) on logarithmic transformed values with Bonferroni post-test for multiple comparisons. *, p \u0026lt; 0.05; ***, p \u0026lt; 0.001; ns, non-significant.\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-6122641/v1/84bc7eb842cb7b4407242f27.png"},{"id":78110483,"identity":"96850ce7-bb71-48ee-97dd-855231dbe004","added_by":"auto","created_at":"2025-03-10 04:56:04","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":971703,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eIL-22 is dispensable for intestinal recovery post CR infection. (A)\u003c/strong\u003e Colon length. \u003cstrong\u003e(B)\u003c/strong\u003e Representative images of large intestine. \u003cstrong\u003e(C)\u003c/strong\u003e Colon weight-to-length ratio. \u003cstrong\u003e(D)\u003c/strong\u003eRepresentative images of H\u0026amp;E-stained distal colon sections. Scale 200 μm. \u003cstrong\u003e(E)\u003c/strong\u003ePCA analysis of differentially regulated proteins in colonic IECs at 9 and 20 dpi. Data shown are pooled values from 2 biological repeats, with 3-5 mice in per group. Each point represents an individual mouse. Refer to Table S4 for the exact number of mice used for experimental groups. P values were determined on data plotted as Mean ± SEM using Two-way ANOVA with Bonferroni post-test for multiple comparisons. *, p \u0026lt; 0.05; **, p \u0026lt; 0.01; ns, non-significant.\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-6122641/v1/e293b62302758eb4ff30f2f9.png"},{"id":99935284,"identity":"1c62e9f5-fa9d-4d8c-8332-e49118233a96","added_by":"auto","created_at":"2026-01-10 08:10:02","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":4791118,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6122641/v1/b2cc94c9-75b1-4d51-aaad-04bd28532a79.pdf"},{"id":78111358,"identity":"17667808-221c-4b48-8d28-53aaa6b621bd","added_by":"auto","created_at":"2025-03-10 05:12:05","extension":"pdf","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":1350100,"visible":true,"origin":"","legend":"Supp","description":"","filename":"SuppMaterialIL22.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6122641/v1/46c9f91e38dfba26199e8ac1.pdf"}],"financialInterests":"There is \u003cb\u003eNO\u003c/b\u003e Competing Interest.","formattedTitle":"Rehydration rescues Il22-/- mice from lethal Citrobacter rodentium infection","fulltext":[{"header":"Significance Statement","content":"\u003cp\u003eIL-22 is considered essential for host survival during \u003cem\u003eC. rodentium\u003c/em\u003e infection, yet the cause of mortality was inconclusive. Here, we show that \u003cem\u003eIl22\u003csup\u003e-/-\u003c/sup\u003e\u003c/em\u003e mice succumb due to dehydration, and that Fluid therapy prevents mortality, revealing IL-22-independent recovery mechanisms. These findings overturn the prevailing paradigm that IL-22 is indispensable for host survival, redefining its role in mucosal immunity.\u003c/p\u003e"},{"header":"Introduction","content":"\u003cp\u003e \u003cem\u003eCitrobacter rodentium\u003c/em\u003e (CR) is the aetiological agent of transmissible murine colonic crypt hyperplasia\u003csup\u003e\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u003c/sup\u003e. CR is an extracellular Gram-negative mouse-specific pathogen; it causes self-limiting infection in C57BL/6 mice, which develop colitis and mild diarrhoea\u003csup\u003e\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u003c/sup\u003e. Infection of mice with CR serves as a robust preclinical model for studying enteric infections (e.g. pathogenic \u003cem\u003eE. coli\u003c/em\u003e), colitis and gut recovery following epithelial damage\u003csup\u003e\u003cspan additionalcitationids=\"CR3\" citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e\u003c/sup\u003e. CR infection disrupts intestinal homeostasis by subverting signalling in intestinal epithelial cells (IECs), compromising barrier integrity, and inducing inflammatory responses\u003csup\u003e\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e,\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e,\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e\u003c/sup\u003e. Host defence mechanisms against CR rely on type 3 immunity, characterised by production of interleukin (IL)-17 and IL-22, which plays a critical role in mucosal immunity\u003csup\u003e\u003cspan additionalcitationids=\"CR6 CR7\" citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003ePerturbation of the gut barrier, either chemically via dextran sulphate sodium (DSS) or by CR, \u003cem\u003eSalmonella Typhimurium\u003c/em\u003e, or \u003cem\u003eClostridioides difficile\u003c/em\u003e infection, triggers secretion of IL-22\u003csup\u003e9\u0026ndash;11\u003c/sup\u003e. IL-22, a member of the IL-10 family of cytokines, is produced primarily by group 3 innate lymphoid cells (ILC3s) and Th17/Th22 cells\u003csup\u003e\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e,\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e,\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e\u003c/sup\u003e. ILC3s serve as the primary source of IL-22 during the early phase of CR infection where it targets superficial IECs\u003csup\u003e\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e\u003c/sup\u003e. Recent findings showed that a brief ciprofloxacin treatment administered 4 days post infection (dpi) induces persistent ILC3 activation\u003csup\u003e\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u003c/sup\u003e. These \"trained\" ILC3s exhibit an enhanced capacity to produce IL-22, conferring greater protection against subsequent infections\u003csup\u003e\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e,\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u003c/sup\u003e. As the infection burden increases and CR colonizes a large surface of the colonic mucosa, IL-22 production shifts from ILC3s to CD4\u003csup\u003e+\u003c/sup\u003e T cells. CD4\u003csup\u003e+\u003c/sup\u003e T cell-derived IL-22 plays a crucial role in preventing bacterial invasion of colonic crypts and limiting systemic dissemination\u003csup\u003e\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e,\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eIL-22 exerts its effects on IECs through binding to the IL-22 receptor, composed of an IL-22R1 and IL-10R2 heterodimer\u003csup\u003e\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e,\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e\u003c/sup\u003e. Binding to the IL-22R triggers activation of the Jak kinase Stat transcription factor pathway, predominantly Jak1, Tyk2 and STAT3\u003csup\u003e8,10,15\u003c/sup\u003e. Upon phosphorylation, STAT3 dimers translocate to the nucleus where they function as transcriptional activators, regulating expression of antimicrobial proteins (AMPs) and multiple cellular functions, including chemotaxis, proliferation, acute-phase responses, innate immunity, inflammation and tissue healing\u003csup\u003e\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e,\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e\u003c/sup\u003e. Amongst the STAT3 regulated proteins are calprotectin (S100A8/S100A9 heterodimer) \u003csup\u003e\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e\u003c/sup\u003e, a metal (Mn- and Zn)-sequestering complex, LCN-2\u003csup\u003e17\u003c/sup\u003e, which inhibits bacterial growth by sequestering the siderophore enterobactin, and Reg family of AMPs\u003csup\u003e\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u003c/sup\u003e. The IL-22-STAT3 axis enhances epithelial barrier integrity by upregulating tight junction proteins (e.g., claudins and occludins) and mucins (e.g., MUC1 and MUC2) \u003csup\u003e\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e,\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e\u003c/sup\u003e. Expression of claudins, calprotectin, LCN-2 and Reg3g are detected as early as 2- to 4-days post infection (dpi) during the CR infection cycle\u003csup\u003e\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e,\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eA seminal publication by Zheng \u003cem\u003eet al.\u003c/em\u003e showed that IL-22 is vital for protecting mice against CR infection, where 100% mortality of \u003cem\u003eIl22\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u0026minus;/\u0026minus;\u003c/em\u003e\u003c/sup\u003e mice was recorded\u003csup\u003e\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u003c/sup\u003e. Since then, there has been a concerted scientific effort aimed at determining the mechanism underpinning this phenotype\u003csup\u003e\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e,\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e,\u003cspan additionalcitationids=\"CR22 CR23 CR24\" citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e\u003c/sup\u003e. Germ-free \u003cem\u003eIl22\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u0026minus;/\u0026minus;\u003c/em\u003e\u003c/sup\u003e mice succumb to CR infection similarly to specific pathogen free \u003cem\u003eIl22\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u0026minus;/\u0026minus;\u003c/em\u003e\u003c/sup\u003e mice, suggesting that mortality is independent of gut microbiota\u003csup\u003e\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e\u003c/sup\u003e. Moreover, \u003cem\u003eStat3\u003c/em\u003e-deficient mice also succumb to CR infection\u003csup\u003e\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e\u003c/sup\u003e. However, mice deficient in several IL-22/STAT3 regulated proteins individually survive and clear the infection\u003csup\u003e\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e\u003c/sup\u003e. While \u003cem\u003eIl22\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u0026minus;/\u0026minus;\u003c/em\u003e\u003c/sup\u003e mice survive infection with CRΔ\u003cem\u003eespF\u003c/em\u003e (EspF is an effector that disrupts TJ) \u003csup\u003e\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e\u003c/sup\u003e, the precise cause of death of CR-infected \u003cem\u003eIl22\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u0026minus;/\u0026minus;\u003c/em\u003e\u003c/sup\u003e mice remains unknown. Notably, CR infection induces severe diarrheal symptoms in \u003cem\u003eIl22\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u0026minus;/\u0026minus;\u003c/em\u003e\u003c/sup\u003e mice\u003csup\u003e5,24,27\u003c/sup\u003e, raising the possibility that dehydration, rather than direct bacterial invasion or inflammation, may be the primary cause of mortality.\u003c/p\u003e \u003cp\u003eThis study aimed to determine the cause of death of \u003cem\u003eIl22\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u0026minus;/\u0026minus;\u003c/em\u003e\u003c/sup\u003e mice infected with CR. We demonstrate that severe dehydration, rather than uncontrolled bacterial burden or inability to restore the gut barrier functions, is the primary cause of fatality. Furthermore, we show that fluid therapy (FT) alone is sufficient to rescue \u003cem\u003eIl22\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u0026minus;/\u0026minus;\u003c/em\u003e\u003c/sup\u003e mice, challenging the prevailing notion that IL-22 is indispensable for survival following CR infection. Our findings suggest the existence of IL-22-independent mechanisms that can take over bacterial clearance and tissue repair functions.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e \u003cb\u003eIl22\u003c/b\u003e \u003csup\u003e \u003cb\u003e\u0026minus;/\u0026minus;\u003c/b\u003e \u003c/sup\u003e \u003cb\u003emice display signs of diarrhoea post CR infection\u003c/b\u003e\u003c/p\u003e \u003cp\u003eTo investigate the cause of death in \u003cem\u003eIl22\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u0026minus;/\u0026minus;\u003c/em\u003e\u003c/sup\u003e mice, we infected \u003cem\u003eIl22\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u0026minus;/\u0026minus;\u003c/em\u003e\u003c/sup\u003e and \u003cem\u003eIl22\u003c/em\u003e\u003csup\u003e\u003cem\u003e+/+\u003c/em\u003e\u003c/sup\u003e C57BL/6 mice with CR by oral gavage. As expected, \u003cem\u003eIl22\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u0026minus;/\u0026minus;\u003c/em\u003e\u003c/sup\u003e mice exhibited significant temporal weight loss (Fig.\u0026nbsp;1A) and reached 100% mortality by 14 dpi (Fig.\u0026nbsp;1B). Prior to reaching the endpoint, the \u003cem\u003eIl22\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u0026minus;/\u0026minus;\u003c/em\u003e\u003c/sup\u003e mice developed severe diarrhoea, characterized by visibly loose stool and faecal matter adhering to the cage walls (Fig.\u0026nbsp;1C). To quantitatively assess diarrhoea severity, we measured faecal water content, which was significantly higher in infected \u003cem\u003eIl22\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u0026minus;/\u0026minus;\u003c/em\u003e\u003c/sup\u003e compared to \u003cem\u003eIl22\u003c/em\u003e\u003csup\u003e\u003cem\u003e+/+\u003c/em\u003e\u003c/sup\u003e mice at 6 dpi (Fig.\u0026nbsp;1D). Additionally, infected \u003cem\u003eIl22\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u0026minus;/\u0026minus;\u003c/em\u003e\u003c/sup\u003e mice exhibited sodium and potassium ion losses in faecal samples, suggesting electrolyte imbalance as a contributing factor to disease severity (Fig.\u0026nbsp;1E-F).\u003c/p\u003e \u003cp\u003eGiven the severe diarrheal phenotype observed in \u003cem\u003eIl22\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u0026minus;/\u0026minus;\u003c/em\u003e\u003c/sup\u003e mice, we next sought to identify epithelial cell perturbations contributing to fluid and electrolyte imbalance. To this end, we performed deep quantitative proteomics analysis on colonic IECs isolated from infected \u003cem\u003eIl22\u003c/em\u003e\u003csup\u003e\u003cem\u003e+/+\u003c/em\u003e\u003c/sup\u003e and \u003cem\u003eIl22\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u0026minus;/\u0026minus;\u003c/em\u003e\u003c/sup\u003e mice at 9 dpi. Among the 7,730 quantified proteins, 861 were differentially expressed between \u003cem\u003eIl22\u003c/em\u003e\u003csup\u003e\u003cem\u003e+/+\u003c/em\u003e\u003c/sup\u003e and \u003cem\u003eIl22\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u0026minus;/\u0026minus;\u003c/em\u003e\u003c/sup\u003e mice post-infection (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05, |log2FC| \u0026gt; 0.5) (Fig.\u0026nbsp;2A). Gene set enrichment analysis of these differentially regulated proteins revealed significant downregulation of pathways associated with ion transport (Fig.\u0026nbsp;2B). \u003cem\u003eIl22\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u0026minus;/\u0026minus;\u003c/em\u003e\u003c/sup\u003e mice exhibited a notable dysregulation of key ion transporters and regulators involved in electrolyte and water absorption in the colon (Fig.\u0026nbsp;2C). We validated the downregulation of key ion transporters implicated in electrolyte and water absorption\u003csup\u003e\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e\u003c/sup\u003e by qRT-PCR (Fig.\u0026nbsp;2D), including Chloride anion exchanger (\u003cem\u003eSlc26a3\u003c/em\u003e), a chloride-bicarbonate exchanger essential for chloride absorption, Carbonic anhydrases 2 (\u003cem\u003eCa2\u003c/em\u003e) and 4 (\u003cem\u003eCa4\u003c/em\u003e) involved in bicarbonate absorption, Aquaporin-8 (\u003cem\u003eAqp8\u003c/em\u003e) which facilitates water absorption, \u003cem\u003eSlc5a8\u003c/em\u003e which functions as a sodium-coupled transporter for short-chain fatty acids, D-lactate, and monocarboxylates and \u003cem\u003eSlc15a1\u003c/em\u003e (\u003cem\u003ePept1\u003c/em\u003e) a proton-dependent peptide transporter that absorbs di-/tripeptides. The combined downregulation of these transporters provides a mechanistic basis for the severe diarrhoea phenotype observed in infected \u003cem\u003eIl22\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u0026minus;/\u0026minus;\u003c/em\u003e\u003c/sup\u003e mice.\u003c/p\u003e \u003cp\u003e \u003cb\u003eDehydration is the primary cause of mortality in\u003c/b\u003e \u003cb\u003eIl22\u003c/b\u003e\u003csup\u003e\u003cb\u003e\u0026minus;/\u0026minus;\u003c/b\u003e\u003c/sup\u003e \u003cb\u003emice post-CR infection\u003c/b\u003e\u003c/p\u003e \u003cp\u003eSince \u003cem\u003eIl22\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u0026minus;/\u0026minus;\u003c/em\u003e\u003c/sup\u003e mice exhibited significant downregulation of key ion transporters responsible for electrolyte absorption, we hypothesized that dehydration was the primary cause of mortality. To test this hypothesis, we implemented a fluid therapy (FT) regimen aimed at restoring hydration status and assessing its impact on survival (Fig.\u0026nbsp;3A). Starting at 5 dpi, coinciding with the onset of diarrhoea, infected \u003cem\u003eIl22\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u0026minus;/\u0026minus;\u003c/em\u003e\u003c/sup\u003e mice received daily subcutaneous injections of a balanced salt solution along with wet food until 20 dpi (Fig.\u0026nbsp;3A, see methods and Table \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e for details).\u003c/p\u003e \u003cp\u003eWhile treated mice continued to present diarrhoea (Fig.\u0026nbsp;3B), FT successfully normalized serum dehydration parameters in \u003cem\u003eIl22\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u0026minus;/\u0026minus;\u003c/em\u003e\u003c/sup\u003e mice\u003csup\u003e29\u003c/sup\u003e. Compared to the untreated \u003cem\u003eIl22\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u0026minus;/\u0026minus;\u003c/em\u003e\u003c/sup\u003e mice, FT-treated \u003cem\u003eIl22\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u0026minus;/\u0026minus;\u003c/em\u003e\u003c/sup\u003e mice exhibited significantly lower total serum protein concentration (Fig.\u0026nbsp;3C). \u003cem\u003eIl22\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u0026minus;/\u0026minus;\u003c/em\u003e\u003c/sup\u003e mice exhibited significantly elevated serum renin and corticosterone levels compared to \u003cem\u003eIl22\u003c/em\u003e\u003csup\u003e\u003cem\u003e+/+\u003c/em\u003e\u003c/sup\u003e mice; however, FT treatment normalized these levels to those of \u003cem\u003eIl22\u003c/em\u003e\u003csup\u003e\u003cem\u003e+/+\u003c/em\u003e\u003c/sup\u003e mice (Fig.\u0026nbsp;3D-E). Moreover, clinical assessment revealed a substantial improvement in hydration status in FT-treated mice, with reductions in ruffled coat appearance, increased skin turgor, improved posture, and enhanced mobility compared to untreated \u003cem\u003eIl22\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u0026minus;/\u0026minus;\u003c/em\u003e\u003c/sup\u003e mice (Table S2). These findings suggest FT reverses the dehydration observed in infected \u003cem\u003eIl22\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u0026minus;/\u0026minus;\u003c/em\u003e\u003c/sup\u003e mice. Acute renal failure is a key consequence of dehydration\u003csup\u003e\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e,\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e\u003c/sup\u003e. To assess renal function, we measured cystatin C levels and found them significantly elevated in \u003cem\u003eIl22\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u0026minus;/\u0026minus;\u003c/em\u003e\u003c/sup\u003e mice, which was reversed by FT treatment (Fig.\u0026nbsp;3F). Importantly, administration of FT resulted in complete survival of CR-infected \u003cem\u003eIl22\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u0026minus;/\u0026minus;\u003c/em\u003e\u003c/sup\u003e mice, indicating that dehydration is the primary driver of mortality (Fig.\u0026nbsp;3G). While FT did not prevent weight loss during the early phase of infection (Fig.\u0026nbsp;3H), FT-treated \u003cem\u003eIl22\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u0026minus;/\u0026minus;\u003c/em\u003e\u003c/sup\u003e mice began to recover from 9 dpi, ultimately regaining body weight comparable to that of \u003cem\u003eIl22\u003c/em\u003e\u003csup\u003e\u003cem\u003e+/+\u003c/em\u003e\u003c/sup\u003e mice by 20 dpi (Fig.\u0026nbsp;3H). Additionally, faecal bacterial loads were similar between FT-treated and untreated \u003cem\u003eIl22\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u0026minus;/\u0026minus;\u003c/em\u003e\u003c/sup\u003e mice during the early infection phase, however, FT-treated mice successfully cleared CR at rates comparable to the \u003cem\u003eIl22\u003c/em\u003e\u003csup\u003e\u003cem\u003e+/+\u003c/em\u003e\u003c/sup\u003e mice during the later infection phase (Fig.\u0026nbsp;3I). Furthermore, recovered \u003cem\u003eIl22\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u0026minus;/\u0026minus;\u003c/em\u003e\u003c/sup\u003e mice were protected from secondary CR challenge (Fig. \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003eA), as evidenced by no weight loss (Fig. \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003eB), absence of diarrhoea (Fig. \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003eC), and efficient clearance of CR by 6 dpi (Fig. \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003eD).\u003c/p\u003e \u003cp\u003e \u003cb\u003eFT does not mitigate CR-mediated pathology in\u003c/b\u003e \u003cb\u003eIl22\u003c/b\u003e\u003csup\u003e\u003cb\u003e\u0026minus;/\u0026minus;\u003c/b\u003e\u003c/sup\u003e \u003cb\u003emice\u003c/b\u003e\u003c/p\u003e \u003cp\u003eWhile FT successfully prevented mortality in \u003cem\u003eIl22\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u0026minus;/\u0026minus;\u003c/em\u003e\u003c/sup\u003e mice, it remained unclear whether it mitigated underlying tissue pathology caused by the infection. We therefore examined CR-mediated pathology in both FT-treated and untreated \u003cem\u003eIl22\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u0026minus;/\u0026minus;\u003c/em\u003e\u003c/sup\u003e mice. Necropsy analysis at 9 dpi revealed that FT did not reduce systemic bacterial dissemination, as comparable levels of CR were detected in the liver (Fig.\u0026nbsp;4A) and spleen (Fig.\u0026nbsp;4B) of both FT-treated and untreated \u003cem\u003eIl22\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u0026minus;/\u0026minus;\u003c/em\u003e\u003c/sup\u003e mice. Immunohistochemistry analysis of colonic tissue showed no differences in epithelial barrier disruption, with both groups displaying a similar loss of E-cadherin expression (Fig.\u0026nbsp;4C).\u003c/p\u003e \u003cp\u003eDeep quantitative proteomic analysis of colonic IECs from infected \u003cem\u003eIl22\u003c/em\u003e\u003csup\u003e\u003cem\u003e+/+\u003c/em\u003e\u003c/sup\u003e and \u003cem\u003eIl22\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u0026minus;/\u0026minus;\u003c/em\u003e\u003c/sup\u003e mice, with or without FT, compared to uninfected mice revealed no global differences in protein expression between FT-treated and untreated \u003cem\u003eIl22\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u0026minus;/\u0026minus;\u003c/em\u003e\u003c/sup\u003e mice (Fig.\u0026nbsp;4D). These findings suggest that FT does not directly modulate the epithelial proteome but instead functions as a supportive measure to counteract dehydration.\u003c/p\u003e \u003cp\u003eWe then examined whether FT had an impact on local inflammatory responses by assessing cytokine levels in the colonic explant cultures. As expected, these showed no detectable IL-22 in \u003cem\u003eIl22\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u0026minus;/\u0026minus;\u003c/em\u003e\u003c/sup\u003e mice (Fig. S2A). IL-22 antagonizes IFNγ-mediated signalling\u003csup\u003e\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e\u003c/sup\u003e, and consequently, CR-infected \u003cem\u003eIl22\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u0026minus;/\u0026minus;\u003c/em\u003e\u003c/sup\u003e mice display enhanced IFNγ-induced genes and pathways\u003csup\u003e\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e,\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u003c/sup\u003e. Both FT-treated and untreated \u003cem\u003eIl22\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u0026minus;/\u0026minus;\u003c/em\u003e\u003c/sup\u003e mice exhibited significantly higher colonic IFNγ (Fig.\u0026nbsp;4E) and TNF (Fig. S2B), compared to \u003cem\u003eIl22\u003c/em\u003e\u003csup\u003e\u003cem\u003e+/+\u003c/em\u003e\u003c/sup\u003e mice. Consistently, FT did not alter IFNγ-regulated proteins in the IECs of \u003cem\u003eIl22\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u0026minus;/\u0026minus;\u003c/em\u003e\u003c/sup\u003e mice (Fig.\u0026nbsp;4F). \u003cem\u003eIl22\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u0026minus;/\u0026minus;\u003c/em\u003e\u003c/sup\u003e mice, with or without FT treatment, exhibited similar levels of IL-6 (Fig. S2C) and IL-17A secretion post-infection as \u003cem\u003eIl22\u003c/em\u003e\u003csup\u003e\u003cem\u003e+/+\u003c/em\u003e\u003c/sup\u003e mice (Fig.\u0026nbsp;4G). However, FT-treated \u003cem\u003eIl22\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u0026minus;/\u0026minus;\u003c/em\u003e\u003c/sup\u003e mice displayed significantly higher levels of IL-17F and IL-10 compared to untreated controls (Fig.\u0026nbsp;4H-I).\u003c/p\u003e \u003cp\u003eIn agreement with the proteomics analysis and key pro-inflammatory cytokines levels, further post-mortem analysis confirmed that FT did not alleviate CR-induced colonic damage in the \u003cem\u003eIl22\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u0026minus;/\u0026minus;\u003c/em\u003e\u003c/sup\u003e mice at 9 dpi. Compared to \u003cem\u003eIl22\u003c/em\u003e\u003csup\u003e\u003cem\u003e+/+\u003c/em\u003e\u003c/sup\u003e-infected controls, CR-infected \u003cem\u003eIl22\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u0026minus;/\u0026minus;\u003c/em\u003e\u003c/sup\u003e mice, regardless of FT administration, exhibited significantly greater colon shortening (Fig.\u0026nbsp;5A-B) and an increased colon weight-to-length ratio (Fig.\u0026nbsp;5C), indicative of heightened inflammation and epithelial erosion\u003csup\u003e\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e\u003c/sup\u003e. Histological examination via haematoxylin and eosin (H\u0026amp;E) staining revealed comparable levels of epithelial damage, crypt loss, mucus layer depletion, mucosal thickening, and immune cell infiltration in both FT-treated and untreated \u003cem\u003eIl22\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u0026minus;/\u0026minus;\u003c/em\u003e\u003c/sup\u003e mice (Fig.\u0026nbsp;5D). These findings demonstrate that while FT effectively counteracts dehydration, it does not ameliorate the pathological effects of CR infection in the colon of \u003cem\u003eIl22\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u0026minus;/\u0026minus;\u003c/em\u003e\u003c/sup\u003e mice.\u003c/p\u003e \u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eIL-22 is dispensable for intestinal recovery post-CR infection\u003c/h2\u003e \u003cp\u003eDespite the persistence of CR-mediated pathology, FT-treated \u003cem\u003eIl22\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u0026minus;/\u0026minus;\u003c/em\u003e\u003c/sup\u003e mice displayed substantial recovery of colonic epithelial integrity over time. By 20 dpi, FT-treated \u003cem\u003eIl22\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u0026minus;/\u0026minus;\u003c/em\u003e\u003c/sup\u003e mice exhibited increased colon length, although still shorter than that of \u003cem\u003eIl22\u003c/em\u003e\u003csup\u003e\u003cem\u003e+/+\u003c/em\u003e\u003c/sup\u003e mice (Fig.\u0026nbsp;5A-B). By 48 dpi, further recovery in colon length was observed (Fig.\u0026nbsp;5A-B). Histological analysis of colonic sections revealed that CR-infected \u003cem\u003eIl22\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u0026minus;/\u0026minus;\u003c/em\u003e\u003c/sup\u003e mice receiving FT exhibited substantial epithelial recovery by 20 dpi, with full restoration by 48 dpi (Fig.\u0026nbsp;5D), showing no discernible differences compared to \u003cem\u003eIl22\u003c/em\u003e\u003csup\u003e\u003cem\u003e+/+\u003c/em\u003e\u003c/sup\u003e controls. This recovery was accompanied by normalization of the colon weight-to-length ratio (Fig.\u0026nbsp;5C), further supporting the notion that epithelial regeneration occurs independently of IL-22. These findings suggest that IL-22 is not required for long-term intestinal recovery.\u003c/p\u003e \u003cp\u003eConsistently, the quantitative proteomics analysis of colonic IECs showed that unlike at 9 dpi, FT-treated \u003cem\u003eIl22\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u0026minus;/\u0026minus;\u003c/em\u003e\u003c/sup\u003e mice clustered with \u003cem\u003eIl22\u003c/em\u003e\u003csup\u003e\u003cem\u003e+/+\u003c/em\u003e\u003c/sup\u003e mice at 20 dpi, indicating comparable recovery at the molecular level (Fig.\u0026nbsp;5E). These results support the notion that alternative pathways can compensate for the absence of IL-22 in promoting epithelial healing and barrier restoration post-infection.\u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eOur study demonstrates that the cause of death of CR-infected \u003cem\u003eIl22\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u0026minus;/\u0026minus;\u003c/em\u003e\u003c/sup\u003e mice is dehydration rather than an inability to control bacterial proliferation or maintain/recover epithelial barrier integrity (Fig. S3). These findings challenge the prevailing dogma regarding the indispensability of IL-22 during CR infection.\u003c/p\u003e\n\u003cp\u003ePrevious studies have established IL-22 as a critical mediator in host defence against CR infection\u003csup\u003e\u003cspan class=\"CitationRef\"\u003e5\u003c/span\u003e\u0026ndash;\u003cspan class=\"CitationRef\"\u003e7\u003c/span\u003e,\u003cspan class=\"CitationRef\"\u003e10\u003c/span\u003e\u003c/sup\u003e. \u003cem\u003eIl22\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u0026minus;/\u0026minus;\u003c/em\u003e\u003c/sup\u003e mice exhibit increased intestinal epithelial damage, higher systemic bacterial burden, and 100% mortality following CR infection. Some studies attributed mortality to IL-22\u0026rsquo;s role in inducing AMPs such as Reg3\u0026beta; and Reg3\u0026gamma;\u003csup\u003e6,10\u003c/sup\u003e, essential for bacterial control. However, mice lacking these AMPs individually survived CR infection\u003csup\u003e\u003cspan class=\"CitationRef\"\u003e25\u003c/span\u003e\u003c/sup\u003e, suggesting that IL-22\u0026rsquo;s protective effects extend beyond AMPs induction. Our findings indicate that the mortality in \u003cem\u003eIl22\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u0026minus;/\u0026minus;\u003c/em\u003e\u003c/sup\u003e mice is primarily due to diarrhoea, leading to ion loss and subsequent dehydration. Proteomic analyses revealed a marked downregulation of key ion transporters and their regulators, including Slc26a3, Aqp8, Ca2, Ca4, Slc5a8, and Slc15a1, which are vital for electrolyte and water absorption in the colon\u003csup\u003e\u003cspan class=\"CitationRef\"\u003e28\u003c/span\u003e,\u003cspan class=\"CitationRef\"\u003e34\u003c/span\u003e\u003c/sup\u003e. This impairment results in excessive fluid loss, underscoring a previously underappreciated role that IL-22 may play in maintaining electrolyte homeostasis during enteric infections.\u003c/p\u003e\n\u003cp\u003eThe role of hydration status in modulating immune responses has recently gained attention\u003csup\u003e\u003cspan class=\"CitationRef\"\u003e35\u003c/span\u003e,\u003cspan class=\"CitationRef\"\u003e36\u003c/span\u003e\u003c/sup\u003e. Water-restricted mice, which exhibit lower faecal water content and constipation, display an impaired ability to eliminate CR and reduced immune cell populations, including B cells, CD4\u003csup\u003e+\u003c/sup\u003e, and CD8\u003csup\u003e+\u003c/sup\u003e T cells in the colon\u003csup\u003e\u003cspan class=\"CitationRef\"\u003e35\u003c/span\u003e\u003c/sup\u003e. Similarly, downregulation of \u003cem\u003eAqp3\u003c/em\u003e is associated with inflammatory and infectious diarrhoea, and \u003cem\u003eAqp3\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u0026minus;/\u0026minus;\u003c/em\u003e\u003c/sup\u003e mice exhibit diminished populations of Th17 and Treg cells\u003csup\u003e\u003cspan class=\"CitationRef\"\u003e35\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003eImplementing a FT regimen effectively mitigated dehydration in \u003cem\u003eIl22\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u0026minus;/\u0026minus;\u003c/em\u003e\u003c/sup\u003e mice, normalizing serum dehydration parameters and improving clinical signs without directly affecting bacterial load, systemic dissemination, colonic damage, or expression of major pro-inflammatory markers. FT did not influence epithelial barrier breakdown, faecal bacterial load, or systemic dissemination of CR in \u003cem\u003eIl22\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u0026minus;/\u0026minus;\u003c/em\u003e\u003c/sup\u003e mice. However, FT-treated \u003cem\u003eIl22\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u0026minus;/\u0026minus;\u003c/em\u003e\u003c/sup\u003e mice cleared CR infection and survived, demonstrating that bacterial clearance can occur in the absence of IL-22 and that systemic dissemination of CR was not the primary cause of mortality, as previously reported\u003csup\u003e\u003cspan class=\"CitationRef\"\u003e5\u003c/span\u003e,\u003cspan class=\"CitationRef\"\u003e24\u003c/span\u003e\u003c/sup\u003e. \u003cem\u003eIl22ra1\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u0026minus;/\u0026minus;\u003c/em\u003e\u003c/sup\u003e mice were shown to succumb to CR infection due to systemic dissemination of \u003cem\u003eEnterococcus faecalis\u003c/em\u003e\u003csup\u003e\u003cspan class=\"CitationRef\"\u003e23\u003c/span\u003e\u003c/sup\u003e. However, germ-free \u003cem\u003eIl22\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u0026minus;/\u0026minus;\u003c/em\u003e\u003c/sup\u003e mice continued to succumb to CR infection, suggesting a microbiota-independent mechanism\u003csup\u003e\u003cspan class=\"CitationRef\"\u003e24\u003c/span\u003e\u003c/sup\u003e. Notably, germ-free \u003cem\u003eIl22\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u0026minus;/\u0026minus;\u003c/em\u003e\u003c/sup\u003e mice exhibited severe diarrhoea post-CR infection\u003csup\u003e\u003cspan class=\"CitationRef\"\u003e24\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003eWith adequate treatment of dehydration, \u003cem\u003eIl22\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u0026minus;/\u0026minus;\u003c/em\u003e\u003c/sup\u003e mice demonstrated substantial recovery of colonic architecture and function by 20 dpi, achieving complete restoration by day 48. Recovered \u003cem\u003eIl22\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u0026minus;/\u0026minus;\u003c/em\u003e\u003c/sup\u003e mice were also protected from rechallenge with CR, indicating that mucosal adaptive immunity remains intact in the absence of IL-22. These findings suggest that while IL-22 contributes to epithelial maintenance during infection, it is dispensable and can be compensated by IL-22-independent mechanisms.\u003c/p\u003e\n\u003cp\u003eIL-17A, IL-17F, IL-6, and IL-10 perform overlapping functions when IL-22 is limited\u003csup\u003e\u003cspan class=\"CitationRef\"\u003e37\u003c/span\u003e\u0026ndash;\u003cspan class=\"CitationRef\"\u003e40\u003c/span\u003e\u003c/sup\u003e. \u003cem\u003eIl22\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u0026minus;/\u0026minus;\u003c/em\u003e\u003c/sup\u003e mice, with or without FT, displayed induction of IL-17A, IL-17F, and IL-10 upon infection. However, FT-treated \u003cem\u003eIl22\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u0026minus;/\u0026minus;\u003c/em\u003e\u003c/sup\u003e mice exhibited significantly higher IL-17F and IL-10 levels compared to untreated controls, suggesting a plausible mechanism for IL-22-independent recovery. IL-17A and IL-17F, co-produced with IL-22 by Th17 cells, enhance the production of critical AMPs such as Reg3\u0026beta; and Reg3\u0026gamma;\u003csup\u003e37,40,41\u003c/sup\u003e, reinforcing epithelial defence mechanisms. IL-6 signals through the gp130 receptor complex to activate STAT3 in intestinal epithelial cells\u003csup\u003e\u003cspan class=\"CitationRef\"\u003e38\u003c/span\u003e\u003c/sup\u003e, promoting cell survival, proliferation, and tissue repair. Additionally, IL-10, known for its potent anti-inflammatory properties\u003csup\u003e\u003cspan class=\"CitationRef\"\u003e39\u003c/span\u003e,\u003cspan class=\"CitationRef\"\u003e42\u003c/span\u003e\u003c/sup\u003e, tempers excessive inflammation and further supports mucosal homeostasis. Collectively, these cytokines form a network that may lead to epithelial recovery in absence of IL-22.\u003c/p\u003e\n\u003cp\u003eTaken together, our data demonstrate that, contrary to prevailing views, IL-22 is dispensable for protecting mice from CR infection. \u003cem\u003eIl22\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u0026minus;/\u0026minus;\u003c/em\u003e\u003c/sup\u003e mice succumb due to dehydration and excessive fluid losses secondary to diarrhoea rather than an inability to restore gut barrier functions. FT rescues \u003cem\u003eIl22\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u0026minus;/\u0026minus;\u003c/em\u003e\u003c/sup\u003e mice by providing physiological support, enabling bacterial clearance and tissue repair via IL-22-independent mechanisms. Although FT did not mitigate initial tissue damage or reduce diarrhoea, it facilitated colonic epithelial recovery over time, underscoring the importance of supportive therapies in enhancing host resilience during enteric infections. Further studies are warranted to elucidate IL-22-independent mechanisms of epithelial regeneration and their therapeutic potential.\u003c/p\u003e\n\u003cp\u003eThe administration of supportive therapy is common in clinical care but is rarely applied to animal models of disease. By enhancing the physiological relevance of murine models, our findings offer new avenues for therapeutic interventions that complement host defence mechanisms.\u003c/p\u003e"},{"header":"Material and methods","content":"\u003cp\u003e\u003cstrong\u003eMouse experiments.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eMouse experiments were performed in accordance with the Animals Scientific Procedures Act of 1986 and were approved by the local Ethical Review Committee according to UK Home Office guidelines. The \u003cem\u003eIl22\u003c/em\u003e\u003csup\u003e\u003cem\u003e+/+\u003c/em\u003e\u003c/sup\u003e and \u003cem\u003eIl22\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u0026minus;/\u0026minus;\u003c/em\u003e\u003c/sup\u003e mice from same founder mice were maintained in homozygous condition and were housed and bred in dedicated animal facilities of Imperial College London (12h light/dark cycle; 22\u0026thinsp;\u0026plusmn;\u0026thinsp;2\u0026deg;C; 30 to 40% humidity). Mice were housed in IVC cages with corn cob bedding and enrichments including nesting material, refuges, and gnawing sticks. Mice were fed with RM1(E) rodent diet (SDS Diet) and water ad libitum. Male mice (age 2\u0026ndash;4 months, 25 to 30 grams weight) were used for experiments. All mice were genotyped and tested for the presence or absence of iCre using multiplex PCR as described\u003csup\u003e\u003cspan class=\"CitationRef\"\u003e43\u003c/span\u003e\u003c/sup\u003e. The sequences of primers (5\u0026rsquo; to 3\u0026rsquo;) used: Forward, CAGGCTCTCCTCTCAGTTATCA; Wildtype reverse, TCCTGAAGGCCAAAATAGG; Mutant reverse, CCTCAGGTTCAGCAGGG AAC.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCR infection.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCR (strain ICC169) was grown overnight in lysogeny broth at 37\u0026deg;C with shaking at 180 rpm, centrifuged at 2500 x g for 10 min and resuspended in sterile PBS. Mice were infected with approximately 1 x 10\u003csup\u003e9\u003c/sup\u003e CFU in 200 \u0026micro;L sterile PBS using oral gavage, as previously described\u003csup\u003e\u003cspan class=\"CitationRef\"\u003e1\u003c/span\u003e\u003c/sup\u003e. Mock infected (uninfected/0 dpi) mice received 200 \u0026micro;L sterile PBS. The inoculum CFU was confirmed by CFU quantification as previously described\u003csup\u003e\u003cspan class=\"CitationRef\"\u003e1\u003c/span\u003e\u003c/sup\u003e. Mice were monitored every day for changes in weight and disease severity was scored for four parameters: coat fur, posture, skin turgor and mobility; scores ranged from 0 to 5, wherein 0 scores for a healthy mouse. Humane end points were met if a mouse lost 20% of its body weight or if a disease score of 3 or more was observed for more than 2 consecutive days.\u003c/p\u003e\n\u003ch3\u003eMeasurement of faecal water, Sodium and Potassium content and CR shedding\u003c/h3\u003e\n\u003cp\u003eTo determine the faecal water content, faeces were freshly collected in pre-weighed 1.5 mL tubes with punctured cap. The tubes with wet faeces were weighed immediately and incubated at 55\u0026deg;C. The tubes were weighed everyday till the weight did not change and were recorded. The wet weight and dry weight of faeces was determined by subtracting the weight of the tube and faecal water content was estimated using the following equation:\u003c/p\u003e\n\u003cdiv id=\"Equa\" class=\"Equation\"\u003e\n \u003cdiv class=\"mathdisplay\" id=\"FileID_Equa\" name=\"EquationSource\"\u003e$$\\:\\%\\:water\\:content=\\:\\frac{wet\\:weight-dry\\:weight}{wet\\:weight}\\:x\\:100$$\u003c/div\u003e\n\u003c/div\u003e\n\u003cp\u003eFaecal sodium and potassium were estimated as described earlier\u003csup\u003e\u003cspan class=\"CitationRef\"\u003e44\u003c/span\u003e\u003c/sup\u003e. Briefly, dry faeces were resuspended in autoclaved double distilled water, homogenised and centrifuged at 100 x g for 1 min. The sodium and potassium content in the supernatant was estimated using LAQUAtwin meters (Horiba, Japan) and was normalised to the dry weight of faeces.\u003c/p\u003e\n\u003cp\u003eTo determine CR faecal shedding, fresh faecal samples were collected at the specified dpi, homogenised in sterile PBS, serially diluted and plated on LB-agar containing 50 mg/kg of kanamycin. For rechallenge experiments, mice were infected with approximately 1 x 10\u003csup\u003e9\u003c/sup\u003e CFU of CR, orally at 50 dpi post primary infection.\u003c/p\u003e\n\u003ch3\u003ePost-mortem pathophysiological analysis\u003c/h3\u003e\n\u003cp\u003eMice were anesthetized via intraperitoneal injection of ketamine (100 mg/kg) and medetomidine (1 mg/kg). Once pedal reflexes were absent, they were positioned in dorsal recumbency. Blood was drawn from the right ventricle using a closed approach, inserting a 25G needle at a 30\u0026deg; angle to the skin until free aspiration into a 1 ml syringe was achieved. Immediately after blood collection, mice were euthanized by cervical dislocation. The collected blood was left to clot at RT for 1 h before centrifugation at 20,000 \u0026times; g for 3 minutes. Serum was then aliquoted and stored at -80\u0026deg;C until further use.\u003c/p\u003e\n\u003cp\u003eEuthanised mice were dissected and the large intestine of mouse consisting of caecum and colon was harvested and laid down on a clean surface in parallel to a mm scale to estimate the colon length and was captured using a digital camera. Colon was removed from caecum, cleaned and weighed using a digital scale. The weight of the colon was normalised for its length and recorded. From the distal side of colon, 0.5 cm colon was stored in 4% paraformaldehyde for histological studies, next 0.5 cm was stored in RNAlater for total RNA preparation and 3.5 cm was collected for colonic IECs preparation. The liver and spleen were harvested, weighed and homogenised in sterile PBS for estimation of systemic burden of CR.\u003c/p\u003e\n\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\n \u003ch2\u003eSerum parameters\u003c/h2\u003e\n \u003cp\u003eTotal protein concentration in serum was estimated using a NanoDrop spectrophotometer (Thermo Scientific). 2 \u0026micro;l of serum sample was used to measure absorbance at 280 nm and the corresponding protein concentration was recorded. Serum renin, corticosterone and Cystatin C concentration were determined using Mouse Renin 1 ELISA Kit (ThermoFischer Scientific; catalogue number EMREN1), Corticosterone Parameter Assay Kit (Bio-techne; catalogue number KGE009) and Mouse Cystatin C DuoSet ELISA (Bio-techne; catalogue number DY1238), respectively according to manufacturer\u0026rsquo;s protocol.\u003c/p\u003e\n\u003c/div\u003e\n\u003ch3\u003eFT protocol\u003c/h3\u003e\n\u003cp\u003eInfected \u003cem\u003eIl22\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u0026minus;/\u0026minus;\u003c/em\u003e\u003c/sup\u003e mice were administered with a FT regime 5 to 20 dpi, where they were provided with wet food and three subcutaneous injections of balanced electrolyte solution, daily. To prepare wet food, RM1(E) (SDS Diet) dry food pellets (average weight of 1.1 gram/pellet) were soaked in drinking water in 50 mL tubes for 30 min, excess fluid was drained and one pellet per mouse was provided in sterile 6 cm dishes inside the cage. For subcutaneous injections, balance electrolyte solution\u003csup\u003e\u003cspan class=\"CitationRef\"\u003e45\u003c/span\u003e\u003c/sup\u003e (PlasmaLyte 148, Baxter International Inc.) was prewarmed to 37\u0026deg;C and the dose was determined based on dehydration status of mice. The dehydration status of mouse was calculated based on scoring the clinical parameters of Anorexia- a lack of appetite and body weight loss, reduced motility, coat and posture (Supplementary Table \u003cspan class=\"InternalRef\"\u003eS1\u003c/span\u003e), scores ranged from 0 to 5, wherein 0 scores for a healthy mouse. The dose of injections was calculated using following equation:\u003c/p\u003e\n\u003cp\u003eBody weight (grams) x % Dehydration (as a decimal value)\u0026thinsp;=\u0026thinsp;Fluid volume (ml)\u003c/p\u003e\n\u003cp\u003eThe volume of fluid to be administered was divided into 3 injections per day.\u003c/p\u003e\n\u003ch3\u003eHistological analysis and immunofluorescence staining\u003c/h3\u003e\n\u003cp\u003eParaformaldehyde-fixed 0.5-cm distal colon samples were processed, paraffin embedded and sectioned at 5 \u0026micro;m. The sections were then stained with either hematoxylin and eosin (H\u0026amp;E)\u003csup\u003e\u003cspan class=\"CitationRef\"\u003e1\u003c/span\u003e\u003c/sup\u003e or processed for immunofluorescence.\u003c/p\u003e\n\u003cp\u003eFor immunofluorescence staining, tissue sections were dewaxed by sequential submersion in Histo-Clear (2\u0026times;10 min), 100% ethanol (2\u0026times;10 min), 95% ethanol (2\u0026times;10 min), 80% ethanol (2\u0026times;3 min), and PBS-TS (PBS\u0026thinsp;+\u0026thinsp;0.1% Tween 20\u0026thinsp;+\u0026thinsp;0.1% saponin, 2\u0026times;3 min). Antigen retrieval was performed by heating sections for 30 min in demasking solution (0.3% trisodium citrate\u0026thinsp;+\u0026thinsp;0.05% Tween 20, pH 6.0), followed by cooling. Slides were blocked in PBS-TS with 10% normal donkey serum for 1 h in a humid chamber, then incubated overnight at 4\u0026deg;C with E-cadherin primary antibody (Abcam, ab76055; 1:100) in PBS-TS with 10% donkey serum. After rinsing twice (10 min each) in PBS-TS, sections were incubated with Alexa Fluor 488 labelled anti-mouse IgG secondary antibody (Jackson ImmunoResearch; 715-545-150), (1:100) and DAPI (1:1000), followed by additional washes. Slides were mounted using ProLong Gold antifade and cured overnight in the dark.\u003c/p\u003e\n\u003cp\u003eAll images were acquired using a Zeiss AxioVision Z1 microscope with a 20X lens objective using an AxioCam MRm camera for H\u0026amp;E and a Hamamatsu C11440 digital camera for immunofluorescence and processed using Zen 2.3 (Blue version; Carl Zeiss MicroImaging GmbH, Germany).\u003c/p\u003e\n\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\n \u003ch2\u003eCytokine profiling explants\u003c/h2\u003e\n \u003cp\u003e0.5-cm distal colonic tissue sample without faeces was weighed and incubated for 2 h in RPMI 1640 medium with glutamine (Sigma) with 100 \u0026micro;g/mL of streptomycin and 100 \u0026micro;g/mL of penicillin. Following this, explants were cultured in complete RPMI medium at 1 mL/0.1 g tissue (RPMI 1640 medium with glutamine supplemented with 10% heat-inactivated FBS, 1 mM sodium pyruvate, 100 \u0026micro;g/mL penicillin, 100 \u0026micro;g/mL streptomycin, and 10 mM HEPES) for 24 h at 37\u0026deg;C with 5% CO2. The supernatant was extracted, centrifuged for 10 min at 3,000 x g to remove cellular debris, and stored at \u0026minus;\u0026thinsp;80\u0026deg;C until further analysis.\u003c/p\u003e\n \u003cp\u003eExplant cytokine levels were assessed from the corresponding samples via LEGENDplex kit (BioLegend, catalogue number 741044) as per manufacturer\u0026rsquo;s instructions. Cytokine levels were acquired using a FACSCalibur flow cytometer (BD Biosciences), and analyses were performed using LEGENDplex data analysis software (BioLegend).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\n \u003ch2\u003eColonic IECs purification\u003c/h2\u003e\n \u003cp\u003eColonic IECs were isolated from 3.5-cm distal colonic tissue samples, as previously described\u003csup\u003e\u003cspan class=\"CitationRef\"\u003e1\u003c/span\u003e\u003c/sup\u003e. Briefly, the 3.5-cm colonic tissue sample was opened longitudinally and washed in 1X Hanks\u0026rsquo; balanced salt solution (HBSS) without Magnesium (Mg\u003csup\u003e+\u0026thinsp;2\u003c/sup\u003e) and Calcium (Ca\u003csup\u003e+\u0026thinsp;2\u003c/sup\u003e). The tissue sample was incubated at 37\u0026deg;C with shaking for 45 min in enterocyte dissociation buffer (1X HBSS without Mg\u003csup\u003e+\u0026thinsp;2\u003c/sup\u003e and Ca\u003csup\u003e+\u0026thinsp;2\u003c/sup\u003e, containing 10 mM HEPES, 1 mM EDTA, and 5 \u0026micro;L/mL 2-\u0026beta;-mercaptoethanol). The remaining tissue was removed, and lifted enterocytes were subsequently collected by centrifugation (2,000 x g for 10 min), followed by three PBS washes at 4\u0026deg;C. Colonic IEC pellets were stored at -80\u0026deg;C, till further use.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e\n \u003ch2\u003eSample Preparation and TMT Labelling\u003c/h2\u003e\n \u003cp\u003eColonic IECs from \u003cem\u003eIl22\u003c/em\u003e\u003csup\u003e\u003cem\u003e+/+\u003c/em\u003e\u003c/sup\u003e or \u003cem\u003eIl22\u003c/em\u003e\u003csup\u003e\u003cem\u003e-/-\u003c/em\u003e\u003c/sup\u003e (+/- FT) infected mice and corresponding uninfected controls were lysed using probe sonication in TEAB buffer (100 mM TEAB, 1% SDC, 1% isopropanol, 50 mM NaCl) containing protease and phosphatase inhibitors, then sonicated again before protein quantification using the Bradford assay (BioRad). Two to four mice per replicate were pooled in 1:1 ratio per sample, reduced and alkylated with 5 mM TCEP and 10 mM IAA (30 min). Proteins were digested with trypsin (75 ng/\u0026micro;L, 18 hrs, RT) and labelled with TMTpro 18-plex reagents (Thermo Scientific). SDC was precipitated with 2% formic acid and removed by centrifugation (10,000 rpm, 5 min). TMT-labelled peptides were dried using a vacuum concentrator.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e\n \u003ch2\u003eHigh-pH RP Fractionation and LC-MS Analysis\u003c/h2\u003e\n \u003cp\u003eTMT-labelled peptides were fractionated by high-pH RP-HPLC using a C18 column (Waters XBridge) with a gradient elution (5\u0026ndash;80% mobile phase B; 0.1% ammonium hydroxide in acetonitrile) at 200 \u0026micro;L/min. Ninety-two fractions were concatenated into 24, dried, and reconstituted in 0.1% formic acid. Approximately 3 \u0026micro;g of peptides per fraction were analysed on an Orbitrap Ascend mass spectrometer using a Real-Time Search-SPS-MS3 method. Peptides were separated on a nanocapillary column (Acclaim PepMap C18, 75 \u0026micro;m \u0026times; 50 cm, 2 \u0026micro;m, 100 \u0026Aring;, 120-min gradient) at 50\u0026deg;C. MS1 scans (400\u0026ndash;1600 m/z) were acquired at 120,000 resolutions with a dynamic exclusion of 45 s, with standard AGC and auto injection time, and included 2\u0026ndash;6 precursor charge states. MS2 scans were acquired in the ion trap using HCD (32% CE). SPS-MS3 scans (HCD CE 55%) were collected at 45,000 resolutions for quantification. These spectra were searched against the \u003cem\u003eMus musculus\u003c/em\u003e and \u003cem\u003eCitrobacter rodentium\u003c/em\u003e reviewed proteomes using the Comet search engine, with parameters set for tryptic peptides allowing a maximum of one missed cleavage. Static modifications included cysteine carbamidomethylation (+\u0026thinsp;57.0215) and N-terminal/lysine TMTpro (+\u0026thinsp;304.2071), with variable modifications including Asn/Gln deamidation (+\u0026thinsp;0.984) and Met oxidation (+\u0026thinsp;15.9949), allowing up to two variable modifications and a maximum of four peptides per protein. Precursors meeting these criteria were selected for SPS10-MS3 scans, performed at an Orbitrap resolution of 45,000 with normalized HCD collision energy set to 55%, AGC at 200%, and a maximum injection time of 200 ms. The mass spectrometry proteomics data have been deposited to the ProteomeXchange Consortium via the PRIDE\u003csup\u003e\u003cspan class=\"CitationRef\"\u003e46\u003c/span\u003e\u003c/sup\u003e partner repository with the dataset identifier PXD061225.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec15\" class=\"Section2\"\u003e\n \u003ch2\u003eProteomics Data Analysis\u003c/h2\u003e\n \u003cp\u003eProteomic data were median normalized to account for variations in sample loading. Log2 fold changes (log2FC) were calculated by comparing CR-infected samples to their corresponding uninfected controls. To correct for potential batch effects, the data were scaled within each biological group. Missing values in the TMT data were imputed using the minimum intensity observed within the corresponding batch. Differential protein expression between \u003cem\u003eIl22\u003c/em\u003e\u003csup\u003e\u003cem\u003e+/+\u003c/em\u003e\u003c/sup\u003e and \u003cem\u003eIl22\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u0026minus;/\u0026minus;\u003c/em\u003e\u003c/sup\u003e was assessed using two-sample t-tests (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) or ANOVA for comparisons involving \u003cem\u003eIl22\u003c/em\u003e\u003csup\u003e\u003cem\u003e+/+\u003c/em\u003e\u003c/sup\u003e and \u003cem\u003eIl22\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u0026minus;/\u0026minus;\u003c/em\u003e\u003c/sup\u003e with and without FT, as implemented in Perseus. Proteins were considered significantly up- or downregulated if they met the statistical threshold (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) and a fold-change cutoff (|log2FC| \u0026ge; 0.5). Principal component analysis (PCA) was performed based on proteins that showed significant changes in expression as determined by ANOVA (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05). The PCA plot was generated to visualize the variance in proteomic profiles between experimental conditions. Enrichment analysis of significantly regulated proteins was conducted using Fisher\u0026rsquo;s exact test, applying Benjamini-Hochberg correction to control the false discovery rate (FDR\u0026thinsp;\u0026lt;\u0026thinsp;0.05). Visualizations of significant enrichment terms were generated using the Matplotlib library in Python.\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003eQuantitative reverse transcription-PCR (qRT-PCR)\u003c/strong\u003e.\u003c/p\u003e\n \u003cp\u003e0.5 cm of distal colon was harvested and incubated in RNAlater for 24 h at 4\u0026deg;C. Total RNA extraction was performed using the RNeasy kit (Qiagen) according to the manufacturer\u0026rsquo;s protocol. Reverse transcription used 2 \u0026micro;g of purified RNA and High-capacity cDNA Reverse Transcription kit. Quantitative PCR was performed using SsoAdvanced Universal SYBR green supermix on a StepOnePlus Real-Time PCR system. Reactions were performed in duplicate, including negative control lacking cDNA. The \u0026Delta;\u0026Delta;CT method of quantification was performed to give values relative to the expression of the averaged baseline measurement. Expression was normalized to the expression of the housekeeping gene \u003cem\u003eGapdh\u003c/em\u003e. Primer pairs used are listed in supplementary Table S3.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec16\" class=\"Section2\"\u003e\n \u003ch2\u003eStatistical analysis and data plotting\u003c/h2\u003e\n \u003cp\u003eNo statistical methods were used to determine sample size. Experiments were planned as randomized blocks with 3\u0026ndash;5 animals per genotype per experiment, and experiments were repeated independently at least 2 times. The details of number of mice used for all experiments are mentioned in Table S4. Data from all mice in all experiments were pooled and analyzed. Data were plotted as Mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SEM.\u003c/p\u003e\n \u003cp\u003eStatistical significance between two normally distributed groups was performed by Student\u0026rsquo;s \u003cem\u003et\u003c/em\u003e test; when normality had not been achieved, a nonparametric Mann-Whitney test was performed. ANOVA was used to test statistical significance for more than two normally distributed groups. When data were not normally distributed (based on D\u0026rsquo;Agostino-Pearson or Shapiro-Wilk normality tests), a logarithm transformation was applied, and they were then analysed by ANOVA. Statistical analysis of proteomics data is detailed in the section above. False discovery rate (FDR; Q\u0026thinsp;=\u0026thinsp;5%) was used to correct for multiple comparisons (Bonferroni correction) as implemented in GraphPad Prism 10.4.0. FDR-adjusted p values\u0026thinsp;\u0026gt;\u0026thinsp;0.05 were considered non-significant (ns). Data plotting and statistical analysis were performed using Prism 10.4.0 (GraphPad software Inc). Statistical details of experiments are described in the figure legends.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec17\" class=\"Section2\"\u003e\n \u003ch2\u003eStudy Approval\u003c/h2\u003e\n \u003cp\u003eAll animal work was conducted at Imperial College London (Association for Assessment and Accreditation of Laboratory Animal Care accredited unit) under the auspices of the Animals (Scientific Procedures) Act (UK) 1986\u003csup\u003e47\u003c/sup\u003e (PP7392693). The animal work was approved locally by the institutional ethics committee. Experiments were designed in agreement with the ARRIVE\u003csup\u003e\u003cspan class=\"CitationRef\"\u003e48\u003c/span\u003e\u003c/sup\u003e guidelines for the reporting and execution of animal experiments.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec19\" class=\"Section2\"\u003e\u003cbr\u003e\u003c/div\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eData Availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe mass spectrometry proteomics data have been deposited in the ProteomeXchange Consortium via the PRIDE\u003csup\u003e46\u003c/sup\u003e partner repository with the dataset identifier PXD061225.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eInclusion and diversity\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe support inclusive, diverse, and equitable conduct of research.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDeclaration of competing interest\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no competing interests.\u003cstrong\u003e\u003cbr\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe thank Prof. Brigitta Stockinger, The Francis Crick Institute, for providing the \u003cem\u003eIl22\u003csup\u003e-/-\u003c/sup\u003e\u003c/em\u003e mice used to establish the colony at Imperial College. We thank Dr. Julia Sanchez-Garrido for careful reading of the paper and critical suggestions and the staff of Central Biomedical Services, Imperial for assistance in maintenance and breeding of animals. This work was supported by Wellcome Trust Investigator Award grants 107057/z/15/z and 224282/Z/21/Z.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n \u003cli\u003eCrepin, V. F., Collins, J. W., Habibzay, M. \u0026amp; Frankel, G. Citrobacter rodentium mouse model of bacterial infection. \u003cem\u003eNat Protoc\u003c/em\u003e \u003cstrong\u003e11\u003c/strong\u003e, 1851-1876 (2016). https://doi.org:10.1038/nprot.2016.100\u003c/li\u003e\n \u003cli\u003eCollins, J. W.\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e Citrobacter rodentium: infection, inflammation and the microbiota. \u003cem\u003eNat Rev Microbiol\u003c/em\u003e \u003cstrong\u003e12\u003c/strong\u003e, 612-623 (2014). https://doi.org:10.1038/nrmicro3315\u003c/li\u003e\n \u003cli\u003eKayagaki, N.\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e Non-canonical inflammasome activation targets caspase-11. \u003cem\u003eNature\u003c/em\u003e \u003cstrong\u003e479\u003c/strong\u003e, 117-121 (2011). https://doi.org:10.1038/nature10558\u003c/li\u003e\n \u003cli\u003eMundy, R., MacDonald, T. T., Dougan, G., Frankel, G. \u0026amp; Wiles, S. Citrobacter rodentium of mice and man. \u003cem\u003eCell Microbiol\u003c/em\u003e \u003cstrong\u003e7\u003c/strong\u003e, 1697-1706 (2005). https://doi.org:10.1111/j.1462-5822.2005.00625.x\u003c/li\u003e\n \u003cli\u003eZheng, Y.\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e Interleukin-22 mediates early host defense against attaching and effacing bacterial pathogens. \u003cem\u003eNat Med\u003c/em\u003e \u003cstrong\u003e14\u003c/strong\u003e, 282-289 (2008). https://doi.org:10.1038/nm1720\u003c/li\u003e\n \u003cli\u003eZindl, C. L.\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e A nonredundant role for T cell-derived interleukin 22 in antibacterial defense of colonic crypts. \u003cem\u003eImmunity\u003c/em\u003e \u003cstrong\u003e55\u003c/strong\u003e, 494-511 e411 (2022). https://doi.org:10.1016/j.immuni.2022.02.003\u003c/li\u003e\n \u003cli\u003eZindl, C. L.\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e Distal colonocytes targeted by C. rodentium recruit T-cell help for barrier defence. \u003cem\u003eNature\u003c/em\u003e \u003cstrong\u003e629\u003c/strong\u003e, 669-678 (2024). https://doi.org:10.1038/s41586-024-07288-1\u003c/li\u003e\n \u003cli\u003eSerafini, N. \u0026amp; Di Santo, J. P. Group 3 innate lymphoid cells: A trained Gutkeeper. \u003cem\u003eImmunol Rev\u003c/em\u003e \u003cstrong\u003e323\u003c/strong\u003e, 126-137 (2024). https://doi.org:10.1111/imr.13322\u003c/li\u003e\n \u003cli\u003eHasegawa, M.\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e Interleukin-22 regulates the complement system to promote resistance against pathobionts after pathogen-induced intestinal damage. \u003cem\u003eImmunity\u003c/em\u003e \u003cstrong\u003e41\u003c/strong\u003e, 620-632 (2014). https://doi.org:10.1016/j.immuni.2014.09.010\u003c/li\u003e\n \u003cli\u003eKeir, M., Yi, Y., Lu, T. \u0026amp; Ghilardi, N. The role of IL-22 in intestinal health and disease. \u003cem\u003eJ Exp Med\u003c/em\u003e \u003cstrong\u003e217\u003c/strong\u003e, e20192195 (2020). https://doi.org:10.1084/jem.20192195\u003c/li\u003e\n \u003cli\u003eMajumdar, S.\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e Absence of Receptor Guanylyl Cyclase C Enhances Ileal Damage and Reduces Cytokine and Antimicrobial Peptide Production during Oral Salmonella enterica Serovar Typhimurium Infection. \u003cem\u003eInfect Immun\u003c/em\u003e \u003cstrong\u003e86\u003c/strong\u003e (2018). https://doi.org:10.1128/IAI.00799-17\u003c/li\u003e\n \u003cli\u003eDudakov, J. A., Hanash, A. M. \u0026amp; van den Brink, M. R. Interleukin-22: immunobiology and pathology. \u003cem\u003eAnnu Rev Immunol\u003c/em\u003e \u003cstrong\u003e33\u003c/strong\u003e, 747-785 (2015). https://doi.org:10.1146/annurev-immunol-032414-112123\u003c/li\u003e\n \u003cli\u003eSerafini, N.\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e Trained ILC3 responses promote intestinal defense. \u003cem\u003eScience\u003c/em\u003e \u003cstrong\u003e375\u003c/strong\u003e, 859-863 (2022). https://doi.org:10.1126/science.aaz8777\u003c/li\u003e\n \u003cli\u003eKotenko, S. V.\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e Identification of the functional interleukin-22 (IL-22) receptor complex: the IL-10R2 chain (IL-10Rbeta ) is a common chain of both the IL-10 and IL-22 (IL-10-related T cell-derived inducible factor, IL-TIF) receptor complexes. \u003cem\u003eJ Biol Chem\u003c/em\u003e \u003cstrong\u003e276\u003c/strong\u003e, 2725-2732 (2001). https://doi.org:10.1074/jbc.M007837200\u003c/li\u003e\n \u003cli\u003eLejeune, D.\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e Interleukin-22 (IL-22) activates the JAK/STAT, ERK, JNK, and p38 MAP kinase pathways in a rat hepatoma cell line. Pathways that are shared with and distinct from IL-10. \u003cem\u003eJ Biol Chem\u003c/em\u003e \u003cstrong\u003e277\u003c/strong\u003e, 33676-33682 (2002). https://doi.org:10.1074/jbc.M204204200\u003c/li\u003e\n \u003cli\u003eWolk, K.\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e IL-22 regulates the expression of genes responsible for antimicrobial defense, cellular differentiation, and mobility in keratinocytes: a potential role in psoriasis. \u003cem\u003eEur J Immunol\u003c/em\u003e \u003cstrong\u003e36\u003c/strong\u003e, 1309-1323 (2006). https://doi.org:10.1002/eji.200535503\u003c/li\u003e\n \u003cli\u003eRaffatellu, M.\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e Lipocalin-2 resistance confers an advantage to Salmonella enterica serotype Typhimurium for growth and survival in the inflamed intestine. \u003cem\u003eCell Host Microbe\u003c/em\u003e \u003cstrong\u003e5\u003c/strong\u003e, 476-486 (2009). https://doi.org:10.1016/j.chom.2009.03.011\u003c/li\u003e\n \u003cli\u003eSonnenberg, G. F.\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e Innate lymphoid cells promote anatomical containment of lymphoid-resident commensal bacteria. \u003cem\u003eScience\u003c/em\u003e \u003cstrong\u003e336\u003c/strong\u003e, 1321-1325 (2012). https://doi.org:10.1126/science.1222551\u003c/li\u003e\n \u003cli\u003eTsai, P. Y.\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e IL-22 Upregulates Epithelial Claudin-2 to Drive Diarrhea and Enteric Pathogen Clearance. \u003cem\u003eCell Host Microbe\u003c/em\u003e \u003cstrong\u003e21\u003c/strong\u003e, 671-681 e674 (2017). https://doi.org:10.1016/j.chom.2017.05.009\u003c/li\u003e\n \u003cli\u003eHopkins, E. G. D., Roumeliotis, T. I., Mullineaux-Sanders, C., Choudhary, J. S. \u0026amp; Frankel, G. Intestinal Epithelial Cells and the Microbiome Undergo Swift Reprogramming at the Inception of Colonic Citrobacter rodentium Infection. \u003cem\u003emBio\u003c/em\u003e \u003cstrong\u003e10\u003c/strong\u003e (2019). https://doi.org:10.1128/mBio.00062-19\u003c/li\u003e\n \u003cli\u003eSatoh-Takayama, N.\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e Microbial flora drives interleukin 22 production in intestinal NKp46+ cells that provide innate mucosal immune defense. \u003cem\u003eImmunity\u003c/em\u003e \u003cstrong\u003e29\u003c/strong\u003e, 958-970 (2008). https://doi.org:10.1016/j.immuni.2008.11.001\u003c/li\u003e\n \u003cli\u003eBasu, R.\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e Th22 cells are an important source of IL-22 for host protection against enteropathogenic bacteria. \u003cem\u003eImmunity\u003c/em\u003e \u003cstrong\u003e37\u003c/strong\u003e, 1061-1075 (2012). https://doi.org:10.1016/j.immuni.2012.08.024\u003c/li\u003e\n \u003cli\u003ePham, T. A.\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e Epithelial IL-22RA1-mediated fucosylation promotes intestinal colonization resistance to an opportunistic pathogen. \u003cem\u003eCell Host Microbe\u003c/em\u003e \u003cstrong\u003e16\u003c/strong\u003e, 504-516 (2014). https://doi.org:10.1016/j.chom.2014.08.017\u003c/li\u003e\n \u003cli\u003eLiu, Y.\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e The gut microbiota-independent virulence of noninvasive bacterial pathogen Citrobacter rodentium. \u003cem\u003ePLoS Pathog\u003c/em\u003e \u003cstrong\u003e20\u003c/strong\u003e, e1012758 (2024). https://doi.org:10.1371/journal.ppat.1012758\u003c/li\u003e\n \u003cli\u003eMelchior, K.\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e IL-22-dependent responses and their role during Citrobacter rodentium infection. \u003cem\u003eInfect Immun\u003c/em\u003e \u003cstrong\u003e92\u003c/strong\u003e, e0009924 (2024). https://doi.org:10.1128/iai.00099-24\u003c/li\u003e\n \u003cli\u003ePickert, G.\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e STAT3 links IL-22 signaling in intestinal epithelial cells to mucosal wound healing. \u003cem\u003eJ Exp Med\u003c/em\u003e \u003cstrong\u003e206\u003c/strong\u003e, 1465-1472 (2009). https://doi.org:10.1084/jem.20082683\u003c/li\u003e\n \u003cli\u003eXia, X.\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e EspF is crucial for Citrobacter rodentium-induced tight junction disruption and lethality in immunocompromised animals. \u003cem\u003ePLoS Pathog\u003c/em\u003e \u003cstrong\u003e15\u003c/strong\u003e, e1007898 (2019). https://doi.org:10.1371/journal.ppat.1007898\u003c/li\u003e\n \u003cli\u003eDas, S., Jayaratne, R. \u0026amp; Barrett, K. E. The Role of Ion Transporters in the Pathophysiology of Infectious Diarrhea. \u003cem\u003eCell Mol Gastroenterol Hepatol\u003c/em\u003e \u003cstrong\u003e6\u003c/strong\u003e, 33-45 (2018). https://doi.org:10.1016/j.jcmgh.2018.02.009\u003c/li\u003e\n \u003cli\u003eBekkevold, C. M., Robertson, K. L., Reinhard, M. K., Battles, A. H. \u0026amp; Rowland, N. E. Dehydration parameters and standards for laboratory mice. \u003cem\u003eJ Am Assoc Lab Anim Sci\u003c/em\u003e \u003cstrong\u003e52\u003c/strong\u003e, 233-239 (2013).\u003c/li\u003e\n \u003cli\u003eDiaz-Morales, N.\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e Age and Hypertension Synergize With Dehydration to Cause Renal Frailty in Rats and Predispose Them to Intrinsic Acute Kidney Injury. \u003cem\u003eLab Invest\u003c/em\u003e \u003cstrong\u003e105\u003c/strong\u003e, 102211 (2024). https://doi.org:10.1016/j.labinv.2024.102211\u003c/li\u003e\n \u003cli\u003eQasem, A. \u0026amp; Rabbani, S. A. Acute kidney injury associated with cholera. \u003cem\u003eCureus\u003c/em\u003e \u003cstrong\u003e15\u003c/strong\u003e,e34101(2023). https://doi.org:10.7759/cureus.34101\u003c/li\u003e\n \u003cli\u003eMoniruzzaman, M.\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e Interleukin-22 suppresses major histocompatibility complex II in mucosal epithelial cells. \u003cem\u003eJ Exp Med\u003c/em\u003e \u003cstrong\u003e220\u003c/strong\u003e, e20230106 (2023). https://doi.org:10.1084/jem.20230106\u003c/li\u003e\n \u003cli\u003eKim, S. H.\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e Inflammatory responses of C57BL/6NKorl mice to dextran sulfate sodium-induced colitis: comparison between three C57BL/6 N sub-strains. \u003cem\u003eLab Anim Res\u003c/em\u003e \u003cstrong\u003e37\u003c/strong\u003e, 8 (2021). https://doi.org:10.1186/s42826-021-00084-2\u003c/li\u003e\n \u003cli\u003ePrasad, H. \u0026amp; Visweswariah, S. S. Impaired Intestinal Sodium Transport in Inflammatory Bowel Disease: From the Passenger to the Driver\u0026apos;s Seat. \u003cem\u003eCell Mol Gastroenterol Hepatol\u003c/em\u003e \u003cstrong\u003e12\u003c/strong\u003e, 277-292 (2021). https://doi.org:10.1016/j.jcmgh.2021.03.005\u003c/li\u003e\n \u003cli\u003eSato, K., Hara-Chikuma, M., Yasui, M., Inoue, J. \u0026amp; Kim, Y. G. Sufficient water intake maintains the gut microbiota and immune homeostasis and promotes pathogen elimination. \u003cem\u003eiScience\u003c/em\u003e \u003cstrong\u003e27\u003c/strong\u003e, 109903 (2024). https://doi.org:10.1016/j.isci.2024.109903\u003c/li\u003e\n \u003cli\u003eO\u0026rsquo;May, J. B.\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e WNK1-dependent water influx is required for CD4+ T cell activation and T cell-dependent antibody responses. \u003cem\u003ebioRxiv\u003c/em\u003e, 2022.2003. 2016.484637 (2022). https://doi.org/10.1101/2022.03.16.484637\u003c/li\u003e\n \u003cli\u003eEyerich, S., Eyerich, K., Cavani, A. \u0026amp; Schmidt-Weber, C. IL-17 and IL-22: siblings, not twins. \u003cem\u003eTrends Immunol\u003c/em\u003e \u003cstrong\u003e31\u003c/strong\u003e, 354-361 (2010). https://doi.org:10.1016/j.it.2010.06.004\u003c/li\u003e\n \u003cli\u003eGrivennikov, S.\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e IL-6 and Stat3 are required for survival of intestinal epithelial cells and development of colitis-associated cancer. \u003cem\u003eCancer Cell\u003c/em\u003e \u003cstrong\u003e15\u003c/strong\u003e, 103-113 (2009). https://doi.org:10.1016/j.ccr.2009.01.001\u003c/li\u003e\n \u003cli\u003eWei, H. X., Wang, B. \u0026amp; Li, B. IL-10 and IL-22 in Mucosal Immunity: Driving Protection and Pathology. \u003cem\u003eFront Immunol\u003c/em\u003e \u003cstrong\u003e11\u003c/strong\u003e, 1315 (2020). https://doi.org:10.3389/fimmu.2020.01315\u003c/li\u003e\n \u003cli\u003eValeri, M. \u0026amp; Raffatellu, M. Cytokines IL-17 and IL-22 in the host response to infection. \u003cem\u003ePathog Dis\u003c/em\u003e \u003cstrong\u003e74\u003c/strong\u003e, ftw111 (2016). https://doi.org:10.1093/femspd/ftw111\u003c/li\u003e\n \u003cli\u003eLiang, S. C.\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e Interleukin (IL)-22 and IL-17 are coexpressed by Th17 cells and cooperatively enhance expression of antimicrobial peptides. \u003cem\u003eJ Exp Med\u003c/em\u003e \u003cstrong\u003e203\u003c/strong\u003e, 2271-2279 (2006). https://doi.org:10.1084/jem.20061308\u003c/li\u003e\n \u003cli\u003eOuyang, W. \u0026amp; O\u0026apos;Garra, A. IL-10 Family Cytokines IL-10 and IL-22: from Basic Science to Clinical Translation. \u003cem\u003eImmunity\u003c/em\u003e \u003cstrong\u003e50\u003c/strong\u003e, 871-891 (2019). https://doi.org:10.1016/j.immuni.2019.03.020\u003c/li\u003e\n \u003cli\u003eAhlfors, H.\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e IL-22 fate reporter reveals origin and control of IL-22 production in homeostasis and infection. \u003cem\u003eJ Immunol\u003c/em\u003e \u003cstrong\u003e193\u003c/strong\u003e, 4602-4613 (2014). https://doi.org:10.4049/jimmunol.1401244\u003c/li\u003e\n \u003cli\u003eMishra, V.\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e Gut-associated cGMP mediates colitis and dysbiosis in a mouse model of an activating mutation in GUCY2C. \u003cem\u003eJ Exp Med\u003c/em\u003e \u003cstrong\u003e218\u003c/strong\u003e, e20210479 (2021). https://doi.org:10.1084/jem.20210479\u003c/li\u003e\n \u003cli\u003eRizoli, S. PlasmaLyte. \u003cem\u003eJ Trauma\u003c/em\u003e \u003cstrong\u003e70\u003c/strong\u003e, S17-18 (2011). https://doi.org:10.1097/TA.0b013e31821a4d89\u003c/li\u003e\n \u003cli\u003ePerez-Riverol, Y.\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e The PRIDE database at 20 years: 2025 update. \u003cem\u003eNucleic Acids Research\u003c/em\u003e \u003cstrong\u003e53\u003c/strong\u003e, D543-D553 (2025).\u003c/li\u003e\n \u003cli\u003eBleby, J. Animals (Scientific Procedures) Act 1986. Vet Rec 119, 22 (1986). https://doi.org:10.1136/vr.119.1.22-a\u003c/li\u003e\n \u003cli\u003ePercie du Sert, N. et al. Reporting animal research: Explanation and elaboration for the ARRIVE guidelines 2.0. PLoS Biol 18, e3000411 (2020). https://doi.org:10.1371/journal.pbio.3000411\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":true,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"nature-portfolio","isNatureJournal":true,"hasQc":false,"allowDirectSubmit":false,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"","title":"Nature Portfolio","twitterHandle":"","acdcEnabled":false,"dfaEnabled":false,"editorialSystem":"ejp","reportingPortfolio":"","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"","lastPublishedDoi":"10.21203/rs.3.rs-6122641/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-6122641/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eInterleukin-22 (IL-22) is considered indispensable for host defence against \u003cem\u003eCitrobacter rodentium\u003c/em\u003e (CR), with 100% mortality of \u003cem\u003eIl22\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u0026minus;/\u0026minus;\u003c/em\u003e\u003c/sup\u003e mice post infection. While IL-22 promotes epithelial barrier integrity and antimicrobial peptide production, the precise mechanism underlying \u003cem\u003eIl22\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u0026minus;/\u0026minus;\u003c/em\u003e\u003c/sup\u003e lethality remains unclear. Here, we show that \u003cem\u003eIl22\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u0026minus;/\u0026minus;\u003c/em\u003e\u003c/sup\u003e mice succumb to CR infection due to dehydration rather than uncontrolled bacterial burden or inability to regenerate intestinal epithelium. Proteomic analysis at 9 days post infection (dpi) revealed significant downregulation of ion transporters (Slc26a3, Aqp8, Ca2, Ca4, Slc5a8, Slc15a1) in \u003cem\u003eIl22\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u0026minus;/\u0026minus;\u003c/em\u003e\u003c/sup\u003e colonic epithelial cells, suggesting an association between IL-22 deficiency and impaired fluid-electrolyte balance. Fluid therapy (FT), initiated at 5 dpi and lasted for 2 weeks, fully rescued \u003cem\u003eIl22\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u0026minus;/\u0026minus;\u003c/em\u003e\u003c/sup\u003e mice, restoring survival without affecting bacterial burden, immune responses, or epithelial integrity. Recovered \u003cem\u003eIl22\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u0026minus;/\u0026minus;\u003c/em\u003e\u003c/sup\u003e mice exhibited epithelial regeneration and protection against reinfection, demonstrating that IL-22-independent pathways support long-term mucosal recovery. These findings overturn the long-standing paradigm that IL-22 is indispensable for host survival from CR infection, revealing that dehydration is the primary cause of mortality. Importantly, this study underscores the necessity of incorporating supportive therapies into preclinical infection models to better reflect physiological conditions and enhance translational relevance.\u003c/p\u003e","manuscriptTitle":"Rehydration rescues Il22-/- mice from lethal Citrobacter rodentium infection","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-03-10 04:55:59","doi":"10.21203/rs.3.rs-6122641/v1","editorialEvents":[],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"nature-communications","isNatureJournal":true,"hasQc":false,"allowDirectSubmit":false,"externalIdentity":"NCOMMS","sideBox":"Learn more about [Nature Communications](http://www.nature.com/ncomms/)","snPcode":"","submissionUrl":"https://mts-ncomms.nature.com/","title":"Nature Communications","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"ejp","reportingPortfolio":"Nature Communications","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"964b2680-b73a-486f-b0ae-50f468ca9d69","owner":[],"postedDate":"March 10th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[{"id":45361161,"name":"Biological sciences/Microbiology/Bacteria/Bacterial host response"},{"id":45361162,"name":"Biological sciences/Immunology/Infectious diseases/Bacterial infection"},{"id":45361163,"name":"Biological sciences/Immunology/Infection"}],"tags":[],"updatedAt":"2026-01-10T08:09:49+00:00","versionOfRecord":{"articleIdentity":"rs-6122641","link":"https://doi.org/10.1038/s41467-025-67006-x","journal":{"identity":"nature-communications","isVorOnly":false,"title":"Nature Communications"},"publishedOn":"2025-12-08 05:00:00","publishedOnDateReadable":"December 8th, 2025"},"versionCreatedAt":"2025-03-10 04:55:59","video":"","vorDoi":"10.1038/s41467-025-67006-x","vorDoiUrl":"https://doi.org/10.1038/s41467-025-67006-x","workflowStages":[]},"version":"v1","identity":"rs-6122641","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-6122641","identity":"rs-6122641","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2025) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00
unpaywall
last seen: 2026-05-21T05:10:58.409756+00:00
License: CC-BY-4.0