Olfactory responses of sex pheromone receptors in Spodoptera litura (Lepidoptera: Noctuidae) to inter- and intra-specific sex pheromone | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Olfactory responses of sex pheromone receptors in Spodoptera litura (Lepidoptera: Noctuidae) to inter- and intra-specific sex pheromone Yueying Zhang, Jiaying Li, Yansong Xiao, Weiai Zeng, Kai Teng, and 5 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-5817533/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Spodoptera litura is an important crop pest while sex pheromone trapping has been used as a tool for S. litura population monitoring. The objective of this study was to detect olfactory responses of sex pheromone receptors in S. litura to inter- and intra- specific sex pheromone. We identified three pheromone odorant receptors (ORs) --- SlituOR13, SlituOR6 and SlituOR16 . SlituOR6 had the strongest response to the minor sex pheromone component E 11-14:Ac of S. litura , and weak responses to the inter-specific sex pheromone components 16:Ac and Z 9-14:Ac. SlituOR13 had a strong response to the minor sex pheromone component E 11-14:Ac of S. litura , and a weak response to the minor component Z 9-14:Ac. SlituOR16 responded strongly to the sex pheromone component Z 9-14:OH of S. exigua , had some responses to the intra-specific sex pheromone component Z 9-14:Ac, Z 9 E 11-14:Ac and Z 9 E 12-14:Ac of S. litura , and the inter-specific sex pheromone component Z 7-12:Ac of Agrotis ipsilon , but a weak response to the minor component E 11-14:Ac of S. litura . Field data from sex pheromone trapping supported that Z 9-14:OH and Z 7-12:Ac inhibited the olfactory response of male S. litura to sex pheromones. Spodoptera litura Xenopus oocyte system olfactory receptor inter-specific sex pheromone intra-specific sex pheromone sex pheromone trapping Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Figure 10 Figure 11 Introduction Insects have developed a special olfactory system during their evolution, which enables them to screen and identify chemicals related to their living in the environment, and to complete a series of behavioral activities such as foraging, avoiding predators, calling, mating and oviposition (Chapman, 2003; Thompson & Pellmyr, 1991). The olfactory system is composed of a variety of chemical sensory genes expressed in the peripheral nervous system, including odorant receptors (ORs), taste receptors (GRs), ionophobic receptors (IRs) and odorant binding proteins (OBPs) (Han et al., 2023; Yang et al., 2024). ORs specifically designed to detect sex pheromone components are called pheromone receptors (PRs) (Fleischer et al., 2018; Gardiner et al., 2008; Leal, 2013). Sex pheromone receptors (PRs) belong to the OR family and have been the focus of research on the mechanism of sex pheromone recognition in recent years (Hu et al., 2024; Yuvaraj et al., 2017). At present, the Xenopus oocyte expression-two electrode voltage clamp system (XOE-TEVC) has been widely used in the expression of receptor proteins such as PRs in insects (Cheikh et al., 2019). The PR gene was expressed in vitro by micro-injection of DNA or RNA into Xenopus oocytes, while TEVC was used to record the current response caused by the receptor activated by different odor molecules (Liu et al., 2013a; Zhang et al., 2023). Spodoptera litura (Fabricius) (Lepidoptera, Noctuidae) is a destructive insect pest that feeds on a variety of crops, such as soybean, cotton, corn, potato and tobacco. It is widely distributed in Asia, Oceania and India subcontinent (Dhivya et al., 2024; Islam et al., 2024). In recent years, with the production region expansion for soybean, corn and other crops that are preferred hosts of S. litura , and the favorable climate condition, the damage caused by S. litura has been increasing (Hu et al., 2024). S. litura has a strong reproductive capacity, hidden habitat and resistance to many classes of chemical insecticides (Anuradha et al., 2023). Insect sex pheromones are trace volatile chemicals produced and released by sexually mature females to attract the conspecific males for mating (Zhang et al., 2024). Sex pheromone of S. litura has been identified as ( cis , trans )-9,12-tetradecadienyl acetate ( Z 9 E 12-14:Ac), ( cis , trans )-9,11-tetradecadienyl acetate ( Z 9 E 11-14:Ac), trans -11-tetradecenyl acetate ( E 11-14:Ac) and cis -9-tetradecenyl acetate ( Z 9-14:Ac) (Tamaki et al., 1973; Tamaki et al., 1976), with Z 9 E 11-14:Ac as the major component (Sun et al., 2003). The absence of Z 9 E 12-14:Ac resulted in a lack of attractiveness (Shen et al., 2009) but the attractiveness of E 11-14:Ac and Z 9-14:Ac in the mixture was not prominent (Sun et al., 2003; Sun et al., 2002). Research on olfactory recognition to inter-specific sex pheromones has been increasing in recent years, but has been limited to the closely related species. For example, Heliothis virescens , H. subflexa and Helicoverpa zea females share the same major component Z 11-16:Ald in their sex pheromones, while the minor components vary from species to species (Guo et al., 2022; Zielonka et al., 2018). In the wind tunnel study, the pheromone plume released by female moth interferes with the interspecific females to attract males in the conspecific species (Lelito et al., 2008). In the rice field, Cnaphalocrocis medinalis can detect the sex pheromone not only from its conspecific species, but also from the inter-species Chilo suppressalis and Sesamia inferens (Cheng et al., 2023). Studies to date have shown that PR genes have some electro-physiological responses to interspecific sex pheromone components (Chang et al., 2015; Wanner et al., 2010). Studies of PR genes in S. litura has been mainly focused on their functional identification to intra-specific sex pheromones (Zhang et al., 2015). SlituOR1 had differential expression in the population of S. litura caught by traps with different ratios of Z 9, E 11-14:Ac and Z 9, E 12-14:Ac in the sex pheromone mixture (Zhang et al., 2017). SlituOR3 responded to Z 9, E 11-14:Ac and Z 9, E 12-14:Ac (Lin et al., 2015). SlituOR6 had a specific response to Z 9, E 12-14:Ac, and SlituOR13 had a weak response to Z 9, E 11-14:Ac or Z 9-14:Ac, while SlituOR16 had a specific response to Z 9-14:OH (Zhang et al., 2015; Zhang et al., 2023). However, there are few studies on the functional identification of PR genes in S. litura for its inter-specific sex pheromones. In the habitat of tobacco crop, in addition to S. litura , there are other lepidopteran pests such as Agrotis ipsilon , H. armigera , H. assulta and S. exigua . Sex pheromone of A. ipsilon contains cis -7-dodecenyl acetate ( Z 7-12:Ac), cis -9-tetradecenyl acetate ( Z 9-14:Ac) and cis -11-hexadecenyl acetate ( Z 11-16:Ac) (Du et al., 2015; Gemeno et al., 2000; Picimbon et al., 1997). Sex pheromone of H. assulta consists of cis -9-hexadecenal ( Z 9-16:Ald), cis -11-hexadecenal ( Z 11-16:Ald) and cis -9-hexadecenyl acetate ( Z 9-16:Ac) (Boo et al., 1995; Cork et al., 1992; Sugie et al., 1991). Sex pheromone of H. armigera comprises Z 11-16:Ald, Z 9-16:Ald, hexadecanal (16:Ald) and cis -9-tetradecenal (Z9-14:Ald) (Dunkelblum et al., 1980; Gao et al., 2020; Zhang et al., 2012), whereas sex pheromone of S. exigua is composed of Z 9 E 12-14:Ac, Z 9-14:Ac, cis -11-hexadecenyl acetate ( Z 11-16:Ac) and cis -9-tetradecenol ( Z 9-14:OH) (Acín et al., 2010; Mochizuki et al., 1993; Persoons et al., 1981; Tumlinson et al., 1990; Wakamura, 1987). The present study focused on three PRs of S. litura males and construction of their expression vectors, used the XOE-TEVC system to determine the current responses of the three PRs to the sex pheromone of S. litura and the inter-specific sex pheromones of A. ipsilon , H. assulta , H. armigera and S. exigua females. This study may help develop efficient sex pheromone-based technology to control these pests. Materials and methods 1.1 Insects S. litura were reared on artificial diet in the lab, with temperature at 25 ± 1℃, relative humidity at 65 ± 5%, and under conditions of photoperiod 14 h light:10 h dark. After eclosion, adults were fed with 10% glucose. Antennae, head, thorax, abdomen, legs and wings of 3-day-old males were isolated for gene cloning or qPCR analysis. 1.2 RNA extraction and cDNA synthesis TRIzol reagent and the PureLink™ RNA Mini Kit (Invitrogen, USA) were used to extract the total RNA from each of the isolated S. litura body parts according to the manufacturer’s protocol. The concentration and purity of RNA were verified by NanoDrop-2000 (Thermo Scientific, Waltham, MA, USA). Single-stranded cDNA templates were obtained from total RNA from the S. litura male antennae using SuperScript™ VILO™ cDNA (Invitrogen, USA). The prepared cDNA template was stored at − 20°C before it was used. 1.3 Transcriptome sequencing and sequence analysis The extracted RNA samples of S. litura body parts were processed by Tianjin Novogene Bioinformatics Technology Co., Ltd. for eukaryotic transcriptome analysis and sequencing without reference genome. The specific cDNA library with quality assurance was obtained by PCR enrichment. The second-generation sequencing technique was used for sequencing, and the sequencing data was merged and assembled using the Trinity software to obtain the Unigene library of the species. The PR and ORco genes with their full-length obtained by the transcriptome sequencing were subjected to blast and analyzed for homology on the NCBI website. The DNAMAN software was used for the sequence analysis, and the online software Clustal Omega ( https://www.ebi.ac.uk/Tools/msa/clustalo/ ) was used for multiple sequence alignments with other Lepidoptera OR genes. Finally, MEGA 7.0 was used to construct a phylogenetic tree. 1.4 Quantitative real time PCR The PR genes of S. litura were screened and obtained from the differentially expressed genes. Quantitative real-time PCR (qPCR) was used to detect the sex expression profiles of the four PRs genes. Specific primers were designed using Premier 6.0 software. The primers were synthesized by Hangzhou Youkang Biotechnology Co., Ltd (Hangzhou, China). As we previously described (Cheng et al., 2023 ), the qPCR was performed with a TB Green Premix Ex Taq II (TaKaRa, Japan) and CFX connect real-time system (Bio-Rad, USA) in 25 µL reactions containing 12.5 µL of TB Green Premix Ex Taq II, 0.5 µL of forward and reverse primers (10 µmol/L), 1 µL of cDNA template, and 10.5 µL of nuclease-free water. The thermal cycling procedures were as follows: 95°C for 30 s, 39 cycles of 95°C for 5 s, 60°C for 30 s. The SlituGAPDH and SlituEF genes were used as the reference genes to standardize the target gene expression. The experiment was replicated three times using three independent RNA samples. The relative gene expression levels were calculated using the relative 2 −ΔΔCT quantitation method. 1.5 Gene cloning for sequence verification The four OR genes ( SlituOR6 , SlituOR13 , SlituOR16 and SlituORco ) were cloned with specific primers (Table 1 ) designed by the Hangzhou Youkang Biotechnology Co., Ltd. The amplification was performed with NEB's Phusion® high-fidelity DNA polymerase. The PCR was performed in 50 µL containing 10 µL of buffer, 2.5 µL of forward and reverse primers (10 µmol/L), 1 µL of cDNA template, 1 µL of dNTPs substrate (10 µmol/L), 1.5 µL of DMSO, 0.5 µL of DNA polymerase and 31 µL of RNase-free water. The reaction procedure was carried out according to the kit instruction. PCR products were run on a 1.2% agarose gel, and the target bands were purified by GeneJET Gel Extraction and DNA Cleanup Micro Kit (ThermoFisher Scientific, USA). Recovered product from the PCR amplification gel was utilized and ligated to the cloning vector pEASY-Blunt Zero, followed by transformation. Finally, the positive clones were sequenced by the Hangzhou Youkang Biotechnology Co., Ltd. Table 1 Primer sequences for S. litura gene cloning Primer names Primer sequences (5´→3´) Slitu-OR6-F1 ATGGGTTTAAAAAAGTTTCT Slitu-OR6-R1 TCAAATGCTGCGTAAGA Slitu-OR13-F1 ATGGATATAAAATTGTCATC Slitu-OR13-R1 TTATTCTTCCTCATCGG Slitu-OR16-F1 ATGAACCTCAAAAAATTCCTT Slitu-OR16-R1 TCACATGCTTCGTAAGAA Slitu-ORco-F1 ATGATGACCAAAGTGAAAGC Slitu-ORco-R1 TTACTTCAGCTGTACCAACAC 1.6 Vector construction and cRNA synthesis Full-length ORFs of the three candidate PR genes ( SlituOR6 , SlituOR13 and SlituOR16 ) and Orco genes were amplified using NEB's Phusion® high-fidelity DNA polymerase and gene-specific primers (Table 2 ). The product was then ligated onto the EcoRV-digested PT7Ts vector. The constructed vector genes were subjected to plasmid extraction, linearized by SacI digestion, and cRNAs were synthesized using the linearized and purified plasmid as a template by the MESSAGE mMACHINE T7 kit (Ambion, USA). The cRNAs were diluted to 2 µg/µL and stored at -80°C. Table 2 Primer sequences for the receptor vector construction of S. litura Primer names Primer sequences (5´→3´) Slitu-OR6-F1 TTTGGCAGATCTGATCGCCACCATGGGTTTAAAAAAGTTTCT Slitu-OR6-R1 GGGCCCACTAGTGATTCAAATGCTGCGTAAGA Slitu-OR13-F1 TTTGGCAGATCTGATCGCCACCATGGATATAAAATTGTCATC Slitu-OR13-R1 GGGCCCACTAGTGATTTATTCTTCCTCATCGG Slitu-OR16-F1 TTTGGCAGATCTGATCGCCACCATGAACCTCAAAAAATTCCT Slitu-OR16-R1 GGGCCCACTAGTGATTCACATGCTTCGTAAGAA Slitu-ORco-F1 TTTGGCAGATCTGATCGCCACCATGATGACCAAAGTGAAAGC Slitu-ORco-R1 GGGCCCACTAGTGATTTACTTCAGCTGTACCAACAC 1.7 PR expression in Xenopus oocytes and electro-physiological recordings The treatment, micro-injection and culture of Xenopus oocytes were the same as we previously reported (Cheng et al., 2023 ). After co-injection of OR/Orco cRNAs, the Xenopus oocytes were cultured at 16°C for 3 to 6 days, then were used for ligand sensitivity measurement with the two electrode voltage clamps (OC-725C; Warner Instruments, Hamden, CT, USA). A total of 21 chemical compounds (Ningbo Newcon Inc., China, with a purity of > 93%) were tested in this experiment. All compounds were dissolved in dimethyl sulfoxide (DMSO) and prepared as 1 mol/L stock solution. The stock solution was diluted with 1× Ringer. The cell currents induced by odors were recorded with TEVC, Digidata 1550B, and pClamp10.0 at a holding potential of − 80 mV. Oocytes were stimulated with each of the compounds at 1× 10 − 4 mol/L for 15 s in a random order, and the next stimulation was performed after the current returned to the baseline. Oocytes were stimulated with only one compound at concentrations from10 − 7 to 10 − 3 mol/L to obtain a dosage-response curve. For each chemical compound, oocytes were tested in the screening assays and in the dosage − response assays. All experiments were replicated three times on different oocytes. 1.8 Fluorescence in Situ Hybridization SweAMI-DAB chromogenic in situ hybridization experiments were carried out to determine the expression pattern of OR16 in the antennae of S. litura . First, the SweAMI technique was used, and the tail-processed specific oligonucleotides were used as probes. The probes were synthesized by Yuanmu Biotechnology (Shanghai, China). The antennae of S. litura were fixed in 4% paraformaldehyde fixative at 4°C for more than 24 h. The antennae were dehydrated and embedded in paraffin, sliced into 4 µm sections with a microtome, and then oven-baked for 2h at 62°C℃. The sections were de-paraffined and placed in a citric acid (pH = 6.0) repair box in a water bath 90°C for 48 min. After natural cooling, proteinase K (20 ug/mL) was added and then digested at 37°C. After washed with pure water, the slices were washed three times with PBS for 5 min each time. Endogenous peroxidase was inactivated by incubation in 3% methanol-H2O2 for 15 min. The pre-hybridization solution was added and incubated for 1 h at 37°C. After removing the pre-hybridization solution, probe hybridization solution was added and hybridization was performed overnight at 42°C in a constant temperature and humidity chamber. Slides were then washed in 2× SSC at 37°C for 10 min, 1× SSC at 37°C twice for 5 min each, and 0.5× SSC at room temperature for 10 min. The slices were then rinsed sequentially with different concentrations of PBS buffer. The hybridization solution containing the signal probe was added, incubated at 42° for 3h, and again washed multiple times with different gradients of SSC. DAPI staining solution was dropped onto the slices, and the slices were incubated in the dark for 8min. After washing, anti-fluorescence quenching sealing agent was added to seal the slices, the sections were placed under a Nikon inverted fluorescence microscope and the images were taken. 1.9 Field experiments Function of the above electro-physiologically active compounds was verified in the field trapping experiment. Each compound at different dosages was added to the binary blend of S. litura sex pheromone to formulate a series of mixtures and the number of moth catches by each mixture was then determined. Field experiment was conducted in 2023 in tobacco fields in Guiyang and Chenzhou, Hunan Province and Xichang, Sichuan Province, and in Napa cabbage fields in Dongpo, Sichuan Province. Heliothis trap (NewCon Inc., Ningbo, China) was used in the field at a height of about 1 m. S. litura sex pheromone lure was a PVC tubing (Length 80 mm, outer diameter 1.1 mm, inner diameter 0.6 mm) containing the binary blend of Z 9 E 11-14:Ac and Z 9 E 12-14:Ac in a ratio of 1000µg:100 µg. Lures were sealed in aluminum foil bags, stored in -20 ℃ freezer and shipped by courier to test locations when needed. The inter-specific sex pheromones were added into the binary blend of Z 9 E 11-14:Ac and Z 9 E 12-14:Ac at dosages of 6.25µg, 12.5µg, 25µg, 50µg, 75µg and 100µg. The intra-specific minor sex pheromone component Z9-14:Ac and E11-14:Ac were added into the binary blend at dosages of 10µg, 30µg, 90µg, 270µg and 510µg. 1.10 Statistical analysis SPSS 23.0 (SPSS Inc., Chicago, IL, USA) was used for the statistical analysis. MEGA 7.0 was used to construct a phylogenetic tree. Independent sample t-test was used for fluorescence quantitative PCR. GraphPad Prism 8.0 (GraphPad Software Inc. San Diego, CA, USA) was used to analyze the obtained curves. Data from field trapping tests were analysed with the one-way ANOVA and the treatment means were separated and compared by the Student’s t-test. Results 2.1 Cloning and phylogenetic tree analysis of PR genes of S. litura SlituOR6 , SlituOR11 , SlituOR13 and SlituOR16 had 1299 (encoding 433 amino acids), 1308 (encoding 436 amino acids), 1302 (encoding 434 amino acids) and 1299 bases (encoding 433 amino acids), respectively (Fig. 1 ). SlituOR6 had 43.60%, 37.53% and 58.20% similarity with SlituOR11 , SlituOR13 and SlituOR16 , respectively, while SlituOR13 had 37.53%, 40.00%, and 39.55% similarity with SlituOR6 , SlituOR11 and SlituOR16 , respectively (Fig. 1 ). The amino acid sequences of ORs of Noctuidae insects such as Mythimna separata , H. armigera , S, frugiperda and the model insect Bombyx mori were obtained by NCBI ( https://archive-dtd.ncbi.nlm.nih . gov/) and the evolutionary tree was constructed. Results showed that SlituOR6 had the highest homology with SlituR6 and clustered in the same evolutionary branch with SfruOR6 and SexiOR6 ; SlituOR11 had the highest homology with SlittOR11 and clustered in the same evolutionary branch with SexiOR11 ; SlituOR13 had the highest homology with SlittOR13 and clustered in the same evolutionary branch with SexiOR13 , and SlituOR16 had the highest homology with SlittOR16 and clustered in the same evolutionary branch with SexiOR16 (Fig. 2 ). 2.2 Expression pattern of PR genes in male S. litura The expression profiles of sex pheromone receptor genes SlituOR6 , SlituOR11 , SlituOR13 and SlituOR16 in the wings, head, thorax, abdomen, leg and antennae of male S. litura were shown in Fig. 3 . Each of the genes were significantly expressed in the antennae of S. litura compared to the other body parts (P < 0.05). 2.3 Functional characterization of three candidate PRs in S. litura Results showed that at a concentration of 10 − 4 M, the SlituOR6 gene had the greatest response to the minor sex pheromone component E 11-14:Ac of S. litura and the inter-specific sex pheromone components 16:Ac and Z 9-14:Ac, respectively, with no obvious response to other compounds (Fig. 4 ). The dose-response curve indicated a maximum response of 260 ± 130 nA to E 11-14:Ac, highlighting the high sensitivity to it (Fig. 5 ). At a concentration of 10 − 4 M, the SlituOR13 had the greatest response to the minor sex pheromone component E 11-14:Ac of S. litura and the inter-specific sex pheromone component Z 9-14:Ac, with no obvious response to the other compounds (Fig. 6 ). When the concentration of E 11-14:Ac was as low as 10 − 7 M, SlituOR13 had a responsive current of 50 ± 20 nA. As the concentration increased to 10 − 4 M, SlituOR13 had the strongest response at 260 ± 130 nA (Fig. 7 ). Responses of SlituOR16 gene to the compounds at a concentration of 10 − 4 M were shown in Fig. 8 . SlituOR16 gene had a relatively strongest response to the S. litura behavioral antagonist Z 9-14:OH, with the current 160 ± 70 nA. It also had a certain responses to the intraspecific sex pheromone component Z 9-14:Ac, Z 9 E 11-14:Ac and Z 9 E 12-14:Ac, and the interspecific sex pheromone component Z 7-12:Ac of S. litura , with a current 80 ± 15nA, 100 ± 20nA, 85 ± 10nA and 85 ± 15nA, respectively. It had a weak response to the minor pheromone component E 11-14:Ac of S. litura , with a current 70 ± 3nA and no obvious response was detected for the other compounds. Dosage-responses of SlituOR16 /Orco to Z 9-14:OH were shown in Fig. 9 . When the concentration was at 10 − 7 M, SlituOR16 responded with a current 50 ± 20 nA. As the concentration increased, the response increased gradually, and when the concentration increased to 10 − 3 mol/L, the response reached 225 ± 20 nA. 2.4 Fluorescence in situ hybridization of OR16 in antennae The results showed that OR16 labeled with the antisense probe was expressed below the long sensilla trichodea, short sensilla trichodea and sensilla basiconica (Figs. 10 B-F), whereas OR16 expression was absent in antennae hybridized with the sense probe in the control group (Fig. 10 A). This suggest that OR16 was consistent with the olfactory function of the sensilla and may be involved in the process of sex pheromone recognition. 2.5 The effect of inter- and intra-specific sex pheromone on the attractiveness of S. litura sex pheromone In the Guiyang tobacco field, results showed that attractiveness of the binary blend of S. litura sex pheromone was dramatically inhibited by either Z 7-12:Ac ( F = 31.166, df = 35, P < 0.001) ( Fig. 11 A) or Z 9-14:OH ( F = 20.857, df = 35, P < 0.001) (Fig. 11 B) at all the dosages tested. Z 9-14:Ac and E 11-14:Ac are minor components of S. litura , but the effect of these two compounds varied depending on geographical locations. In the Guiyang tobacco field, the number of moths trapped by the sex pheromone mixture with Z 9-14:Ac was also reduced ( F = 5.461, df = 25, P = 0.003) (Fig. 11 C) but E 11-14:Ac has no effect ( F = 0.676, df = 35, P = 0.645) (Fig. 11 D). However, in Xichang of Sichuan, Z 9-14:Ac has a significant synergistic effect at trace amounts ( F = 3.625, df = 29, P = 0.014) (Fig. 11 E), but not in Dongpo ( F = 1.862, df = 29, P = 0.139) (Fig. 11 G). E 11-14: Ac has significant enhancement in Dongpo ( F = 2.958, df = 29, P = 0.032) and Xichang ( F = 6.706, df = 29, P < 0.001), Sichuan. Following compounds tested in the sex pheromone blends had no significant impact on the attractiveness: Z 11-14:Ac ( F = 0.666, df = 35, P = 0.652), Z 11-16:OH ( F = 2.086, df = 35, P = 0.095), Z 9-16:Ald ( F = 0.595, df = 35, P = 0.704), Z 11-16:Ac ( F = 0.964, df = 35, P = 0.455), Z 11-16:Ald ( F = 0.435, df = 35, P = 0.821), 14:Ac ( F = 1.806, df = 35, P = 0.142), E 9-14:Ac ( F = 0.789, df = 25, P = 0.543) and Z 9-12:Ac ( F = 1.449, df = 35, P = 0.236). Discussion Greater expression in S. litura adult antennae implies importance of the OR in olfaction. In this study, the greater expression of four PRs ( SlituOR6 , SlituOR11 , SlituOR13 and SlituOR16 ) in the antennae was confirmed by qPCR, suggesting the antennae may play an important role in insect sex pheromone perception. For the function, we defined the current responses of SlituOR6 , SlituOR13 , and SlituOR16 to 21 sex pheromone components by XOE-TEVC to clarify their functions. The results showed that SlituOR6 responded to the secondary sex pheromone components E 11-14:Ac and Z 9-14:Ac, and also responded to the interspecific sex pheromone component 16:Ac. SlituOR13 responded to the minor sex pheromone components E 11-14:Ac and Z 9-14:Ac, and no response to other sex pheromones and interspecific sex pheromones. SlituOR16 showed a strong current response to interspecific sex pheromones Z 9-14:OH and Z 7-12:Ac, and a certain response to intraspecific sex pheromones Z 9-14:Ac, Z 9 E 11-14:Ac, Z 9 E 12-14:Ac and E 11-14:Ac. It is concluded that SlituOR13 may only be responsible for the recognition of intra-specific sex pheromones, while SlituOR6 and SlituOR16 can recognize both intra-specific and inter-specific sex pheromones. S. exigua , S. frugiperda and S. litura are closely related species that have common host plants and can be found in the same habitat, such as corns. Numerous reports showed that closely related species shared the same sex pheromone component (Yan et al., 2019 ; Yang et al., 2009 ; Zielonka et al., 2018 ). Z 9 E 12-14:Ac and Z 9-14:Ac are the major sex pheromone components of S. exigua , whereas Z 9-14:Ac is also the major sex pheromone component of S. frugiperda (Tumlinson et al., 1986 ; Wakamura, 1987 ). Z 9 E 12-14:Ac is also present in trace amount in S. frugiperda sex pheromone, while E 11-14:Ac is its minor component (Tabata et al., 2023 ; Wang et al., 2022a ). We have often found a small number of S. litura and S. exigua moths in the sex pheromone traps used to monitor S. frugiperda population (Y. Du, unpublished data). This reduced the effectiveness in monitoring these pests by the sex pheromone trapping. The composition and ratio of each compounds in the sex pheromone blend are the key, but the trace components also play an important role in the specificity of sex pheromone (Chen et al., 2018 ). At present, the olfactory responses of different insect species to their sex pheromones in the same crop habitat have not been fully investigated. Z 9-14:OH and Z 7-12:Ac are not sex pheromone components of S. litura , because they have never been detected in the extracts of its sex pheromone glands (Sun et al., 2003 ; Sun et al., 2002 ). Z9-14:OH is one of the minor components of S. exigua sex pheromone (Mochizuki et al., 1993 ; Wakamura, 1987 ), while Z 7-12:Ac is the major component of the A. ipsilon sex pheromone and the minor component of S. frugiperda sex pheromone (Tumlinson et al., 1986 ). By field experiments and in vitro functional verification, we found that Z 9-14:OH and Z 7-12:Ac strongly inhibited the olfactory perception of sex pheromone in male S. litura , in which SlituOR16 receptors play an important role. SlituOR16 is one of the major receptors that sense the sex pheromone of S. litura , and it responds to all four intrinsic sex pheromone components. The olfactory receptors of C. medinalis in rice fields sensed Z 11-16:Ald and Z 11-16:Ac in C. suppressalis and S. inferens sex pheromones, whereas Z 11-16:Ald and Z 11-16:Ac are not components of C. medinalis sex pheromone (Cheng et al., 2023 ). Similar situations exist in Plutella xylostella , S. litura , and S. exigua in vegetable fields. Z 9 E 11-14:Ac and Z 9 E 12-14:Ac inhibit the sex pheromone trapping of male P. xylostella (Wang et al., 2022b ). This chemical communication with sex pheromone in interspecific species may have been related to the spatial distribution of insect species in the same habitat and their competition or ecological niche, and also reflects the important ecological significance of premating in the reproduction of insects (Kohno & Iida, 2024 ). A. ipsilon larvae feed on roots, while S. litura larvae feed on leaves (Li et al., 2022 ; Sayed et al., 2023 ). If the density of A.ipsilon females in the habitat is high, it would affect the living space for the offspring of leaf-feeding insects. Similarly, the C. suppressalis and S. inferens are borers, while the larvae of C. medinalis are leaf rollers. The high density of females will also threaten the offspring of C. medinalis moths to complete their life cycle. S. litura , H. armigera and H. assulta are important pests of tobacco, and the larvae fed on the leaves (Garcia, 2006 ; Yuan et al., 2024 ; Zhang et al., 2022 ). However, in this study, none of the sex pheromone receptors of S. litura showed electro-physiological response to the sex pheromone components of H. armigera or H. assulta . The relationship between insect species in the same habitat is of great interest in the pest management with sex pheromone technology, that is whether we can use Z 7-12:Ac and Z 9-14:OH to replace or partially replace Z 9 E 11-14:Ac and Z 9 E 12-14:Ac in the mating disruption. Because Z 9 E 11-14:Ac and Z 9E1 2 -14:Ac contain double-bond, their synthetic costs are higher than those of Z 7-12:Ac and Z 9-14:OH. At the same time, the calling behavior of A. ipsilon and S. exigua can also be disrupted in the high dosages of Z 7-12:Ac and Z 9-14:OH. This might be a potential for mating disruption to multiple pests in the tobacco crop. In this study, the responses of three PRs to inter- and intra-specific sex pheromones of A. ipsilon , H. assulta , H. armigera and S. exigua were determined by XOE-TEVC system. The function of sex pheromone receptors was verified by field experiments. It offers novel insights into the molecular mechanisms underlying sex pheromone sensing in moths and suggesting innovative approaches for future pest management. Declarations ACKNOWLEDGEMENTS This work was financially supported by the Key Science and Technology Project of China National Tobacco Bureau (110202201027 (LS-11)) to T. Liu and China National Tobacco Bureau Hunan Provincial Key Project (HN2023KJ21) to S. Wu. Authors’ contributions SW, TL and YD proposed and managed the project.JL, YX, WZ and KT arranged and designed the field experiments; JL, YX and WZ performed the field experiments; YZ and MC performed the molecular and electrophysiological experiments; CD and SW performed statistical analysis; SW, TL and YD managed the projects. YZ, MC and CD wrote the original draft paper, YD wrote and finalized the paper. All authors have discussed the results of the manuscript. Availability of data and materials The data that support the findings of this study are available upon reasonable request. Conflict of interest The authors have no relevant financial or non-financial interests to disclose. References Acín P, Rosell G, Guerrero A, Quero C (2010) Sex Pheromone of the Spanish Population of the Beet Armyworm Spodoptera exigua. J Chem Ecol 36:778–786. 10.1007/s10886-010-9817-z Anuradha P, Sudhanan EM, Priyanka M, Emaiya R, Karthik P, Suganthi A, Krishnamoorthy SV (2023) Determination of chlorantraniliprole for managing Helicoverpa armigera and Spodoptera litura in cotton ecosystem. Environ Res 239 doi:ARTN 117301. 10.1016/j.envres.2023.117301 Boo KS, Park KC, Hall DR, Cork A, Berg BG, Mustaparta H (1995) (Z)-9-Tetradecenal - a Potent Inhibitor of Pheromone-Mediated Communication in the Oriental Tobacco Budworm Moth, Helicoverpa-Assulta. J Comp Physiol a-Sensory Neural Behav Physiol 177:695–699 Chang HT, Liu Y, Yang T, Pelosi P, Dong SL, Wang GR (2015) Pheromone binding proteins enhance the sensitivity of olfactory receptors to sex pheromones in. Scientific Reports 5. doi:ARTN 13093 10.1038/srep13093 Chapman RF (2003) Contact chemoreception infeeding by phytophagous insects. Ann Rev Entomol 48:455–484. 10.1146/annurev.ento.48.091801.112629 Chen QH, Zhu F, Tian ZH, Zhang WM, Guo R, Liu WC, Pan LM, Du YJ (2018) Minor Components Play an Important Role in Interspecific Recognition of Insects: A Basis to Pheromone Based Electronic Monitoring Tools for Rice Pests. Insects 9. doi:ARTN 19210.3390/insects9040192. Cheng JJ, Chen QH, Guo QS, Du YJ (2023) Moth sex pheromones affect interspecific competition among sympatric species and possibly population distribution by modulating pre-mating behavior. Insect Sci 30:501–516. 10.1111/1744-7917.13099 Cork A, Boo KS, Dunkelblum E, Hall DR, Jeerajunga K, Kehat M, Jie EK, Park KC, Tepgidagarn P, Xun L (1992) Female Sex-Pheromone of Oriental Tobacco Budworm, Helicoverpa-Assulta (Guenee) (Lepidoptera, Noctuidae) - Identification and Field Testing. J Chem Ecol 18:403–418. 10.1007/Bf00994240 Dhivya M, Karthi S, Amala K, Vasantha-Srinivasan P, Han YS, Al Obaid S, Senthil-Nathan S, Park KB (2024) Phytometabolites from coral jasmine flower extracts: Toxic effects on Spodoptera litura and enzyme inhibition in nontarget earthworm Eisenia fetida as an alternative approach. Environ Res 252 doi:ARTN 118896. 10.1016/j.envres.2024.118896 Du YJ, Feng B, Li HG, Liu CM, Zeng J, Pan LM, Yu Q (2015) Field Evaluation of Agrotis ipsilon (Lepidoptera: Noctuidae) Pheromone Blends and Their Application to Monitoring Moth Populations in China. Environ Entomol 44:724–733. 10.1093/ee/nvv043 Dunkelblum E, Gothilf S, Kehat M (1980) Identification of the Sex-Pheromone of the Cotton Bollworm, Heliothis-Armigera, in Israel. Phytoparasitica 8:209–211. 10.1007/Bf03158319 Fleischer J, Pregitzer P, Breer H, Krieger J (2018) Access to the odor world: olfactory receptors and their role for signal transduction in insects. Cell Mol Life Sci 75:485–508. 10.1007/s00018-017-2627-5 Gao K, Torres-Vila LM, Zalucki MP, Li YP, Griepink F, Heckel DG, Groot AT (2020) Geographic variation in sexual communication in the cotton bollworm. Pest Manag Sci 76:3596–3605. 10.1002/ps.5893 Garcia FJM (2006) Analysis of the spatio-temporal distribution of Hb. in a tomato field using a stochastic approach. Biosyst Eng 93:253–259. 10.1016/j.biosystemseng.2005.12.011 Gardiner A, Barker D, Butlin RK, Jordan WC, Ritchie MG (2008) Drosophila chemoreceptor gene evolution: selection, specialization and genome size. Mol Ecol 17:1648–1657. 10.1111/j.1365-294X.2008.03713.x Gemeno C, Lutfallah AF, Haynes KF (2000) Pheromone blend variation and cross-attraction among populations of the black cutworm moth (Lepidoptera: noctuidae). Ann Entomol Soc Am 93:1322–1328 doi:Doi 10.1603/0013-8746(2000)093[1322:Pbvaca]2.0.Co;2 Guo H, Huang LQ, Gong XL, Wang CZ (2022) Comparison of functions of pheromone receptor repertoires in Helicoverpa armigera and Helicoverpa assulta using a Drosophila expression system. Insect Biochemistry and Molecular Biology 141. doi:ARTN 103702 10.1016/j.ibmb.2021.103702 Han WK, Wei ZQ, Yang YL, Liu XL, Yan Q, Zhang J, Dong SL (2023) Roles of GOBP1 in perception of host plant volatiles revealed by CRISPR/Cas9-mediated mutagenesis in. J Appl Entomol 147:602–610. 10.1111/jen.13150 Hu J, Zhang Y, Tan LS, Wang XY, Liu W, Wang GR, Zheng XL (2024) Functional characterization of sex pheromone receptors PflaOR29 and PflaOR44 involved in the chemoreception of a diurnal moth, Phauda flammans (Walker) (Lepidoptera: Phaudidae). Pesticide Biochemistry and Physiology 203. doi:ARTN 105998 10.1016/j.pestbp.2024.105998 Islam Y, Shah FM, Güncan A, Naeem A, Zhou XM (2024) Temperature-induced effects on development, reproduction, and predation of Harmonia axyridis fed on first instar larvae Spodoptera litura. Bull Entomol Res 114:244–253. 10.1017/S0007485324000051 Kohno K, Iida H (2024) Possible mechanisms mitigating reproductive interference supposed between Xylena fumosa (Butler) and X. formosa (Butler) (Lepidoptera: Noctuidae: Xyleninae), both by-captured in a commercial pheromone trap for Helicoverpa armigera (Hübner) (Lepidoptera: Noctuidae: Heliothinae). Entomological Science 27. doi:ARTN e12567 10.1111/ens.12567 Leal WS (2013) Odorant Reception in Insects: Roles of Receptors, Binding Proteins, and Degrading Enzymes. Ann Rev Entomol 58:373–391. 10.1146/annurev-ento-120811-153635 Lelito JP, Myrick AJ, Baker TC (2008) Interspecific pheromone plume interference among sympatric heliothine moths: A wind tunnel test using live, calling females. J Chem Ecol 34:725–733. 10.1007/s10886-008-9475-6 Li YX, Gao H, Zhang H, Yu RN, Feng F, Tang J, Li B (2022) Characterization and expression profiling of G protein-coupled receptors (GPCRs) in (Lepidoptera: Noctuidae). Comparative Biochemistry and Physiology D-Genomics & Proteomics 44. doi:ARTN 101018 10.1016/j.cbd.2022.101018 Lin XD, Zhang QH, Wu ZN, Du YJ (2015) Identification and Differential Expression of a Candidate Sex Pheromone Receptor in Natural Populations of Spodoptera litura. Plos One 10. doi:ARTN e0131407 10.1371/journal.pone.0131407 Liu CC, Liu Y, Walker WB, Dong SL, Wang GR (2013a) IIdentification and functional characterization of sex pheromone receptors in beet armyworm Spodoptera exigua (Hübner). Insect Biochem Mol Biol 43:747–754. 10.1016/j.ibmb.2013.05.009 Liu NY, He P, Dong SL (2012) Binding properties of pheromone-binding protein 1 from the common cutworm. Comp Biochem Physiol B-Biochemistry Mol Biology 161:295–302. 10.1016/j.cbpb.2011.11.007 Liu NY, Liu CC, Dong SL (2013b) Functional differentiation of pheromone-binding proteins in the common cutworm. Comp Biochem Physiol a-Molecular Integr Physiol 165:254–262. 10.1016/j.cbpa.2013.03.016 Mochizuki F, Shibuya T, Ihara T, Wakamura S (1993) Electrophysiological Responses of the Male Antenna to Compounds Found in the Female Sex-Pheromone Gland of Spodoptera-Exigua, (Hubner) (Lepidoptera, Noctuidae). Applied Entomology and Zoology 28: 489–496. doi: 10.1303/aez.28.489 Persoons CJ, Vanderkraan C, Nooijen WJ, Ritter FJ, Voerman S, Baker TC (1981) Sex-Pheromone of the Beet Armyworm, Spodoptera-Exigua - Isolation, Identification and Preliminary Field-Evaluation. Entomol Exp Appl 30:98–99. 10.1111/j.1570-7458.1981.tb03591.x Picimbon JF, Gadenne C, Becard JM, Clement JL, Sreng L (1997) Sex pheromone of the French black cutworm moth, Agrotis ipsilon (Lepidoptera: Noctuidae): Identification and regulation of a multicomponent blend. J Chem Ecol 23:211–230. 10.1023/B:Joec.0000006355.13207.91 Sayed RM, El Sayed TS, Rizk SA (2023) Potency of Bio Magic (Metarhizium anisopliae fungus) and gamma radiation in the black cut worm, Agrotis ipsilon (Hufnagel) larvae. Egyptian Journal of Biological Pest Control 33. doi:ARTN 1 10.1186/s41938-023-00647-6 Shen YL, Gao Y, Du YJ (2009) The synergism of plant volatile compounds and sex pheromones of the tobacco cutworm moth, Spodoptera litura (Lepidoptera: Noctuidae). Acta Entomol Sinica 52:1290–1297 Sugie H, Tatsuki S, Nakagaki S, Rao CBJ, Yamamoto A (1991) Identification of the Sex-Pheromone of the Oriental Tobacco Budworm, Heliothis-Assulta (Guenee) (Lepidoptera, Noctuidae). Appl Entomol Zool 26:151–153. 10.1303/aez.26.151 Sun F, Du JW, Chen TH (2003) The behavioral responses of Spodoptera litura (F.) males to the female sex pheromone in wind tunnel and field trapping tests. Acta Entomol Sinica 46:26–130 Sun F, Hu YY, Du JW (2002) The sex pheromone communication system of Spodoptera litura (Fabricius). Acta Entomol Sinica 45:404–407 Tabata J, Nakano R, Yasui H, Nakamura K, Takehara K, Matsuda H, Ikenoue Y, Kusuhata Y, Kinjo K, Nakama K, Tsuha Y, Ishikawa Y (2023) Sex pheromone of the fall armyworm Spodoptera frugiperda (Lepidoptera: Noctuidae) of a Far East population from Okinawa, Japan. Entomol Exp Appl 171:535–541. 10.1111/eea.13287 Tamaki Y, Noguchi H, Yushima T (1973) Sex pheromone of Spodoptera litura (F.) (Lepidoptera: Noctuidae): isolation, identification, and synthesis. Applied Entomology Zoology: 200–203 Tamaki Y, Ohsawa T, Yushima T, Noguchi H (1976) Sex pheromone and related compounds secreted by the virgin females of Spodoptera litura (F). Jpn J Appl Entomol Zool 20:81–86 Thompson JN, Pellmyr O (1991) Evolution of Oviposition Behavior and Host Preference in Lepidoptera. Ann Rev Entomol 36:65–89. 10.1146/annurev.en.36.010191.000433 Tumlinson JH, Mitchell ER, Teal PEA, Heath RR, Mengelkoch LJ (1986) Sex-Pheromone of Fall Armyworm, Spodoptera-Frugiperda Smith,J.E. - Identification of Components Critical to Attraction in the Field. J Chem Ecol 12:1909–1926. 10.1007/Bf01041855 Tumlinson JH, Mitchell ER, Yu HS (1990) Analysis and Field-Evaluation of Volatile Blend Emitted by Calling Virgin Females of Beet Armyworm Moth, Spodoptera-Exigua (Hubner). J Chem Ecol 16:3411–3423. 10.1007/Bf00982107 Wakamura S (1987) Sex-Pheromone of the Beet Armyworm, Spodoptera-Exigua (Hubner) (Lepidoptera, Noctuidae) - Field Attraction of Male Moths in Japan to (Z,E)-9,12-Tetradecadienyl Acetate and (Z)-9-Tetradecen-1-Ol. Appl Entomol Zool 22:348–351. 10.1303/aez.22.348 Wang C, Zhang S, Guo MB, Hou XQ, Yang B, Wang GR (2022a) Optimization of a pheromone lure by analyzing the peripheral coding of sex pheromones of Spodoptera frugiperda in China. Pest Manag Sci 78:2995–3004. 10.1002/ps.6924 Wang FM, Shen ZJ, Schal C, Zhu JJ, Zhou GX, Wang YL, Wang JR, Deng JY, Wan NF (2022b) Pheromone antagonism in Plu tella xylostella (Linnaeus) by sex pheromones of two sympatric noctuid moths. Pest Manag Sci 78:379–387. 10.1002/ps.6651 Wanner KW, Nichols AS, Allen JE, Bunger PL, Garczynski SF, Linn CE, Robertson HM, Luetje CW (2010) Sex Pheromone Receptor Specificity in the European Corn Borer Moth,. Plos One 5. doi:ARTN e8685 10.1371/journal.pone.0008685 Yan Q, Liu XL, Wang YL, Tang XQ, Shen ZJ, Dong SL, Den JY (2019) Two Sympatric Spodoptera Species Could Mutually Recognize Sex Pheromone Components for Behavioral Isolation. Front Physiol 10 doi:ARTN 1256. 10.3389/fphys.2019.01256 Yang CY, Han KS, Boo KS (2009) Sex Pheromones and Reproductive Isolation of Three Species in Genus. J Chem Ecol 35:342–348. 10.1007/s10886-009-9602-z Yang J, Mo BT, Li GC, Huang LQ, Guo H, Wang CZ (2024) Identification and functional characterization of chemosensory genes in olfactory and taste organs of Spodoptera litura (Lepidoptera: Noctuidae). Insect Sci. 10.1111/1744-7917.13350 Yuan XF, Zhong H, Xia ZY, Lu ZJ, Chen W, Liu YX, Zhou GC, Liu XQ, Deng MJ, Yu HZ (2024) Integrated transcriptome and 1H NMR-based metabolome to explore the potential mechanism of Spodoptera litura in response to flupyrimin. Pestic Biochem Physiol 205:106146–106146. 10.1016/j.pestbp.2024.106146 Yuvaraj JK, Corcoran JA, Andersson MN, Newcomb RD, Anderbrant O, Löfstedt C (2017) Characterization of Odorant Receptors from a Non-ditrysian Moth, Eriocrania semipurpurella Sheds Light on the Origin of Sex Pheromone Receptors in Lepidoptera. Mol Biol Evol 34:2733–2746. 10.1093/molbev/msx215 Zhang HL, Li KY, Zhang YB (2022) Comparing the Transcriptomes of Two Different Tissues in (Guenee). J Chem 2022 doi:Artn 3820942. 10.1155/2022/3820942 Zhang J, Yan SW, Liu Y, Jacquin-Joly E, Dong SL, Wang GR (2015) IIdentification and functional characterization of sex pheromone receptors in the common cutworm (Spodoptera litura). Chem Senses 40:7–16. 10.1093/chemse/bju052 Zhang JP, Salcedo C, Fang YL, Zhang RJ, Zhang ZN (2012) An overlooked component: (Z)-9-tetradecenal as a sex pheromone in. J Insect Physiol 58:1209–1216. 10.1016/j.jinsphys.2012.05.018 Zhang QH, Wu ZN, Zhou JJ, Du YJ (2017) Molecular and functional characterization of a candidate sex pheromone receptor OR1 in. Insect Sci 24:543–558. 10.1111/1744-7917.12294 Zhang S, Jacquin-Joly E, Montagné N, Liu F, Liu Y, Wang GR (2024) Identification of an odorant receptor responding to sex pheromones in Spodoptera frugiperda extends the novel type-I PR lineage in moths. Insect Sci 31:489–502. 10.1111/1744-7917.13248 Zhang S, Liu F, Yang B, Liu Y, Wang GR (2023) Functional characterization of sex pheromone receptors in Spodoptera frugiperda, S. exigua, and S. litura moths. Insect Sci 30:305–320. 10.1111/1744-7917.13098 Zielonka M, Breer H, Krieger J (2018) Molecular elements of pheromone detection in the female moth. Insect Sci 25:389–400. 10.1111/1744-7917.12434 Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-5817533","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":401976273,"identity":"8c71f80a-5482-4cff-a1ff-a8d6bcec2ed8","order_by":0,"name":"Yueying Zhang","email":"","orcid":"","institution":"Zhejiang University","correspondingAuthor":false,"prefix":"","firstName":"Yueying","middleName":"","lastName":"Zhang","suffix":""},{"id":401976274,"identity":"45dc8542-64cc-4472-9c32-bb839d2ef06c","order_by":1,"name":"Jiaying Li","email":"","orcid":"","institution":"Yongzhou Municipal Tobacco Company","correspondingAuthor":false,"prefix":"","firstName":"Jiaying","middleName":"","lastName":"Li","suffix":""},{"id":401976275,"identity":"b09bb9da-9eaf-4ff7-846b-0926e4908de3","order_by":2,"name":"Yansong Xiao","email":"","orcid":"","institution":"Chenzhou Municipal Tobacco Company","correspondingAuthor":false,"prefix":"","firstName":"Yansong","middleName":"","lastName":"Xiao","suffix":""},{"id":401976276,"identity":"de2ef71d-9529-42cf-b2dc-4f6104e32406","order_by":3,"name":"Weiai Zeng","email":"","orcid":"","institution":"Changsha Municipal Tobacco Company","correspondingAuthor":false,"prefix":"","firstName":"Weiai","middleName":"","lastName":"Zeng","suffix":""},{"id":401976277,"identity":"a6c9a2cc-6852-4455-8926-501681c6a553","order_by":4,"name":"Kai Teng","email":"","orcid":"","institution":"Xiangxi Municipal Tobacco Company","correspondingAuthor":false,"prefix":"","firstName":"Kai","middleName":"","lastName":"Teng","suffix":""},{"id":401976278,"identity":"f60ea8dc-4e89-4e6b-92ee-f6d0cd71d0ba","order_by":5,"name":"Mengdan Chen","email":"","orcid":"","institution":"Zhejiang University","correspondingAuthor":false,"prefix":"","firstName":"Mengdan","middleName":"","lastName":"Chen","suffix":""},{"id":401976279,"identity":"273a3d67-0879-4908-9f5b-31cd2dd7214d","order_by":6,"name":"Caroline Du","email":"","orcid":"","institution":"Zhejiang University","correspondingAuthor":false,"prefix":"","firstName":"Caroline","middleName":"","lastName":"Du","suffix":""},{"id":401976280,"identity":"46bef9e8-f1fd-4dc2-b674-7ecafbfe262f","order_by":7,"name":"Tianbo Liu","email":"","orcid":"","institution":"Hunan Tobacco Science Research Institute","correspondingAuthor":false,"prefix":"","firstName":"Tianbo","middleName":"","lastName":"Liu","suffix":""},{"id":401976281,"identity":"c32f2255-60fe-4503-9315-cd6920acbf0e","order_by":8,"name":"Shaolong Wu","email":"","orcid":"","institution":"Hunan Tobacco Science Research Institute","correspondingAuthor":false,"prefix":"","firstName":"Shaolong","middleName":"","lastName":"Wu","suffix":""},{"id":401976282,"identity":"699fd487-88c8-4699-9fc1-f86a553c3ba3","order_by":9,"name":"Yongjun Du","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA3klEQVRIie3RMQrCMBTG8SeBuBTnFCl6hEigKohnqQid3ARxLAid1L3gIXqESIYupXNFh07VwUHxABpr57RugvlP3/B+0wPQ6X41AtDwmh5QeI/6xODfkOKSOOWoOqXRRlyG/skKD+dsbsDICjnKMyWJE3dg+jkLj47DDHBZyHGfKkk6s6npi4kkXBI5uIFJPXLYe5I8axGWFSRFIAmvJmYc20ASwYLYhd6OTlkgsK0krWjNHmQhrG0U5fS6HMuxypWkywG3ywtMi2ci1b2s4wG63z4bZRXHOp1O96e9AHTYT/PJOGDuAAAAAElFTkSuQmCC","orcid":"https://orcid.org/0000-0001-6463-385X","institution":"Zhejiang University College of Agriculture and Biotechnology","correspondingAuthor":true,"prefix":"","firstName":"Yongjun","middleName":"","lastName":"Du","suffix":""}],"badges":[],"createdAt":"2025-01-13 07:21:34","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-5817533/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-5817533/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":73967993,"identity":"1981b9dd-5fca-4ca7-a0f6-eeb860a27cb7","added_by":"auto","created_at":"2025-01-16 13:07:41","extension":"jpeg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":136972,"visible":true,"origin":"","legend":"\u003cp\u003eAlignment of amino acid sequences of sex pheromone receptors of \u003cem\u003eS. litura\u003c/em\u003e\u003c/p\u003e","description":"","filename":"image1.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-5817533/v1/039f8eb7a64288e6a82c7905.jpeg"},{"id":73967990,"identity":"ba6014de-b670-428c-924e-302aca705b84","added_by":"auto","created_at":"2025-01-16 13:07:40","extension":"jpeg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":133548,"visible":true,"origin":"","legend":"\u003cp\u003ePhylogenetic tree of \u003cem\u003eS. litura\u003c/em\u003e \u003cem\u003eSlituOR6\u003c/em\u003e, \u003cem\u003eSlituOR13 \u003c/em\u003eand \u003cem\u003eSlituORco\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eMsep: \u003cem\u003eM. separata\u003c/em\u003e; Psau: \u003cem\u003ePeridroma saucia\u003c/em\u003e; Aseg: \u003cem\u003eAgrotis segetum\u003c/em\u003e; Sfru: \u003cem\u003eSpodoptera frugiperda\u003c/em\u003e; Harm: \u003cem\u003eHelicoverpa armigera\u003c/em\u003e; Hass: \u003cem\u003eH. assulta\u003c/em\u003e; Bmor: \u003cem\u003eBombyx mori\u003c/em\u003e; Hvir: \u003cem\u003eHeliothis virescens\u003c/em\u003e; Slitt: \u003cem\u003eS. littora\u003c/em\u003e\u003c/p\u003e","description":"","filename":"image2.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-5817533/v1/9af9e9336bbf51e689f0268d.jpeg"},{"id":73967988,"identity":"02ad1774-7008-4180-9fe7-0a7dc8b3a9e5","added_by":"auto","created_at":"2025-01-16 13:07:40","extension":"jpeg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":69969,"visible":true,"origin":"","legend":"\u003cp\u003eExpression profile of PRs in different body parts of\u003cem\u003e S. litura \u003c/em\u003emales\u003c/p\u003e\n\u003cp\u003eHe: head; Th: thorax; Ab: abdomen; Le: leg; Wi: wing; An: antennae\u003c/p\u003e\n\u003cp\u003eDifferent letters over bars indicate statistically significant difference at \u003cem\u003eP\u003c/em\u003e\u0026lt; 0.\u003c/p\u003e","description":"","filename":"image3.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-5817533/v1/edc339ef28e0b96e5e430fb1.jpeg"},{"id":73967991,"identity":"31da4f2b-8f58-4f40-b40f-ffac019510f9","added_by":"auto","created_at":"2025-01-16 13:07:40","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":74323,"visible":true,"origin":"","legend":"\u003cp\u003eResponse of \u003cem\u003eSlituOR6\u003c/em\u003e/\u003cem\u003eSlituORco \u003c/em\u003eto inter- and intra-specific pheromone components. (a) Inward currents of \u003cem\u003eSlituOR6\u003c/em\u003e/\u003cem\u003eORco Xenopus\u003c/em\u003e oocytes in responses to chemical compounds at 10\u003csup\u003e-4\u003c/sup\u003e M solution. (b) Response spectrum of \u003cem\u003eSlituOR6\u003c/em\u003e/\u003cem\u003eORco Xenopus\u003c/em\u003e oocytes. Different letters beside bars indicate statistically significant difference at \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05. Data represent mean ± SEM (n =6).\u003c/p\u003e","description":"","filename":"image4.png","url":"https://assets-eu.researchsquare.com/files/rs-5817533/v1/a26d56149c46598bb22d28e3.png"},{"id":73967992,"identity":"9701cff2-e06f-4f80-b10b-bbfe7df4509c","added_by":"auto","created_at":"2025-01-16 13:07:40","extension":"jpeg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":31971,"visible":true,"origin":"","legend":"\u003cp\u003eDosage-response of \u003cem\u003eSlituOR6\u003c/em\u003e/\u003cem\u003eSlituORco \u003c/em\u003eto the intra-specific sex pheromone component \u003cem\u003eE\u003c/em\u003e11-14:Ac. (a) \u003cem\u003eSlituOR6/ORco \u003c/em\u003eresponse to different dosages of \u003cem\u003eE\u003c/em\u003e11-14:Ac. (b) Dosage-response curve (n =4).\u003c/p\u003e","description":"","filename":"image5.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-5817533/v1/f5a1a388dddd367892200c36.jpeg"},{"id":73968935,"identity":"f876cd29-150a-42e7-ba50-586e8cc208e3","added_by":"auto","created_at":"2025-01-16 13:15:41","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":87754,"visible":true,"origin":"","legend":"\u003cp\u003eResponse of \u003cem\u003eSlituOR13\u003c/em\u003e/\u003cem\u003eSlituORco \u003c/em\u003eto inter- and intra-specific pheromone components. (a) Inward currents of \u003cem\u003eSlituOR13\u003c/em\u003e/\u003cem\u003eORco Xenopus\u003c/em\u003e oocytes in responses to chemical compounds at 10\u003csup\u003e-4\u003c/sup\u003e M solution. (b) Response spectrum of \u003cem\u003eSlituOR13\u003c/em\u003e/\u003cem\u003eORco Xenopus\u003c/em\u003e oocytes. Different letters beside bars indicate statistically significant difference at \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05(n =5).\u003c/p\u003e","description":"","filename":"image6.png","url":"https://assets-eu.researchsquare.com/files/rs-5817533/v1/f5bdfd2f733be66a62364fb8.png"},{"id":73968932,"identity":"a24436fa-9167-428c-9988-53d26f6da539","added_by":"auto","created_at":"2025-01-16 13:15:41","extension":"jpeg","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":44443,"visible":true,"origin":"","legend":"\u003cp\u003eDosage-response of \u003cem\u003eSlituOR13\u003c/em\u003e/\u003cem\u003eSlituORco \u003c/em\u003eto the intra-specific sex pheromone component \u003cem\u003eE\u003c/em\u003e11-14:Ac. (a-b) Responses and dose-response curves of \u003cem\u003eSlituOR13\u003c/em\u003e/\u003cem\u003eSlituORco\u003c/em\u003e to different doses of \u003cem\u003eE\u003c/em\u003e11-14:Ac. (n=4)\u003c/p\u003e","description":"","filename":"image7.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-5817533/v1/24e7e78c3b0ee2a8a635757c.jpeg"},{"id":73967998,"identity":"4031a473-0748-4561-89f2-3e5c95e5ff1d","added_by":"auto","created_at":"2025-01-16 13:07:41","extension":"jpeg","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":55680,"visible":true,"origin":"","legend":"\u003cp\u003eResponse of \u003cem\u003eSlituOR16\u003c/em\u003e/\u003cem\u003eSlituORco \u003c/em\u003eto inter- and intra-specific pheromone components. (a) Inward currents of \u003cem\u003eSlituOR16\u003c/em\u003e/\u003cem\u003eORco Xenopus\u003c/em\u003e oocytes in responses to chemical compounds at 10\u003csup\u003e-4\u003c/sup\u003e M solution. (b) Response spectrum of \u003cem\u003eSlituOR16\u003c/em\u003e/\u003cem\u003eORco Xenopus oocytes\u003c/em\u003e. Different letters beside bars indicate statistically significant difference at \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05(n=4).\u003c/p\u003e","description":"","filename":"image8.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-5817533/v1/38867ab7f5a00f36043a8597.jpeg"},{"id":73968005,"identity":"8fdfefee-308d-4e1c-be9a-db31ddad80fb","added_by":"auto","created_at":"2025-01-16 13:07:41","extension":"jpeg","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":45496,"visible":true,"origin":"","legend":"\u003cp\u003eDosage-response of \u003cem\u003eSlituOR16\u003c/em\u003e/\u003cem\u003eSlituORco \u003c/em\u003eto intra-specific sex pheromone of \u003cem\u003eE\u003c/em\u003e11-14:Ac. (a) Responses of \u003cem\u003eSlituOR16\u003c/em\u003e/\u003cem\u003eORco \u003c/em\u003eto \u003cem\u003eZ\u003c/em\u003e9-14:OH at different dosages. (b) Dosage-response curve (n=3).\u003c/p\u003e","description":"","filename":"image9.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-5817533/v1/6bde1c3894110eb0c0dacec6.jpeg"},{"id":73968933,"identity":"b370b20c-0616-4eee-ac1c-b591e5d25846","added_by":"auto","created_at":"2025-01-16 13:15:41","extension":"png","order_by":10,"title":"Figure 10","display":"","copyAsset":false,"role":"figure","size":479580,"visible":true,"origin":"","legend":"\u003cp\u003eFluorescence in situ hybridization of SlituOR16 in adult antennae of S. \u003cem\u003elitura\u003c/em\u003e. Longitudinal sections of male antennae. (A): Labelling using sense probe as a control. (B-F): antisense probe on consecutive sections of antenna. The nucleus of DAPI channel is blue, and positive expression is the corresponding fluorescein-labeled fluorescence. Hybridization fluorescence signals are indicated with arrows.\u003c/p\u003e","description":"","filename":"image10.png","url":"https://assets-eu.researchsquare.com/files/rs-5817533/v1/172e7da64e95ab4da5960228.png"},{"id":73968014,"identity":"56ace48f-2c0a-4dc9-befe-cd3e5861e739","added_by":"auto","created_at":"2025-01-16 13:07:41","extension":"jpeg","order_by":11,"title":"Figure 11","display":"","copyAsset":false,"role":"figure","size":245229,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of inter- and intra- specific sex pheromone on the attractiveness of \u003cem\u003eS. litura \u003c/em\u003esex pheromone in a tobacco field. PH = \u003cem\u003eZ\u003c/em\u003e9\u003cem\u003eE\u003c/em\u003e11-14:Ac and \u003cem\u003eZ\u003c/em\u003e9\u003cem\u003eE\u003c/em\u003e12-14:Ac in a ratio of 1000μg:100 μg. A, B in Guiyang, Chenzhou, Hunan, 2023), C. D: Z9-14:Ac and E11-14:Ac in a tobacco field .E,F: Z9-14:Ac and E11-14:Ac in the tobacco field in Xichang, Sichuan, 2023; G, H: Z9-14:Ac and E11-14:Ac in Napa cabbage field in Dongpo, Sichuan, 2023.\u003c/p\u003e\n\u003cp\u003eDifferent letters over bars indicate statistically significant difference at \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05.\u003c/p\u003e","description":"","filename":"image11.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-5817533/v1/e21336392742b3788893d776.jpeg"},{"id":77406326,"identity":"9e5d2ab0-4eff-4bb7-abc9-ccfdd19296d4","added_by":"auto","created_at":"2025-02-28 09:32:33","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2430698,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-5817533/v1/63b4940e-d190-421e-801b-caf21409ead1.pdf"}],"financialInterests":"","formattedTitle":"Olfactory responses of sex pheromone receptors in Spodoptera litura (Lepidoptera: Noctuidae) to inter- and intra-specific sex pheromone","fulltext":[{"header":"Introduction","content":"\u003cp\u003eInsects have developed a special olfactory system during their evolution, which enables them to screen and identify chemicals related to their living in the environment, and to complete a series of behavioral activities such as foraging, avoiding predators, calling, mating and oviposition (Chapman, 2003; Thompson \u0026amp; Pellmyr, 1991). The olfactory system is composed of a variety of chemical sensory genes expressed in the peripheral nervous system, including odorant receptors (ORs), taste receptors (GRs), ionophobic receptors (IRs) and odorant binding proteins (OBPs) (Han et al., 2023; Yang et al., 2024). ORs specifically designed to detect sex pheromone components are called pheromone receptors (PRs) (Fleischer et al., 2018; Gardiner et al., 2008; Leal, 2013). Sex pheromone receptors (PRs) belong to the OR family and have been the focus of research on the mechanism of sex pheromone recognition in recent years\u0026nbsp;(Hu et al., 2024; Yuvaraj et al., 2017). At present, the \u003cem\u003eXenopus\u003c/em\u003e oocyte expression-two electrode voltage clamp system (XOE-TEVC) has been widely used in the expression of receptor proteins such as PRs in insects (Cheikh et al., 2019). The PR gene was expressed \u003cem\u003ein vitro\u003c/em\u003e by micro-injection of DNA or RNA into \u003cem\u003eXenopus\u003c/em\u003e oocytes, while TEVC was used to record the current response caused by the receptor activated by different odor molecules\u0026nbsp;(Liu et al., 2013a; Zhang et al., 2023).\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eSpodoptera litura\u0026nbsp;\u003c/em\u003e(Fabricius) (Lepidoptera, Noctuidae) is a destructive insect pest that feeds on a variety of crops, such as soybean, cotton, corn, potato and tobacco. It is widely distributed in Asia, Oceania and India subcontinent (Dhivya et al., 2024; Islam et al., 2024). In recent years, with the production region expansion for soybean, corn and other crops that are preferred hosts of\u0026nbsp;\u003cem\u003eS. litura\u003c/em\u003e, and the favorable climate condition, the damage caused by\u0026nbsp;\u003cem\u003eS. litura\u003c/em\u003e has been increasing\u0026nbsp;(Hu et al., 2024).\u0026nbsp;\u003cem\u003eS. litura\u0026nbsp;\u003c/em\u003ehas a strong reproductive capacity, hidden habitat and resistance to many classes of chemical insecticides\u0026nbsp;(Anuradha et al., 2023). Insect sex pheromones are trace volatile chemicals produced and released by sexually mature females to attract the conspecific males for mating\u0026nbsp;(Zhang et al., 2024). Sex pheromone of\u0026nbsp;\u003cem\u003eS. litura\u0026nbsp;\u003c/em\u003ehas been identified as (\u003cem\u003ecis\u003c/em\u003e,\u0026nbsp;\u003cem\u003etrans\u003c/em\u003e)-9,12-tetradecadienyl acetate (\u003cem\u003eZ\u003c/em\u003e9\u003cem\u003eE\u003c/em\u003e12-14:Ac), (\u003cem\u003ecis\u003c/em\u003e,\u003cem\u003etrans\u003c/em\u003e)-9,11-tetradecadienyl acetate (\u003cem\u003eZ\u003c/em\u003e9\u003cem\u003eE\u003c/em\u003e11-14:Ac),\u0026nbsp;\u003cem\u003etrans\u003c/em\u003e-11-tetradecenyl acetate (\u003cem\u003eE\u003c/em\u003e11-14:Ac) and\u0026nbsp;\u003cem\u003ecis\u003c/em\u003e-9-tetradecenyl acetate (\u003cem\u003eZ\u003c/em\u003e9-14:Ac)\u0026nbsp;(Tamaki et al., 1973; Tamaki et al., 1976), with\u0026nbsp;\u003cem\u003eZ\u003c/em\u003e9\u003cem\u003eE\u003c/em\u003e11-14:Ac as the major component\u0026nbsp;(Sun et al., 2003). The absence of\u0026nbsp;\u003cem\u003eZ\u003c/em\u003e9\u003cem\u003eE\u003c/em\u003e12-14:Ac resulted in a lack of attractiveness\u0026nbsp;(Shen et al., 2009)\u0026nbsp;but the attractiveness of\u0026nbsp;\u003cem\u003eE\u003c/em\u003e11-14:Ac and\u0026nbsp;\u003cem\u003eZ\u003c/em\u003e9-14:Ac in the mixture was not prominent\u0026nbsp;(Sun et al., 2003; Sun et al., 2002).\u003c/p\u003e\n\u003cp\u003eResearch on olfactory recognition to inter-specific sex pheromones has been increasing in recent years, but has been limited to the closely related species. For example, \u003cem\u003eHeliothis virescens\u003c/em\u003e, \u003cem\u003eH. subflexa\u003c/em\u003e and \u003cem\u003eHelicoverpa zea\u003c/em\u003e females share the same major component\u0026nbsp;\u003cem\u003eZ\u003c/em\u003e11-16:Ald in their sex pheromones, while the minor components vary from species to species (Guo et al., 2022; Zielonka et al., 2018). In the wind tunnel study, the pheromone plume released by female moth interferes with the interspecific females to attract males in the conspecific species (Lelito et al., 2008). In the rice field,\u0026nbsp;\u003cem\u003eCnaphalocrocis medinalis\u003c/em\u003e can detect the sex pheromone not only from its conspecific species, but also from the inter-species\u0026nbsp;\u003cem\u003eChilo suppressalis\u003c/em\u003e and\u0026nbsp;\u003cem\u003eSesamia inferens\u003c/em\u003e (Cheng et al., 2023). Studies to date have shown that PR genes have some electro-physiological responses to interspecific sex pheromone components\u0026nbsp;(Chang et al., 2015; Wanner et al., 2010). Studies of PR genes in\u0026nbsp;\u003cem\u003eS. litura\u003c/em\u003e has been mainly focused on their functional identification to intra-specific sex pheromones\u0026nbsp;(Zhang et al., 2015).\u0026nbsp;\u003cem\u003eSlituOR1\u0026nbsp;\u003c/em\u003ehad differential expression in the population of\u0026nbsp;\u003cem\u003eS. litura\u003c/em\u003e caught by traps with different ratios of\u0026nbsp;\u003cem\u003eZ\u003c/em\u003e9,\u0026nbsp;\u003cem\u003eE\u003c/em\u003e11-14:Ac and\u0026nbsp;\u003cem\u003eZ\u003c/em\u003e9,\u0026nbsp;\u003cem\u003eE\u003c/em\u003e12-14:Ac in the sex pheromone mixture\u0026nbsp;(Zhang et al., 2017).\u0026nbsp;\u003cem\u003eSlituOR3\u0026nbsp;\u003c/em\u003eresponded to\u0026nbsp;\u003cem\u003eZ\u003c/em\u003e9,\u0026nbsp;\u003cem\u003eE\u003c/em\u003e11-14:Ac and\u0026nbsp;\u003cem\u003eZ\u003c/em\u003e9,\u0026nbsp;\u003cem\u003eE\u003c/em\u003e12-14:Ac\u0026nbsp;(Lin et al., 2015).\u0026nbsp;\u003cem\u003eSlituOR6\u0026nbsp;\u003c/em\u003ehad a specific response to\u0026nbsp;\u003cem\u003eZ\u003c/em\u003e9,\u0026nbsp;\u003cem\u003eE\u003c/em\u003e12-14:Ac, and\u0026nbsp;\u003cem\u003eSlituOR13\u0026nbsp;\u003c/em\u003ehad a weak response to\u0026nbsp;\u003cem\u003eZ\u003c/em\u003e9,\u0026nbsp;\u003cem\u003eE\u003c/em\u003e11-14:Ac or\u0026nbsp;\u003cem\u003eZ\u003c/em\u003e9-14:Ac, while\u0026nbsp;\u003cem\u003eSlituOR16\u0026nbsp;\u003c/em\u003ehad a specific response to\u0026nbsp;\u003cem\u003eZ\u003c/em\u003e9-14:OH\u0026nbsp;(Zhang et al., 2015; Zhang et al., 2023). However, there are few studies on the functional identification of PR genes in \u003cem\u003eS. litura\u003c/em\u003e for its inter-specific sex pheromones.\u003c/p\u003e\n\u003cp\u003eIn the habitat of tobacco crop, in addition to\u0026nbsp;\u003cem\u003eS. litura\u003c/em\u003e, there are other lepidopteran pests such as\u0026nbsp;\u003cem\u003eAgrotis ipsilon\u003c/em\u003e,\u0026nbsp;\u003cem\u003eH. armigera\u003c/em\u003e,\u0026nbsp;\u003cem\u003eH. assulta\u003c/em\u003e and\u0026nbsp;\u003cem\u003eS. exigua\u003c/em\u003e. Sex pheromone of\u0026nbsp;\u003cem\u003eA. ipsilon\u003c/em\u003e contains\u0026nbsp;\u003cem\u003ecis\u003c/em\u003e-7-dodecenyl acetate (\u003cem\u003eZ\u003c/em\u003e7-12:Ac),\u0026nbsp;\u003cem\u003ecis\u003c/em\u003e-9-tetradecenyl acetate (\u003cem\u003eZ\u003c/em\u003e9-14:Ac) and\u0026nbsp;\u003cem\u003ecis\u003c/em\u003e-11-hexadecenyl acetate (\u003cem\u003eZ\u003c/em\u003e11-16:Ac) (Du et al., 2015; Gemeno et al., 2000; Picimbon et al., 1997). Sex pheromone of\u0026nbsp;\u003cem\u003eH. assulta\u003c/em\u003e consists of\u0026nbsp;\u003cem\u003ecis\u003c/em\u003e-9-hexadecenal (\u003cem\u003eZ\u003c/em\u003e9-16:Ald),\u0026nbsp;\u003cem\u003ecis\u003c/em\u003e-11-hexadecenal (\u003cem\u003eZ\u003c/em\u003e11-16:Ald) and\u0026nbsp;\u003cem\u003ecis\u003c/em\u003e-9-hexadecenyl acetate (\u003cem\u003eZ\u003c/em\u003e9-16:Ac)\u0026nbsp;(Boo et al., 1995; Cork et al., 1992; Sugie et al., 1991). Sex pheromone of\u0026nbsp;\u003cem\u003eH. armigera\u003c/em\u003e comprises\u0026nbsp;\u003cem\u003eZ\u003c/em\u003e11-16:Ald,\u0026nbsp;\u003cem\u003eZ\u003c/em\u003e9-16:Ald, hexadecanal (16:Ald) and\u0026nbsp;\u003cem\u003ecis\u003c/em\u003e-9-tetradecenal (Z9-14:Ald)\u0026nbsp;(Dunkelblum et al., 1980; Gao et al., 2020; Zhang et al., 2012), whereas sex pheromone of\u0026nbsp;\u003cem\u003eS. exigua\u003c/em\u003e is composed of\u0026nbsp;\u003cem\u003eZ\u003c/em\u003e9\u003cem\u003eE\u003c/em\u003e12-14:Ac,\u0026nbsp;\u003cem\u003eZ\u003c/em\u003e9-14:Ac,\u0026nbsp;\u003cem\u003ecis\u003c/em\u003e-11-hexadecenyl acetate (\u003cem\u003eZ\u003c/em\u003e11-16:Ac) and\u0026nbsp;\u003cem\u003ecis\u003c/em\u003e-9-tetradecenol (\u003cem\u003eZ\u003c/em\u003e9-14:OH)\u0026nbsp;(Ac\u0026iacute;n et al., 2010; Mochizuki et al., 1993; Persoons et al., 1981; Tumlinson et al., 1990; Wakamura, 1987).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe present study focused on three PRs of\u0026nbsp;\u003cem\u003eS. litura\u003c/em\u003e males and construction of their expression vectors, used the XOE-TEVC system to determine the current responses of the three PRs to the sex pheromone of\u0026nbsp;\u003cem\u003eS. litura\u0026nbsp;\u003c/em\u003eand the inter-specific sex pheromones of\u0026nbsp;\u003cem\u003eA. ipsilon\u003c/em\u003e,\u0026nbsp;\u003cem\u003eH. assulta\u003c/em\u003e,\u0026nbsp;\u003cem\u003eH. armigera\u0026nbsp;\u003c/em\u003eand\u0026nbsp;\u003cem\u003eS. exigua\u0026nbsp;\u003c/em\u003efemales. This study may help develop efficient sex pheromone-based technology to control these pests.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cdiv id=\"Sec2\" class=\"Section2\"\u003e \u003ch2\u003e1.1 Insects\u003c/h2\u003e \u003cp\u003e \u003cem\u003eS. litura\u003c/em\u003e were reared on artificial diet in the lab, with temperature at 25\u0026thinsp;\u0026plusmn;\u0026thinsp;1℃, relative humidity at 65\u0026thinsp;\u0026plusmn;\u0026thinsp;5%, and under conditions of photoperiod 14 h light:10 h dark. After eclosion, adults were fed with 10% glucose. Antennae, head, thorax, abdomen, legs and wings of 3-day-old males were isolated for gene cloning or qPCR analysis.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e1.2 RNA extraction and cDNA synthesis\u003c/h2\u003e \u003cp\u003eTRIzol reagent and the PureLink\u0026trade; RNA Mini Kit (Invitrogen, USA) were used to extract the total RNA from each of the isolated \u003cem\u003eS. litura\u003c/em\u003e body parts according to the manufacturer\u0026rsquo;s protocol. The concentration and purity of RNA were verified by NanoDrop-2000 (Thermo Scientific, Waltham, MA, USA). Single-stranded cDNA templates were obtained from total RNA from the \u003cem\u003eS. litura\u003c/em\u003e male antennae using SuperScript\u0026trade; VILO\u0026trade; cDNA (Invitrogen, USA). The prepared cDNA template was stored at \u0026minus;\u0026thinsp;20\u0026deg;C before it was used.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003e1.3 Transcriptome sequencing and sequence analysis\u003c/h2\u003e \u003cp\u003eThe extracted RNA samples of \u003cem\u003eS. litura\u003c/em\u003e body parts were processed by Tianjin Novogene Bioinformatics Technology Co., Ltd. for eukaryotic transcriptome analysis and sequencing without reference genome. The specific cDNA library with quality assurance was obtained by PCR enrichment. The second-generation sequencing technique was used for sequencing, and the sequencing data was merged and assembled using the Trinity software to obtain the Unigene library of the species.\u003c/p\u003e \u003cp\u003eThe PR and ORco genes with their full-length obtained by the transcriptome sequencing were subjected to blast and analyzed for homology on the NCBI website. The DNAMAN software was used for the sequence analysis, and the online software Clustal Omega (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.ebi.ac.uk/Tools/msa/clustalo/\u003c/span\u003e\u003cspan address=\"https://www.ebi.ac.uk/Tools/msa/clustalo/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) was used for multiple sequence alignments with other Lepidoptera OR genes. Finally, MEGA 7.0 was used to construct a phylogenetic tree.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003e1.4 Quantitative real time PCR\u003c/h2\u003e \u003cp\u003eThe PR genes of \u003cem\u003eS. litura\u003c/em\u003e were screened and obtained from the differentially expressed genes. Quantitative real-time PCR (qPCR) was used to detect the sex expression profiles of the four PRs genes. Specific primers were designed using Premier 6.0 software. The primers were synthesized by Hangzhou Youkang Biotechnology Co., Ltd (Hangzhou, China).\u003c/p\u003e \u003cp\u003eAs we previously described (Cheng et al., \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2023\u003c/span\u003e), the qPCR was performed with a TB Green Premix Ex Taq II (TaKaRa, Japan) and CFX connect real-time system (Bio-Rad, USA) in 25 \u0026micro;L reactions containing 12.5 \u0026micro;L of TB Green Premix Ex Taq II, 0.5 \u0026micro;L of forward and reverse primers (10 \u0026micro;mol/L), 1 \u0026micro;L of cDNA template, and 10.5 \u0026micro;L of nuclease-free water. The thermal cycling procedures were as follows: 95\u0026deg;C for 30 s, 39 cycles of 95\u0026deg;C for 5 s, 60\u0026deg;C for 30 s. The \u003cem\u003eSlituGAPDH\u003c/em\u003e and \u003cem\u003eSlituEF\u003c/em\u003e genes were used as the reference genes to standardize the target gene expression. The experiment was replicated three times using three independent RNA samples. The relative gene expression levels were calculated using the relative 2\u003csup\u003e\u0026minus;ΔΔCT\u003c/sup\u003e quantitation method.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003e1.5 Gene cloning for sequence verification\u003c/h2\u003e \u003cp\u003eThe four OR genes (\u003cem\u003eSlituOR6\u003c/em\u003e, \u003cem\u003eSlituOR13\u003c/em\u003e, \u003cem\u003eSlituOR16\u003c/em\u003e and \u003cem\u003eSlituORco\u003c/em\u003e) were cloned with specific primers (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e) designed by the Hangzhou Youkang Biotechnology Co., Ltd. The amplification was performed with NEB's Phusion\u0026reg; high-fidelity DNA polymerase. The PCR was performed in 50 \u0026micro;L containing 10 \u0026micro;L of buffer, 2.5 \u0026micro;L of forward and reverse primers (10 \u0026micro;mol/L), 1 \u0026micro;L of cDNA template, 1 \u0026micro;L of dNTPs substrate (10 \u0026micro;mol/L), 1.5 \u0026micro;L of DMSO, 0.5 \u0026micro;L of DNA polymerase and 31 \u0026micro;L of RNase-free water. The reaction procedure was carried out according to the kit instruction. PCR products were run on a 1.2% agarose gel, and the target bands were purified by GeneJET Gel Extraction and DNA Cleanup Micro Kit (ThermoFisher Scientific, USA). Recovered product from the PCR amplification gel was utilized and ligated to the cloning vector pEASY-Blunt Zero, followed by transformation. Finally, the positive clones were sequenced by the Hangzhou Youkang Biotechnology Co., Ltd.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimer sequences for S. \u003cem\u003elitura\u003c/em\u003e gene cloning\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"2\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePrimer names\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePrimer sequences (5\u0026acute;\u0026rarr;3\u0026acute;)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSlitu-OR6-F1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eATGGGTTTAAAAAAGTTTCT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSlitu-OR6-R1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTCAAATGCTGCGTAAGA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSlitu-OR13-F1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eATGGATATAAAATTGTCATC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSlitu-OR13-R1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTTATTCTTCCTCATCGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSlitu-OR16-F1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eATGAACCTCAAAAAATTCCTT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSlitu-OR16-R1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTCACATGCTTCGTAAGAA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSlitu-ORco-F1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eATGATGACCAAAGTGAAAGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSlitu-ORco-R1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTTACTTCAGCTGTACCAACAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003e1.6 Vector construction and cRNA synthesis\u003c/h2\u003e \u003cp\u003eFull-length ORFs of the three candidate PR genes (\u003cem\u003eSlituOR6\u003c/em\u003e, \u003cem\u003eSlituOR13\u003c/em\u003e and \u003cem\u003eSlituOR16\u003c/em\u003e) and Orco genes were amplified using NEB's Phusion\u0026reg; high-fidelity DNA polymerase and gene-specific primers (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). The product was then ligated onto the EcoRV-digested \u003cem\u003ePT7Ts\u003c/em\u003e vector. The constructed vector genes were subjected to plasmid extraction, linearized by SacI digestion, and cRNAs were synthesized using the linearized and purified plasmid as a template by the MESSAGE mMACHINE T7 kit (Ambion, USA). The cRNAs were diluted to 2 \u0026micro;g/\u0026micro;L and stored at -80\u0026deg;C.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimer sequences for the receptor vector construction of S. \u003cem\u003elitura\u003c/em\u003e\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"2\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePrimer names\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePrimer sequences (5\u0026acute;\u0026rarr;3\u0026acute;)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSlitu-OR6-F1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTTTGGCAGATCTGATCGCCACCATGGGTTTAAAAAAGTTTCT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSlitu-OR6-R1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGGGCCCACTAGTGATTCAAATGCTGCGTAAGA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSlitu-OR13-F1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTTTGGCAGATCTGATCGCCACCATGGATATAAAATTGTCATC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSlitu-OR13-R1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGGGCCCACTAGTGATTTATTCTTCCTCATCGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSlitu-OR16-F1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTTTGGCAGATCTGATCGCCACCATGAACCTCAAAAAATTCCT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSlitu-OR16-R1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGGGCCCACTAGTGATTCACATGCTTCGTAAGAA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSlitu-ORco-F1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTTTGGCAGATCTGATCGCCACCATGATGACCAAAGTGAAAGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSlitu-ORco-R1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGGGCCCACTAGTGATTTACTTCAGCTGTACCAACAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003e1.7 PR expression in \u003cem\u003eXenopus\u003c/em\u003e oocytes and electro-physiological recordings\u003c/h2\u003e \u003cp\u003eThe treatment, micro-injection and culture of \u003cem\u003eXenopus\u003c/em\u003e oocytes were the same as we previously reported (Cheng et al., \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). After co-injection of OR/Orco cRNAs, the \u003cem\u003eXenopus\u003c/em\u003e oocytes were cultured at 16\u0026deg;C for 3 to 6 days, then were used for ligand sensitivity measurement with the two electrode voltage clamps (OC-725C; Warner Instruments, Hamden, CT, USA). A total of 21 chemical compounds (Ningbo Newcon Inc., China, with a purity of \u0026gt;\u0026thinsp;93%) were tested in this experiment. All compounds were dissolved in dimethyl sulfoxide (DMSO) and prepared as 1 mol/L stock solution. The stock solution was diluted with 1\u0026times; Ringer. The cell currents induced by odors were recorded with TEVC, Digidata 1550B, and pClamp10.0 at a holding potential of \u0026minus;\u0026thinsp;80 mV. Oocytes were stimulated with each of the compounds at 1\u0026times; 10\u003csup\u003e\u0026minus;\u0026thinsp;4\u003c/sup\u003e mol/L for 15 s in a random order, and the next stimulation was performed after the current returned to the baseline. Oocytes were stimulated with only one compound at concentrations from10\u003csup\u003e\u0026minus;\u0026thinsp;7\u003c/sup\u003e to 10\u003csup\u003e\u0026minus;\u0026thinsp;3\u003c/sup\u003e mol/L to obtain a dosage-response curve. For each chemical compound, oocytes were tested in the screening assays and in the dosage\u0026thinsp;\u0026minus;\u0026thinsp;response assays. All experiments were replicated three times on different oocytes.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003e1.8 Fluorescence in Situ Hybridization\u003c/h2\u003e \u003cp\u003eSweAMI-DAB chromogenic in situ hybridization experiments were carried out to determine the expression pattern of OR16 in the antennae of S. \u003cem\u003elitura\u003c/em\u003e. First, the SweAMI technique was used, and the tail-processed specific oligonucleotides were used as probes. The probes were synthesized by Yuanmu Biotechnology (Shanghai, China). The antennae of \u003cem\u003eS. litura\u003c/em\u003e were fixed in 4% paraformaldehyde fixative at 4\u0026deg;C for more than 24 h. The antennae were dehydrated and embedded in paraffin, sliced into 4 \u0026micro;m sections with a microtome, and then oven-baked for 2h at 62\u0026deg;C℃. The sections were de-paraffined and placed in a citric acid (pH\u0026thinsp;=\u0026thinsp;6.0) repair box in a water bath 90\u0026deg;C for 48 min. After natural cooling, proteinase K (20 ug/mL) was added and then digested at 37\u0026deg;C. After washed with pure water, the slices were washed three times with PBS for 5 min each time. Endogenous peroxidase was inactivated by incubation in 3% methanol-H2O2 for 15 min. The pre-hybridization solution was added and incubated for 1 h at 37\u0026deg;C. After removing the pre-hybridization solution, probe hybridization solution was added and hybridization was performed overnight at 42\u0026deg;C in a constant temperature and humidity chamber. Slides were then washed in 2\u0026times; SSC at 37\u0026deg;C for 10 min, 1\u0026times; SSC at 37\u0026deg;C twice for 5 min each, and 0.5\u0026times; SSC at room temperature for 10 min. The slices were then rinsed sequentially with different concentrations of PBS buffer. The hybridization solution containing the signal probe was added, incubated at 42\u0026deg; for 3h, and again washed multiple times with different gradients of SSC. DAPI staining solution was dropped onto the slices, and the slices were incubated in the dark for 8min. After washing, anti-fluorescence quenching sealing agent was added to seal the slices, the sections were placed under a Nikon inverted fluorescence microscope and the images were taken.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003e1.9 Field experiments\u003c/h2\u003e \u003cp\u003eFunction of the above electro-physiologically active compounds was verified in the field trapping experiment. Each compound at different dosages was added to the binary blend of \u003cem\u003eS. litura\u003c/em\u003e sex pheromone to formulate a series of mixtures and the number of moth catches by each mixture was then determined. Field experiment was conducted in 2023 in tobacco fields in Guiyang and Chenzhou, Hunan Province and Xichang, Sichuan Province, and in Napa cabbage fields in Dongpo, Sichuan Province. \u003cem\u003eHeliothis\u003c/em\u003e trap (NewCon Inc., Ningbo, China) was used in the field at a height of about 1 m. \u003cem\u003eS. litura\u003c/em\u003e sex pheromone lure was a PVC tubing (Length 80 mm, outer diameter 1.1 mm, inner diameter 0.6 mm) containing the binary blend of \u003cem\u003eZ\u003c/em\u003e9\u003cem\u003eE\u003c/em\u003e11-14:Ac and \u003cem\u003eZ\u003c/em\u003e9\u003cem\u003eE\u003c/em\u003e12-14:Ac in a ratio of 1000\u0026micro;g:100 \u0026micro;g. Lures were sealed in aluminum foil bags, stored in -20 ℃ freezer and shipped by courier to test locations when needed. The inter-specific sex pheromones were added into the binary blend of \u003cem\u003eZ\u003c/em\u003e9\u003cem\u003eE\u003c/em\u003e11-14:Ac and \u003cem\u003eZ\u003c/em\u003e9\u003cem\u003eE\u003c/em\u003e12-14:Ac at dosages of 6.25\u0026micro;g, 12.5\u0026micro;g, 25\u0026micro;g, 50\u0026micro;g, 75\u0026micro;g and 100\u0026micro;g. The intra-specific minor sex pheromone component Z9-14:Ac and E11-14:Ac were added into the binary blend at dosages of 10\u0026micro;g, 30\u0026micro;g, 90\u0026micro;g, 270\u0026micro;g and 510\u0026micro;g.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003e1.10 Statistical analysis\u003c/h2\u003e \u003cp\u003eSPSS 23.0 (SPSS Inc., Chicago, IL, USA) was used for the statistical analysis. MEGA 7.0 was used to construct a phylogenetic tree. Independent sample t-test was used for fluorescence quantitative PCR. GraphPad Prism 8.0 (GraphPad Software Inc. San Diego, CA, USA) was used to analyze the obtained curves. Data from field trapping tests were analysed with the one-way ANOVA and the treatment means were separated and compared by the Student\u0026rsquo;s t-test.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003e2.1 Cloning and phylogenetic tree analysis of PR genes of \u003cem\u003eS. litura\u003c/em\u003e\u003c/h2\u003e \u003cp\u003e \u003cem\u003eSlituOR6\u003c/em\u003e, \u003cem\u003eSlituOR11\u003c/em\u003e, \u003cem\u003eSlituOR13\u003c/em\u003e and \u003cem\u003eSlituOR16\u003c/em\u003e had 1299 (encoding 433 amino acids), 1308 (encoding 436 amino acids), 1302 (encoding 434 amino acids) and 1299 bases (encoding 433 amino acids), respectively (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). \u003cem\u003eSlituOR6\u003c/em\u003e had 43.60%, 37.53% and 58.20% similarity with \u003cem\u003eSlituOR11\u003c/em\u003e, \u003cem\u003eSlituOR13\u003c/em\u003e and \u003cem\u003eSlituOR16\u003c/em\u003e, respectively, while \u003cem\u003eSlituOR13\u003c/em\u003e had 37.53%, 40.00%, and 39.55% similarity with \u003cem\u003eSlituOR6\u003c/em\u003e, \u003cem\u003eSlituOR11\u003c/em\u003e and \u003cem\u003eSlituOR16\u003c/em\u003e, respectively (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThe amino acid sequences of ORs of Noctuidae insects such as \u003cem\u003eMythimna separata\u003c/em\u003e, \u003cem\u003eH. armigera\u003c/em\u003e, \u003cem\u003eS, frugiperda\u003c/em\u003e and the model insect \u003cem\u003eBombyx mori\u003c/em\u003e were obtained by NCBI (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://archive-dtd.ncbi.nlm.nih\u003c/span\u003e\u003cspan address=\"https://archive-dtd.ncbi.nlm.nih\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. gov/) and the evolutionary tree was constructed. Results showed that \u003cem\u003eSlituOR6\u003c/em\u003e had the highest homology with \u003cem\u003eSlituR6\u003c/em\u003e and clustered in the same evolutionary branch with \u003cem\u003eSfruOR6\u003c/em\u003e and \u003cem\u003eSexiOR6\u003c/em\u003e; \u003cem\u003eSlituOR11\u003c/em\u003e had the highest homology with \u003cem\u003eSlittOR11\u003c/em\u003e and clustered in the same evolutionary branch with \u003cem\u003eSexiOR11\u003c/em\u003e; \u003cem\u003eSlituOR13\u003c/em\u003e had the highest homology with \u003cem\u003eSlittOR13\u003c/em\u003e and clustered in the same evolutionary branch with \u003cem\u003eSexiOR13\u003c/em\u003e, and \u003cem\u003eSlituOR16\u003c/em\u003e had the highest homology with \u003cem\u003eSlittOR16\u003c/em\u003e and clustered in the same evolutionary branch with \u003cem\u003eSexiOR16\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003e2.2 Expression pattern of PR genes in male \u003cem\u003eS. litura\u003c/em\u003e\u003c/h2\u003e \u003cp\u003eThe expression profiles of sex pheromone receptor genes \u003cem\u003eSlituOR6\u003c/em\u003e, \u003cem\u003eSlituOR11\u003c/em\u003e, \u003cem\u003eSlituOR13\u003c/em\u003e and \u003cem\u003eSlituOR16\u003c/em\u003e in the wings, head, thorax, abdomen, leg and antennae of male \u003cem\u003eS. litura\u003c/em\u003e were shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e. Each of the genes were significantly expressed in the antennae of \u003cem\u003eS. litura\u003c/em\u003e compared to the other body parts (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003e2.3 Functional characterization of three candidate PRs in \u003cem\u003eS. litura\u003c/em\u003e\u003c/h2\u003e \u003cp\u003eResults showed that at a concentration of 10\u003csup\u003e\u0026minus;\u0026thinsp;4\u003c/sup\u003e M, the \u003cem\u003eSlituOR6\u003c/em\u003e gene had the greatest response to the minor sex pheromone component \u003cem\u003eE\u003c/em\u003e11-14:Ac of \u003cem\u003eS. litura\u003c/em\u003e and the inter-specific sex pheromone components 16:Ac and \u003cem\u003eZ\u003c/em\u003e9-14:Ac, respectively, with no obvious response to other compounds (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e). The dose-response curve indicated a maximum response of 260\u0026thinsp;\u0026plusmn;\u0026thinsp;130 nA to \u003cem\u003eE\u003c/em\u003e11-14:Ac, highlighting the high sensitivity to it (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eAt a concentration of 10\u003csup\u003e\u0026minus;\u0026thinsp;4\u003c/sup\u003e M, the \u003cem\u003eSlituOR13\u003c/em\u003e had the greatest response to the minor sex pheromone component \u003cem\u003eE\u003c/em\u003e11-14:Ac of \u003cem\u003eS. litura\u003c/em\u003e and the inter-specific sex pheromone component \u003cem\u003eZ\u003c/em\u003e9-14:Ac, with no obvious response to the other compounds (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e). When the concentration of \u003cem\u003eE\u003c/em\u003e11-14:Ac was as low as 10\u003csup\u003e\u0026minus;\u0026thinsp;7\u003c/sup\u003e M, \u003cem\u003eSlituOR13\u003c/em\u003e had a responsive current of 50\u0026thinsp;\u0026plusmn;\u0026thinsp;20 nA. As the concentration increased to 10\u003csup\u003e\u0026minus;\u0026thinsp;4\u003c/sup\u003e M, \u003cem\u003eSlituOR13\u003c/em\u003e had the strongest response at 260\u0026thinsp;\u0026plusmn;\u0026thinsp;130 nA (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eResponses of \u003cem\u003eSlituOR16\u003c/em\u003e gene to the compounds at a concentration of 10\u003csup\u003e\u0026minus;\u0026thinsp;4\u003c/sup\u003e M were shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003e. \u003cem\u003eSlituOR16\u003c/em\u003e gene had a relatively strongest response to the \u003cem\u003eS. litura\u003c/em\u003e behavioral antagonist \u003cem\u003eZ\u003c/em\u003e9-14:OH, with the current 160\u0026thinsp;\u0026plusmn;\u0026thinsp;70 nA. It also had a certain responses to the intraspecific sex pheromone component \u003cem\u003eZ\u003c/em\u003e9-14:Ac, \u003cem\u003eZ\u003c/em\u003e9\u003cem\u003eE\u003c/em\u003e11-14:Ac and \u003cem\u003eZ\u003c/em\u003e9\u003cem\u003eE\u003c/em\u003e12-14:Ac, and the interspecific sex pheromone component \u003cem\u003eZ\u003c/em\u003e7-12:Ac of \u003cem\u003eS. litura\u003c/em\u003e, with a current 80\u0026thinsp;\u0026plusmn;\u0026thinsp;15nA, 100\u0026thinsp;\u0026plusmn;\u0026thinsp;20nA, 85\u0026thinsp;\u0026plusmn;\u0026thinsp;10nA and 85\u0026thinsp;\u0026plusmn;\u0026thinsp;15nA, respectively. It had a weak response to the minor pheromone component \u003cem\u003eE\u003c/em\u003e11-14:Ac of \u003cem\u003eS. litura\u003c/em\u003e, with a current 70\u0026thinsp;\u0026plusmn;\u0026thinsp;3nA and no obvious response was detected for the other compounds.\u003c/p\u003e \u003cp\u003eDosage-responses of \u003cem\u003eSlituOR16\u003c/em\u003e /Orco to \u003cem\u003eZ\u003c/em\u003e9-14:OH were shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003e. When the concentration was at 10\u003csup\u003e\u0026minus;\u0026thinsp;7\u003c/sup\u003e M, \u003cem\u003eSlituOR16\u003c/em\u003e responded with a current 50\u0026thinsp;\u0026plusmn;\u0026thinsp;20 nA. As the concentration increased, the response increased gradually, and when the concentration increased to 10\u003csup\u003e\u0026minus;\u0026thinsp;3\u003c/sup\u003e mol/L, the response reached 225\u0026thinsp;\u0026plusmn;\u0026thinsp;20 nA.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003e2.4 Fluorescence in situ hybridization of OR16 in antennae\u003c/h2\u003e \u003cp\u003eThe results showed that OR16 labeled with the antisense probe was expressed below the long sensilla trichodea, short sensilla trichodea and sensilla basiconica (Figs.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e10\u003c/span\u003eB-F), whereas OR16 expression was absent in antennae hybridized with the sense probe in the control group (Fig.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e10\u003c/span\u003eA). This suggest that OR16 was consistent with the olfactory function of the sensilla and may be involved in the process of sex pheromone recognition.\u003c/p\u003e \u003cp\u003e \u003cb\u003e2.5 The effect of inter- and intra-specific sex pheromone on the attractiveness of\u003c/b\u003e \u003cb\u003eS. litura\u003c/b\u003e \u003cb\u003esex pheromone\u003c/b\u003e\u003c/p\u003e \u003cp\u003eIn the Guiyang tobacco field, results showed that attractiveness of the binary blend of \u003cem\u003eS. litura\u003c/em\u003e sex pheromone was dramatically inhibited by either \u003cem\u003eZ\u003c/em\u003e7-12:Ac (\u003cem\u003eF\u003c/em\u003e\u0026thinsp;=\u0026thinsp;31.166, \u003cem\u003edf\u003c/em\u003e\u0026thinsp;=\u0026thinsp;35, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001) ( Fig.\u0026nbsp;\u003cspan refid=\"Fig11\" class=\"InternalRef\"\u003e11\u003c/span\u003eA) or \u003cem\u003eZ\u003c/em\u003e9-14:OH (\u003cem\u003eF\u003c/em\u003e\u0026thinsp;=\u0026thinsp;20.857, \u003cem\u003edf\u003c/em\u003e\u0026thinsp;=\u0026thinsp;35, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001) (Fig.\u0026nbsp;\u003cspan refid=\"Fig11\" class=\"InternalRef\"\u003e11\u003c/span\u003eB) at all the dosages tested. \u003cem\u003eZ\u003c/em\u003e9-14:Ac and \u003cem\u003eE\u003c/em\u003e11-14:Ac are minor components of \u003cem\u003eS. litura\u003c/em\u003e, but the effect of these two compounds varied depending on geographical locations. In the Guiyang tobacco field, the number of moths trapped by the sex pheromone mixture with \u003cem\u003eZ\u003c/em\u003e9-14:Ac was also reduced (\u003cem\u003eF\u003c/em\u003e\u0026thinsp;=\u0026thinsp;5.461, \u003cem\u003edf\u003c/em\u003e\u0026thinsp;=\u0026thinsp;25, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.003) (Fig.\u0026nbsp;\u003cspan refid=\"Fig11\" class=\"InternalRef\"\u003e11\u003c/span\u003eC) but \u003cem\u003eE\u003c/em\u003e11-14:Ac has no effect (\u003cem\u003eF\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.676, \u003cem\u003edf\u003c/em\u003e\u0026thinsp;=\u0026thinsp;35, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.645) (Fig.\u0026nbsp;\u003cspan refid=\"Fig11\" class=\"InternalRef\"\u003e11\u003c/span\u003eD). However, in Xichang of Sichuan, \u003cem\u003eZ\u003c/em\u003e9-14:Ac has a significant synergistic effect at trace amounts (\u003cem\u003eF\u003c/em\u003e\u0026thinsp;=\u0026thinsp;3.625, \u003cem\u003edf\u003c/em\u003e\u0026thinsp;=\u0026thinsp;29, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.014) (Fig.\u0026nbsp;\u003cspan refid=\"Fig11\" class=\"InternalRef\"\u003e11\u003c/span\u003eE), but not in Dongpo (\u003cem\u003eF\u003c/em\u003e\u0026thinsp;=\u0026thinsp;1.862,\u003cem\u003edf\u003c/em\u003e\u0026thinsp;=\u0026thinsp;29,\u003cem\u003eP\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.139) (Fig.\u0026nbsp;\u003cspan refid=\"Fig11\" class=\"InternalRef\"\u003e11\u003c/span\u003eG). \u003cem\u003eE\u003c/em\u003e11-14: Ac has significant enhancement in Dongpo (\u003cem\u003eF\u003c/em\u003e\u0026thinsp;=\u0026thinsp;2.958, \u003cem\u003edf\u003c/em\u003e\u0026thinsp;=\u0026thinsp;29, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.032) and Xichang (\u003cem\u003eF\u003c/em\u003e\u0026thinsp;=\u0026thinsp;6.706, \u003cem\u003edf\u003c/em\u003e\u0026thinsp;=\u0026thinsp;29, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001), Sichuan. Following compounds tested in the sex pheromone blends had no significant impact on the attractiveness: \u003cem\u003eZ\u003c/em\u003e11-14:Ac (\u003cem\u003eF\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.666, \u003cem\u003edf\u003c/em\u003e\u0026thinsp;=\u0026thinsp;35, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.652), \u003cem\u003eZ\u003c/em\u003e11-16:OH (\u003cem\u003eF\u003c/em\u003e\u0026thinsp;=\u0026thinsp;2.086, \u003cem\u003edf\u003c/em\u003e\u0026thinsp;=\u0026thinsp;35, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.095), \u003cem\u003eZ\u003c/em\u003e9-16:Ald (\u003cem\u003eF\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.595, \u003cem\u003edf\u003c/em\u003e\u0026thinsp;=\u0026thinsp;35, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.704), \u003cem\u003eZ\u003c/em\u003e11-16:Ac (\u003cem\u003eF\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.964, \u003cem\u003edf\u003c/em\u003e\u0026thinsp;=\u0026thinsp;35, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.455), \u003cem\u003eZ\u003c/em\u003e11-16:Ald (\u003cem\u003eF\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.435, \u003cem\u003edf\u003c/em\u003e\u0026thinsp;=\u0026thinsp;35, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.821), 14:Ac (\u003cem\u003eF\u003c/em\u003e\u0026thinsp;=\u0026thinsp;1.806, \u003cem\u003edf\u003c/em\u003e\u0026thinsp;=\u0026thinsp;35, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.142), \u003cem\u003eE\u003c/em\u003e9-14:Ac (\u003cem\u003eF\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.789, \u003cem\u003edf\u003c/em\u003e\u0026thinsp;=\u0026thinsp;25, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.543) and \u003cem\u003eZ\u003c/em\u003e9-12:Ac (\u003cem\u003eF\u003c/em\u003e\u0026thinsp;=\u0026thinsp;1.449, \u003cem\u003edf\u003c/em\u003e\u0026thinsp;=\u0026thinsp;35, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.236).\u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eGreater expression in \u003cem\u003eS. litura\u003c/em\u003e adult antennae implies importance of the OR in olfaction. In this study, the greater expression of four PRs (\u003cem\u003eSlituOR6\u003c/em\u003e, \u003cem\u003eSlituOR11\u003c/em\u003e, \u003cem\u003eSlituOR13\u003c/em\u003e and \u003cem\u003eSlituOR16\u003c/em\u003e) in the antennae was confirmed by qPCR, suggesting the antennae may play an important role in insect sex pheromone perception. For the function, we defined the current responses of \u003cem\u003eSlituOR6\u003c/em\u003e, \u003cem\u003eSlituOR13\u003c/em\u003e, and \u003cem\u003eSlituOR16\u003c/em\u003e to 21 sex pheromone components by XOE-TEVC to clarify their functions. The results showed that SlituOR6 responded to the secondary sex pheromone components \u003cem\u003eE\u003c/em\u003e11-14:Ac and \u003cem\u003eZ\u003c/em\u003e9-14:Ac, and also responded to the interspecific sex pheromone component 16:Ac. \u003cem\u003eSlituOR13\u003c/em\u003e responded to the minor sex pheromone components \u003cem\u003eE\u003c/em\u003e11-14:Ac and \u003cem\u003eZ\u003c/em\u003e9-14:Ac, and no response to other sex pheromones and interspecific sex pheromones. SlituOR16 showed a strong current response to interspecific sex pheromones \u003cem\u003eZ\u003c/em\u003e9-14:OH and \u003cem\u003eZ\u003c/em\u003e7-12:Ac, and a certain response to intraspecific sex pheromones \u003cem\u003eZ\u003c/em\u003e9-14:Ac, \u003cem\u003eZ\u003c/em\u003e9\u003cem\u003eE\u003c/em\u003e11-14:Ac, \u003cem\u003eZ\u003c/em\u003e9\u003cem\u003eE\u003c/em\u003e12-14:Ac and \u003cem\u003eE\u003c/em\u003e11-14:Ac. It is concluded that \u003cem\u003eSlituOR13\u003c/em\u003e may only be responsible for the recognition of intra-specific sex pheromones, while \u003cem\u003eSlituOR6\u003c/em\u003e and \u003cem\u003eSlituOR16\u003c/em\u003e can recognize both intra-specific and inter-specific sex pheromones.\u003c/p\u003e \u003cp\u003e \u003cem\u003eS. exigua\u003c/em\u003e, \u003cem\u003eS. frugiperda\u003c/em\u003e and \u003cem\u003eS. litura\u003c/em\u003e are closely related species that have common host plants and can be found in the same habitat, such as corns. Numerous reports showed that closely related species shared the same sex pheromone component (Yan et al., \u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Yang et al., \u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e2009\u003c/span\u003e; Zielonka et al., \u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). \u003cem\u003eZ\u003c/em\u003e9\u003cem\u003eE\u003c/em\u003e12-14:Ac and \u003cem\u003eZ\u003c/em\u003e9-14:Ac are the major sex pheromone components of \u003cem\u003eS. exigua\u003c/em\u003e, whereas \u003cem\u003eZ\u003c/em\u003e9-14:Ac is also the major sex pheromone component of \u003cem\u003eS. frugiperda\u003c/em\u003e (Tumlinson et al., \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e1986\u003c/span\u003e; Wakamura, \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e1987\u003c/span\u003e). \u003cem\u003eZ\u003c/em\u003e9\u003cem\u003eE\u003c/em\u003e12-14:Ac is also present in trace amount in \u003cem\u003eS. frugiperda\u003c/em\u003e sex pheromone, while \u003cem\u003eE\u003c/em\u003e11-14:Ac is its minor component (Tabata et al., \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2023\u003c/span\u003e; Wang et al., \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e2022a\u003c/span\u003e). We have often found a small number of \u003cem\u003eS. litura\u003c/em\u003e and \u003cem\u003eS. exigua\u003c/em\u003e moths in the sex pheromone traps used to monitor \u003cem\u003eS. frugiperda\u003c/em\u003e population (Y. Du, unpublished data). This reduced the effectiveness in monitoring these pests by the sex pheromone trapping. The composition and ratio of each compounds in the sex pheromone blend are the key, but the trace components also play an important role in the specificity of sex pheromone (Chen et al., \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2018\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eAt present, the olfactory responses of different insect species to their sex pheromones in the same crop habitat have not been fully investigated. \u003cem\u003eZ\u003c/em\u003e9-14:OH and \u003cem\u003eZ\u003c/em\u003e7-12:Ac are not sex pheromone components of \u003cem\u003eS. litura\u003c/em\u003e, because they have never been detected in the extracts of its sex pheromone glands (Sun et al., \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2003\u003c/span\u003e; Sun et al., \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e2002\u003c/span\u003e). Z9-14:OH is one of the minor components of \u003cem\u003eS. exigua\u003c/em\u003e sex pheromone (Mochizuki et al., \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e1993\u003c/span\u003e; Wakamura, \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e1987\u003c/span\u003e), while \u003cem\u003eZ\u003c/em\u003e7-12:Ac is the major component of the \u003cem\u003eA. ipsilon\u003c/em\u003e sex pheromone and the minor component of \u003cem\u003eS. frugiperda\u003c/em\u003e sex pheromone (Tumlinson et al., \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e1986\u003c/span\u003e). By field experiments and \u003cem\u003ein vitro\u003c/em\u003e functional verification, we found that \u003cem\u003eZ\u003c/em\u003e9-14:OH and \u003cem\u003eZ\u003c/em\u003e7-12:Ac strongly inhibited the olfactory perception of sex pheromone in male S. \u003cem\u003elitura\u003c/em\u003e, in which \u003cem\u003eSlituOR16\u003c/em\u003e receptors play an important role. \u003cem\u003eSlituOR16\u003c/em\u003e is one of the major receptors that sense the sex pheromone of \u003cem\u003eS. litura\u003c/em\u003e, and it responds to all four intrinsic sex pheromone components. The olfactory receptors of \u003cem\u003eC. medinalis\u003c/em\u003e in rice fields sensed \u003cem\u003eZ\u003c/em\u003e11-16:Ald and \u003cem\u003eZ\u003c/em\u003e11-16:Ac in \u003cem\u003eC. suppressalis\u003c/em\u003e and \u003cem\u003eS. inferens\u003c/em\u003e sex pheromones, whereas \u003cem\u003eZ\u003c/em\u003e11-16:Ald and \u003cem\u003eZ\u003c/em\u003e11-16:Ac are not components of \u003cem\u003eC. medinalis\u003c/em\u003e sex pheromone (Cheng et al., \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). Similar situations exist in \u003cem\u003ePlutella xylostella\u003c/em\u003e, \u003cem\u003eS. litura\u003c/em\u003e, and \u003cem\u003eS. exigua\u003c/em\u003e in vegetable fields. \u003cem\u003eZ\u003c/em\u003e9\u003cem\u003eE\u003c/em\u003e11-14:Ac and \u003cem\u003eZ\u003c/em\u003e9\u003cem\u003eE\u003c/em\u003e12-14:Ac inhibit the sex pheromone trapping of male \u003cem\u003eP. xylostella\u003c/em\u003e (Wang et al., \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e2022b\u003c/span\u003e). This chemical communication with sex pheromone in interspecific species may have been related to the spatial distribution of insect species in the same habitat and their competition or ecological niche, and also reflects the important ecological significance of premating in the reproduction of insects (Kohno \u0026amp; Iida, \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). \u003cem\u003eA. ipsilon\u003c/em\u003e larvae feed on roots, while \u003cem\u003eS. litura\u003c/em\u003e larvae feed on leaves (Li et al., \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2022\u003c/span\u003e; Sayed et al., \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). If the density of \u003cem\u003eA.ipsilon\u003c/em\u003e females in the habitat is high, it would affect the living space for the offspring of leaf-feeding insects. Similarly, the \u003cem\u003eC. suppressalis\u003c/em\u003e and \u003cem\u003eS. inferens\u003c/em\u003e are borers, while the larvae of \u003cem\u003eC. medinalis\u003c/em\u003e are leaf rollers. The high density of females will also threaten the offspring of \u003cem\u003eC. medinalis\u003c/em\u003e moths to complete their life cycle. \u003cem\u003eS. litura\u003c/em\u003e, \u003cem\u003eH. armigera\u003c/em\u003e and \u003cem\u003eH. assulta\u003c/em\u003e are important pests of tobacco, and the larvae fed on the leaves (Garcia, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2006\u003c/span\u003e; Yuan et al., \u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e2024\u003c/span\u003e; Zhang et al., \u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). However, in this study, none of the sex pheromone receptors of S. \u003cem\u003elitura\u003c/em\u003e showed electro-physiological response to the sex pheromone components of \u003cem\u003eH. armigera\u003c/em\u003e or \u003cem\u003eH. assulta\u003c/em\u003e.\u003c/p\u003e \u003cp\u003eThe relationship between insect species in the same habitat is of great interest in the pest management with sex pheromone technology, that is whether we can use \u003cem\u003eZ\u003c/em\u003e7-12:Ac and \u003cem\u003eZ\u003c/em\u003e9-14:OH to replace or partially replace \u003cem\u003eZ\u003c/em\u003e9\u003cem\u003eE\u003c/em\u003e11-14:Ac and \u003cem\u003eZ\u003c/em\u003e9\u003cem\u003eE\u003c/em\u003e12-14:Ac in the mating disruption. Because \u003cem\u003eZ\u003c/em\u003e9\u003cem\u003eE\u003c/em\u003e11-14:Ac and \u003cem\u003eZ\u003c/em\u003e9E1\u003cem\u003e2\u003c/em\u003e-14:Ac contain double-bond, their synthetic costs are higher than those of \u003cem\u003eZ\u003c/em\u003e7-12:Ac and \u003cem\u003eZ\u003c/em\u003e9-14:OH. At the same time, the calling behavior of \u003cem\u003eA. ipsilon\u003c/em\u003e and \u003cem\u003eS. exigua\u003c/em\u003e can also be disrupted in the high dosages of \u003cem\u003eZ\u003c/em\u003e7-12:Ac and \u003cem\u003eZ\u003c/em\u003e9-14:OH. This might be a potential for mating disruption to multiple pests in the tobacco crop.\u003c/p\u003e \u003cp\u003eIn this study, the responses of three PRs to inter- and intra-specific sex pheromones of A. \u003cem\u003eipsilon\u003c/em\u003e, H. \u003cem\u003eassulta\u003c/em\u003e, H. \u003cem\u003earmigera\u003c/em\u003e and S. \u003cem\u003eexigua\u003c/em\u003e were determined by XOE-TEVC system. The function of sex pheromone receptors was verified by field experiments. It offers novel insights into the molecular mechanisms underlying sex pheromone sensing in moths and suggesting innovative approaches for future pest management.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eACKNOWLEDGEMENTS\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was financially supported by the Key Science and Technology Project of China National Tobacco Bureau (110202201027 (LS-11)) to T. Liu and China National Tobacco Bureau Hunan Provincial Key Project (HN2023KJ21) to S. Wu.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors\u0026rsquo; contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSW, TL and YD proposed and managed the project.JL, YX, WZ and KT arranged and designed the field experiments; JL, YX and WZ performed the field experiments; YZ and MC performed the molecular and electrophysiological experiments; CD and SW performed statistical analysis; SW, TL and YD managed the projects. YZ, MC and CD wrote the original draft paper, YD wrote and finalized the paper. All authors have discussed the results of the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe data that support the findings of this study are available upon reasonable request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflict of interest\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors have no relevant financial or non-financial interests to disclose.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eAc\u0026iacute;n P, Rosell G, Guerrero A, Quero C (2010) Sex Pheromone of the Spanish Population of the Beet Armyworm Spodoptera exigua. J Chem Ecol 36:778\u0026ndash;786. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s10886-010-9817-z\u003c/span\u003e\u003cspan address=\"10.1007/s10886-010-9817-z\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAnuradha P, Sudhanan EM, Priyanka M, Emaiya R, Karthik P, Suganthi A, Krishnamoorthy SV (2023) Determination of chlorantraniliprole for managing Helicoverpa armigera and Spodoptera litura in cotton ecosystem. Environ Res 239 doi:ARTN 117301. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.envres.2023.117301\u003c/span\u003e\u003cspan address=\"10.1016/j.envres.2023.117301\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBoo KS, Park KC, Hall DR, Cork A, Berg BG, Mustaparta H (1995) (Z)-9-Tetradecenal - a Potent Inhibitor of Pheromone-Mediated Communication in the Oriental Tobacco Budworm Moth, Helicoverpa-Assulta. J Comp Physiol a-Sensory Neural Behav Physiol 177:695\u0026ndash;699\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChang HT, Liu Y, Yang T, Pelosi P, Dong SL, Wang GR (2015) Pheromone binding proteins enhance the sensitivity of olfactory receptors to sex pheromones in. Scientific Reports 5. doi:ARTN 13093 \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/srep13093\u003c/span\u003e\u003cspan address=\"10.1038/srep13093\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChapman RF (2003) Contact chemoreception infeeding by phytophagous insects. Ann Rev Entomol 48:455\u0026ndash;484. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1146/annurev.ento.48.091801.112629\u003c/span\u003e\u003cspan address=\"10.1146/annurev.ento.48.091801.112629\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen QH, Zhu F, Tian ZH, Zhang WM, Guo R, Liu WC, Pan LM, Du YJ (2018) Minor Components Play an Important Role in Interspecific Recognition of Insects: A Basis to Pheromone Based Electronic Monitoring Tools for Rice Pests. Insects 9. doi:ARTN 19210.3390/insects9040192.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCheng JJ, Chen QH, Guo QS, Du YJ (2023) Moth sex pheromones affect interspecific competition among sympatric species and possibly population distribution by modulating pre-mating behavior. Insect Sci 30:501\u0026ndash;516. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/1744-7917.13099\u003c/span\u003e\u003cspan address=\"10.1111/1744-7917.13099\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCork A, Boo KS, Dunkelblum E, Hall DR, Jeerajunga K, Kehat M, Jie EK, Park KC, Tepgidagarn P, Xun L (1992) Female Sex-Pheromone of Oriental Tobacco Budworm, Helicoverpa-Assulta (Guenee) (Lepidoptera, Noctuidae) - Identification and Field Testing. J Chem Ecol 18:403\u0026ndash;418. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/Bf00994240\u003c/span\u003e\u003cspan address=\"10.1007/Bf00994240\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDhivya M, Karthi S, Amala K, Vasantha-Srinivasan P, Han YS, Al Obaid S, Senthil-Nathan S, Park KB (2024) Phytometabolites from coral jasmine flower extracts: Toxic effects on Spodoptera litura and enzyme inhibition in nontarget earthworm Eisenia fetida as an alternative approach. Environ Res 252 doi:ARTN 118896. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.envres.2024.118896\u003c/span\u003e\u003cspan address=\"10.1016/j.envres.2024.118896\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDu YJ, Feng B, Li HG, Liu CM, Zeng J, Pan LM, Yu Q (2015) Field Evaluation of Agrotis ipsilon (Lepidoptera: Noctuidae) Pheromone Blends and Their Application to Monitoring Moth Populations in China. Environ Entomol 44:724\u0026ndash;733. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1093/ee/nvv043\u003c/span\u003e\u003cspan address=\"10.1093/ee/nvv043\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDunkelblum E, Gothilf S, Kehat M (1980) Identification of the Sex-Pheromone of the Cotton Bollworm, Heliothis-Armigera, in Israel. Phytoparasitica 8:209\u0026ndash;211. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/Bf03158319\u003c/span\u003e\u003cspan address=\"10.1007/Bf03158319\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFleischer J, Pregitzer P, Breer H, Krieger J (2018) Access to the odor world: olfactory receptors and their role for signal transduction in insects. Cell Mol Life Sci 75:485\u0026ndash;508. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s00018-017-2627-5\u003c/span\u003e\u003cspan address=\"10.1007/s00018-017-2627-5\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGao K, Torres-Vila LM, Zalucki MP, Li YP, Griepink F, Heckel DG, Groot AT (2020) Geographic variation in sexual communication in the cotton bollworm. Pest Manag Sci 76:3596\u0026ndash;3605. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1002/ps.5893\u003c/span\u003e\u003cspan address=\"10.1002/ps.5893\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGarcia FJM (2006) Analysis of the spatio-temporal distribution of Hb. in a tomato field using a stochastic approach. Biosyst Eng 93:253\u0026ndash;259. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.biosystemseng.2005.12.011\u003c/span\u003e\u003cspan address=\"10.1016/j.biosystemseng.2005.12.011\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGardiner A, Barker D, Butlin RK, Jordan WC, Ritchie MG (2008) Drosophila chemoreceptor gene evolution: selection, specialization and genome size. Mol Ecol 17:1648\u0026ndash;1657. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/j.1365-294X.2008.03713.x\u003c/span\u003e\u003cspan address=\"10.1111/j.1365-294X.2008.03713.x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGemeno C, Lutfallah AF, Haynes KF (2000) Pheromone blend variation and cross-attraction among populations of the black cutworm moth (Lepidoptera: noctuidae). Ann Entomol Soc Am 93:1322\u0026ndash;1328 doi:Doi 10.1603/0013-8746(2000)093[1322:Pbvaca]2.0.Co;2\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGuo H, Huang LQ, Gong XL, Wang CZ (2022) Comparison of functions of pheromone receptor repertoires in Helicoverpa armigera and Helicoverpa assulta using a Drosophila expression system. Insect Biochemistry and Molecular Biology 141. doi:ARTN 103702 \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.ibmb.2021.103702\u003c/span\u003e\u003cspan address=\"10.1016/j.ibmb.2021.103702\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHan WK, Wei ZQ, Yang YL, Liu XL, Yan Q, Zhang J, Dong SL (2023) Roles of GOBP1 in perception of host plant volatiles revealed by CRISPR/Cas9-mediated mutagenesis in. J Appl Entomol 147:602\u0026ndash;610. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/jen.13150\u003c/span\u003e\u003cspan address=\"10.1111/jen.13150\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHu J, Zhang Y, Tan LS, Wang XY, Liu W, Wang GR, Zheng XL (2024) Functional characterization of sex pheromone receptors PflaOR29 and PflaOR44 involved in the chemoreception of a diurnal moth, Phauda flammans (Walker) (Lepidoptera: Phaudidae). Pesticide Biochemistry and Physiology 203. doi:ARTN 105998 \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.pestbp.2024.105998\u003c/span\u003e\u003cspan address=\"10.1016/j.pestbp.2024.105998\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eIslam Y, Shah FM, G\u0026uuml;ncan A, Naeem A, Zhou XM (2024) Temperature-induced effects on development, reproduction, and predation of Harmonia axyridis fed on first instar larvae Spodoptera litura. Bull Entomol Res 114:244\u0026ndash;253. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1017/S0007485324000051\u003c/span\u003e\u003cspan address=\"10.1017/S0007485324000051\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKohno K, Iida H (2024) Possible mechanisms mitigating reproductive interference supposed between Xylena fumosa (Butler) and X. formosa (Butler) (Lepidoptera: Noctuidae: Xyleninae), both by-captured in a commercial pheromone trap for Helicoverpa armigera (H\u0026uuml;bner) (Lepidoptera: Noctuidae: Heliothinae). Entomological Science 27. doi:ARTN e12567 \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/ens.12567\u003c/span\u003e\u003cspan address=\"10.1111/ens.12567\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLeal WS (2013) Odorant Reception in Insects: Roles of Receptors, Binding Proteins, and Degrading Enzymes. Ann Rev Entomol 58:373\u0026ndash;391. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1146/annurev-ento-120811-153635\u003c/span\u003e\u003cspan address=\"10.1146/annurev-ento-120811-153635\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLelito JP, Myrick AJ, Baker TC (2008) Interspecific pheromone plume interference among sympatric heliothine moths: A wind tunnel test using live, calling females. J Chem Ecol 34:725\u0026ndash;733. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s10886-008-9475-6\u003c/span\u003e\u003cspan address=\"10.1007/s10886-008-9475-6\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi YX, Gao H, Zhang H, Yu RN, Feng F, Tang J, Li B (2022) Characterization and expression profiling of G protein-coupled receptors (GPCRs) in (Lepidoptera: Noctuidae). Comparative Biochemistry and Physiology D-Genomics \u0026amp; Proteomics 44. doi:ARTN 101018 \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.cbd.2022.101018\u003c/span\u003e\u003cspan address=\"10.1016/j.cbd.2022.101018\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLin XD, Zhang QH, Wu ZN, Du YJ (2015) Identification and Differential Expression of a Candidate Sex Pheromone Receptor in Natural Populations of Spodoptera litura. Plos One 10. doi:ARTN e0131407 \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1371/journal.pone.0131407\u003c/span\u003e\u003cspan address=\"10.1371/journal.pone.0131407\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu CC, Liu Y, Walker WB, Dong SL, Wang GR (2013a) IIdentification and functional characterization of sex pheromone receptors in beet armyworm Spodoptera exigua (H\u0026uuml;bner). Insect Biochem Mol Biol 43:747\u0026ndash;754. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.ibmb.2013.05.009\u003c/span\u003e\u003cspan address=\"10.1016/j.ibmb.2013.05.009\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu NY, He P, Dong SL (2012) Binding properties of pheromone-binding protein 1 from the common cutworm. Comp Biochem Physiol B-Biochemistry Mol Biology 161:295\u0026ndash;302. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.cbpb.2011.11.007\u003c/span\u003e\u003cspan address=\"10.1016/j.cbpb.2011.11.007\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu NY, Liu CC, Dong SL (2013b) Functional differentiation of pheromone-binding proteins in the common cutworm. Comp Biochem Physiol a-Molecular Integr Physiol 165:254\u0026ndash;262. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.cbpa.2013.03.016\u003c/span\u003e\u003cspan address=\"10.1016/j.cbpa.2013.03.016\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMochizuki F, Shibuya T, Ihara T, Wakamura S (1993) Electrophysiological Responses of the Male Antenna to Compounds Found in the Female Sex-Pheromone Gland of Spodoptera-Exigua, (Hubner) (Lepidoptera, Noctuidae). Applied Entomology and Zoology 28: 489\u0026ndash;496. doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1303/aez.28.489\u003c/span\u003e\u003cspan address=\"10.1303/aez.28.489\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePersoons CJ, Vanderkraan C, Nooijen WJ, Ritter FJ, Voerman S, Baker TC (1981) Sex-Pheromone of the Beet Armyworm, Spodoptera-Exigua - Isolation, Identification and Preliminary Field-Evaluation. Entomol Exp Appl 30:98\u0026ndash;99. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/j.1570-7458.1981.tb03591.x\u003c/span\u003e\u003cspan address=\"10.1111/j.1570-7458.1981.tb03591.x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePicimbon JF, Gadenne C, Becard JM, Clement JL, Sreng L (1997) Sex pheromone of the French black cutworm moth, Agrotis ipsilon (Lepidoptera: Noctuidae): Identification and regulation of a multicomponent blend. J Chem Ecol 23:211\u0026ndash;230. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1023/B:Joec.0000006355.13207.91\u003c/span\u003e\u003cspan address=\"10.1023/B:Joec.0000006355.13207.91\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSayed RM, El Sayed TS, Rizk SA (2023) Potency of Bio Magic (Metarhizium anisopliae fungus) and gamma radiation in the black cut worm, Agrotis ipsilon (Hufnagel) larvae. Egyptian Journal of Biological Pest Control 33. doi:ARTN 1 \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/s41938-023-00647-6\u003c/span\u003e\u003cspan address=\"10.1186/s41938-023-00647-6\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShen YL, Gao Y, Du YJ (2009) The synergism of plant volatile compounds and sex pheromones of the tobacco cutworm moth, Spodoptera litura (Lepidoptera: Noctuidae). Acta Entomol Sinica 52:1290\u0026ndash;1297\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSugie H, Tatsuki S, Nakagaki S, Rao CBJ, Yamamoto A (1991) Identification of the Sex-Pheromone of the Oriental Tobacco Budworm, Heliothis-Assulta (Guenee) (Lepidoptera, Noctuidae). Appl Entomol Zool 26:151\u0026ndash;153. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1303/aez.26.151\u003c/span\u003e\u003cspan address=\"10.1303/aez.26.151\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSun F, Du JW, Chen TH (2003) The behavioral responses of Spodoptera litura (F.) males to the female sex pheromone in wind tunnel and field trapping tests. Acta Entomol Sinica 46:26\u0026ndash;130\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSun F, Hu YY, Du JW (2002) The sex pheromone communication system of Spodoptera litura (Fabricius). Acta Entomol Sinica 45:404\u0026ndash;407\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTabata J, Nakano R, Yasui H, Nakamura K, Takehara K, Matsuda H, Ikenoue Y, Kusuhata Y, Kinjo K, Nakama K, Tsuha Y, Ishikawa Y (2023) Sex pheromone of the fall armyworm Spodoptera frugiperda (Lepidoptera: Noctuidae) of a Far East population from Okinawa, Japan. Entomol Exp Appl 171:535\u0026ndash;541. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/eea.13287\u003c/span\u003e\u003cspan address=\"10.1111/eea.13287\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTamaki Y, Noguchi H, Yushima T (1973) Sex pheromone of Spodoptera litura (F.) (Lepidoptera: Noctuidae): isolation, identification, and synthesis. Applied Entomology Zoology: 200\u0026ndash;203\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTamaki Y, Ohsawa T, Yushima T, Noguchi H (1976) Sex pheromone and related compounds secreted by the virgin females of Spodoptera litura (F). Jpn J Appl Entomol Zool 20:81\u0026ndash;86\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eThompson JN, Pellmyr O (1991) Evolution of Oviposition Behavior and Host Preference in Lepidoptera. Ann Rev Entomol 36:65\u0026ndash;89. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1146/annurev.en.36.010191.000433\u003c/span\u003e\u003cspan address=\"10.1146/annurev.en.36.010191.000433\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTumlinson JH, Mitchell ER, Teal PEA, Heath RR, Mengelkoch LJ (1986) Sex-Pheromone of Fall Armyworm, Spodoptera-Frugiperda Smith,J.E. - Identification of Components Critical to Attraction in the Field. J Chem Ecol 12:1909\u0026ndash;1926. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/Bf01041855\u003c/span\u003e\u003cspan address=\"10.1007/Bf01041855\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTumlinson JH, Mitchell ER, Yu HS (1990) Analysis and Field-Evaluation of Volatile Blend Emitted by Calling Virgin Females of Beet Armyworm Moth, Spodoptera-Exigua (Hubner). J Chem Ecol 16:3411\u0026ndash;3423. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/Bf00982107\u003c/span\u003e\u003cspan address=\"10.1007/Bf00982107\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWakamura S (1987) Sex-Pheromone of the Beet Armyworm, Spodoptera-Exigua (Hubner) (Lepidoptera, Noctuidae) - Field Attraction of Male Moths in Japan to (Z,E)-9,12-Tetradecadienyl Acetate and (Z)-9-Tetradecen-1-Ol. Appl Entomol Zool 22:348\u0026ndash;351. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1303/aez.22.348\u003c/span\u003e\u003cspan address=\"10.1303/aez.22.348\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang C, Zhang S, Guo MB, Hou XQ, Yang B, Wang GR (2022a) Optimization of a pheromone lure by analyzing the peripheral coding of sex pheromones of Spodoptera frugiperda in China. Pest Manag Sci 78:2995\u0026ndash;3004. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1002/ps.6924\u003c/span\u003e\u003cspan address=\"10.1002/ps.6924\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang FM, Shen ZJ, Schal C, Zhu JJ, Zhou GX, Wang YL, Wang JR, Deng JY, Wan NF (2022b) Pheromone antagonism in Plu tella xylostella (Linnaeus) by sex pheromones of two sympatric noctuid moths. Pest Manag Sci 78:379\u0026ndash;387. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1002/ps.6651\u003c/span\u003e\u003cspan address=\"10.1002/ps.6651\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWanner KW, Nichols AS, Allen JE, Bunger PL, Garczynski SF, Linn CE, Robertson HM, Luetje CW (2010) Sex Pheromone Receptor Specificity in the European Corn Borer Moth,. Plos One 5. doi:ARTN e8685 \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1371/journal.pone.0008685\u003c/span\u003e\u003cspan address=\"10.1371/journal.pone.0008685\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYan Q, Liu XL, Wang YL, Tang XQ, Shen ZJ, Dong SL, Den JY (2019) Two Sympatric Spodoptera Species Could Mutually Recognize Sex Pheromone Components for Behavioral Isolation. Front Physiol 10 doi:ARTN 1256. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/fphys.2019.01256\u003c/span\u003e\u003cspan address=\"10.3389/fphys.2019.01256\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang CY, Han KS, Boo KS (2009) Sex Pheromones and Reproductive Isolation of Three Species in Genus. J Chem Ecol 35:342\u0026ndash;348. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s10886-009-9602-z\u003c/span\u003e\u003cspan address=\"10.1007/s10886-009-9602-z\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang J, Mo BT, Li GC, Huang LQ, Guo H, Wang CZ (2024) Identification and functional characterization of chemosensory genes in olfactory and taste organs of Spodoptera litura (Lepidoptera: Noctuidae). Insect Sci. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/1744-7917.13350\u003c/span\u003e\u003cspan address=\"10.1111/1744-7917.13350\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYuan XF, Zhong H, Xia ZY, Lu ZJ, Chen W, Liu YX, Zhou GC, Liu XQ, Deng MJ, Yu HZ (2024) Integrated transcriptome and 1H NMR-based metabolome to explore the potential mechanism of Spodoptera litura in response to flupyrimin. Pestic Biochem Physiol 205:106146\u0026ndash;106146. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.pestbp.2024.106146\u003c/span\u003e\u003cspan address=\"10.1016/j.pestbp.2024.106146\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYuvaraj JK, Corcoran JA, Andersson MN, Newcomb RD, Anderbrant O, L\u0026ouml;fstedt C (2017) Characterization of Odorant Receptors from a Non-ditrysian Moth, Eriocrania semipurpurella Sheds Light on the Origin of Sex Pheromone Receptors in Lepidoptera. Mol Biol Evol 34:2733\u0026ndash;2746. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1093/molbev/msx215\u003c/span\u003e\u003cspan address=\"10.1093/molbev/msx215\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang HL, Li KY, Zhang YB (2022) Comparing the Transcriptomes of Two Different Tissues in (Guenee). J Chem 2022 doi:Artn 3820942. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1155/2022/3820942\u003c/span\u003e\u003cspan address=\"10.1155/2022/3820942\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang J, Yan SW, Liu Y, Jacquin-Joly E, Dong SL, Wang GR (2015) IIdentification and functional characterization of sex pheromone receptors in the common cutworm (Spodoptera litura). Chem Senses 40:7\u0026ndash;16. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1093/chemse/bju052\u003c/span\u003e\u003cspan address=\"10.1093/chemse/bju052\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang JP, Salcedo C, Fang YL, Zhang RJ, Zhang ZN (2012) An overlooked component: (Z)-9-tetradecenal as a sex pheromone in. J Insect Physiol 58:1209\u0026ndash;1216. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.jinsphys.2012.05.018\u003c/span\u003e\u003cspan address=\"10.1016/j.jinsphys.2012.05.018\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang QH, Wu ZN, Zhou JJ, Du YJ (2017) Molecular and functional characterization of a candidate sex pheromone receptor OR1 in. Insect Sci 24:543\u0026ndash;558. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/1744-7917.12294\u003c/span\u003e\u003cspan address=\"10.1111/1744-7917.12294\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang S, Jacquin-Joly E, Montagn\u0026eacute; N, Liu F, Liu Y, Wang GR (2024) Identification of an odorant receptor responding to sex pheromones in Spodoptera frugiperda extends the novel type-I PR lineage in moths. Insect Sci 31:489\u0026ndash;502. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/1744-7917.13248\u003c/span\u003e\u003cspan address=\"10.1111/1744-7917.13248\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang S, Liu F, Yang B, Liu Y, Wang GR (2023) Functional characterization of sex pheromone receptors in Spodoptera frugiperda, S. exigua, and S. litura moths. Insect Sci 30:305\u0026ndash;320. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/1744-7917.13098\u003c/span\u003e\u003cspan address=\"10.1111/1744-7917.13098\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZielonka M, Breer H, Krieger J (2018) Molecular elements of pheromone detection in the female moth. Insect Sci 25:389\u0026ndash;400. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/1744-7917.12434\u003c/span\u003e\u003cspan address=\"10.1111/1744-7917.12434\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Spodoptera litura, Xenopus oocyte system, olfactory receptor, inter-specific sex pheromone, intra-specific sex pheromone, sex pheromone trapping","lastPublishedDoi":"10.21203/rs.3.rs-5817533/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-5817533/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e \u003cem\u003eSpodoptera litura\u003c/em\u003e is an important crop pest while sex pheromone trapping has been used as a tool for \u003cem\u003eS. litura\u003c/em\u003e population monitoring. The objective of this study was to detect olfactory responses of sex pheromone receptors in \u003cem\u003eS. litura\u003c/em\u003e to inter- and intra- specific sex pheromone. We identified three pheromone odorant receptors (ORs) --- \u003cem\u003eSlituOR13, SlituOR6\u003c/em\u003e and \u003cem\u003eSlituOR16\u003c/em\u003e. \u003cem\u003eSlituOR6\u003c/em\u003e had the strongest response to the minor sex pheromone component \u003cem\u003eE\u003c/em\u003e11-14:Ac of \u003cem\u003eS. litura\u003c/em\u003e, and weak responses to the inter-specific sex pheromone components 16:Ac and \u003cem\u003eZ\u003c/em\u003e9-14:Ac. \u003cem\u003eSlituOR13\u003c/em\u003e had a strong response to the minor sex pheromone component \u003cem\u003eE\u003c/em\u003e11-14:Ac of \u003cem\u003eS. litura\u003c/em\u003e, and a weak response to the minor component \u003cem\u003eZ\u003c/em\u003e9-14:Ac. \u003cem\u003eSlituOR16\u003c/em\u003e responded strongly to the sex pheromone component \u003cem\u003eZ\u003c/em\u003e9-14:OH of \u003cem\u003eS. exigua\u003c/em\u003e, had some responses to the intra-specific sex pheromone component \u003cem\u003eZ\u003c/em\u003e9-14:Ac, \u003cem\u003eZ\u003c/em\u003e9\u003cem\u003eE\u003c/em\u003e11-14:Ac and \u003cem\u003eZ\u003c/em\u003e9\u003cem\u003eE\u003c/em\u003e12-14:Ac of \u003cem\u003eS. litura\u003c/em\u003e, and the inter-specific sex pheromone component \u003cem\u003eZ\u003c/em\u003e7-12:Ac of \u003cem\u003eAgrotis ipsilon\u003c/em\u003e, but a weak response to the minor component \u003cem\u003eE\u003c/em\u003e11-14:Ac of \u003cem\u003eS. litura\u003c/em\u003e. Field data from sex pheromone trapping supported that \u003cem\u003eZ\u003c/em\u003e9-14:OH and \u003cem\u003eZ\u003c/em\u003e7-12:Ac inhibited the olfactory response of male \u003cem\u003eS. litura\u003c/em\u003e to sex pheromones.\u003c/p\u003e","manuscriptTitle":"Olfactory responses of sex pheromone receptors in Spodoptera litura (Lepidoptera: Noctuidae) to inter- and intra-specific sex pheromone","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-01-16 13:07:36","doi":"10.21203/rs.3.rs-5817533/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"fdaebb05-b94c-487f-b51d-4c0b8a3983ac","owner":[],"postedDate":"January 16th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2025-02-28T09:24:26+00:00","versionOfRecord":[],"versionCreatedAt":"2025-01-16 13:07:36","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-5817533","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-5817533","identity":"rs-5817533","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.