Impact of strontium, magnesium, and zinc ions on the in vitro osteogenesis of maxillary sinus membrane stem cells | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Impact of strontium, magnesium, and zinc ions on the in vitro osteogenesis of maxillary sinus membrane stem cells Zhihao Zhang, Ning Gong, Ying Wang, Lei Xu, Sinan Zhao, Yanshan Liu, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-3972505/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Purpose Human Maxillary Sinus Membrane Stem Cells (hMSMSCs) contribute significantly to bone formation following maxillary sinus floor augmentation (MSFA). The biological behavior of mesenchymal stem cells is notably influenced by varying concentrations of magnesium (Mg 2+ ), strontium (Sr 2+ ), and zinc (Zn 2+ ) ions; however, their specific effects on hMSMSCs have not been comprehensively studied. Methods We isolated hMSMSCs and identified their mesenchymal stem cell characteristics by flow cytometry and multilineage differentiation experiments. Subsequently, the hMSMSCs were cultured in media containing different concentrations of these metal ions. The proliferation and viability of hMSMSCs were assessed using CCK-8 and Calcein AM/PI staining. After osteogenic induction, cells were evaluated for alkaline phosphatase (ALP) activity, ALP staining, and Alizarin Red staining. Additionally, qRT-PCR was used to detect differences in osteogenic gene expression, and immunofluorescence staining was used to observe variations in OCN protein levels. Results The results indicated that 1mM Mg 2+ , 0.01mM Sr 2+ , and 0.001mM Zn 2+ significantly improved the proliferation and activity of hMSMSCs. These concentrations also notably enhanced ALP secretion, increased bone-related gene expression, and augmented osteocalcin expression and formation of extracellular calcium nodules, thereby improving osteogenic differentiation. However, higher concentrations of Mg 2+ , Sr 2+ , and Zn 2+ decreased cell viability and osteogenic differentiation. Conclusions Mg 2+ , Sr 2+ , and Zn 2+ promote osteogenic differentiation and proliferation of hMSMSCs in a concentration-dependent manner, indicating that the type and concentration of ions in the extracellular environment can significantly alter hMSMSCs behavior, which is a crucial consideration for material design in maxillary sinus elevation applications. Clinical Relevance: Our findings demonstrate that Mg 2+ , Sr 2+ , and Zn 2+ enhance osteogenic differentiation and proliferation of hMSMSCs, offering a strategic approach to improve bone regeneration in maxillary sinus elevation procedures. Mesenchymal stem cells Osteogenesis Schneiderian membrane Ions Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Introduction Maxillary sinus floor augmentation (MSFA), known for its stable vertical bone formation and clinical predictability in the osteogenesis area, is a vital [ 1 ]] technique for vertical bone augmentation in the posterior maxillary region. The influence of the maxillary sinus membrane on bone formation in this area may be a critical factor in the success of MSFA [ 2 ]. For instance, Rong et al. [ 3 ] used titanium membranes to isolate the sinus wall and membrane, discovering significant new bone formation on the sinus membrane side of the MSFA after isolation. This suggests an intrinsic bone-forming capability of the maxillary sinus membrane, indicating its crucial role in MSFA osteogenesis. Srouji et al. [ 4 ]] isolated and cultured cells from the maxillary sinus membrane, identifying stem cells with mesenchymal characteristics and confirming their potential for osteogenic, osteoclastic, and adipogenic differentiation. Guo et al. [ 5 ] demonstrated that the osteogenic potential of maxillary sinus membrane stem cells (MSMSCs) is similar to that of bone marrow mesenchymal stem cells (MSCs), showing a strong osteogenic differentiation capability. These studies collectively suggest that MSMSCs play a significant role in bone regeneration guided by the maxillary sinus membrane after MSFA. However, numerous studies have indicated that osteogenic differentiation of stem cells is primarily regulated by changes in the osteogenic environment surrounding the cells [ 6 ]. Research has shown that the osteogenic differentiation capability of MSMSCs is also influenced by changes in the surrounding osteogenic environment. Liu et al. [ 7 ] observed that MSMSCs exhibited varying osteogenic differentiation capabilities when exposed to materials with varying stiffness levels. This suggests that MSMSCs can alter their osteogenic differentiation capabilities based on changes in their immediate environment. However, further investigation is needed to understand how these environmental variations affect MSMSCs compared to traditional seed cells, such as BMSCs. Additionally, exploring methods to better optimize the osteogenic differentiation of MSMSCs for improved bone formation in MSFA requires a more detailed study. Research indicates that the osteogenic efficacy of MSCs is markedly influenced by the types and concentrations of metal ions present in their surrounding environment. This phenomenon has garnered considerable interest in the field of bone regeneration [[ 8 ]. Changes in the types and concentrations of ions such as strontium (Sr 2+ )[ 9 ]], magnesium (Mg 2+ ) [ 10 ], or zinc (Zn 2+ ) [ 11 ] within the cellular microenvironment can affect MSC functions, including proliferation and osteogenic differentiation. These alterations influence relevant signaling pathways and enzyme activities. For instance, studies have found that while lower concentrations of Sr 2+ (25–500µM) promote osteogenic differentiation in human adipose-derived stem cells (hASCs), higher concentrations (1000–3000µM) inhibit this process and induce apoptosis [ 9 ]. Similar observations have been reported for Mg [ 12 ] and Zn ions [ 13 ]. For instance, Mg 2+ were found to promote osteogenic differentiation and mineralization of mouse MSCs by activating the p38/Osx/Runx2 signaling pathway [ 14 ]. These studies demonstrated the impact of metal ion types and concentrations in the surrounding environment on stem cell osteogenic performance. However, different types of stem cells may react distinctly to the same type and concentration of metal ions. For example, studies have shown that concentrations of Sr 2+ below 1mM significantly promote osteogenic differentiation in placental decidual basalis-derived MSCs (PDB-MSCs), but these concentrations do not enhance osteogenic gene expression in bone marrow-derived MSCs (BMSCs) [ 15 ]. Similarly, a concentration of 100µM Zn 2+ significantly increased the expression of osteogenic genes and ALP in BMSCs [ 16 ]], whereas a lower concentration was sufficient to enhance osteogenic differentiation in hASCs [ 17 ]]. However, to the best of our knowledge, there has been no research conducted on the effects of metal ions on the osteogenic capabilities of MSMSCs, warranting further investigation. We hypothesized that modifying the type and concentration of ions in the microenvironment would affect the proliferation and differentiation of MSMSCs in a concentration-dependent manner. In the present study, we explored the effects of Mg, Sr, and Zn ions on the cell viability and osteogenic differentiation of hMSMSCs to validate our hypothesis. Materials and Methods Extraction and Identification of hMSMSCs Samples of MSMSCs were obtained following the ethical guidelines of the Affiliated Hospital of Qingdao University (Qingdao, China). The samples were obtained with informed consent from patients aged 18–25 years (n = 3) exhibiting abnormal occlusion, jaw development issues, or maxillofacial deformities and who had undergone Le Fort I osteotomy for orthognathic surgery. Smokers and patients with skeletal or systemic diseases were excluded. The maxillary sinus membrane was exposed within the truncated maxilla, extracted over a 2mm*2mm area, and secured with absorbable sutures to close the mucoperiosteum tightly. Post-collection, all samples were washed and preserved in PBS solution supplemented with antibiotics at 4℃. Cell isolation was conducted for 24 h. These samples were used for (a) histological analysis, (b) establishment of in vitro cultures of MSMSC-derived cells, (c) analysis of the in vitro differentiation potential of these cells, and (d) investigation of the effect of ions on osteogenic differentiation of MSMSCs in vitro. Cell culture The maxillary sinus membranes were carefully extracted from patients undergoing maxillofacial surgery. These samples were treated in 4 mg/mL of dispase at 37°C for 4 h to eliminate the epithelial cells. Subsequently, the samples were sliced and digested in 3 mg/mL of collagenase for 30 minutes at 37°C. The processed samples were then cultured in T75 flasks containing 10% FBS (Procell, China) and 1% penicillin-streptomycin in DMEM (Meilunbio, China). The cells were incubated at 37°C in a 5% CO2 environment. Upon reaching 80% confluence, cells were passaged at a 1:3 ratio. The third generation of cells was utilized for subsequent experiments. Multi-differentiation assay A differentiation induction culture kit (Meilunbio, China) was used to induce osteogenic, adipogenic, and chondrogenic differentiation of MSMSCs. Cells were seeded in six-well plates at a density of 1×10 5 cells/mL. Osteogenic and adipogenic differentiations were induced for 14 days, while chondrogenic differentiation was induced for 21 days. After induction, cells were fixed in 4% paraformaldehyde for 10 min. Calcified nodules were stained with alizarin red solution (pH4.2) for 30 minutes. Adipocytes were stained with Oil Red O for 15 min, while chondrocytes were stained with alizarin blue for 15 min. Immunophenotype identification assay A total of 5×10 5 cells dispersed in 400 µl of Cell Staining Buffer (Elabscience, China) were labeled with antibodies (CD44, CD105, CD73, CD45, CD19, CD11b from Elabscience, China) and analyzed using a flow cytometer Antibodies were used at a concentration of 0.5 µg/10 6 cells in a 100 µL volume. Groups The experiment was divided into ten groups, nine of which were subjected to various concentrations of Mg, Zn, and Sr to simulate actual physiological conditions. Ions were added to the medium in the form of MgCl 2 , SrCl 2, or ZnCl 2 . The specific levels are listed in Table 1 . Table 1 Groups Groups Conditions Blank Culture Media only (Mg 2+ 0.8mM) Mg1 Culture Media with 1mM MgCl 2 (Mg 2+ 1.8mM) Mg2 Culture Media with 2mM MgCl 2 (Mg 2+ 2.8mM) Mg5 Culture Media with 5mM MgCl 2 (Mg 2+ 5.8mM) Sr0.01 Culture Media with 0.01mM SrCl 2 Sr0.1 Culture Media with 0.1mM SrCl 2 Sr1 Culture Media with 1mM SrCl 2 Zn0.0001 Culture Media with 0.0001mM ZnCl 2 Zn0.001 Culture Media with 0.001mM ZnCl 2 Zn0.01 Culture Media with 0.001mM ZnCl 2 Cell viability Cell viability of curcumin-treated cells was determined using a Cell Counting Kit-8 (Meilunbio, China). MSMSCs harvested during the exponential growth phase were individually digested with 0.25% trypsin-ethylene diamine tetra acetic acid (EDTA) (Procell, China). Viable single cell suspensions were obtained by centrifugation at 1000 rpm for 5 min. These suspended cells were seeded in 96-well plates at a density of 8,000 cells/well, with three replicates per group. After treatment with DMEM and varying ion concentrations for 24 and 72 h, 10% CCK-8 solution was added to each well and incubated for 3 h at 37˚C. The absorbance at 450 nm was subsequently measured using an enzyme marker. $$\text{C}\text{e}\text{l}\text{l} \text{V}\text{i}\text{a}\text{b}\text{i}\text{l}\text{i}\text{t}\text{y} \left(\text{%}\right)=\left(\frac{Absorbance of Treated Sample-Absorbance of Blank}{Absorbance of Control-Absorbance of Blank}\right)\times 100$$ Live/Dead cell Immunofluorescence staining The 24 wells plates were evaluated by seeding them with hMSMSCs cells and assessing cytotoxicity through Calcein AM/PI staining, followed by quantitative analysis using ImageJ. hMSMSCs cultured in DMEM supplemented with 10% FBS and 1% penicillin-streptomycin, were seeded onto plates at a density of 5x10 4 cells/mL and allowed to adhere for 2 hours before the addition of fresh medium with ions. After 24–72 hours of further incubation, cell viability was assessed using a staining solution of 2 µM Calcein AM and 4 µM PI in PBS, incubating in the dark for 30 minutes. ImageJ was employed to count live (green) and dead (red) cells, calculating the percentage of viable cells. Osteogenic differentiation Upon reaching 80% confluence, MSMSCs were transferred to osteogenic medium (OM) composed of DMEM medium supplemented with 15% FBS, 1% NEAA, 0.1 mM β-mercaptoethanol, 1%penicillin/streptavidin, 5µg mL − 1 ascorbic acid, 10 mM sodium glycerophosphate, and 10 − 8 M dexamethasone. The medium was refreshed every two days. After inductions for various durations (3 days,7 days, 14 days, 21 days), cells were used for subsequent experiments. Alkaline phosphatase (ALP) activity assay The ALP activity assay was performed to assess the in vitro osteogenic differentiation ability of Mg 2+ , Sr 2+ , and Zn 2+ . MSMSCs were seeded in 24-well plates at a density of 2×10 4 cells/cm 2 . Upon reaching 60% confluence, the cell culture medium was replaced with an osteogenic induction medium containing varying ion concentrations. The cell culture medium was renewed every two days. After culturing for 3,7 and 14 days, ALP staining and activity assays were conducted. For ALP staining, MSMSCs were washed thrice with PBS, fixed with 4% paraformaldehyde for 10 min, and stained using the BCIP/NBT ALP Color Development Kit (Meilunbio, China) following the manufacturer's instructions. To assess ALP activity, proteins were extracted from lysed cells using radioimmunoprecipitation assay (RIPA) lysis buffer (Solarbio, China). ALP activity was assayed using an Alkaline phosphatase assay kit (Nanjing Jiancheng Bioengineering Institute, China) to quantify the relative ALP quantity, according to the manufacturer's instructions. The amount of ALP in the cells was standardized relative to the total protein content. Alizarin red staining (ARS) HMSMSCs were seeded in 24-well plates at a density of 2 × 10 4 cells/cm 2 . When cell confluence reached 60%, the medium was replaced with an osteogenic induction medium containing varying ion levels, with the medium refreshed every two days. After 21 days in the OM, Alizarin red (Beyotime, China) staining (ARS) was performed. Following culture in the ion-containing calcification medium, cells were fixed with 4% paraformaldehyde, washed thrice with PBS, and subjected to alizarin red staining to visualize calcium deposition through the formation of mineralization nodules. Immunofluorescence staining of Osteocalcin/BGLAP After incubation in the OM for 21 days, cells were fixed in 4% paraformaldehyde in PBS (pH 7.4) for 10 min at room temperature. Subsequently, cells were washed with ice-cold PBS and permeabilized with 0.1% Triton X-100 in PBS for 30 min. Following another PBS wash, cells were blocked with 1% BSA in PBST (PBS + 0.1% Tween 20) for 30 min. Subsequently, cells were incubated overnight at 4°C with Osteocalcin Rabbit Polyclonal Antibody (diluted 1:200, Beyotime, China). After washing with PBS, cells were incubated with fluorescein isothiocyanate-labeled goat Anti-Rabbit IgG (diluted 1:500, Beyotime, China) for 1 h at room temperature. After washing with PBS, cells were counterstained with DAPI (diluted 1:1000, Meilunbio, China) and Actin-Tracker Red-Rhodamine (diluted 1:200, Beyotime, China) according to the manufacturer's instructions. Immunofluorescence images were captured using an inverted fluorescence microscope (ECLIPSE Ts2R, Nikon, Japan), and ImageJ software was used for image processing. Quantitive Reverse Transcription-Polymerase Chain Reaction (qRT-PCR) Total RNA was extracted from third-generation MSMSCs induced with varying magnesium ion concentrations for 3, 7, and 14 days using RNA-easy Isolation Reagent (Vazyme, China), following the manufacturer's instructions. The purity and concentration of RNA were determined using UV spectroscopy. Subsequently, cDNA was synthesized from 1 mg of total RNA using the PrimeScript RT Reagent Kit (TaKaRa, Japan). The synthesized cDNA samples were subjected to real-time polymerase chain reaction using the Roche Light Cycler 96 (Roche, Mann, Japan) and TB Green Premix Ex TaqTM II (Takara, Japan). Reaction conditions included incubation at 95°C for 30 s, 95°C for 5 s, and 60°C for 30 s. GADPH was used as an internal control, and the relative expression levels of the target genes were calculated using the 2 − ΔΔCt method. Table 2 qRT-PCR primer sequences Gene Sequences GADPH F: GGAGCGAGATCCCTCCAAAAT R: GGCTGTTGTCATACTTCTCATGG RUNX2 F: TGGTTACTGTCATGGCGGGTA R: TCTCAGATCGTTGAACCTTGCTA OPG F: GCGCTCGTGTTTCTGGACA R: AGTATAGACACTCGTCACTGGTG BMP-2 F: AAGCCAAACACAAACAGCGGAAAC R: CGTCAAGGTACAGCATCGAGATAGC Col1A1 F: GAGGGCCAAGACGAAGACATC R: CAGATCACGTCATCGCACAAC TGFβ1 F: CAACTATTGCTTCAGCTCCACG R: AAGTTGGCATGGTAGCCCTT Statistical analysis Each experiment was performed in triplicate and repeated at least thrice. Differences among the data in each group were compared using one-way ANOVA and Tukey's multiple comparison tests. Statistical analysis was performed using GraphPad (GraphPad Prism 9 Software Inc., La Jolla, CA, USA). Results Isolation, Culture, and Identification of hMSMSCs After three days of culturing hMSMSCs, cell attachment was observed (Fig. 2 b). By day five, the cells were closely arranged, and by day ten, they achieved 80% confluence, exhibiting a long spindle shape and a school-of-fish distribution. The CCK-8 assay (Fig. 2 a) showed an "S" shaped cell proliferation curve, with slower proliferation during days 1–2, rapid proliferation and entry into the logarithmic phase during days 2–5, and a plateau phase with slowed proliferation rate on days 6–7. Flow cytometry (Fig. 2 c) revealed that the obtained cells were positive for CD44, CD73, and CD105 and negative for CD11b, CD45, and CD19. The positivity rates for CD44, CD73, and CD105 were 98.8%, 87.6%, and 87.0%, respectively, while the rates for CD11b, CD45, and CD19 were 2.91%, 0.47%, and 3.59%, respectively, matching the stem cell phenotype. After 21 days of osteogenic, chondrogenic, and adipogenic differentiation induction, Alizarin Red staining revealed red calcium salt deposits (Fig. 2 d-A, magnified 40×), Alizarin Blue staining showed blue coloration (Fig. 2 d-B, magnified 100×), and Oil Red O staining revealed scattered orange-red fat droplets between cells (Fig. 2 d-C, magnified 200×). Cell Viability and Proliferation of hMSMSCs The CCK-8 method was used to compare the effects of different ion concentrations on the viability of hMSMSCs by calculating the cell survival rates for each group on days 1 and 3 (Fig. 3 d). Overall, compared with the blank group, the addition of ions did not produce significant cytotoxicity. Mg1, Mg2, Sr0.01, Sr0.1, Zn0.0001, and Zn0.001 exhibited significant proliferation-promoting effects. On day 3, Calcein AM/PI live/dead cell staining (Fig. 2 a) revealed that the live cell fluorescence signals in the Mg1, Sr0.01, Sr0.1, Zn0.0001, and Zn0.001 groups were significantly higher than those in the blank group. Analysis of the Calcein AM-(Fig. 3 b) and PI-(Fig. 3 c) stained areas using ImageJ software revealed that the fluorescence intensity in the Mg1, Sr0.01, Sr0.1, Zn0.0001, and Zn0.001 groups was significantly higher than in the blank group; however, the percentage of dead cells in the Mg5 (8%) and Sr1 (13%) groups was noticeably higher than in the other groups. Osteogenesis of hMSMSCs In a culture environment with different ion concentrations, cells were continuously induced to undergo osteogenesis for 3, 7, and 14 days, and ALP secretion and related gene expression were detected. Alkaline phosphatase (ALP) is a marker for osteogenic differentiation (Fig. 4 ). ALP staining (Fig. 4 a) showed that compared to the blank group, there were no visible differences in staining intensity among the groups at 3 days. On days 7 and 14, the Mg1, Sr0.01, Zn0.001, and Zn0.0001 groups exhibited notably darker staining than that of the blank group. In contrast, groups with higher ion concentrations, Mg5, Sr1, and Zn0.01, showed lighter staining and fewer stained cells than the blank group. Simultaneously, at each observation point, the expression of osteogenesis-related growth factor genes (Runx2, BMP-2, TGF-β1, OPG) in the Mg1, Sr0.01, and Zn0.001 groups was significantly higher than that of the blank group (Fig. 4 b). Similarly, the expression of genes related to osteogenic proteins (Col1A1) was significantly higher in the Mg1, Sr0.01, and Zn0.001 groups than in the blank group; however, there was no significant difference between the Mg1 and Sr0.01 groups. These results suggest that Mg, Sr, and Zn ions can effectively promote the osteogenic differentiation of hMSCs by influencing gene expression. However, with increasing ion concentration, no significant difference was found in the expression of osteogenesis-related growth factor genes between the Mg2, Mg5, Sr0.1, Sr1, Zn0.01, and blank groups (P > 0.05), suggesting that excessively high ion concentrations may not affect hMSMSCs. To further verify the impact of ions on cell osteogenic differentiation, histological Alizarin Red staining was performed (Fig. 4 a). The Mg1, Sr0.01, and Zn0.001 groups exhibited significantly increased formation of red calcium nodules compared to the blank group. Conversely, the Mg2, Mg5, Sr0.1, Sr1, and Zn0.01 groups exhibited fewer stained calcium nodules than the blank group. Our results clearly demonstrated hMSMSC differentiation using 0.01mM Sr, 0.001mM Zn, and 1mM Mg. Notably, although 0.1mM Sr and 0.0001Mm Zn initially partially enhanced ALP secretion and upregulated some related gene expressions during osteogenic induction, there was no significant difference in the expression of RUNX-2, BMP-2, COL1A1 between the 0.0001Zn and blank groups, indicating that, in terms of osteogenic differentiation, hMSMSCs might respond to specific concentrations of Mg, Sr, or Zn ions. Immunofluorescence staining of Osteocalcin/BGLAP In a culture environment with different ion concentrations, osteogenesis was continuously induced in the cells for 21 days, and osteocalcin/BGLAP was detected using immunofluorescence staining (Fig. 5 ). BGLAP was stained green with FITC, β-Actin was stained red with rhodamine, and cell nuclei were stained blue with DAPI (Fig. 5 a-c).Osteocalcin (BGLAP/OCN), an important secretory protein in the late stages of osteogenic differentiation, is present in the extracellular matrix and plays a role in promoting mineralization. As shown in Fig. 5 (a), in the Mg groups, the green fluorescence of Mg1 was greater than that in the blank, Mg2, and Mg5 groups. Simultaneously, Fig. 5 (b, c) indicates that Sr0.01 and Zn0.001 exhibited greater green fluorescence than the blank and their respective parallel groups. Subsequently, the fluorescence intensity of each group was calculated using ImageJ, and Fig. 5 (d) shows that the fluorescence intensity of Mg1, Sr0.01, Sr0.1, Zn0.001, and Zn0.0001 was significantly higher than that of the blank group. In summary, Mg, Sr, and Zn ions enhanced the secretion of BGLAP by hMSMSCs in a concentration-dependent manner. Notably, the Mg1, Sr0.01, and Zn0.001 groups exhibited the highest fluorescence intensities, with no statistically significant difference between their data. However, the fluorescence intensities of Sr0.01 and Zn0.0001 were significantly lower than those of Mg1, Sr0.01, and Zn0.001. Discussion The maxillary sinus membrane, also known as Schneiderian membrane, is a double-layered mucoperiosteal structure that covers the interior of the maxillary sinus cavity. The inner side of the maxillary sinus is lined with a pseudostratified columnar ciliated epithelium containing numerous goblet cells. The intrinsic vascular layer below the epithelium includes the serous glands, mucous glands, and thin-walled small veins. The epithelial and intrinsic layers constitute the mucous membrane, which, combined with the adjacent periosteum, forms a defensive barrier within the maxillary sinus [ 18 ][ 19 ]. MSFA is the most common method for bone defect repair in the posterior maxillary region. The maxillary sinus membrane plays a significant role in early bone formation during MSFA, and a series of studies have confirmed that osteogenic differentiation of MSMSCs is an important source of early bone formation in the maxillary sinus. In this study, we successfully extracted stem cells from human maxillary sinus membranes. CCK-8 assay demonstrated the self-renewal capability of hMSMSCs in vitro. Flow cytometry showed that these cells expressed CD105, CD73, and CD44 but did not express CD45, CD11b, or CD19. Additionally, the results of multilineage induction differentiation experiments confirmed the multilineage differentiation potential of hMSMSCs. Collectively, these results indicate that we successfully extracted hMSMSCs with multilineage differentiation capabilities. We discovered that Sr 2+ , Mg 2+ , and Zn 2+ alter the crucial cellular behavior of human Schneiderian membrane-derived stem cells in a concentration-dependent manner. In this study, we altered ion concentrations in the extracellular environment by adding different concentrations of MgCl 2 , SrCl 2, and ZnCl 2 to the cell culture medium. This method is simple and effective, allowing precise and stable control of the concentrations of various ions, thereby facilitating the observation of cellular biological responses to changes in ion concentration. Cell proliferation is an indispensable part of the bone regeneration process [ 20 ].In our research, we demonstrated through CCK-8 and Calcein AM/PI staining that different types and/or concentrations of metal ions could significantly affect the cell viability and proliferation of hMSMSCs. For instance, compared with the blank group, 0.01mM and 0.1mM Sr 2+ , 0.0001 and 0.001 mM Zn 2+ , and 1mM and 2 mM Mg 2+ had no significant impact on the viability of hMSMSCs and noticeably enhanced cell proliferation, with no significant differences in cell viability and proliferation among these experimental groups. Numerous studies have confirmed the promoting effect of appropriate concentrations of Sr 2+ , Mg 2+ , and Zn 2+ on cell proliferation; however, the biological responses of different types of mesenchymal stem cells to varying concentrations of metal ions are not the same. For example, studies have found that BMSCs and PDLCs undergo maximum proliferation at 360 mg/L (approximately 4.11mM) of Sr ions [ 21 , 22 ]. However, in our study, Sr ion concentrations exceeding 1mM significantly reduced the viability and proliferation of hMSMSCs. These results suggest that hMSMSCs may exhibit completely different biological responses to the same concentration of metal ions as traditional tissue-engineered seed cells such as BMSCs. In the bone-forming area of MSFA, BMSCs from the base of the maxillary sinus and MSMSCs from the maxillary sinus membrane promote new bone formation together, and our study found that a single concentration of strontium ions might be insufficient to simultaneously promote the proliferation of both types of cells. Previous research found that 1.8mM magnesium ions significantly improved the proliferation of BMSCs [ 23 ].Our study also discovered that 1mM and 2mM Mg 2+ could significantly enhance the proliferation of MSMSCs, suggesting that magnesium ions might be suitable for the new bone formation of MSFA. For osteogenic differentiation, we observed and quantitatively analyzed the ALP expression in each group, followed by Alizarin Red staining for further verification. The results showed that at all time points, the ALP expression in the 0.01mM Sr 2+ , 0.001mM Zn 2+ , and 1mM Mg 2+ groups was significantly better than that in the blank group. The magnesium ion group had a weaker promotional effect than strontium and zinc, with no significant differences between strontium and zinc. Studies have confirmed that ALP promotes the formation of hydroxyapatite crystals in the bone tissue and is involved in the osteogenic differentiation process, serving as an early indicator of osteogenic differentiation [ 24 ]]. This indicated that appropriate concentrations of Mg 2+ , Sr 2+ , and Zn 2+ effectively enhanced the ALP activity of hMSMSCs, thereby promoting early osteogenic differentiation. Studies have shown that Mg 2+ [ 25 ] and Zn 2+ [ 26 ] are necessary for maintaining ALP enzyme activity, with functions in stabilizing the protein conformation, which may be related to the improvement in ALP activity in hMSMSCs. However, as the concentration of metal ions increased further, the ALP activity of each group of hMSMSCs decreased significantly, suggesting that excessively high concentrations of metal ions inhibited early osteogenesis. Alizarin Red staining showed similar results, consistent with those of previous studies on high concentrations of Sr 2+ [ 9 ], Mg 2+ [ 12 ] and Zn 2+ [ 13 ]]. Differently, the concentration-dependent effect is highly related to the type of cells, as previously found optimal biological concentrations, such as 25–500µM Sr 2+ [ 9 ], were inconsistent with our findings. However, not all differences were absolute; for instance, 1.8mM magnesium ions have been reported to promote osteogenic differentiation [ 23 ], which is similar to our results. We further examined the expression of osteogenesis-related genes in each group of hMSMSCs, including osteogenesis-related growth factors (RUNX2, BMP-2, OPG, TGF-β1) and marker proteins (Col1A1). In this study, compared to the blank group, we found significantly increased expression of osteogenesis-related genes in the 0.01mM Sr, 0.001mM Zn, and 1mM Mg groups of hMSMSCs. BMP-2 and TGF-β1 have been repeatedly confirmed as important growth factors promoting MSC osteogenic differentiation. RUNX2 is a key osteogenic transcription factor [ 27 ] that can induce MSCs to differentiate into immature osteoblasts and activate and control the expression of osteogenic differentiation genes such as ALP, Col1A1, and BMP-2 [ 28 ][ 24 ]. Previous studies have shown that various metal ions can enhance the expression of osteogenic genes, such as RUNX2, in stem cells. For example, Mg 2+ can effectively promote the expression of RUNX2 in bone marrow stromal cells, subsequently increasing the expression of osteogenic marker proteins at different stages, such as ALP, Col1A1, and osteocalcin [ 29 ].In this study, we found that Sr 2+ , Mg 2+ , and Zn 2+ also enhanced RUNX2 expression in hMSMSCs. OPG is a secreted glycoprotein that can bind to RANKL, blocking the interaction between RANKL and RANK, thereby inhibiting the formation of osteoclasts and reducing bone resorption[ 23 ]. Reports have shown that Sr 2+ [ 30 ], Zn 2+ [ 31 ], and Mg 2+ [ 32 ] can affect OPG expression in cells, suggesting that these three ions may regulate OPG expression in hMSMSCs to reduce bone resorption in the maxillary sinus and promote osteogenesis. Finally, we used fluorescence staining to observe the effects of different concentrations of the three metal ions on osteocalcin expression in hMSMSCs. Osteocalcin is a non-collagenous protein that is mainly present in the extracellular matrix of bone cells, is primarily expressed during matrix maturation and mineralization, and is secreted only by mature osteoblasts. Immunofluorescence staining showed that osteocalcin expression in the 0.01mM Sr, 0.001mM Zn, and 1mM Mg groups of hMSMSCs significantly increased. The amino acid sequence of osteocalcin (aspartic acid and glutamic acid) can specifically bind to calcium ions, which in turn capture phosphate ions, induce the formation of hydroxyapatite mineral crystals[ 33 ], regulate osteoblast behavior, and promote extracellular matrix calcification[ 34 ]. Therefore, appropriate concentrations of Sr, Mg 2+ , and Zn may be beneficial for the osteogenic mineralization of hMSMSCs. This conclusion was also confirmed by Alizarin Red calcium nodule staining. Our study has some limitations. First, the regulation of ion concentrations in the human body is complex; therefore, a more precise range of ion concentrations may be used in our future research. Secondly, this study did not explore the effects of different combinations of ions acting simultaneously on cells. Previous studies have shown that combinations of multiple metal elements may possess superior osteogenic properties [ 35 ]. Finally, this study did not fully elucidate the specific regulatory actions of ions on cells, such as specific signaling pathways, target genes, or proteins. Therefore, the mechanisms of ion-mediated regulation of osteogenic differentiation should be assessed in the future. In conclusion, variations in the types and concentrations of ions in the extracellular environment can significantly alter the behavior of hMSMSCs and can be considered to improve the material design for maxillary sinus elevation applications. Conclusions Magnesium, zinc, and strontium ions variably affect the vitality and osteogenic differentiation of MSMSCs, depending on their concentrations. Lower concentrations of these ions boost cell proliferation and differentiation, while higher levels act as inhibitors. The optimal concentrations are 1.8mM for Mg 2+ , and 0.001mM for Zn 2+ , and 0.01mM for Sr 2+ . Among these, Zn 2+ at their optimal concentration exhibit the most significant biological efficacy. Declarations Author Contributions: Conceptualization, Zhihao Zhang and Fei Tan; Formal analysis, Zhihao Zhang, Ning Gong, Ying Wang, Lei Xu, Sinan Zhao; Funding acquisition, Fei Tan; Investigation, Yanshan Liu; Methodology, Zhihao Zhang and Fei Tan; Project administration, Ying Wang and Sinan Zhao; Resources, Yanshan Liu and Fei Tan; Supervision, Fei Tan; Validation, Zhihao Zhang and Ning Gong; Writing—original draft, Zhihao Zhang; Writing—review and editing, Fei Tan; All authors have read and agreed to the published version of the manuscript. Conflict of Interest The authors report there are no competing interests to declare. Funding This research was supported by a grant of Project through the Shandong Provincial Natural Science Foundation Regular Program, funded by Department of Science & Technology of Shandong Province (Grant No. ZR2022MH239) Ethical Approval This study was reviewed and approved by the Institutional Review Board (IRB) of The Affiliated Hospital of Qingdao University. All procedures performed in the study involving human participants were in accordance with the ethical standards of the institutional and national research committee and with the 1964 Helsinki declaration standards. The ethical approval number for this research is QYFY WZLL 28450 . Informed Consent statements All participants in this study provided informed consent prior to their involvement. Three volunteers, after being fully informed about the purpose of the research, the procedures to be undertaken, potential risks, and benefits, as well as their rights to withdraw from the study at any time without penalty, have signed the informed consent forms. The scanned copies of the documents pertaining to ethical approval and informed consent statements have been uploaded to the "Related Files" section. References Stern A, Green J (2012) Sinus Lift Procedures: An Overview of Current Techniques. Dental Clin N Am 56:219–233. https://doi.org/10.1016/j.cden.2011.09.003 Riben C, Thor A (2012) The Maxillary Sinus Membrane Elevation Procedure: Augmentation of Bone around Dental Implants without Grafts—A Review of a Surgical Technique. Int J Dentistry 2012:1–9. https://doi.org/10.1155/2012/105483 Rong Q, Li X, Chen SL et al (2015) Effect of the Schneiderian membrane on the formation of bone after lifting the floor of the maxillary sinus: an experimental study in dogs. Br J Oral Maxillofac Surg 53:607–612. https://doi.org/10.1016/j.bjoms.2015.02.010 Srouji S, Kizhner T, David DB et al (2008) The Schneiderian Membrane Contains Osteoprogenitor Cells: In Vivo and In Vitro Study. Calcif Tissue Int 84:138–145. https://doi.org/10.1007/s00223-008-9202-x Guo J, Weng J, Rong Q et al (2015) Investigation of multipotent postnatal stem cells from human maxillary sinus membrane. Sci Rep 5. https://doi.org/10.1038/srep11660 de Peppo GM, Marolt D (2013) Modulating the biochemical and biophysical culture environment to enhance osteogenic differentiation and maturation of human pluripotent stem cell-derived mesenchymal progenitors. Stem Cell Res Ther. https://doi.org/10.1186/scrt317 Liu Y, Wang J, Zhai P et al (2021) Stiffness Regulates the Morphology, Adhesion, Proliferation, and Osteogenic Differentiation of Maxillary Schneiderian Sinus Membrane-Derived Stem Cells. Stem Cells Int 2021:1–12. https://doi.org/10.1155/2021/8868004 Bosch-Rué E, Diez-Tercero L, Giordano-Kelhoffer B et al (2021) Biological Roles and Delivery Strategies for Ions to Promote Osteogenic Induction. Front Cell Dev Biology 8. https://doi.org/10.3389/fcell.2020.614545 Aimaiti A, Maimaitiyiming A, Boyong X et al (2017) Low-dose strontium stimulates osteogenesis but high-dose doses cause apoptosis in human adipose-derived stem cells via regulation of the ERK1/2 signaling pathway. Stem Cell Res Ther 8. https://doi.org/10.1186/s13287-017-0726-8 Díaz-Tocados JM, Herencia C, Martínez-Moreno JM et al (2017) Magnesium Chloride promotes Osteogenesis through Notch signaling activation and expansion of Mesenchymal Stem Cells. Sci Rep 7. https://doi.org/10.1038/s41598-017-08379-y Yusa K, Yamamoto O, Takano H et al (2016) Zinc-modified titanium surface enhances osteoblast differentiation of dental pulp stem cells in vitro. Sci Rep 6. https://doi.org/10.1038/srep29462 Qi T, Weng J, Yu F et al (2020) Insights into the Role of Magnesium Ions in Affecting Osteogenic Differentiation of Mesenchymal Stem Cells. Biol Trace Elem Res 199:559–567. https://doi.org/10.1007/s12011-020-02183-y Yusa K, Yamamoto O, Iino M et al (2016) Eluted zinc ions stimulate osteoblast differentiation and mineralization in human dental pulp stem cells for bone tissue engineering. Arch Oral Biol 71:162–169. https://doi.org/10.1016/j.archoralbio.2016.07.010 Ni S, Xiong X, Ni X (2020) MgCl2 promotes mouse mesenchymal stem cell osteogenic differentiation by activating the p38/Osx/Runx2 signaling pathway. Mol Med Rep. https://doi.org/10.3892/mmr.2020.11487 Huang Y, Wu C, Xie H et al (2019) Strontium Promotes the Proliferation and Osteogenic Differentiation of Human Placental Decidual Basalis- and Bone Marrow-Derived MSCs in a Dose-Dependent Manner. https://doi.org/10.1155/2019/4242178 . Stem Cells International Park KH, Choi Y, Yoon DS et al (2018) Zinc Promotes Osteoblast Differentiation in Human Mesenchymal Stem Cells Via Activation of the cAMP-PKA-CREB Signaling Pathway. Stem Cells Dev 27:1125–1135. https://doi.org/10.1089/scd.2018.0023 Fathi E, Farahzadi R (2017) Enhancement of osteogenic differentiation of rat adipose tissue-derived mesenchymal stem cells by zinc sulphate under electromagnetic field via the PKA, ERK1/2 and Wnt/β-catenin signaling pathways. PLoS ONE. https://doi.org/10.1371/journal.pone.0173877 Scharf KE, Lawson W, Shapiro JM, Gannon PJ (1995) Pressure measurements in the normal and occluded rabbit maxillary sinus. Laryngoscope 105:570–574 Puranen J (1966) Reorganization of Fresh and Preserved Bone Transplants: An Experimental Study in Rabbits Using Tetracycline Labelling. Acta Orthop Scand 37:3–77 Pang S, Shen J, Liu Y et al (2015) Proliferation and Osteogenic Differentiation of Mesenchymal Stem Cells Induced by a Short Isoform of NELL-1. https://doi.org/10.1002/stem.1884 . STEM CELLS Bizelli-Silveira C, Pullisaar H, Abildtrup LA et al (2018) Strontium enhances proliferation and osteogenic behavior of periodontal ligament cells in vitro. J N Res 53:1020–1028. https://doi.org/10.1111/jre.12601 Bizelli-Silveira C, Abildtrup LA, Spin‐Neto R et al (2019) Strontium enhances proliferation and osteogenic behavior of bone marrow stromal cells of mesenchymal and ectomesenchymal origins in vitro. Clin Experimental Dent Res 5:541–550. https://doi.org/10.1002/cre2.221 Díaz-Tocados JM, Herencia C, Martínez-Moreno JM et al (2017) Magnesium Chloride promotes Osteogenesis through Notch signaling activation and expansion of Mesenchymal Stem Cells. Sci Rep 7. https://doi.org/10.1038/s41598-017-08379-y Vimalraj S (2020) Alkaline phosphatase: Structure, expression and its function in bone mineralization. Gene 754:144855 Sharma U, Pal D, Prasad R (2013) Alkaline Phosphatase: An Overview. Indian J Clin Biochem 29:269–278 O’Connor JP, Kanjilal D, Teitelbaum M et al (2020) Zinc as a Therapeutic Agent in Bone Regeneration. Mater 13:2211. https://doi.org/10.3390/ma13102211 Vimalraj S, Arumugam B, Miranda PJ, Selvamurugan N (2015) Runx2: Structure, function, and phosphorylation in osteoblast differentiation. Int J Biol Macromol 78:202–208 Bruderer M, Richards RG, Alini M, Stoddart MJ (2014) Role and regulation of RUNX2 in osteogenesis. Eur Cell Mater 28:269–286 Phimphilai M, Zhao Z, Boules H et al (2006) BMP Signaling Is Required for RUNX2-Dependent Induction of the Osteoblast Phenotype. J Bone Miner Res 21:637–646 Tong X, Gu J, Song R et al (2018) Osteoprotegerin inhibit osteoclast differentiation and bone resorption by enhancing autophagy via AMPK/mTOR/p70S6K signaling pathway in vitro. J Cell Biochem 120:1630–1642. https://doi.org/10.1002/jcb.27468 Molenda M, Kolmas J (2023) The Role of Zinc in Bone Tissue Health and Regeneration—a Review. https://doi.org/10.1007/s12011-023-03631-1 . Biological Trace Element Research Tong X, Gu J, Song R et al (2018) Osteoprotegerin inhibit osteoclast differentiation and bone resorption by enhancing autophagy via AMPK/mTOR/p70S6K signaling pathway in vitro. J Cell Biochem 120:1630–1642 Perez RA, Seo S-J, Won J-E et al (2015) Therapeutically relevant aspects in bone repair and regeneration. Mater N a 18:573–589. https://doi.org/10.1016/j.mattod.2015.06.011 Tsao Y-T, Huang Y-J, Wu H-H et al (2017) Osteocalcin Mediates Biomineralization during Osteogenic Maturation in Human Mesenchymal Stromal Cells. Int J Mol Sci 18:159. https://doi.org/10.3390/ijms18010159 Dali SSM, Wong S, Chin K, Ahmad F (2023) The Osteogenic Properties of Calcium Phosphate Cement Doped with Synthetic Materials: A Structured Narrative Review of Preclinical Evidence. Int J Mol Sci. https://doi.org/10.3390/ijms24087161 Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-3972505","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":273877855,"identity":"801adf9c-86f0-4049-92cc-b1d0e7f42410","order_by":0,"name":"Zhihao Zhang","email":"","orcid":"","institution":"Department of Prosthodontic, The Affiliated Hospital of Qingdao University","correspondingAuthor":false,"prefix":"","firstName":"Zhihao","middleName":"","lastName":"Zhang","suffix":""},{"id":273877856,"identity":"9fcff536-0378-4303-a842-6745b4f0a410","order_by":1,"name":"Ning Gong","email":"","orcid":"","institution":"Department of Prosthodontic, The Affiliated Hospital of Qingdao University","correspondingAuthor":false,"prefix":"","firstName":"Ning","middleName":"","lastName":"Gong","suffix":""},{"id":273877860,"identity":"25347e9f-e8da-443e-8783-29a11ffc744f","order_by":2,"name":"Ying Wang","email":"","orcid":"","institution":"Department of Prosthodontic, The Affiliated Hospital of Qingdao University","correspondingAuthor":false,"prefix":"","firstName":"Ying","middleName":"","lastName":"Wang","suffix":""},{"id":273877862,"identity":"63b9c2e8-5f96-4258-a666-affc77fced60","order_by":3,"name":"Lei Xu","email":"","orcid":"","institution":"Department of Prosthodontic, The Affiliated Hospital of Qingdao University","correspondingAuthor":false,"prefix":"","firstName":"Lei","middleName":"","lastName":"Xu","suffix":""},{"id":273877864,"identity":"56917828-2f09-4d01-9d77-5b7a28f03dd6","order_by":4,"name":"Sinan Zhao","email":"","orcid":"","institution":"Department of Prosthodontic, The Affiliated Hospital of Qingdao University","correspondingAuthor":false,"prefix":"","firstName":"Sinan","middleName":"","lastName":"Zhao","suffix":""},{"id":273877865,"identity":"a0440cb4-0dbb-48fa-98b0-de84fb08fb07","order_by":5,"name":"Yanshan Liu","email":"","orcid":"","institution":"Department of Oral and Maxillofacial Surgery, The Affiliated Hospital of Qingdao University","correspondingAuthor":false,"prefix":"","firstName":"Yanshan","middleName":"","lastName":"Liu","suffix":""},{"id":273877866,"identity":"93c81f95-4ea6-46d9-b4cb-9a3087c0f209","order_by":6,"name":"Fei Tan","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAwUlEQVRIiWNgGAWjYJCCDwwGNnLy7I2NDz8Qo5yHgYFxBkNBmrFhz+FmYwnitXw4nNhwI71NgIcYLfbsZw82MBgcNmac+bCNQYLBTk63gZAtPHmJQC3pcuzSiW0PChiSjc0OEHRYjvnjPwbWxoyzE9sNJBgOJG4jqIX/jSHQFubEhpsH2yR4iNIikQPS4gz0PiOxWm6AbQEFciIwkA2I8At7P8iWP6CoPP7w4YcKOzmCWtCAAWnKR8EoGAWjYBTgAAD2Hj+gOLjgTAAAAABJRU5ErkJggg==","orcid":"","institution":"Department of Prosthodontic, The Affiliated Hospital of Qingdao University","correspondingAuthor":true,"prefix":"","firstName":"Fei","middleName":"","lastName":"Tan","suffix":""}],"badges":[],"createdAt":"2024-02-20 10:33:58","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-3972505/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-3972505/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":51467856,"identity":"2e3f75ef-3a37-46d1-b299-f83ff44e2a26","added_by":"auto","created_at":"2024-02-22 06:54:09","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":4516266,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eGraphic Abstract\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"Figure1.GraphicAbstract.png","url":"https://assets-eu.researchsquare.com/files/rs-3972505/v1/0df714e92584151d9cb37f5c.png"},{"id":51467853,"identity":"33475eeb-005f-49ca-9a36-a9971b50c129","added_by":"auto","created_at":"2024-02-22 06:54:09","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":2302681,"visible":true,"origin":"","legend":"\u003cp\u003eIsolation, culture and identification of hMSMSCs. (a. Cell growth curve; b. Cell growth status; c. flow cytometry; a. Alizarin Red staining for osteogenic induction differentiation 40×; b. Alcian Blue staining for chondrogenic induction differentiation 100×; c. Oil Red O staining for adipogenic induction differentiation 200×.)\u003c/p\u003e","description":"","filename":"Figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-3972505/v1/0438d8c2b8354fe6e6f68579.png"},{"id":51468244,"identity":"1ec6a9a8-5422-4f7e-a52f-797c7f733844","added_by":"auto","created_at":"2024-02-22 07:02:09","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":1293479,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of magnesium ions on hMSMSCs activity and proliferation. (a). Fluorescence staining of Calcein AM/PI live-dead cells cultured for 72 hours in each group, ×100; (b). Fluorescence intensity of Calcein AM in each group; (c). Fluorescence intensity of PI in each group; (d). Cell viability of each group for 24 and 72 hours; (e). Ratio of living to dead cells. Each value represents a mean ±SD for three independent experiments (n =3) each done in triplicate. *p<0.05; Experimental group versus blank groups (One-way ANOVA test)\u003c/p\u003e","description":"","filename":"Figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-3972505/v1/0284c3031afd08514e13982b.png"},{"id":51467855,"identity":"0fd17c18-5599-4698-a57f-11b0f45fe7d8","added_by":"auto","created_at":"2024-02-22 06:54:09","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":3466555,"visible":true,"origin":"","legend":"\u003cp\u003eOsteogenic differentiation assay. (a) Alkaline phosphatase staining of each group after 3, 7, and 14 d of osteogenesis induction and alizarin red staining after 21 d of induction (×40). (b) Quantitative analysis of the effect of alkaline phosphatase activity and detection of osteogenesis-related gene expression after 3,7, and 14 days of osteogenic induction. Each value represents a mean ±SD for three independent experiments (n =3) each done in triplicate. *p<0.05 on day3; #p<0.05 on day7; $p<0.05 on day14; Experimental group versus Blank groups (One-way ANOVA test)\u003c/p\u003e","description":"","filename":"Figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-3972505/v1/3a96f9c74080f2d5b3fc8e81.png"},{"id":51467857,"identity":"c7fab6c8-c3e4-4d37-ba47-d280267c89bd","added_by":"auto","created_at":"2024-02-22 06:54:09","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":2233738,"visible":true,"origin":"","legend":"\u003cp\u003eImmunofluorescence staining of Osteocalcin/BGLAP . (a) Immunofluorescence staining of BGLAP-DAPI- cytoskeleton of Mg groups after 21 days of osteogenesis induction. (×200). (b) Immunofluorescence staining of BGLAP-DAPI- cytoskeleton of Sr groups after 21 days of osteogenesis induction. (×200). (c) Immunofluorescence staining of BGLAP-DAPI- cytoskeleton of Zn groups after 21 days of osteogenesis induction. (×200). (d) Quantitative analysis of fluorescence intensity of BGLAP. Each value represents a mean ±SD for three independent experiments (n =3) each done in triplicate. *p<0.05; Experimental group versus blank groups (One-way ANOVA test).\u003c/p\u003e","description":"","filename":"figure5.png","url":"https://assets-eu.researchsquare.com/files/rs-3972505/v1/fb290911319167b324dd9c6f.png"},{"id":51535789,"identity":"23b53126-55ce-4e83-94ac-195d2c534884","added_by":"auto","created_at":"2024-02-23 09:31:15","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":3865229,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-3972505/v1/b5924245-d0a8-442f-bcf2-0075180f3f8f.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Impact of strontium, magnesium, and zinc ions on the in vitro osteogenesis of maxillary sinus membrane stem cells","fulltext":[{"header":"Introduction","content":"\u003cp\u003eMaxillary sinus floor augmentation (MSFA), known for its stable vertical bone formation and clinical predictability in the osteogenesis area, is a vital [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]] technique for vertical bone augmentation in the posterior maxillary region. The influence of the maxillary sinus membrane on bone formation in this area may be a critical factor in the success of MSFA [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. For instance, Rong et al. [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e] used titanium membranes to isolate the sinus wall and membrane, discovering significant new bone formation on the sinus membrane side of the MSFA after isolation. This suggests an intrinsic bone-forming capability of the maxillary sinus membrane, indicating its crucial role in MSFA osteogenesis. Srouji et al. [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]] isolated and cultured cells from the maxillary sinus membrane, identifying stem cells with mesenchymal characteristics and confirming their potential for osteogenic, osteoclastic, and adipogenic differentiation. Guo et al. [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e] demonstrated that the osteogenic potential of maxillary sinus membrane stem cells (MSMSCs) is similar to that of bone marrow mesenchymal stem cells (MSCs), showing a strong osteogenic differentiation capability. These studies collectively suggest that MSMSCs play a significant role in bone regeneration guided by the maxillary sinus membrane after MSFA. However, numerous studies have indicated that osteogenic differentiation of stem cells is primarily regulated by changes in the osteogenic environment surrounding the cells [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. Research has shown that the osteogenic differentiation capability of MSMSCs is also influenced by changes in the surrounding osteogenic environment. Liu et al. [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e] observed that MSMSCs exhibited varying osteogenic differentiation capabilities when exposed to materials with varying stiffness levels. This suggests that MSMSCs can alter their osteogenic differentiation capabilities based on changes in their immediate environment. However, further investigation is needed to understand how these environmental variations affect MSMSCs compared to traditional seed cells, such as BMSCs. Additionally, exploring methods to better optimize the osteogenic differentiation of MSMSCs for improved bone formation in MSFA requires a more detailed study.\u003c/p\u003e \u003cp\u003eResearch indicates that the osteogenic efficacy of MSCs is markedly influenced by the types and concentrations of metal ions present in their surrounding environment. This phenomenon has garnered considerable interest in the field of bone regeneration [[\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. Changes in the types and concentrations of ions such as strontium (Sr\u003csup\u003e2+\u003c/sup\u003e)[\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]], magnesium (Mg\u003csup\u003e2+\u003c/sup\u003e) [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e], or zinc (Zn\u003csup\u003e2+\u003c/sup\u003e) [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e] within the cellular microenvironment can affect MSC functions, including proliferation and osteogenic differentiation. These alterations influence relevant signaling pathways and enzyme activities. For instance, studies have found that while lower concentrations of Sr\u003csup\u003e2+\u003c/sup\u003e (25\u0026ndash;500\u0026micro;M) promote osteogenic differentiation in human adipose-derived stem cells (hASCs), higher concentrations (1000\u0026ndash;3000\u0026micro;M) inhibit this process and induce apoptosis [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. Similar observations have been reported for Mg [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e] and Zn ions [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. For instance, Mg\u003csup\u003e2+\u003c/sup\u003e were found to promote osteogenic differentiation and mineralization of mouse MSCs by activating the p38/Osx/Runx2 signaling pathway [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. These studies demonstrated the impact of metal ion types and concentrations in the surrounding environment on stem cell osteogenic performance. However, different types of stem cells may react distinctly to the same type and concentration of metal ions. For example, studies have shown that concentrations of Sr\u003csup\u003e2+\u003c/sup\u003e below 1mM significantly promote osteogenic differentiation in placental decidual basalis-derived MSCs (PDB-MSCs), but these concentrations do not enhance osteogenic gene expression in bone marrow-derived MSCs (BMSCs) [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. Similarly, a concentration of 100\u0026micro;M Zn\u003csup\u003e2+\u003c/sup\u003e significantly increased the expression of osteogenic genes and ALP in BMSCs [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]], whereas a lower concentration was sufficient to enhance osteogenic differentiation in hASCs [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]]. However, to the best of our knowledge, there has been no research conducted on the effects of metal ions on the osteogenic capabilities of MSMSCs, warranting further investigation.\u003c/p\u003e \u003cp\u003eWe hypothesized that modifying the type and concentration of ions in the microenvironment would affect the proliferation and differentiation of MSMSCs in a concentration-dependent manner. In the present study, we explored the effects of Mg, Sr, and Zn ions on the cell viability and osteogenic differentiation of hMSMSCs to validate our hypothesis.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eExtraction and Identification of hMSMSCs\u003c/h2\u003e \u003cp\u003e Samples of MSMSCs were obtained following the ethical guidelines of the Affiliated Hospital of Qingdao University (Qingdao, China). The samples were obtained with informed consent from patients aged 18\u0026ndash;25 years (n\u0026thinsp;=\u0026thinsp;3) exhibiting abnormal occlusion, jaw development issues, or maxillofacial deformities and who had undergone Le Fort I osteotomy for orthognathic surgery. Smokers and patients with skeletal or systemic diseases were excluded. The maxillary sinus membrane was exposed within the truncated maxilla, extracted over a 2mm*2mm area, and secured with absorbable sutures to close the mucoperiosteum tightly. Post-collection, all samples were washed and preserved in PBS solution supplemented with antibiotics at 4℃. Cell isolation was conducted for 24 h. These samples were used for (a) histological analysis, (b) establishment of in vitro cultures of MSMSC-derived cells, (c) analysis of the in vitro differentiation potential of these cells, and (d) investigation of the effect of ions on osteogenic differentiation of MSMSCs in vitro.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eCell culture\u003c/h2\u003e \u003cp\u003eThe maxillary sinus membranes were carefully extracted from patients undergoing maxillofacial surgery. These samples were treated in 4 mg/mL of dispase at 37\u0026deg;C for 4 h to eliminate the epithelial cells. Subsequently, the samples were sliced and digested in 3 mg/mL of collagenase for 30 minutes at 37\u0026deg;C. The processed samples were then cultured in T75 flasks containing 10% FBS (Procell, China) and 1% penicillin-streptomycin in DMEM (Meilunbio, China). The cells were incubated at 37\u0026deg;C in a 5% CO2 environment. Upon reaching 80% confluence, cells were passaged at a 1:3 ratio. The third generation of cells was utilized for subsequent experiments.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eMulti-differentiation assay\u003c/h2\u003e \u003cp\u003eA differentiation induction culture kit (Meilunbio, China) was used to induce osteogenic, adipogenic, and chondrogenic differentiation of MSMSCs. Cells were seeded in six-well plates at a density of 1\u0026times;10\u003csup\u003e5\u003c/sup\u003e cells/mL. Osteogenic and adipogenic differentiations were induced for 14 days, while chondrogenic differentiation was induced for 21 days. After induction, cells were fixed in 4% paraformaldehyde for 10 min. Calcified nodules were stained with alizarin red solution (pH4.2) for 30 minutes. Adipocytes were stained with Oil Red O for 15 min, while chondrocytes were stained with alizarin blue for 15 min.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eImmunophenotype identification assay\u003c/h2\u003e \u003cp\u003eA total of 5\u0026times;10\u003csup\u003e5\u003c/sup\u003e cells dispersed in 400 \u0026micro;l of Cell Staining Buffer (Elabscience, China) were labeled with antibodies (CD44, CD105, CD73, CD45, CD19, CD11b from Elabscience, China) and analyzed using a flow cytometer Antibodies were used at a concentration of 0.5 \u0026micro;g/10\u003csup\u003e6\u003c/sup\u003e cells in a 100 \u0026micro;L volume.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eGroups\u003c/h2\u003e \u003cp\u003eThe experiment was divided into ten groups, nine of which were subjected to various concentrations of Mg, Zn, and Sr to simulate actual physiological conditions. Ions were added to the medium in the form of MgCl\u003csub\u003e2\u003c/sub\u003e, SrCl\u003csub\u003e2,\u003c/sub\u003e or ZnCl\u003csub\u003e2\u003c/sub\u003e. The specific levels are listed in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eGroups\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"2\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGroups\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eConditions\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBlank\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCulture Media only (Mg\u003csup\u003e2+\u003c/sup\u003e0.8mM)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMg1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCulture Media with 1mM MgCl\u003csub\u003e2\u003c/sub\u003e(Mg\u003csup\u003e2+\u003c/sup\u003e1.8mM)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMg2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCulture Media with 2mM MgCl\u003csub\u003e2\u003c/sub\u003e(Mg\u003csup\u003e2+\u003c/sup\u003e2.8mM)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMg5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCulture Media with 5mM MgCl\u003csub\u003e2\u003c/sub\u003e(Mg\u003csup\u003e2+\u003c/sup\u003e5.8mM)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSr0.01\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCulture Media with 0.01mM SrCl\u003csub\u003e2\u003c/sub\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSr0.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCulture Media with 0.1mM SrCl\u003csub\u003e2\u003c/sub\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSr1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCulture Media with 1mM SrCl\u003csub\u003e2\u003c/sub\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eZn0.0001\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCulture Media with 0.0001mM ZnCl\u003csub\u003e2\u003c/sub\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eZn0.001\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCulture Media with 0.001mM ZnCl\u003csub\u003e2\u003c/sub\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eZn0.01\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCulture Media with 0.001mM ZnCl\u003csub\u003e2\u003c/sub\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eCell viability\u003c/h2\u003e \u003cp\u003eCell viability of curcumin-treated cells was determined using a Cell Counting Kit-8 (Meilunbio, China). MSMSCs harvested during the exponential growth phase were individually digested with 0.25% trypsin-ethylene diamine tetra acetic acid (EDTA) (Procell, China). Viable single cell suspensions were obtained by centrifugation at 1000 rpm for 5 min. These suspended cells were seeded in 96-well plates at a density of 8,000 cells/well, with three replicates per group. After treatment with DMEM and varying ion concentrations for 24 and 72 h, 10% CCK-8 solution was added to each well and incubated for 3 h at 37˚C. The absorbance at 450 nm was subsequently measured using an enzyme marker.\u003cdiv id=\"Equa\" class=\"Equation\"\u003e\u003cdiv format=\"TEX\" class=\"mathdisplay\" id=\"FileID_Equa\" name=\"EquationSource\"\u003e\n$$\\text{C}\\text{e}\\text{l}\\text{l} \\text{V}\\text{i}\\text{a}\\text{b}\\text{i}\\text{l}\\text{i}\\text{t}\\text{y} \\left(\\text{%}\\right)=\\left(\\frac{Absorbance of Treated Sample-Absorbance of Blank}{Absorbance of Control-Absorbance of Blank}\\right)\\times 100$$\u003c/div\u003e\u003c/div\u003e\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eLive/Dead cell Immunofluorescence staining\u003c/h2\u003e \u003cp\u003e The 24 wells plates were evaluated by seeding them with hMSMSCs cells and assessing cytotoxicity through Calcein AM/PI staining, followed by quantitative analysis using ImageJ. hMSMSCs cultured in DMEM supplemented with 10% FBS and 1% penicillin-streptomycin, were seeded onto plates at a density of 5x10\u003csup\u003e4\u003c/sup\u003e cells/mL and allowed to adhere for 2 hours before the addition of fresh medium with ions. After 24\u0026ndash;72 hours of further incubation, cell viability was assessed using a staining solution of 2 \u0026micro;M Calcein AM and 4 \u0026micro;M PI in PBS, incubating in the dark for 30 minutes. ImageJ was employed to count live (green) and dead (red) cells, calculating the percentage of viable cells.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003eOsteogenic differentiation\u003c/h2\u003e \u003cp\u003eUpon reaching 80% confluence, MSMSCs were transferred to osteogenic medium (OM) composed of DMEM medium supplemented with 15% FBS, 1% NEAA, 0.1 mM β-mercaptoethanol, 1%penicillin/streptavidin, 5\u0026micro;g mL\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e ascorbic acid, 10 mM sodium glycerophosphate, and 10\u003csup\u003e\u0026minus;\u0026thinsp;8\u003c/sup\u003e M dexamethasone. The medium was refreshed every two days. After inductions for various durations (3 days,7 days, 14 days, 21 days), cells were used for subsequent experiments.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eAlkaline phosphatase (ALP) activity assay\u003c/h2\u003e \u003cp\u003eThe ALP activity assay was performed to assess the in vitro osteogenic differentiation ability of Mg\u003csup\u003e2+\u003c/sup\u003e, Sr\u003csup\u003e2+\u003c/sup\u003e, and Zn\u003csup\u003e2+\u003c/sup\u003e. MSMSCs were seeded in 24-well plates at a density of 2\u0026times;10\u003csup\u003e4\u003c/sup\u003e cells/cm\u003csup\u003e2\u003c/sup\u003e. Upon reaching 60% confluence, the cell culture medium was replaced with an osteogenic induction medium containing varying ion concentrations. The cell culture medium was renewed every two days. After culturing for 3,7 and 14 days, ALP staining and activity assays were conducted. For ALP staining, MSMSCs were washed thrice with PBS, fixed with 4% paraformaldehyde for 10 min, and stained using the BCIP/NBT ALP Color Development Kit (Meilunbio, China) following the manufacturer's instructions. To assess ALP activity, proteins were extracted from lysed cells using radioimmunoprecipitation assay (RIPA) lysis buffer (Solarbio, China). ALP activity was assayed using an Alkaline phosphatase assay kit (Nanjing Jiancheng Bioengineering Institute, China) to quantify the relative ALP quantity, according to the manufacturer's instructions. The amount of ALP in the cells was standardized relative to the total protein content.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eAlizarin red staining (ARS)\u003c/h2\u003e \u003cp\u003eHMSMSCs were seeded in 24-well plates at a density of 2 \u0026times; 10\u003csup\u003e4\u003c/sup\u003e cells/cm\u003csup\u003e2\u003c/sup\u003e. When cell confluence reached 60%, the medium was replaced with an osteogenic induction medium containing varying ion levels, with the medium refreshed every two days. After 21 days in the OM, Alizarin red (Beyotime, China) staining (ARS) was performed. Following culture in the ion-containing calcification medium, cells were fixed with 4% paraformaldehyde, washed thrice with PBS, and subjected to alizarin red staining to visualize calcium deposition through the formation of mineralization nodules.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eImmunofluorescence staining of Osteocalcin/BGLAP\u003c/h2\u003e \u003cp\u003eAfter incubation in the OM for 21 days, cells were fixed in 4% paraformaldehyde in PBS (pH 7.4) for 10 min at room temperature. Subsequently, cells were washed with ice-cold PBS and permeabilized with 0.1% Triton X-100 in PBS for 30 min. Following another PBS wash, cells were blocked with 1% BSA in PBST (PBS\u0026thinsp;+\u0026thinsp;0.1% Tween 20) for 30 min. Subsequently, cells were incubated overnight at 4\u0026deg;C with Osteocalcin Rabbit Polyclonal Antibody (diluted 1:200, Beyotime, China). After washing with PBS, cells were incubated with fluorescein isothiocyanate-labeled goat Anti-Rabbit IgG (diluted 1:500, Beyotime, China) for 1 h at room temperature. After washing with PBS, cells were counterstained with DAPI (diluted 1:1000, Meilunbio, China) and Actin-Tracker Red-Rhodamine (diluted 1:200, Beyotime, China) according to the manufacturer's instructions. Immunofluorescence images were captured using an inverted fluorescence microscope (ECLIPSE Ts2R, Nikon, Japan), and ImageJ software was used for image processing.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eQuantitive Reverse Transcription-Polymerase Chain Reaction (qRT-PCR)\u003c/h2\u003e \u003cp\u003eTotal RNA was extracted from third-generation MSMSCs induced with varying magnesium ion concentrations for 3, 7, and 14 days using RNA-easy Isolation Reagent (Vazyme, China), following the manufacturer's instructions. The purity and concentration of RNA were determined using UV spectroscopy. Subsequently, cDNA was synthesized from 1 mg of total RNA using the PrimeScript RT Reagent Kit (TaKaRa, Japan). The synthesized cDNA samples were subjected to real-time polymerase chain reaction using the Roche Light Cycler 96 (Roche, Mann, Japan) and TB Green Premix Ex TaqTM II (Takara, Japan). Reaction conditions included incubation at 95\u0026deg;C for 30 s, 95\u0026deg;C for 5 s, and 60\u0026deg;C for 30 s. \u003cem\u003eGADPH\u003c/em\u003e was used as an internal control, and the relative expression levels of the target genes were calculated using the 2\u003csup\u003e\u0026minus;\u0026thinsp;ΔΔCt\u003c/sup\u003e method.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eqRT-PCR primer sequences\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSequences\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eGADPH\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eF: GGAGCGAGATCCCTCCAAAAT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eR: GGCTGTTGTCATACTTCTCATGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eRUNX2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eF: TGGTTACTGTCATGGCGGGTA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eR: TCTCAGATCGTTGAACCTTGCTA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eOPG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eF: GCGCTCGTGTTTCTGGACA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eR: AGTATAGACACTCGTCACTGGTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eBMP-2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eF: AAGCCAAACACAAACAGCGGAAAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eR: CGTCAAGGTACAGCATCGAGATAGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eCol1A1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eF: GAGGGCCAAGACGAAGACATC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eR: CAGATCACGTCATCGCACAAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eTGFβ1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eF: CAACTATTGCTTCAGCTCCACG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eR: AAGTTGGCATGGTAGCCCTT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eEach experiment was performed in triplicate and repeated at least thrice. Differences among the data in each group were compared using one-way ANOVA and Tukey's multiple comparison tests. Statistical analysis was performed using GraphPad (GraphPad Prism 9 Software Inc., La Jolla, CA, USA).\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003eIsolation, Culture, and Identification of hMSMSCs\u003c/h2\u003e \u003cp\u003eAfter three days of culturing hMSMSCs, cell attachment was observed (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eb). By day five, the cells were closely arranged, and by day ten, they achieved 80% confluence, exhibiting a long spindle shape and a school-of-fish distribution. The CCK-8 assay (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ea) showed an \"S\" shaped cell proliferation curve, with slower proliferation during days 1\u0026ndash;2, rapid proliferation and entry into the logarithmic phase during days 2\u0026ndash;5, and a plateau phase with slowed proliferation rate on days 6\u0026ndash;7. Flow cytometry (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ec) revealed that the obtained cells were positive for CD44, CD73, and CD105 and negative for CD11b, CD45, and CD19. The positivity rates for CD44, CD73, and CD105 were 98.8%, 87.6%, and 87.0%, respectively, while the rates for CD11b, CD45, and CD19 were 2.91%, 0.47%, and 3.59%, respectively, matching the stem cell phenotype. After 21 days of osteogenic, chondrogenic, and adipogenic differentiation induction, Alizarin Red staining revealed red calcium salt deposits (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ed-A, magnified 40\u0026times;), Alizarin Blue staining showed blue coloration (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ed-B, magnified 100\u0026times;), and Oil Red O staining revealed scattered orange-red fat droplets between cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ed-C, magnified 200\u0026times;).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003eCell Viability and Proliferation of hMSMSCs\u003c/h2\u003e \u003cp\u003eThe CCK-8 method was used to compare the effects of different ion concentrations on the viability of hMSMSCs by calculating the cell survival rates for each group on days 1 and 3 (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ed). Overall, compared with the blank group, the addition of ions did not produce significant cytotoxicity. Mg1, Mg2, Sr0.01, Sr0.1, Zn0.0001, and Zn0.001 exhibited significant proliferation-promoting effects. On day 3, Calcein AM/PI live/dead cell staining (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ea) revealed that the live cell fluorescence signals in the Mg1, Sr0.01, Sr0.1, Zn0.0001, and Zn0.001 groups were significantly higher than those in the blank group. Analysis of the Calcein AM-(Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eb) and PI-(Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ec) stained areas using ImageJ software revealed that the fluorescence intensity in the Mg1, Sr0.01, Sr0.1, Zn0.0001, and Zn0.001 groups was significantly higher than in the blank group; however, the percentage of dead cells in the Mg5 (8%) and Sr1 (13%) groups was noticeably higher than in the other groups.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003eOsteogenesis of hMSMSCs\u003c/h2\u003e \u003cp\u003eIn a culture environment with different ion concentrations, cells were continuously induced to undergo osteogenesis for 3, 7, and 14 days, and ALP secretion and related gene expression were detected. Alkaline phosphatase (ALP) is a marker for osteogenic differentiation (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e). ALP staining (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ea) showed that compared to the blank group, there were no visible differences in staining intensity among the groups at 3 days. On days 7 and 14, the Mg1, Sr0.01, Zn0.001, and Zn0.0001 groups exhibited notably darker staining than that of the blank group. In contrast, groups with higher ion concentrations, Mg5, Sr1, and Zn0.01, showed lighter staining and fewer stained cells than the blank group.\u003c/p\u003e \u003cp\u003eSimultaneously, at each observation point, the expression of osteogenesis-related growth factor genes (Runx2, BMP-2, TGF-β1, OPG) in the Mg1, Sr0.01, and Zn0.001 groups was significantly higher than that of the blank group (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eb). Similarly, the expression of genes related to osteogenic proteins (Col1A1) was significantly higher in the Mg1, Sr0.01, and Zn0.001 groups than in the blank group; however, there was no significant difference between the Mg1 and Sr0.01 groups. These results suggest that Mg, Sr, and Zn ions can effectively promote the osteogenic differentiation of hMSCs by influencing gene expression. However, with increasing ion concentration, no significant difference was found in the expression of osteogenesis-related growth factor genes between the Mg2, Mg5, Sr0.1, Sr1, Zn0.01, and blank groups (P\u0026thinsp;\u0026gt;\u0026thinsp;0.05), suggesting that excessively high ion concentrations may not affect hMSMSCs.\u003c/p\u003e \u003cp\u003eTo further verify the impact of ions on cell osteogenic differentiation, histological Alizarin Red staining was performed (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ea). The Mg1, Sr0.01, and Zn0.001 groups exhibited significantly increased formation of red calcium nodules compared to the blank group. Conversely, the Mg2, Mg5, Sr0.1, Sr1, and Zn0.01 groups exhibited fewer stained calcium nodules than the blank group. Our results clearly demonstrated hMSMSC differentiation using 0.01mM Sr, 0.001mM Zn, and 1mM Mg. Notably, although 0.1mM Sr and 0.0001Mm Zn initially partially enhanced ALP secretion and upregulated some related gene expressions during osteogenic induction, there was no significant difference in the expression of RUNX-2, BMP-2, COL1A1 between the 0.0001Zn and blank groups, indicating that, in terms of osteogenic differentiation, hMSMSCs might respond to specific concentrations of Mg, Sr, or Zn ions.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003eImmunofluorescence staining of Osteocalcin/BGLAP\u003c/h2\u003e \u003cp\u003eIn a culture environment with different ion concentrations, osteogenesis was continuously induced in the cells for 21 days, and osteocalcin/BGLAP was detected using immunofluorescence staining (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e). BGLAP was stained green with FITC, β-Actin was stained red with rhodamine, and cell nuclei were stained blue with DAPI (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ea-c).Osteocalcin (BGLAP/OCN), an important secretory protein in the late stages of osteogenic differentiation, is present in the extracellular matrix and plays a role in promoting mineralization. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e(a), in the Mg groups, the green fluorescence of Mg1 was greater than that in the blank, Mg2, and Mg5 groups. Simultaneously, Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e(b, c) indicates that Sr0.01 and Zn0.001 exhibited greater green fluorescence than the blank and their respective parallel groups. Subsequently, the fluorescence intensity of each group was calculated using ImageJ, and Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e(d) shows that the fluorescence intensity of Mg1, Sr0.01, Sr0.1, Zn0.001, and Zn0.0001 was significantly higher than that of the blank group. In summary, Mg, Sr, and Zn ions enhanced the secretion of BGLAP by hMSMSCs in a concentration-dependent manner. Notably, the Mg1, Sr0.01, and Zn0.001 groups exhibited the highest fluorescence intensities, with no statistically significant difference between their data. However, the fluorescence intensities of Sr0.01 and Zn0.0001 were significantly lower than those of Mg1, Sr0.01, and Zn0.001.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eThe maxillary sinus membrane, also known as Schneiderian membrane, is a double-layered mucoperiosteal structure that covers the interior of the maxillary sinus cavity. The inner side of the maxillary sinus is lined with a pseudostratified columnar ciliated epithelium containing numerous goblet cells. The intrinsic vascular layer below the epithelium includes the serous glands, mucous glands, and thin-walled small veins. The epithelial and intrinsic layers constitute the mucous membrane, which, combined with the adjacent periosteum, forms a defensive barrier within the maxillary sinus [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e][\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. MSFA is the most common method for bone defect repair in the posterior maxillary region. The maxillary sinus membrane plays a significant role in early bone formation during MSFA, and a series of studies have confirmed that osteogenic differentiation of MSMSCs is an important source of early bone formation in the maxillary sinus. In this study, we successfully extracted stem cells from human maxillary sinus membranes. CCK-8 assay demonstrated the self-renewal capability of hMSMSCs in vitro. Flow cytometry showed that these cells expressed CD105, CD73, and CD44 but did not express CD45, CD11b, or CD19. Additionally, the results of multilineage induction differentiation experiments confirmed the multilineage differentiation potential of hMSMSCs. Collectively, these results indicate that we successfully extracted hMSMSCs with multilineage differentiation capabilities.\u003c/p\u003e \u003cp\u003eWe discovered that Sr\u003csup\u003e2+\u003c/sup\u003e, Mg\u003csup\u003e2+\u003c/sup\u003e, and Zn\u003csup\u003e2+\u003c/sup\u003e alter the crucial cellular behavior of human Schneiderian membrane-derived stem cells in a concentration-dependent manner. In this study, we altered ion concentrations in the extracellular environment by adding different concentrations of MgCl\u003csub\u003e2\u003c/sub\u003e, SrCl\u003csub\u003e2,\u003c/sub\u003e and ZnCl\u003csub\u003e2\u003c/sub\u003e to the cell culture medium. This method is simple and effective, allowing precise and stable control of the concentrations of various ions, thereby facilitating the observation of cellular biological responses to changes in ion concentration. Cell proliferation is an indispensable part of the bone regeneration process [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e].In our research, we demonstrated through CCK-8 and Calcein AM/PI staining that different types and/or concentrations of metal ions could significantly affect the cell viability and proliferation of hMSMSCs. For instance, compared with the blank group, 0.01mM and 0.1mM Sr\u003csup\u003e2+\u003c/sup\u003e, 0.0001 and 0.001 mM Zn\u003csup\u003e2+\u003c/sup\u003e, and 1mM and 2 mM Mg\u003csup\u003e2+\u003c/sup\u003e had no significant impact on the viability of hMSMSCs and noticeably enhanced cell proliferation, with no significant differences in cell viability and proliferation among these experimental groups. Numerous studies have confirmed the promoting effect of appropriate concentrations of Sr\u003csup\u003e2+\u003c/sup\u003e, Mg\u003csup\u003e2+\u003c/sup\u003e, and Zn\u003csup\u003e2+\u003c/sup\u003e on cell proliferation; however, the biological responses of different types of mesenchymal stem cells to varying concentrations of metal ions are not the same. For example, studies have found that BMSCs and PDLCs undergo maximum proliferation at 360 mg/L (approximately 4.11mM) of Sr ions [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e, \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. However, in our study, Sr ion concentrations exceeding 1mM significantly reduced the viability and proliferation of hMSMSCs. These results suggest that hMSMSCs may exhibit completely different biological responses to the same concentration of metal ions as traditional tissue-engineered seed cells such as BMSCs. In the bone-forming area of MSFA, BMSCs from the base of the maxillary sinus and MSMSCs from the maxillary sinus membrane promote new bone formation together, and our study found that a single concentration of strontium ions might be insufficient to simultaneously promote the proliferation of both types of cells. Previous research found that 1.8mM magnesium ions significantly improved the proliferation of BMSCs [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e].Our study also discovered that 1mM and 2mM Mg\u003csup\u003e2+\u003c/sup\u003e could significantly enhance the proliferation of MSMSCs, suggesting that magnesium ions might be suitable for the new bone formation of MSFA.\u003c/p\u003e \u003cp\u003eFor osteogenic differentiation, we observed and quantitatively analyzed the ALP expression in each group, followed by Alizarin Red staining for further verification. The results showed that at all time points, the ALP expression in the 0.01mM Sr\u003csup\u003e2+\u003c/sup\u003e, 0.001mM Zn\u003csup\u003e2+\u003c/sup\u003e, and 1mM Mg\u003csup\u003e2+\u003c/sup\u003e groups was significantly better than that in the blank group. The magnesium ion group had a weaker promotional effect than strontium and zinc, with no significant differences between strontium and zinc. Studies have confirmed that ALP promotes the formation of hydroxyapatite crystals in the bone tissue and is involved in the osteogenic differentiation process, serving as an early indicator of osteogenic differentiation [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]]. This indicated that appropriate concentrations of Mg\u003csup\u003e2+\u003c/sup\u003e, Sr\u003csup\u003e2+\u003c/sup\u003e, and Zn\u003csup\u003e2+\u003c/sup\u003e effectively enhanced the ALP activity of hMSMSCs, thereby promoting early osteogenic differentiation. Studies have shown that Mg\u003csup\u003e2+\u003c/sup\u003e [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e] and Zn\u003csup\u003e2+\u003c/sup\u003e [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e] are necessary for maintaining ALP enzyme activity, with functions in stabilizing the protein conformation, which may be related to the improvement in ALP activity in hMSMSCs. However, as the concentration of metal ions increased further, the ALP activity of each group of hMSMSCs decreased significantly, suggesting that excessively high concentrations of metal ions inhibited early osteogenesis. Alizarin Red staining showed similar results, consistent with those of previous studies on high concentrations of Sr\u003csup\u003e2+\u003c/sup\u003e [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e], Mg\u003csup\u003e2+\u003c/sup\u003e [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e] and Zn\u003csup\u003e2+\u003c/sup\u003e [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]]. Differently, the concentration-dependent effect is highly related to the type of cells, as previously found optimal biological concentrations, such as 25\u0026ndash;500\u0026micro;M Sr\u003csup\u003e2+\u003c/sup\u003e [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e], were inconsistent with our findings. However, not all differences were absolute; for instance, 1.8mM magnesium ions have been reported to promote osteogenic differentiation [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e], which is similar to our results.\u003c/p\u003e \u003cp\u003eWe further examined the expression of osteogenesis-related genes in each group of hMSMSCs, including osteogenesis-related growth factors (RUNX2, BMP-2, OPG, TGF-β1) and marker proteins (Col1A1). In this study, compared to the blank group, we found significantly increased expression of osteogenesis-related genes in the 0.01mM Sr, 0.001mM Zn, and 1mM Mg groups of hMSMSCs. BMP-2 and TGF-β1 have been repeatedly confirmed as important growth factors promoting MSC osteogenic differentiation. RUNX2 is a key osteogenic transcription factor [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e] that can induce MSCs to differentiate into immature osteoblasts and activate and control the expression of osteogenic differentiation genes such as ALP, Col1A1, and BMP-2 [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e][\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. Previous studies have shown that various metal ions can enhance the expression of osteogenic genes, such as RUNX2, in stem cells. For example, Mg\u003csup\u003e2+\u003c/sup\u003e can effectively promote the expression of RUNX2 in bone marrow stromal cells, subsequently increasing the expression of osteogenic marker proteins at different stages, such as ALP, Col1A1, and osteocalcin [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e].In this study, we found that Sr\u003csup\u003e2+\u003c/sup\u003e, Mg\u003csup\u003e2+\u003c/sup\u003e, and Zn\u003csup\u003e2+\u003c/sup\u003e also enhanced RUNX2 expression in hMSMSCs. OPG is a secreted glycoprotein that can bind to RANKL, blocking the interaction between RANKL and RANK, thereby inhibiting the formation of osteoclasts and reducing bone resorption[\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. Reports have shown that Sr\u003csup\u003e2+\u003c/sup\u003e [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e], Zn\u003csup\u003e2+\u003c/sup\u003e [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e], and Mg\u003csup\u003e2+\u003c/sup\u003e[\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e] can affect OPG expression in cells, suggesting that these three ions may regulate OPG expression in hMSMSCs to reduce bone resorption in the maxillary sinus and promote osteogenesis. Finally, we used fluorescence staining to observe the effects of different concentrations of the three metal ions on osteocalcin expression in hMSMSCs. Osteocalcin is a non-collagenous protein that is mainly present in the extracellular matrix of bone cells, is primarily expressed during matrix maturation and mineralization, and is secreted only by mature osteoblasts. Immunofluorescence staining showed that osteocalcin expression in the 0.01mM Sr, 0.001mM Zn, and 1mM Mg groups of hMSMSCs significantly increased. The amino acid sequence of osteocalcin (aspartic acid and glutamic acid) can specifically bind to calcium ions, which in turn capture phosphate ions, induce the formation of hydroxyapatite mineral crystals[\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e], regulate osteoblast behavior, and promote extracellular matrix calcification[\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. Therefore, appropriate concentrations of Sr, Mg\u003csup\u003e2+\u003c/sup\u003e, and Zn may be beneficial for the osteogenic mineralization of hMSMSCs. This conclusion was also confirmed by Alizarin Red calcium nodule staining.\u003c/p\u003e \u003cp\u003eOur study has some limitations. First, the regulation of ion concentrations in the human body is complex; therefore, a more precise range of ion concentrations may be used in our future research. Secondly, this study did not explore the effects of different combinations of ions acting simultaneously on cells. Previous studies have shown that combinations of multiple metal elements may possess superior osteogenic properties [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]. Finally, this study did not fully elucidate the specific regulatory actions of ions on cells, such as specific signaling pathways, target genes, or proteins. Therefore, the mechanisms of ion-mediated regulation of osteogenic differentiation should be assessed in the future. In conclusion, variations in the types and concentrations of ions in the extracellular environment can significantly alter the behavior of hMSMSCs and can be considered to improve the material design for maxillary sinus elevation applications.\u003c/p\u003e"},{"header":"Conclusions","content":"\u003cp\u003eMagnesium, zinc, and strontium ions variably affect the vitality and osteogenic differentiation of MSMSCs, depending on their concentrations. Lower concentrations of these ions boost cell proliferation and differentiation, while higher levels act as inhibitors. The optimal concentrations are 1.8mM for Mg\u003csup\u003e2+\u003c/sup\u003e, and 0.001mM for Zn\u003csup\u003e2+\u003c/sup\u003e, and 0.01mM for Sr\u003csup\u003e2+\u003c/sup\u003e. Among these, Zn\u003csup\u003e2+\u003c/sup\u003e at their optimal concentration exhibit the most significant biological efficacy.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cem\u003eAuthor Contributions:\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eConceptualization, Zhihao Zhang and Fei Tan; Formal analysis, Zhihao Zhang, Ning Gong, Ying Wang, Lei Xu, Sinan Zhao; Funding acquisition, \u0026nbsp;Fei Tan; Investigation, Yanshan Liu; Methodology, Zhihao Zhang and Fei Tan; Project administration, Ying Wang and Sinan Zhao; Resources, Yanshan Liu and Fei Tan; Supervision, Fei Tan; Validation, Zhihao Zhang and Ning Gong; Writing—original draft, Zhihao Zhang; Writing—review and editing, Fei Tan; All authors have read and agreed to the published version of the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eConflict of Interest\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eThe authors report there are no competing interests to declare.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eFunding\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eThis research was supported by a grant of Project through the Shandong Provincial Natural Science Foundation Regular Program, funded by Department of Science \u0026amp; Technology of Shandong Province (Grant No. ZR2022MH239)\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eEthical Approval\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eThis study was reviewed and approved by the Institutional Review Board (IRB) of The Affiliated Hospital of Qingdao University. All procedures performed in the study involving human participants were in accordance with the ethical standards of the institutional and national research committee and with the 1964 Helsinki declaration standards. The ethical approval number for this research is\u003cstrong\u003e\u0026nbsp;QYFY WZLL 28450\u003c/strong\u003e.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eInformed Consent statements\u0026nbsp;\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eAll participants in this study provided informed consent prior to their involvement. Three volunteers, after being fully informed about the purpose of the research, the procedures to be undertaken, potential risks, and benefits, as well as their rights to withdraw from the study at any time without penalty, have signed the informed consent forms.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe scanned copies of the documents pertaining to ethical approval and informed consent statements have been uploaded to the \"Related Files\" section.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eStern A, Green J (2012) Sinus Lift Procedures: An Overview of Current Techniques. Dental Clin N Am 56:219\u0026ndash;233. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.cden.2011.09.003\u003c/span\u003e\u003cspan address=\"10.1016/j.cden.2011.09.003\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRiben C, Thor A (2012) The Maxillary Sinus Membrane Elevation Procedure: Augmentation of Bone around Dental Implants without Grafts\u0026mdash;A Review of a Surgical Technique. Int J Dentistry 2012:1\u0026ndash;9. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1155/2012/105483\u003c/span\u003e\u003cspan address=\"10.1155/2012/105483\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRong Q, Li X, Chen SL et al (2015) Effect of the Schneiderian membrane on the formation of bone after lifting the floor of the maxillary sinus: an experimental study in dogs. Br J Oral Maxillofac Surg 53:607\u0026ndash;612. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.bjoms.2015.02.010\u003c/span\u003e\u003cspan address=\"10.1016/j.bjoms.2015.02.010\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSrouji S, Kizhner T, David DB et al (2008) The Schneiderian Membrane Contains Osteoprogenitor Cells: In Vivo and In Vitro Study. Calcif Tissue Int 84:138\u0026ndash;145. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s00223-008-9202-x\u003c/span\u003e\u003cspan address=\"10.1007/s00223-008-9202-x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGuo J, Weng J, Rong Q et al (2015) Investigation of multipotent postnatal stem cells from human maxillary sinus membrane. Sci Rep 5. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/srep11660\u003c/span\u003e\u003cspan address=\"10.1038/srep11660\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ede Peppo GM, Marolt D (2013) Modulating the biochemical and biophysical culture environment to enhance osteogenic differentiation and maturation of human pluripotent stem cell-derived mesenchymal progenitors. Stem Cell Res Ther. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/scrt317\u003c/span\u003e\u003cspan address=\"10.1186/scrt317\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu Y, Wang J, Zhai P et al (2021) Stiffness Regulates the Morphology, Adhesion, Proliferation, and Osteogenic Differentiation of Maxillary Schneiderian Sinus Membrane-Derived Stem Cells. Stem Cells Int 2021:1\u0026ndash;12. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1155/2021/8868004\u003c/span\u003e\u003cspan address=\"10.1155/2021/8868004\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBosch-Ru\u0026eacute; E, Diez-Tercero L, Giordano-Kelhoffer B et al (2021) Biological Roles and Delivery Strategies for Ions to Promote Osteogenic Induction. Front Cell Dev Biology 8. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fcell.2020.614545\u003c/span\u003e\u003cspan address=\"10.3389/fcell.2020.614545\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAimaiti A, Maimaitiyiming A, Boyong X et al (2017) Low-dose strontium stimulates osteogenesis but high-dose doses cause apoptosis in human adipose-derived stem cells via regulation of the ERK1/2 signaling pathway. Stem Cell Res Ther 8. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s13287-017-0726-8\u003c/span\u003e\u003cspan address=\"10.1186/s13287-017-0726-8\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eD\u0026iacute;az-Tocados JM, Herencia C, Mart\u0026iacute;nez-Moreno JM et al (2017) Magnesium Chloride promotes Osteogenesis through Notch signaling activation and expansion of Mesenchymal Stem Cells. Sci Rep 7. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41598-017-08379-y\u003c/span\u003e\u003cspan address=\"10.1038/s41598-017-08379-y\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYusa K, Yamamoto O, Takano H et al (2016) Zinc-modified titanium surface enhances osteoblast differentiation of dental pulp stem cells in vitro. Sci Rep 6. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/srep29462\u003c/span\u003e\u003cspan address=\"10.1038/srep29462\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eQi T, Weng J, Yu F et al (2020) Insights into the Role of Magnesium Ions in Affecting Osteogenic Differentiation of Mesenchymal Stem Cells. Biol Trace Elem Res 199:559\u0026ndash;567. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s12011-020-02183-y\u003c/span\u003e\u003cspan address=\"10.1007/s12011-020-02183-y\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYusa K, Yamamoto O, Iino M et al (2016) Eluted zinc ions stimulate osteoblast differentiation and mineralization in human dental pulp stem cells for bone tissue engineering. Arch Oral Biol 71:162\u0026ndash;169. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.archoralbio.2016.07.010\u003c/span\u003e\u003cspan address=\"10.1016/j.archoralbio.2016.07.010\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNi S, Xiong X, Ni X (2020) MgCl2 promotes mouse mesenchymal stem cell osteogenic differentiation by activating the p38/Osx/Runx2 signaling pathway. Mol Med Rep. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3892/mmr.2020.11487\u003c/span\u003e\u003cspan address=\"10.3892/mmr.2020.11487\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHuang Y, Wu C, Xie H et al (2019) Strontium Promotes the Proliferation and Osteogenic Differentiation of Human Placental Decidual Basalis- and Bone Marrow-Derived MSCs in a Dose-Dependent Manner. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1155/2019/4242178\u003c/span\u003e\u003cspan address=\"10.1155/2019/4242178\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Stem Cells International\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePark KH, Choi Y, Yoon DS et al (2018) Zinc Promotes Osteoblast Differentiation in Human Mesenchymal Stem Cells Via Activation of the cAMP-PKA-CREB Signaling Pathway. Stem Cells Dev 27:1125\u0026ndash;1135. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1089/scd.2018.0023\u003c/span\u003e\u003cspan address=\"10.1089/scd.2018.0023\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFathi E, Farahzadi R (2017) Enhancement of osteogenic differentiation of rat adipose tissue-derived mesenchymal stem cells by zinc sulphate under electromagnetic field via the PKA, ERK1/2 and Wnt/β-catenin signaling pathways. PLoS ONE. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1371/journal.pone.0173877\u003c/span\u003e\u003cspan address=\"10.1371/journal.pone.0173877\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eScharf KE, Lawson W, Shapiro JM, Gannon PJ (1995) Pressure measurements in the normal and occluded rabbit maxillary sinus. Laryngoscope 105:570\u0026ndash;574\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePuranen J (1966) Reorganization of Fresh and Preserved Bone Transplants: An Experimental Study in Rabbits Using Tetracycline Labelling. Acta Orthop Scand 37:3\u0026ndash;77\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePang S, Shen J, Liu Y et al (2015) Proliferation and Osteogenic Differentiation of Mesenchymal Stem Cells Induced by a Short Isoform of NELL-1. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1002/stem.1884\u003c/span\u003e\u003cspan address=\"10.1002/stem.1884\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. STEM CELLS\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBizelli-Silveira C, Pullisaar H, Abildtrup LA et al (2018) Strontium enhances proliferation and osteogenic behavior of periodontal ligament cells in vitro. J N Res 53:1020\u0026ndash;1028. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/jre.12601\u003c/span\u003e\u003cspan address=\"10.1111/jre.12601\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBizelli-Silveira C, Abildtrup LA, Spin‐Neto R et al (2019) Strontium enhances proliferation and osteogenic behavior of bone marrow stromal cells of mesenchymal and ectomesenchymal origins in vitro. Clin Experimental Dent Res 5:541\u0026ndash;550. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1002/cre2.221\u003c/span\u003e\u003cspan address=\"10.1002/cre2.221\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eD\u0026iacute;az-Tocados JM, Herencia C, Mart\u0026iacute;nez-Moreno JM et al (2017) Magnesium Chloride promotes Osteogenesis through Notch signaling activation and expansion of Mesenchymal Stem Cells. Sci Rep 7. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41598-017-08379-y\u003c/span\u003e\u003cspan address=\"10.1038/s41598-017-08379-y\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVimalraj S (2020) Alkaline phosphatase: Structure, expression and its function in bone mineralization. Gene 754:144855\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSharma U, Pal D, Prasad R (2013) Alkaline Phosphatase: An Overview. Indian J Clin Biochem 29:269\u0026ndash;278\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eO\u0026rsquo;Connor JP, Kanjilal D, Teitelbaum M et al (2020) Zinc as a Therapeutic Agent in Bone Regeneration. Mater 13:2211. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/ma13102211\u003c/span\u003e\u003cspan address=\"10.3390/ma13102211\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVimalraj S, Arumugam B, Miranda PJ, Selvamurugan N (2015) Runx2: Structure, function, and phosphorylation in osteoblast differentiation. Int J Biol Macromol 78:202\u0026ndash;208\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBruderer M, Richards RG, Alini M, Stoddart MJ (2014) Role and regulation of RUNX2 in osteogenesis. Eur Cell Mater 28:269\u0026ndash;286\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePhimphilai M, Zhao Z, Boules H et al (2006) BMP Signaling Is Required for RUNX2-Dependent Induction of the Osteoblast Phenotype. J Bone Miner Res 21:637\u0026ndash;646\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTong X, Gu J, Song R et al (2018) Osteoprotegerin inhibit osteoclast differentiation and bone resorption by enhancing autophagy via AMPK/mTOR/p70S6K signaling pathway in vitro. J Cell Biochem 120:1630\u0026ndash;1642. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1002/jcb.27468\u003c/span\u003e\u003cspan address=\"10.1002/jcb.27468\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMolenda M, Kolmas J (2023) The Role of Zinc in Bone Tissue Health and Regeneration\u0026mdash;a Review. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s12011-023-03631-1\u003c/span\u003e\u003cspan address=\"10.1007/s12011-023-03631-1\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Biological Trace Element Research\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTong X, Gu J, Song R et al (2018) Osteoprotegerin inhibit osteoclast differentiation and bone resorption by enhancing autophagy via AMPK/mTOR/p70S6K signaling pathway in vitro. J Cell Biochem 120:1630\u0026ndash;1642\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePerez RA, Seo S-J, Won J-E et al (2015) Therapeutically relevant aspects in bone repair and regeneration. Mater N a 18:573\u0026ndash;589. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.mattod.2015.06.011\u003c/span\u003e\u003cspan address=\"10.1016/j.mattod.2015.06.011\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTsao Y-T, Huang Y-J, Wu H-H et al (2017) Osteocalcin Mediates Biomineralization during Osteogenic Maturation in Human Mesenchymal Stromal Cells. Int J Mol Sci 18:159. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/ijms18010159\u003c/span\u003e\u003cspan address=\"10.3390/ijms18010159\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDali SSM, Wong S, Chin K, Ahmad F (2023) The Osteogenic Properties of Calcium Phosphate Cement Doped with Synthetic Materials: A Structured Narrative Review of Preclinical Evidence. Int J Mol Sci. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/ijms24087161\u003c/span\u003e\u003cspan address=\"10.3390/ijms24087161\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Mesenchymal stem cells, Osteogenesis, Schneiderian membrane, Ions","lastPublishedDoi":"10.21203/rs.3.rs-3972505/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-3972505/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003ePurpose\u003c/h2\u003e \u003cp\u003eHuman Maxillary Sinus Membrane Stem Cells (hMSMSCs) contribute significantly to bone formation following maxillary sinus floor augmentation (MSFA). The biological behavior of mesenchymal stem cells is notably influenced by varying concentrations of magnesium (Mg\u003csup\u003e2+\u003c/sup\u003e), strontium (Sr\u003csup\u003e2+\u003c/sup\u003e), and zinc (Zn\u003csup\u003e2+\u003c/sup\u003e) ions; however, their specific effects on hMSMSCs have not been comprehensively studied.\u003c/p\u003e\u003ch2\u003eMethods\u003c/h2\u003e \u003cp\u003eWe isolated hMSMSCs and identified their mesenchymal stem cell characteristics by flow cytometry and multilineage differentiation experiments. Subsequently, the hMSMSCs were cultured in media containing different concentrations of these metal ions. The proliferation and viability of hMSMSCs were assessed using CCK-8 and Calcein AM/PI staining. After osteogenic induction, cells were evaluated for alkaline phosphatase (ALP) activity, ALP staining, and Alizarin Red staining. Additionally, qRT-PCR was used to detect differences in osteogenic gene expression, and immunofluorescence staining was used to observe variations in OCN protein levels.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e \u003cp\u003eThe results indicated that 1mM Mg\u003csup\u003e2+\u003c/sup\u003e, 0.01mM Sr\u003csup\u003e2+\u003c/sup\u003e, and 0.001mM Zn\u003csup\u003e2+\u003c/sup\u003e significantly improved the proliferation and activity of hMSMSCs. These concentrations also notably enhanced ALP secretion, increased bone-related gene expression, and augmented osteocalcin expression and formation of extracellular calcium nodules, thereby improving osteogenic differentiation. However, higher concentrations of Mg\u003csup\u003e2+\u003c/sup\u003e, Sr\u003csup\u003e2+\u003c/sup\u003e, and Zn\u003csup\u003e2+\u003c/sup\u003e decreased cell viability and osteogenic differentiation.\u003c/p\u003e\u003ch2\u003eConclusions\u003c/h2\u003e \u003cp\u003eMg\u003csup\u003e2+\u003c/sup\u003e, Sr\u003csup\u003e2+\u003c/sup\u003e, and Zn\u003csup\u003e2+\u003c/sup\u003e promote osteogenic differentiation and proliferation of hMSMSCs in a concentration-dependent manner, indicating that the type and concentration of ions in the extracellular environment can significantly alter hMSMSCs behavior, which is a crucial consideration for material design in maxillary sinus elevation applications.\u003c/p\u003e\u003ch2\u003eClinical Relevance:\u003c/h2\u003e \u003cp\u003eOur findings demonstrate that Mg\u003csup\u003e2+\u003c/sup\u003e, Sr\u003csup\u003e2+\u003c/sup\u003e, and Zn\u003csup\u003e2+\u003c/sup\u003e enhance osteogenic differentiation and proliferation of hMSMSCs, offering a strategic approach to improve bone regeneration in maxillary sinus elevation procedures.\u003c/p\u003e","manuscriptTitle":"Impact of strontium, magnesium, and zinc ions on the in vitro osteogenesis of maxillary sinus membrane stem cells","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-02-22 06:54:04","doi":"10.21203/rs.3.rs-3972505/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"07d7b8cd-e7fe-4048-bd72-a91ff456b38c","owner":[],"postedDate":"February 22nd, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-02-26T07:50:49+00:00","versionOfRecord":[],"versionCreatedAt":"2024-02-22 06:54:04","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-3972505","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-3972505","identity":"rs-3972505","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.