Deletion of endothelial KLF4 as a model for preeclampsia

preprint OA: closed CC-BY-4.0
📄 Open PDF Full text JSON View at publisher
Full text 40,567 characters · extracted from oa-pdf · 7 sections · click to expand

Keywords

Hypertension, gestational hypertension, sFLT1, preeclampsia, endothelial 22 cell, KLF2/4 23 24 25 Running title: Deletion of endothelial KLF4 as a model for Preeclampsia 26 27 .CC-BY 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted March 31, 2026. ; https://doi.org/10.64898/2026.03.30.715448doi: bioRxiv preprint 28

Abstract

29 Preeclampsia (PE), or gestational hypertension, affects around 5% of pregnancies and 30 leads to approximately 70,000 maternal and 500,000 fetal deaths per year worldwide, 31 with increased cardiovascular and metabolic disease in survivors. PE is associated with 32 elevated circulating levels of the alternative splice isoform of VEGF receptor 1 (sFlt1), 33 defects in placental vasculature, kidney damage and, in severe disease, fetal growth 34 restriction. Current mouse models induce PE via direct expression of sFlt1 or elevation 35 of blood pressure, which bypass the natural risk factors for human disease, such as 36 age, obesity, hypertension and diabetes. These risk factors have in common reduced 37 expression of Krüppel-like factors 2 and 4 (KLF2/4), the endothelial transcription factors 38 that protect against cardiovascular disease. We now report that inducible deletion of 39 KLF4 in maternal endothelium (KLF4iECKO) results in gestational hypertension, elevated 40 sFlt1, defective placental vasculature, kidney damage and fetal growth restriction. 41 KLF4iECKO may thus serve as a mouse PE model suitable for mechanistic analysis and 42 screening of treatments that address upstream risk factors. 43 .CC-BY 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted March 31, 2026. ; https://doi.org/10.64898/2026.03.30.715448doi: bioRxiv preprint

Introduction

44 Despite advances in detection and classification, preeclampsia (PE) remains a 45 major cause of fetal death and maternal morbidity and mortality worldwide [1, 2]. In 46 addition to short term effects on health, women after preeclamptic pregnancy show 47 large increases in cardiovascular disease (CVD) incidence and mortality [3]. CVD risk 48 scales with PE severity [4], defined as late (> 34wks) vs early-onset (< 34wks), as mild 49 (140mmHg < BP 160mmHg), and with vs without fetal 50 growth restriction (FGR)[4]. The most dangerous form of PE is early-onset, severe, with 51 FGR, which raises the incidence of maternal CVD later in life as well as the incidence of 52 metabolic syndrome and neurodevelopmental delays in the child [5]. Methods to 53 manage PE are limited, indeed, the only cure is delivery of the placenta and fetus. 54 Management is possible, but treatment options are limited out of concern for the 55 developing fetus. 56 The principal risk factors for PE – age, obesity, hypertension and diabetes – mirror 57 those for CVD. Widely used PE mouse models induce hypertension by infusion of 58 angiotensin II or elevation of sFLT1 through viral overexpression, bypassing the 59 endogenous regulatory pathways that govern PE (ref?). Thus, they do not account for 60 the upstream risk factors in human disease. These human risk factors, however, share 61 a common feature: they are opposed by endothelial cell (EC) expression of Krüppel-like 62 factors 2 and 4 (KLF2/4), homologous transcription factors with overlapping (but 63 nonidentical) gene targets and functions in ECs [6-8]. Klf2/4 expression in ECs declines 64 with age [9, 10] and in diabetes [11-13] including gestational diabetes [14]. Elevating 65 Klf2 or 4 confers resistance to multiple CVDs in mouse models [15, 16]. KLF2/4 66 function is vital to blood pressure regulation by inducing eNOS to control vascular tone 67 and limiting vascular inflammation[17, 18]. While mouse EC-specific knock out (ECKO) 68 of all four alleles of Klf2 and 4 is lethal, ECKO of 1-2 copies of these genes did not 69 affect mouse survival [17]. A recent study showed that ECKO of Klf4 had little effect in 70 young mice but markedly accelerated vascular aging (Jain, soon, I hope). 71 Measurement of blood pressure and circulating sFLT1 is the current standard for 72 diagnosing PE, while sFlt1 is also critical to its pathophysiology [19, 20]. The placenta is 73 thought to be the main source of circulating sFLT1, though a contribution from the 74 maternal vascular has not been ruled out and could explain features of disease 75 progression [21, 22]. Here, we report the development of a genetic model of PE driven 76 by EC-specific KLF4 deletion, which offers a physiologically relevant platform that more 77 closely mimics the human risk factors that drive PE [12]. 78 79

Methods

80 .CC-BY 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted March 31, 2026. ; https://doi.org/10.64898/2026.03.30.715448doi: bioRxiv preprint siRNA KD of KLF2 or 4 in HUVECs 81 HUVECs were plated such that they were between 50-80% confluent at the time 82 of siRNA treatment. Lipofectamine RNAiMAX (ThermoFisher Cat #13778075) was used 83 to transfect 10nM KLF2, KLF4 or control siRNA into cells in Opti-Mem, as 84 recommended by the manufacturer. The mixture was incubated on cells overnight in 85 complete media (Lonza EGM-2 Endothelial Cell Growth Medium-2 BulletKit cat #CC-86 3162) before they were replenished and allowed to recover for 24h prior to collection for 87 qPCR analysis. 88 For all qPCR analysis, cDNA was generated using the iSCRIPT cDNA Synthesis 89 Kit (BioRad Cat#1708890) and qPCR was performed using SSO Advanced SYBR 90 Green (BioRad Cat#1725270). Primer sequences used are as follows: 91 Target FWD REV huKLF2 AAGAGCTCGCACCTAAAGGC CTTTCGGTAGTGGCGGGTAA huKLF4 CTATGCAGGCTGTGGCAAAACC TTGCGGTAGTGCCTGGTCAGTT huGAPD H GTCTCCTCTGACTTCAACAGCG ACCACCCTGTTGCTGTAGCCAA huFLT1 TGGCAGCGAGAAACATTCTTTTAT C CAGCAATACTCCGTAAGACCACA C husFLT1 ACAATCAGAGGTGAGCACTGCAA TCCGAGCCTGAAAGTTAGCAA 92 RNAscope on Placenta Sections 93 Placentas were dissected at GD18.5, separated from the yolk sac and pup and 94 immersion-fixed in 4% PFA overnight at 4C with gentle rocking. Images were taken of 95 the underside (pup side) for visceral placenta vascularization analysis. Placentas were 96 then incubated in 30% sucrose overnight at 4C with gentle rocking. Once placentas 97 were saturated, as indicated by their sinking in the sucrose solution, they were cut in 98 half longitudinally and frozen cut side down in OCT at -80C. Rapid freezing was 99 accomplished by using acetone chilled by dry ice. A cryostat was then used to cut 10um 100 longitudinal sections. 101 Slides containing placenta sections were then baked at 60C for 1hr, washed in PBS 102 and post-fixed in 4% PFA for 1hr. Slides were then dehydrated in EtOH prior to 103 beginning H2O2 treatment. ACD’s Multiplex Fluorescent V2 protease-free protocol was 104 followed. sFLT1 probe: FLT1 probe: multiplex kit:. Following completion of the 105 hybridization protocol, sections were then subjected to FN protein staining. Briefly, 106 sections were washed in TBS/0.1%Tween 20 (TBST) three times, 5mins each. The 107 sections were then blocked in TBS/5%BSA for 1hr followed by FN antibody incubation 108 (Millipore cat#F3648, 1:500) for 2h at RT. Primary antibody was then washed off with 109 TBST and secondary antibody (Alexa Fluor series from ThermoFisher; 1:1000) plus 110 .CC-BY 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted March 31, 2026. ; https://doi.org/10.64898/2026.03.30.715448doi: bioRxiv preprint DAPI (ThermoFisher Cat#D1306, 1:10,000) was added in TBS/5% w/v BSA for 1hr at 111 RT. Sections were then washed a final time before using TrueView Autofluorescence Kit 112 (Vector Laboratories cat#SP-8400-15) diluted 1:10 to decrease background staining. 113 Slides were then mounted using Vector Lab’s VactaShield vibrance antifade mounting 114 medium (cat#H-1700-2). Imaging was done on a Zeiss Leica Confocal Microscope 115 using the Leica Application Suit X software. A 40x oil objective was used for all images. 116 Z-stacks of approximately 10um were taken with at least 5-6 images taken per sample. 117 With RNAscope, it can be challenging to identify real versus background signal. Two 118 ways we distinguished signal from noise were by firstly setting imaging parameters 119 based off sections that were stained with positive and negative control probes provided 120 by ACD. Secondly, by utilizing z-stacks, areas that displayed real signal were more 121 apparent if RNAscope spots appeared in multiple z-sections. Maximal projections were 122 used to enhance spots that were real versus not real. Image analysis was done using 123 Fiji with maximal z-projections. 124 sFLT1 ELISA Measurements 125 Blood samples were taken from dams at GD18.5 via cardiac puncture. Blood was 126 collected into EDTA-coated K2 tubes (VWR cat#76343-512) and spun at 10,000g for 127 10mins at 4C to separate the serum, which was then isolated and flash frozen in LN2 128 before being stored at -80C. Samples were then thawed on ice prior to analysis. sFLT1 129 serum levels were analyzed using R&D’s VEGR1 ELISA kit (Cat #MVR100) with the 130 DuoSet ELISA Ancillary Reagent Kit (Cat #DY008B). Serum samples were diluted from 131 1:5-1:20 to ensure samples landed within the standard curve. Raw pg/mL values are 132 plotted. 133 Mice 134 iECKO and Timed matings 135 8-9wk old KLF4f/f;CDH5cre-ERT2+ dams were injected with 80mg/kg/day tamoxifen for 5 136 days to induce ECKO. Dams were rested for 1wk following injections as tamoxifen can 137 reduce fertility [23]. At the same time, male B6 littermates were separated 1wk prior to 138 combination with females. Dams were then provided with dirty male bedding for 72hrs 139 prior to introduction of males to induce estrus. 1-2 females were then introduced to male 140 cages for 3 days before separating. Pregnancy was confirmed via plug checking, 7-day 141 weight gain ≥2g or by blood pressure status. 142 Blood pressure monitoring via the CODA System 143 Mice were trained for 3-5 days prior to data collection. Training consisted of regular 144 blood pressure measurements within the system. To reinforce training, foraging mix 145 (VWR cat #76628-302) or other treats were given following any blood pressure 146 collection. Blood pressure was taken every other day for 2 weeks following confirmation 147 .CC-BY 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted March 31, 2026. ; https://doi.org/10.64898/2026.03.30.715448doi: bioRxiv preprint of pregnancy (GD7.5-GD17.5). Data per day consists of at least 3 measurements 148 averaged. Data for non-pregnant control mice consists of at least 3 averaged 149 measurements every other day for 2 weeks giving at least 18 averaged measurements 150 per control mouse. To quantify acquisition stability, we calculated the percent coefficient 151 of variation (%CV) for repeated tail-cuff cycles within each session for each mouse. 152 Early acclimation sessions exhibited higher variability, consistent with handling-related 153 stress, whereas CV progressively decreased with training. Sessions demonstrating 154 %CV values within the expected physiological range (<10%) were considered stable. 155 Kidney Analysis 156 Sections and IF staining 157 Kidneys were isolated from perfusion-fixed mice at GD18.5 and incubated in 4% 158 PFA overnight at 4C with gentle rocking. Kidneys were then soaked in 30% sucrose 159 overnight at 4C with gentle rocking or until the kidney was saturated as indicated by it 160 sinking in the solution. Kidneys were then cut in half longitudinally, dabbed of excess 161 sucrose and embedded in OCT with the cut-side down. Rapid freezing was 162 accomplished using acetone chilled with dry ice. 10um sections were taken using a 163 cryostat set at -20C. For staining, slides were thawed at room temperature (RT) and 164 washed three times in PBS for 5mins to remove excess OCT. Samples were then 165 blocked and permeabilized in PBS/0.1% TritonX/5% BSA for 1hr at RT. Primary 166 antibodies were diluted in PBS/TritonX/BSA (FN (Millipore cat#F3648, 1:500), CD31 167 (Fisher Scientific cat#AF3628, 1:1000), CD34 (Abcam cat#AB81289)) and incubated 168 overnight in a humidity chamber at 4C. Primary antibodies were then washed off with 169 PBS/0.1% tween20 (PBST) three times for 5mins. Alexa Fluor Secondary antibodies 170 were diluted in PBS/TritonX/BSA at 1:1000 and left for 1hr at RT. Slides were then 171 washed again in PBST before the excess was blotted off. Slides were mounted using 172 Prolong Gold antifade mounting medium (Invitrogen cat#P36980) and allowed to cure 173 overnight prior to imaging. Imaging was done on a Zeiss Leica Confocal Microscope 174 using the Leica Application Suit X software. A 20x air objective was used for all kidney 175 images. Image analysis was done using Fiji. 176 H&E staining 177 Kidney sections were taken as described in the previous section. H&E staining of 178 tissue sections was done by the Yale Research Histology Core using standard 179 techniques 180 Urine collection and ACR 181 Urine was collected from GD17-18.5 dams prior to dissection using a clean cage 182 without bedding, covered with saranwrap. The mouse was allowed to freely walk around 183 until naturally voiding at which point the urine was quickly collected via clean syringe 184 .CC-BY 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted March 31, 2026. ; https://doi.org/10.64898/2026.03.30.715448doi: bioRxiv preprint and stored at -80C prior to analysis. ACR was then measured using two kits: Albuwell M 185 (Ethos biosciences cat#CHM03V055, and the creatinine companion kit (Ethos 186 biosciences cat# CHM03V058) Samples were diluted 1:2-1:5. 187

Results

188 KLF2 association with hypertension 189 Given that both PE and cardiovascular disease share key risk factors, we 190 interrogated the CVD Knowledge Portal (CVDkP) for variants in KLF2/4. Although 191 associations between KLF2/4 SNPs and PE did not reach statistical significance, likely 192 because of the limited statistical power of the study, variant rs3745318 in KLF2 is 193 associated with blood pressure and coronary artery disease (Figure 1A and [24]). 194 Furthermore, this variant is identified in the GTEx database as an eQTL for KLF2 in 195 whole blood (p = 1.27e-6), supporting a potential regulatory role in vascular pathways 196 linked to PE (figure 1B). 197 To address function, we suppressed KLF2 or 4 expression in HUVECs in vitro 198 and used QPCR to quantify both total Flt1 (tFlt1) and the soluble isoform (sFlt1). siRNA-199 mediated knockdown (KD) of Klf2 (validated in Fig 1C) increased the sFlt1/tFlt1 ratio by 200 approximately 2-fold, without significantly changing total Flt1 (tFlt1) mRNA (Fig 1D). Klf4 201 knockdown (validated in Fig 1E) similarly increased the sFlt1/tFlt1 ratio (Fig 1F). 202 Knockdown of Klf2 or 4 thus induces a shift in mRNA splicing rather than expression. 203 The established causal role of sFlt1 in PE, together with genetic links between Klf2/4 204 and hypertension, prompted us to examine a possible role for KLF signaling in PE [24]. 205 KLF4 iECKO triggers severe PE. 206 In mice, early-onset, severe preeclampsia is characterized by elevated blood 207 pressure (average BP>130) before the third trimester, elevated circulating sFLT1, and 208 evidence of kidney or other organ damage [4, 25]. KLF4f/f;CDH5Cre-ERT2 dams were treated 209 with tamoxifen to specifically delete endothelial KLF4 (KLF4iECKO) then bred with wild-210 type B6 males, producing WT offspring. Thus, any observed phenotype is attributable to 211 the maternal genotype rather than the fetus. 212 Blood pressure was measured using a CODA tail-cuff telemetry system. To ensure 213 accuracy, within-session variability, expressed as percent coefficient of variation (%CV) 214 of tail-cuff measurements was calculated. %CV declined across acclimation sessions, 215 marked on all graphs as a purple box, indicating effective mouse training (supplemental 216 figure 1A-C). Percent CV was calculated per individual per experimental session and 217 sessions above 10% CV were discarded (Supplemental figure 1A-C). We observed no 218 difference in resting blood pressure between KLF4iECKO and KLF4f/f dams prior to the 219 onset of pregnancy (Figure 2A, time point -1; supplemental figure 1D-F), as is often the 220 case in human PE. However, GD6.5, KLF4iECKO dams had a trend toward elevated BP 221 .CC-BY 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted March 31, 2026. ; https://doi.org/10.64898/2026.03.30.715448doi: bioRxiv preprint by day 2.5, did not go through the mid-gestation nadir at around GD8.5, and remained 222 elevated over controls at later times (Figure 2A; supplemental figure 1G-H). KLF4iECKO 223 thus elevates blood pressure within the first trimester of pregnancy in mice. 224 To assess similarities to human preeclampsia, we next measured circulating sFLT1 225 and indicators of end organ damage. At GD18.5, pregnant KLF4iECKO dams had strongly 226 elevated sFLT1 compared to controls (Figure 2B; supplemental figure 2A). Kidney 227 damage was analyzed using CD34 staining, a proteinuria assay and H&E glomeruli 228 staining. These metrics revealed increased proteinuria, CD34 expression and capillary 229 occlusion in KLF4iECKO dams compared to controls (figure 2C-D, supplemental figure 230 1H-I) [26]. 231 While evidence concerning which cell types contribute to elevated sFLT1 in the 232 maternal circulation is mixed, it is known that maternal ECs can produce sFLT1 [27]. 233 This source potentially creates a positive feedback loop, promoting maternal endothelial 234 dysfunction and CVD risk, which can worsen fetal sFlt1 production. We therefore 235 assayed sFlt1 mRNA in arterial endothelium of KLF4iECKO dams using RNAscope 236 probes specific for sFLT1 and total FLT1(supplemental figure 2B-D). Examination of 237 aortic endothelium en face revealed elevated sFLT1 mRNA in ECs in KLF4iECKO dams 238 compared to cre- controls (Figure 2E-F). Together, these data indicate that KLF4iECKO 239 dams display a severe, early-onset PE phenotype. 240 KLF4iECKO triggers fetal growth restriction 241 Severe PE is associated with poor placental perfusion, leading to fetal growth 242 restriction (FGR). Measures for FGR in mice include reduced pup weight and litter size, 243 which were both strongly decreased in KLF4iECKO litters (Figure 3A-B). Additionally, 244 placental vascular area, measured both by longitudinal sections and macroscopically, 245 was decreased in KLF4iECKO placentas (Figure 3C-D). RNAscope analysis of placenta 246 sections showed increased sFLT1 mRNA in the dense labyrinth in KLF4iECKO placentas 247 (Figure 3E; supplemental figure 3). Overall, these data confirm that maternal deletion of 248 endothelial Klf4 results in severe preeclamptic pregnancy and FGR. 249

Discussion

250 Preeclampsia is a severe disease of pregnancy leading not only to maternal or fetal 251 death but to life-long increased incidence of CVD in surviving mother [28, 29] and 252 increased metabolic syndrome, impaired vascular function and neurodevelopmental 253 problems in surviving offspring [5, 30]. Mild PE is associated with a ~2-fold increased 254 incidence of maternal CVD while severe, early onset PE increases future CVD by 255 almost 10-fold [31]. Our data identify maternal KLF4iECKO as a novel genetic model of 256 early onset PE with FGR, the most severe form. Unlike viral sFLT1 overexpression, this 257 approach preserves endogenous regulation and maternal–placental interactions, 258 .CC-BY 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted March 31, 2026. ; https://doi.org/10.64898/2026.03.30.715448doi: bioRxiv preprint providing a physiologically relevant framework for studying how maternal vasculature 259 defects contribute to development of PE. It may also better represent disease in 260 humans where the main risk factors are known to decrease endothelial Klf2 and 4 261 expression. PE was also observed in a spontaneously hypertensive rat model [32] but 262 the mouse KLF4iECKO model offers greater opportunity for reverse genetic functional 263 analysis as well as better recapitulating PE predisposition in otherwise healthy women 264 [30]. 265 Treating PE is a considerable challenge, due to a large extent to the risk of harm to the 266 fetus. Hypertension management through aspirin administration is currently the only 267 widely used therapy to mitigate PE symptoms. Our model suggests that the maternal 268 vasculature may offer viable targets. Indeed, the KLF2/4 target gene eNOS, a major 269 component of blood pressure regulation and target of hypertensive risk factors, is under 270 consideration as a target for PE treatment [33, 34]. Recently developed antibodies [6] 271 and siRNaS [35] that target vascular endothelium and elevate Klf2/4 expression, 272 perhaps in conjunction with delivery via nanoparticles, Fab fragments and some 273 antibody subtypes, e.g., IgA and IgM, that do not efficiently cross the placental barrier 274 offer some promise here. The Klf4iECKO model therefore offers a suitable platform to test 275 these interventions in future studies. 276 277 278 279 280 281 282 283 284 285 286 287 Acknowledgments 288 We thank the Yale Research Histology Core, M. Jain (Brown University) for the 289 KLF4f/f;CHD5cre-ERT2 mice, H. Aldrich for sample OCT embedding, and the Schwartz Lab 290 members for the extensive discussions. 291 .CC-BY 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted March 31, 2026. ; https://doi.org/10.64898/2026.03.30.715448doi: bioRxiv preprint Sources of Funding 292 This work was supported by a National Institutes of Health grant no. RO1 HL171773 to 293 M.A.S and a T32 Fellowship no 5T32HL007950 to E.M. 294 Disclosures 295 The authors declare no competing interests. 296 297 298 299 300 301 302 303 304 305 306 307 308 309 310 311 312 313 314

References

315 1. Cresswell, J.A., et al., Global and regional causes of maternal deaths 2009-20: a 316 WHO systematic analysis. Lancet Glob Health, 2025. 13(4): p. e626-e634. 317 2. Ma'ayeh, M. and M.M. Costantine, Prevention of preeclampsia. Semin Fetal 318 Neonatal Med, 2020. 25(5): p. 101123. 319 .CC-BY 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted March 31, 2026. ; https://doi.org/10.64898/2026.03.30.715448doi: bioRxiv preprint 3. Bellamy, L., et al., Pre-eclampsia and risk of cardiovascular disease and cancer 320 in later life: systematic review and meta-analysis. BMJ, 2007. 335(7627): p. 974. 321 4. Roberts, J.M., et al., Subtypes of Preeclampsia: Recognition and Determining 322 Clinical Usefulness. Hypertension, 2021. 77(5): p. 1430-1441. 323 5. Huang, K.H., et al., Prediction of pre-eclampsia complicated by fetal growth 324 restriction and its perinatal outcome based on an artificial neural network model. 325 Front Physiol, 2022. 13: p. 992040. 326 6. Joshi, D., et al., Endothelial gamma-protocadherins inhibit KLF2 and KLF4 to 327 promote atherosclerosis. Nat Cardiovasc Res, 2024. 3(9): p. 1035-1048. 328 7. Hsieh, P.N., et al., Aging and the Kruppel-like factors. Trends Cell Mol Biol, 2017. 329 12: p. 1-15. 330 8. Deng, H., et al., A KLF2-BMPER-Smad1/5 checkpoint regulates high fluid shear 331 stress-mediated artery remodeling. Nat Cardiovasc Res, 2024. 3(7): p. 785-798. 332 9. Hsieh, P.N., et al., A conserved KLF-autophagy pathway modulates nematode 333 lifespan and mammalian age-associated vascular dysfunction. Nat Commun, 334 2017. 8(1): p. 914. 335 10. Dykxhoorn, D.M., et al., MicroRNA-29c-3p and -126a Contribute to the 336 Decreased Angiogenic Potential of Aging Endothelial Progenitor Cells. Int J Mol 337 Sci, 2025. 26(9). 338 11. Samak, M., et al., Dysregulation of Kruppel-like Factor 2 and Myocyte Enhancer 339 Factor 2D Drive Cardiac Microvascular Inflammation and Dysfunction in 340 Diabetes. Int J Mol Sci, 2023. 24(3). 341 12. Thakar, S., et al., Intermittent High Glucose Elevates Nuclear Localization of 342 EZH2 to Cause H3K27me3-Dependent Repression of KLF2 Leading to 343 Endothelial Inflammation. Cells, 2021. 10(10). 344 13. Zhong, F., et al., Reduced Kruppel-like factor 2 expression may aggravate the 345 endothelial injury of diabetic nephropathy. Kidney Int, 2015. 87(2): p. 382-95. 346 14. Zhang, H., Z. Chen, and X. Wang, Differentiated serum levels of Kruppel-like 347 factors 2 and 4, sP-selectin, and sE-selectin in patients with gestational diabetes 348 mellitus. Gynecol Endocrinol, 2022. 38(12): p. 1121-1124. 349 15. Gao, J., et al., Endothelial Kruppel-like factor 2/4: Regulation and function in 350 cardiovascular diseases. Cell Signal, 2025. 130: p. 111699. 351 16. Boon, R.A., et al., Kruppel-like factor 2 improves neovascularization capacity of 352 aged proangiogenic cells. Eur Heart J, 2011. 32(3): p. 371-7. 353 17. Sangwung, P., et al., KLF2 and KLF4 control endothelial identity and vascular 354 integrity. JCI Insight, 2017. 2(4): p. e91700. 355 18. Hamik, A., et al., Kruppel-like factor 4 regulates endothelial inflammation. J Biol 356 Chem, 2007. 282(18): p. 13769-79. 357 19. Ng, K.W., et al., Biomarkers and point of care screening approaches for the 358 management of preeclampsia. Commun Med (Lond), 2024. 4(1): p. 208. 359 20. MacDonald, T.M., et al., Clinical tools and biomarkers to predict preeclampsia. 360 EBioMedicine, 2022. 75: p. 103780. 361 21. Slehria, T., et al., A Gap in Knowledge-Sudden Death and Preeclampsia. Am J 362 Cardiol, 2023. 202: p. 199-200. 363 .CC-BY 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted March 31, 2026. ; https://doi.org/10.64898/2026.03.30.715448doi: bioRxiv preprint 22. Atluri, N., et al., Challenges to diagnosing and managing preeclampsia in a low-364 resource setting: A qualitative study of obstetric provider perspectives from 365 Ghana. PLOS Glob Public Health, 2023. 3(5): p. e0001790. 366 23. Akduman, A.T., et al., Effect of tamoxifen on ovarian reserve: A randomized 367 controlled assessor-blind trial in a mouse model. J Turk Ger Gynecol Assoc, 368 2014. 15(4): p. 228-32. 369 24. Kivioja, A., et al., Increased Risk of Preeclampsia in Women With a Genetic 370 Predisposition to Elevated Blood Pressure. Hypertension, 2022. 79(9): p. 2008-371 2015. 372 25. Sones, J.L. and R.L. Davisson, Preeclampsia, of mice and women. Physiol 373 Genomics, 2016. 48(8): p. 565-72. 374 26. Dupont, V., et al., Impaired renal reserve contributes to preeclampsia via the 375 kynurenine and soluble fms-like tyrosine kinase 1 pathway. J Clin Invest, 2022. 376 132(20). 377 27. Huang, X., et al., sFlt-1-enriched exosomes induced endothelial cell dysfunction 378 and a preeclampsia-like phenotype in mice. Cytokine, 2023. 166: p. 156190. 379 28. Yang, C., et al., Long-Term Impacts of Preeclampsia on the Cardiovascular 380 System of Mother and Offspring. Hypertension, 2023. 80(9): p. 1821-1833. 381 29. Wojczakowski, W., et al., Preeclampsia and Cardiovascular Risk for Offspring. J 382 Clin Med, 2021. 10(14). 383 30. Turbeville, H.R. and J.M. Sasser, Preeclampsia beyond pregnancy: long-term 384 consequences for mother and child. Am J Physiol Renal Physiol, 2020. 318(6): p. 385 F1315-F1326. 386 31. Brown, M.C., et al., Cardiovascular disease risk in women with pre-eclampsia: 387 systematic review and meta-analysis. Eur J Epidemiol, 2013. 28(1): p. 1-19. 388 32. Davisson, R.L., et al., Discovery of a spontaneous genetic mouse model of 389 preeclampsia. Hypertension, 2002. 39(2 Pt 2): p. 337-42. 390 33. Ssengonzi, R., et al., Endothelial Nitric Oxide synthase (eNOS) in Preeclampsia: 391 An Update. J Pregnancy Child Health, 2024. 6. 392 34. Kim, S., et al., Alleviation of preeclampsia-like symptoms through PlGF and 393 eNOS regulation by hypoxia- and NF-kappaB-responsive miR-214-3p deletion. 394 Exp Mol Med, 2024. 56(6): p. 1388-1400. 395 35. Zhou, Z., et al., Targeted polyelectrolyte complex micelles treat vascular 396 complications in vivo. Proc Natl Acad Sci U S A, 2021. 118(50). 397 398 399 400 Figure Legends 401 Figure 1. KLF2/4 are involved in hypertension and sFLT1 elevation. A CVD 402 Knowledge Portal (CVDkP) analysis revealed SNPs within KLF2 linked to hypertension, 403 a major causal factor in the development of PE. B This variant is identified in the GTEx 404 database as an eQTL for KLF2 in whole blood. C-F siRNA-mediated KD of KLF2 (B-C) 405 .CC-BY 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted March 31, 2026. ; https://doi.org/10.64898/2026.03.30.715448doi: bioRxiv preprint or 4 (D-E) in HUVECs significantly increased the sFLT1/FLT1 ratio in comparison to 406 control siRNA. We did not observe a change in total FLT1 levels, indicating that KLF2/4 407 negatively regulates the splicing of sFLT1 and not the overall transcript levels of FLT1. 408 Figure 2. KLF4iECKO mice develop early, severe preeclamptic pregnancies. A mean 409 arterial pressure (MAP) was tracked using tail-cuff telemetry over the course of KLF4f/f 410 or KLF4iECKO pregnancies. Dams lacking EC KLF4 showed significant hypertension in 411 comparison to cre- controls for the duration of their pregnancy. Prior to pregnancy, mice 412 showed no difference between genotypes (GD-1). Days covered by purple are training 413 days. B Blood samples were collected at GD18.5 via cardiac puncture. Samples were 414 then run at dilutions ranging from 1:5-1:20 to ensure values landed within the standard 415 curve. 6 B6 and 9 KLF4-/- dams were analyzed using R&D’s VEGFR1 ELISA kit. KLF4-416 /- mice had significantly higher sFLT1 in comparison to B6 controls. C To determine the 417 extent of kidney damage during KLF4iECKO preeclamptic pregnancies, we collected urine 418 prior to sacrificing on GD18.5 and calculated the albumin:creatine (ACR). KLF4iECKO 419 dams had significantly more proteinurea in comparison to B6 controls. D This was 420 further confirmed via kidney H&E staining, which showed severe occlusion of the 421 glomeruli in KLF4iECKO versus cre- controls. E-F RNAscope analysis of ECs in the aorta 422 showed that KLF4iECKO dams had significantly more sFLT1 splicing in their aortic 423 endothelium in comparison to cre- animal controls. 424 Figure 3. Pups from KLF4iECKO Dams experience fetal growth restriction and 425 decreased placental vascular area. A Following dissection from the yolk sac and 426 placenta, pups were weighed as a group and the average pup weight was determined 427 for each litter by dividing the total weight by the number of pups. Data points represent 428 litters. Pups from KLF4iECKO pregnancies were significantly smaller in comparison to B6 429 controls. A representative pup comparison is pictured to the right of the quantification. B 430 In addition to being smaller, litters from KLF4iECKO pregnancies had significantly fewer 431 pups in comparison to B6 litters. C-D Placental vascular area was analyzed in two 432 ways: firstly, via gross analysis of the underside (pup side) of the placenta where blood 433 perfusion can be used to distinguish between the vascular area (VA) and the total area 434 (TA) (C), and secondly via sectioning and comparing the dense labyrinth area to the 435 total placental area (D). Representative images with area tracings are shown for both 436 analyses. Gross images were taken using an iPhone 8. Placenta section images were 437 taken using a 20x air objective with tiling used to capture the entire section. Data is 438 represented as per placenta (C) with at least 6 sections being analyzed per genotype in 439 3 independent staining (D). E RNAscope analysis with FN protein staining on placenta 440 sections reveals increased sFLT1 splicing and FN deposition in KLF4iECKO versus B6 441 controls. Representative images are shown with zoomed insets (Ei-ii) and 442 quantification. Data points are placentas that are an average of 3 stained sections, 443 .CC-BY 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted March 31, 2026. ; https://doi.org/10.64898/2026.03.30.715448doi: bioRxiv preprint placentas from at least 3 different litters were used for each genotype. All data is shown 444 as the mean +/- SEM. 445 Supplemental Figure 1. Additional assays on hypertension and kidney damage. A-446 C percent coefficient of variation (%CV) calculated per session per individual to ensure 447 robust measurements. For each animal and session, BP was calculated as the mean of 448 ≥3 accepted tail-cuff cycles. Session stability was quantified using the coefficient of 449 variation (CV = SD/mean × 100). Cycle-level outliers exceeding ±2 SD were excluded to 450 remove technical artifacts. Sessions demonstrating CV values within the expected 451 physiological range (<10%) were considered stable. Days covered by purple are training 452 days. D-F average diastolic (D) and systolic (E) and mean (F) blood pressure 453 comparison between nonpregant B6, KLF4f/f and iECKO dams showing no difference 454 prior to pregnancy. G-H Time course of diastolic (G) and systolic (H) blood pressure 455 changes during pregnancy in f/f or iECKO KLF4 animals. Days covered in purple are 456 training days. I-J Representative CD34 staining in KLF4iECKO and f/f controls with 457 quantification (I). 458 Supplemental Figure 2. RNAscope Schematic and Analysis. A confirmation of 459 KLF4iECKO following tamoxifen injection. Aortas were stained en face for KLF4, CD31 460 and DAPI to confirm iECKO. B Mouse FLT1 mRNA schematic is shown with RNAscope 461 probe locations and the sFLT1 i13 splice site (red line). C RNAscope probe control 462 staining in en face aorta pieces. Laser power and exposure for each repeat experiment 463 was determined by control probe fluorescence before imaging experimental samples. D 464 Split channel representative RNAscope en face aortas with FN protein staining and 465 sample calculation. 466 Supplement Figure 3. Placenta RNAscope validation using mouse positive and 467 negative control probes. Placenta sections from 2-3 individual litters were used to 468 stain for positive and negative control probes. Imaging parameters (laser power, 469 exposure) for experimental samples were determined based on detection of signal only 470 in the positive control set, but not the negative control set, as represented here. 471 Channels HRP-C1 and –C2 were optimized in this experiment, we did not develop 472 HRP-C3 since that channel was taken by FN protein staining. 473 474 Figures 475 Figure 1 476 .CC-BY 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted March 31, 2026. ; https://doi.org/10.64898/2026.03.30.715448doi: bioRxiv preprint 477 Figure 2 478 479 480 Figure 3 481 .CC-BY 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted March 31, 2026. ; https://doi.org/10.64898/2026.03.30.715448doi: bioRxiv preprint 482 Supplemental Figure 1 483 484 Supplemental Figure 2 485 .CC-BY 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted March 31, 2026. ; https://doi.org/10.64898/2026.03.30.715448doi: bioRxiv preprint 486 Supplemental Figure 3 487 488 .CC-BY 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted March 31, 2026. ; https://doi.org/10.64898/2026.03.30.715448doi: bioRxiv preprint .CC-BY 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted March 31, 2026. ; https://doi.org/10.64898/2026.03.30.715448doi: bioRxiv preprint .CC-BY 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted March 31, 2026. ; https://doi.org/10.64898/2026.03.30.715448doi: bioRxiv preprint .CC-BY 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted March 31, 2026. ; https://doi.org/10.64898/2026.03.30.715448doi: bioRxiv preprint

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: oa-pdf

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2026) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00
unpaywall
last seen: 2026-05-23T02:00:01.238055+00:00
License: CC-BY-4.0