Intro
Our recent studies in Merkel cell carcinoma revealed that the intensity of glucose-6-phosphate dehydrogenase (G6PD) expression is an indicator of tumor typing based on immune activity and inversely correlates with programmed death ligand-1 (PD-L1) expression in tumor cells and prognosis. 1 G6PD expression in tumors and G6PD activity in serum were suggested to be useful biomarkers in immunotherapy. However, how G6PD relates to tumor immunity and immunotherapy, including immune checkpoint inhibitors (ICIs), remains unclear.
G6PD is the rate-limiting enzyme of pentose phosphate pathway (PPP), catalyzing the first step in the oxidative process of PPP, in which decarboxylation produces pentoses such as deoxyribose and ribose, which are necessary for nucleic acid synthesis, and 2 moles of NADP+ (nicotinamide adenine dinucleotide phosphate) are reduced to NADPH. Deoxyribose and ribose are the raw materials for nucleic acid synthesis, and NADPH is used as an antioxidant to remove reactive oxygen species. 2 The role of G6PD in cells is well understood by its deficiency. G6PD deficiency is an X-linked genetic enzyme deficiency that occurs predominantly in African Americans. When G6PD deficiency prevents the production of NADPH at PPP, red blood cells, which lack mitochondria and use PPP as their sole source of NADPH, become particularly vulnerable to oxidative stress. This leads to hemolytic anemia after acute illnesses such as fevers, and viral or bacterial infections that increase oxidative stress, or after ingestion of oxidizing drugs such as salicylic acid or sulfonamides. 3 NADPH exerts its antioxidant stress effects on cells other than erythrocytes, and cells with high G6PD expression are thought to accumulate less oxidative stress and undergo less cellular senescence.
G6PD is present in the cytoplasm of all cells, but its expression is higher in cancer cells than in normal cells. This is because proliferating cells require more ribose-5-phosphate, a product of PPP, for nucleic acid synthesis. In addition, NADPH, a by-product of PPP, contributes to the antioxidant resistance of tumor cells. The hypermetabolism of cancer cells in the glycolytic pathway, including PPP, is referred to as the “Warburg effect”. 4 Since cancer cells produce ATP in the glycolytic pathway even under aerobic conditions, their choice of inefficient glycolytic ATP production over efficient mitochondrial oxidative phosphorylation may be due not only to adaptation to hypoxic conditions but also to the supply of nucleic acids and NADPH. 5 7 This enhanced glucose metabolism in tumors has also been applied to positron emission tomography using fluorodeoxyglucose.
Low G6PD activity causes premature cell senescence and cell death due to oxidative stress while aberrant activation of G6PD causes uncontrolled cell growth and differentiation. 8 Elevated G6PD activity upregulates antiapoptotic factors and inhibits cell cycle proteins. 9 Increased G6PD activity and PPP activation are observed in the G1 and late S phase of the cell cycle and are closely related to DNA synthesis and replication in cancer cells. 10 Elevated G6PD activity also promotes epithelial transformation of cancers 11 and enhances vascular endothelial cell proliferation, migration, and angiogenesis by stimulating endothelial NO synthase activity and carbon monoxide production by vascular endothelial cells. 12 13 Overexpression of G6PD enhances stress tolerance of cancer cells, which is closely associated with resistance to chemotherapy and radiotherapy. 14 15 G6PD has been reported to be associated with cisplatin resistance in non-small cell lung cancer, 16 erlotinib resistance in pancreatic cancer, 17 and doxorubicin resistance in colon cancer. 18 Thus, G6PD activity has been reported to be a biomarker as a prognostic factor in various cancers, 19 21 but no one has described the mechanism of its association with tumor immunity. We hypothesized that inhibition of G6PD induces immunogenic cell death (ICD), which is cell death accompanied by antigen presentation.
Results
Three melanoma cell lines (SK-Mel28, COLO679, A375) were cultured and G6PD expression was measured by qRT-PCR. A375 melanoma cells had the highest G6PD expression compared with other cell lines (p=0.0014, Dunnett’s test, figure 1A ). XTT assay at 24 hours after the addition of each concentration of H 2 O 2 showed that A375 melanoma cells were significantly more resistant to oxidative damage than the other cell lines at 800 µM H2O2 (p=0.0489, Dunnett’s test, figure 1B ). G6PD in melanoma cells (COLO679) was inhibited by G6PDi-1 100 µM (p=0.011, Student’s t-test, figure 1C ). Melanoma cells showed decreased tolerance to H 2 O 2 in a G6PDi-1 concentration-dependent manner ( figure 1D ). Melanoma cells genetically blocked for G6PD with shRNA also showed significantly reduced G6PD expression by qRT-PCR (p<0.00001, Student’s t-test, figure 1E ). Melanoma cells genetically blocked for G6PD with shRNA were significantly less resistant to oxidative damage when 200 µM H2O2 was added compared with cells transfected with empty vector (p=0.0328, Student’s t-test, figure 1F ). The NADP + /NADPH ratio was increased by the concentration of G6PDi-1 (COLO679, Williams’ test, figure 1G ) and was significantly increased by knockdown of the G6PD gene (A375, figure 1H ; B16 mouse melanoma, figure 1I ).
400 µM H 2 O 2 was added to melanoma cells in which G6PD was inhibited by 100 µM G6PDi-1. After 24 hours, only the culture medium supernatant was collected and the amount of HMGB1 protein was measured. Even without H 2 O 2 , HMGB1 was elevated in the culture medium of G6PD-inhibited melanoma cells but was more significantly elevated when 400 µM H2O2 was added to G6PD-inhibited melanoma cells ( figure 2A ). Melanoma cells in which G6PD was blocked with shRNA were also treated with 400 µM H 2 O 2 , and HMGB1 was measured in the culture medium supernatant 24 hours later. There was no difference in the amount of HMGB1 released without the addition of H 2 O 2 , but the addition of H 2 O 2 increased HMGB1 release, significantly more than in melanomas transfected with empty vector ( figure 2B ). Immunofluorescent with calreticulin stained red, β-actin stained green, and nuclei stained blue showed calreticulin migrating to the cell membrane surface in melanoma cells with 200 µM H 2 O 2 ( figure 2C ).
The analysis was performed using the profiled data set containing 83 melanoma samples containing 31 primary and 52 metastatic lesions with comprehensive gene expression analysis for 13,488 genes accessible at GEO database ( GSE8401 ). Samples with G6PD expression higher than the average of all samples were designated high G6PD, and samples with G6PD expression lower than the average were designated low G6PD. 83 melanoma samples were classified into 31 samples in the high G6PD group and 52 samples in the low G6PD group. Clustering analysis revealed genes that are downregulated and upregulated in each group ( figure 3A ). Genes significantly highly expressed in each group were represented by volcano plots ( figure 3B ). For BAAT , DAZ4 , and KRT33A , which are significantly upregulated in high G6PD group, their role in cancer is not clear. FAM163A is a positive regulator of the ERK signaling pathway and is associated with neuroblastoma and lung squamous cell carcinoma. 24 PLA2G2A is associated with esophageal adenocarcinoma and glioblastoma and has been reported to promote fatty acid synthesis and energy metabolism in pancreatic cancer cells with K-ras mutations. 25
SCGB1D2 mutations have been reported in breast and gynecological cancers and are associated with poor prognosis in pancreatic ductal adenocarcinoma. 26 GAGE analysis revealed sets of genes specifically upregulated in the low G6PD group ( table 1 ). Pathway analysis results showed that eight of the top 10 gene sets were endoplasmic reticulum target gene related, reflecting endoplasmic reticulum stress. Two more gene sets (7th and 8th) and the 14th gene set (B cell activation, not shown in table 1 ) were related to lymphocyte activation ( figure 3C ).
ERendoplasmic reticulumG6PDglucose-6-phosphate dehydrogenasemRNAmessenger RNASRPsignal-recognition particle
Mice treated with anti-PD-L1 antibody had smaller tumor growth than mice injected with PBS. Among those treated with anti-PD-L1 antibody, Mice injected with B16 knockdown of G6PD showed significantly smaller tumors than those injected with B16 with the empty vector (p=0.0497, Student’s t-test, figure 4A,B ). Tumors in mice injected with PBS but not anti-PD-L1 antibody showed no difference between G6PD knockdown melanoma cells and empty vector controls. It can be said that mice seeded with tumors in which G6PD was knocked down responded well to ICIs. Fluorescent immunostaining counts of the number of infiltrating CD8-positive cells using tumors obtained on day 23 showed that G6PD knockdown melanomas treated with PD-L1 had significantly more cellular infiltration than other tumors (p=0.027, Tukey test, figure 4C,D ).
Mice were injected subcutaneously with B16 melanoma cells at two sites on either side of the back. One group was injected subcutaneously with an empty vector (EV)-transfected tumor on both the left and right sides, and the other group was injected subcutaneously with EV-transfected tumor on the left and a G6PD shRNA-knocked down tumor on the right. Both groups were treated with 200 µg/mouse anti-PD-L1 antibody twice a week. Comparing tumor size after 20 days, not only the shG6PD tumor (p=0.0186, Dunnett’s test) but also EV-transfected tumors of mice with shG6PD tumors, significantly inhibited tumor growth compared with mice without knocked down G6PD was observed (p=0.0393, Dunnett’s test, figure 4E ). In addition, significant differences in mouse survival were also observed (p=0.0357, log-rank test, figure 4F ). Quantitative comparison of immunohistochemical staining of lymphocytes infiltrating EV-transfected tumors on the left back of mice in each group revealed that the number of CD8-positive cells was significantly higher in mice with G6PD knockdown tumors on the right back (p=0.0128, Student’s t-test), which correlated with tumor shrinkage. While the number of CD8 and PD1 double-positive cells was also increased, the ratio of PD1-positive cells to total CD8-positive cells was unchanged ( figure 4G,H ).
We analyzed 42 patients with pathologically diagnosed cutaneous malignant melanoma who were treated with ICIs at Nagoya City University Hospital. The cohort included 26 men and 16 women with a median age of 70. They were one-third low CSD, one-third Acral type, followed by Mucosal and High CSD. Three cases were primary unknown. They were treated with nivolumab, pembrolizumab, or nivolumab+ipilimumab combination therapy ( table 2 ). The G6PD negative group showed longer progression-free survival (PFS) than the positive group (p=0.0473, log-rank test, figure 5A ). G6PD positivity or negativity was determined by immunostaining. If more than 10% of tumor cells stained red, they were considered positive. If less than 10%, they were considered negative. The cases were clearly distinguishable, as in the representative case ( figure 5B ). There was no significant difference in the occurrence of grade III or higher immune-related adverse events (irAE) in each group (Fisher’s exact test, figure 5C ).
Total percentage values might sum to <100% due to rounding.
CBDCAcarboplatinCSDcumulative sun damageICIimmune checkpoint inhibitorIpiIpilimumabLCNEClarge cell neuroendocrine carcinomaNivonivolumabPEMpemetrexedPembropembrolizumab
The lung cancer cohort consisted of 30 patients, 26 males and 4 females, with a mean age of 68.8. adenocarcinoma accounted for 73.3% of the cases. Treatment consisted of nivolumab, pembrolizumab, atezolizumab, durvalumab, pembrolizumab+carboplatin (CBDCA)+pemetrexed (PEM), or nivolumab+ipilimumab combination therapy ( table 2 ). Also in this cohort, the G6PD negative group showed longer PFS than the positive group (p=0.0287, log-rank test, figure 5D ). The presence or absence of G6PD expression was determined by the same method as for melanoma. Representative cases were shown ( figure 5E ). There was no significant difference in the occurrence of grade III or higher irAE in each group (Fisher’s exact test, figure 5F ).
Discussion
According to this study, inhibiting G6PD reduces NADPH production and causes ICD in tumor cells, making them more vulnerable to oxidative damage. This ICD activates the tumor immunity and strengthens the effects of ICIs. The study shows that the expression of G6PD is inversely related to the effectiveness of ICIs in melanoma and lung cancer. These cancers have a higher tumor mutation burden and are more sensitive to the activation of tumor immunity by suppressing G6PD expression. This research is the first to reveal the mechanism of tumor immune activation by G6PD inhibition, which is beneficial for the provision of more effective immunotherapy. It strongly supports the clinical application of G6PD inhibition in cancer therapy.
Since PPP is the major glucose metabolic pathway in cancer cells, inhibition of G6PD could be a promising strategy in cancer therapy. As already mentioned, G6PD deficiency is a genetic disorder that is seen with some frequency and its relationship to cancer development has been investigated. A 17-year, 11708-person study at a teaching hospital in Northern Sardinia, Italy, found that G6PD deficiency lowers the risk of gastric, hepatocellular, and 27 colorectal cancer. 28 29 The less of cancer susceptibility in G6PD deficiency raises hopes for the application of G6PD inhibition to anticancer therapy.
There have been several reports of previous efforts to treat cancer by inhibiting G6PD. 8 6-Aminonicotinamide (6-AN) is a well-known competitive inhibitor of G6PD that is structurally similar to NADP. 30 It has been demonstrated radiosensitizing activity against malignant tumors in combination with 2-deoxy-D-glucose 15 31 32 and antitumor effects against breast and bladder cancer in combination with cisplatin or 5-fluorouracil. 33 34 However, it is a competitive inhibitor with limited efficacy and is not suitable for real-world clinical use due to the complications of severe neurological deficits. 35 Dehydroepiandrosterone (DHEA) is a type of adrenal steroid that is a non-competitive inhibitor of G6PD. It has been reported to have anticancer activity against cervical cancer cells, 36 but clinical application is still far from practical because high doses must be taken internally and DHEA must be converted to other active forms. 12
As a new G6PD inhibitor in 2018, Polydatin (3,4′,5-trihydroxystilbene-3-β-d-glucoside; trans-resveratrol 3-β-mono-D-glucoside; piceid), a natural molecule found in the tapeworm and other plants, was reported. 37 Polydatin induces cell death due to ER stress and oxidative damage via inhibition of G6PD, inhibiting oral cancer cell proliferation and lymph node metastasis. Polydatin has been administered in various animal models at doses up to 200 mg/kg and no significant cardiovascular, liver, bone marrow, or renal toxicity has been reported. 38 40 In humans, phase II clinical trials for other non-cancer diseases (irritable bowel syndrome, endometriosis-related pain) have been conducted using doses ranging from 20 to 40 mg twice daily for up to 3 months with no significant toxic effects reported. 41 42 Polydatin, like other G6PD inhibitors, has also been reported to have synergistic effects when used in combination with cisplatin and other drugs. 37 However, the relationship between these G6PD inhibitors and tumor immunity and their efficacy in combination with immunotherapy has not been investigated to date.
Closer to clinical application, zoledronic acid (ZA), the current standard of treatment for patients with bone metastases or osteoporosis, was reported to inhibit G6PD. 43 ZA inhibits TAp73 stability and reduces G6PD activity via blockade of Ras signaling. ZA has a direct effect on tumor cells as well as on bone metastases. 44 45 Like other G6PD inhibitors, it has also been reported to be effective in combination with cytotoxic anticancer agents. 46 In 2022, ZA was tested in combination with anti-PD-1 antibody, an ICI, for non-small cell lung cancer and showed significantly longer PFS (HR: 0.520, p=0.028,) and higher disease control rates (75.0% vs 51.7%, p=0.049) than anti-PD-1 antibody therapy alone. 47 Although the association with G6PD inhibition was not examined, interestingly, an enhancement of antitumor immunity was observed in the combination group, with more CD8+IFN-γ+T cells and γδ T cells in the circulation and tumor-infiltrating lymphocytes. G6PD inhibition and ICD induction by ZA may be one of the mechanisms for its antitumor immune activation.
G6PD inhibition can induce ICD, which can be beneficial for cancer therapy. However, to achieve the full effect of ICD induction, G6PD inhibition should be combined with immunotherapy. The current study also suggests a new form of clinical application where the local injection of G6PD inhibitors into skin metastases or lymph nodes can enhance the effect of ICIs. This is similar to the abscopal effect of radiotherapy. Furthermore, the observation that G6PD inhibition of a part of the tumor also inhibited the growth of other tumors via enhancement of antitumor immunity is significant. The present study’s findings reveal the potential of G6PD inhibition in cancer therapy, which has been investigated in various ways.
Materials|Methods
Human melanoma cell lines, SK-Mel-28 (ATCC, Manassas, Virginia, USA) and COLO679 (Riken, Tokyo, Japan) were cultured in RPMI 1640 culture medium (Gibco, Life Technologies, Carlsbad, California, USA) with 10% fetal bovine serum (FBS). Human melanoma cell line A375 (ECACC, Salisbury, UK) was cultured in Dulbecco’s modified eagle medium (DMEM, Gibco) with 15% FBS. Mouse melanoma cell line B16 (Riken) was cultured in DMEM with 10% FBS.
Chemical inhibition of G6PD was performed by the addition of G6PDi-1 (Cayman Chemical, Ann Arbor, Michigan, USA) for 24 hours. Genetic blocking of G6PD was performed using shRNA plasmid (sc-60667-SH, Santa Cruz Biotechnology, Santa Cruz, California, USA). Transfection was performed according to the protocol provided by the supplier. Control shRNA plasmid (sc-108060, Santa Cruz) was used as a negative control. The transfected cells were cultured in a medium with puromycin. Real-time PCR and high mobility group box 1 (HMGB1) assay were also performed by different three shRNA sequences for G6PD (abx-951683, Abbexa, Cambridge, UK) and control shRNA plasmid (abx-991273, Abbexa) with similar results.
messenger RNA (mRNA) purification was performed using an RNeasy Mini kit (Qiagen, Hilden, Germany). The mRNA was converted to cDNA using a High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Foster City, California, USA) and PT-100 Programmable Thermal Controller (MJ Research, Watertown, Massachusetts, USA). Real-time PCR was run in triplicate on a DNA Engine Opticon 2 system (MJ Research) using Platinum SYBR Green qPCR Supermix UDG (Invitrogen, Carlsbad, California, USA) and the oligonucleotide primers (Eurofins Genomics, Tokyo, Japan). The levels of gene expression were relative to β-actin expression. The gene-specific forward and reverse primers sequences used were as follows: G6PD, 5’- CTGTTCCGTGAGGACCAGATCT -3’ (forward) and 5’- TGAAGGTGAGGATAACGCAGGC -3’ (reverse); β-actin, 5’- CCCCAGGCACCAGGGCGTGAT -3’ (forward) and 5’- GGTCATCTTCTCGAGGTTGGCCTTGGGGT -3’ (reverse).
2,3-Bis-(2-Methoxy-4-Nitro-5-Sulfophenyl)-2H-Tetrazolium-5-Carboxanilide (XTT) assay was performed by using Cell Proliferation Kit II (Roche, Basel, Switzerland). Cells were treated with various concentrations of hydrogen peroxide (H 2 O 2 ) for 24 hours, then labeled according to protocols provided by the supplier, and absorbance was measured at 492 and 690 nm using SPECTRAmax 340PC Microplate Spectrophotometer (Molecular Devices, Sunnyvale, California, USA).
NADP/NADPH Assay Kit-WST (Dojindo, Kumamoto, Japan) was used for the assay. The assay was performed according to protocols provided by the supplier. COLO679 human melanoma cells were used for chemical inhibition by G6PDi-1 and A375 human melanoma cells and B16 mouse melanoma cells for genetic blockade by shRNA plasmid.
HMGB1 ELISA Kit Exp (Shino-Test, Tokyo, Japan) was used for the assay. The assay was performed according to protocols provided by the supplier. COLO679 melanoma cells were used for chemical inhibition by G6PDi-1 and A375 melanoma cells for genetic blockade by shRNA plasmid.
COLO679 melanoma cells treated with 200 µM H 2 O 2 for 2 hours in eight-well chamber slides (Nunc, Roskilde, Denmark) were processed for indirect immunofluorescence to detect the expression of signal transduction proteins using primary antibodies to Anti-Calreticulin (1:75, ab2907, Abcam, Cambridge, UK) and Anti-β-actin (1:620, ab6276-100, Abcam). Bound antibodies were visualized with appropriate secondary antibodies, Alexa Fluor 594 goat anti-Rabbit IgG (Invitrogen) and Alexa Flour 488 goat anti-Mouse IgG (Invitrogen) at 37°C for 30 min at 1:500 dilution with 5% goat serum. 4′,6-Diamidino-2-phenylindol, dihydrochloride (DAPI, Vector Laboratories, Burlingame, California, USA) was used as a counterstain. The fluorescence of red produced by Alexa 594, green by Alexa 488, and blue by DAPI was observed and captured using a fluorescence microscope BZ-X810 (Keyence, Osaka, Japan).
The in silico analyses were performed using the profiled data set containing 83 melanoma samples containing 31 primary and 52 metastatic lesions with comprehensive gene expression analysis for 13,488 genes accessible at GEO database ( GSE8401 ). 22 A clustered heatmap of all samples was generated using the online tool iDEP.96 ( http://bioinfomatics.sdstate.edu/idep/ ). 23 The same tool was used for generally applicable gene-set enrichment (GAGE) analysis, GO (gene ontology) biological process was selected for gene sets and pathway significance cut-off (false discovery rate; FDR) was set to 0.2.
All animal experiments conducted were approved by the university’s ethics committee (No. 21-024 H03). 1×10 7 B16 melanoma cells knocked down G6PD using shRNA plasmid (Santa Cruz) were injected subcutaneously into the back of 6-week-old C57BL/6 female mice. Mice injected in the back with B16 melanoma cells transfected with the empty vector using Control shRNA Plasmid-A as described above were used as controls. 6 days later, twice-weekly 200 µg/mouse anti-PD-L1 antibody (Leinco Technologies, St. Louis, Missouri, USA) or phosphate-buffered saline (PBS) intraperitoneally injections started. After a total of five PD-L1 or PBS injections, the mice were sacrificed 23 days after tumor injection. Tumor volume was measured with calipers and the number of infiltrating lymphocytes with immunohistochemistry. Each group consisted of five mice and all experiments were performed in triplicate as the smallest number that can be statistically analyzed. If some mice died during the course of the experiment, all tumor size measurements for those mice were excluded.
Undyed formalin-fixed paraffin-embedded (FFPE) tissue slides (Nunc) were processed for indirect immunofluorescence to detect the expression of signal transduction proteins using primary antibodies to the anti-CD8 antibody (1:500, ab217344, Abcam, 1:100, #14-0195-82, Invitrogen) and anti-PD1 antibody (1:500, ab214421, Abcam). Bound antibodies were visualized with the appropriate secondary antibodies, Alexa Fluor 594 goat anti-rabbit IgG (Invitrogen), Alexa Flour 594 goat anti-rat IgG (Invitrogen) and Alexa Flour 488 goat anti-rabbit IgG (Invitrogen) at 37°C for 30 min at 1:500 dilution with 5% goat serum. DAPI (Vector Laboratories) was used as a counterstain. The red fluorescence produced by Alexa 594 and blue fluorescence produced by 4′,6-diamidino-2-phenylindol were observed and captured using a fluorescence microscope BZ-X810 (Keyence). After evaluating entire specimens, CD8-positive cells were counted in 3–5 locations with a high density of infiltrating cells, and the mean value was calculated.
All patients who received ICI treatment at Nagoya City University between July 2014 and March 2021 for malignant melanoma and between January 2016 and March 2022 for lung cancer, had an FFPE sample stored and were followed for at least 6 months were collected. 42 melanoma patients and 30 lung cancer patients were included. The melanoma cohort included 26 men and 16 women with a median age of 70. The lung cancer cohort consisted of 26 males and 4 females, with a mean age of 68.8. FFPE samples obtained from surgery or biopsy were stained with the anti-G6PD antibody (1:25, HPA000247, Sigma,) and VECTASTAIN ABC-AP Kit (Vector Laboratories) to determine the presence of G6PD expression in tumor cells.
All experiments were performed in triplicate at least three separate times and the average value and SD were reported. Statistical analyses were performed by using Graph Pad Prism V.9 (Graph Pad Software, San Diego, California, USA) and Pharmaco Analyst Software (Humanlife, Tokyo, Japan). Probability values of less than 0.05 were considered statistically significant.
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.