Cooperative Clamp-Mediated Promoter Recognition by Poxviral RNAP and Its TBP/TFIIB-Like Partner | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Cooperative Clamp-Mediated Promoter Recognition by Poxviral RNAP and Its TBP/TFIIB-Like Partner Utz Fischer, Stefan Jungwirth, Julia Bartuli, Stephanie Lamer, and 2 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7417495/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 18 Feb, 2026 Read the published version in Nature Communications → Version 1 posted You are reading this latest preprint version Abstract The recruitment of RNA polymerase (RNAP) to gene promoters is a critical step in gene expression. For RNAP II, this process is initiated by the TATA-box binding protein (TBP) and transcription factor IIB (TFIIB), with homologs of these TBP/TFIIB pairs found in all known multi-subunit RNAP systems. Here, we describe a previously unknown mode of promoter recognition by the poxviral intermediate transcription factor 3 (VITF-3). This heterodimeric factor comprises an atypical TBP/TFIIB pair forming a stable ring structure inert towards DNA in the absence of viral RNAP (vRNAP). Promoter recognition instead requires concerted VITF-3 and vRNAP binding, as revealed by cryo-EM analysis of the intermediate pre-initiation complex (iPIC). During iPIC formation, vRNAP facilitates ring opening and loading of VITF-3 onto the promoter, anchoring the polymerase at the transcription start site. Our findings propose vRNAP as a clamp loader for VITF-3 and reveal a thus far unknown transcription initiation mechanism. Biological sciences/Structural biology/Electron microscopy/Cryoelectron microscopy Biological sciences/Biochemistry/Enzymes/Multienzyme complexes Biological sciences/Molecular biology/Transcription/Transcriptional regulatory elements Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Introduction The initiation of transcription is a fundamental process across all domains of life, requiring the assembly of a pre-initiation complex (PIC) at precisely defined regions within gene promoters 1 . Eukaryotic and archaeal multi-subunit DNA-dependent RNA polymerases (RNAPs), including RNAPs II and III utilize a core set of two universally conserved transcription factors (TFs) for transcription initiation 2 – 5 . One of these is TATA-box binding protein (TBP), which binds the TATA box of RNAP II/III genes and connects the polymerase to its cognate promoter 5 . TATA-box binding is mediated by a conserved domain comprising two repeats that fold into a saddle-like structure. This domain interacts with DNA via the minor groove, inducing bending and melting of the duplex to recruit additional factors and stabilize the PIC 6 , 7 . Remarkably, TBP is not strictly required for basal transcription initiation at RNAP I promoters and structural studies show no resolved density for TBP in cryogenic electron microscopy (cryo-EM) reconstructions of RNAP I PICs 8 . Instead, it acts as a coactivator, enhancing initiation rates by stabilizing promoter interactions 8 , 9 . In addition to genuine TBP, several TBP-related proteins or TBP-like factors (TBPLFs) have been identified in metazoans, but their mode of action in transcription initiation is understood in only a few cases 10 – 12 . The second universally conserved TF belongs to the TFIIB-related protein (TFBRP) family. Its name-giving member TFIIB serves multiple functions in RNAP II transcription, including stabilizing the DNA-TBP complex and assisting RNAP II recruitment to the promoter 13 – 15 . Other TFBRPs perform similar tasks but employ interactions that differ partially or entirely from the canonical RNAP II system 16 , 17 . Recent studies on poxviruses provided unexpected insight into the evolution of TBP/TFIIB pairs involved in the transcription by multi-subunit RNAPs 18 – 20 . Poxviruses are double-stranded DNA viruses that replicate and express their genomes in the cytoplasm of their hosts using their own transcription and replication machinery 21 – 23 . Structural and functional investigations on the prototypic poxvirus Vaccinia have revealed an elaborate transcription apparatus centered around a virus-encoded multi-subunit RNA polymerase (vRNAP) 19 , 24 . This complex, composed of eight subunits (Rpo147, Rpo132, Rpo35, Rpo30, Rpo22, Rpo19, Rpo18, and Rpo7), transcribes all poxviral genes 24 – 27 . For co-transcriptional RNA processing and transcription termination, vRNAP cooperates with further virus-encoded factors including the heterodimeric capping enzyme (CE) 20 , 28 , 29 . During the viral replication cycle, vRNAP is directed to specific promoters through specialized transcription and processing factors, enabling the coordinated expression of early, intermediate, and late genes 24 , 30 . Transcription initiation at early promoters requires the heterodimeric Vaccinia early transcription factor (VETF-l and -s) and Rap94 to assemble the early pre-initiation complex (ePIC) 18 , 31 – 35 . Rap94 is a multifunctional protein containing a TFIIB homology domain, whereas VETF-l possesses a unique TBP-like domain (TBPLD), defining VETF-l and Rap94 as a TBP/TFIIB pair 18 , 19 . Unlike the symmetric binding of TBP to the minor groove of the TATA-box, the TBPLD of VETF-l recognizes early gene promoters by asymmetrically contacting the major groove 7 , 18 , 19 . The CE is not part of the ePIC but assembles with the elongating vRNAP for co-transcriptional capping and termination 20 , 36 . Transcription of intermediate genes relies on a distinct set of virus-encoded factors that act together with vRNAP 24 . Intermediate promoters comprise the consensus-lacking, but AT-rich core element separated by a 12-base pair (bp) spacer from the initiator element, which contains the strictly conserved TAAA motif spanning positions − 1 to + 3 37,38 . Several intermediate TFs have been identified, including CE, Vaccinia intermediate transcription factor 3 (VITF-3) consisting of subunits VITF-3s and VITF-3l as well as the host factors G3BP1 and p137 39–42 . Biochemical studies suggested that the VITF-3s/l heterodimer recognizes the AT-rich core element, but its precise role in intermediate PIC (iPIC) assembly and its mode of function in transcription remains unknown 38 , 41 . In this study, we established a strategy to isolate Vaccinia intermediate transcription complexes enabling their investigation by biochemical and structural approaches. We identify the heterodimeric VITF-3 as a TBP/TFIIB pair that acts in a radically different manner than other known TBP/TFIIB pairs. The cryo-EM structure of the iPIC shows that the VITF-3 heterodimer forms a closed ring around the AT-rich upstream element, anchoring the vRNAP and the viral CE at the promoter. The biochemical dissection of PIC assembly revealed a previously unknown mechanism that requires VITF-3 loading onto the intermediate promoter and direct promoter recognition facilitated by vRNAP. Results Purification of the Vaccinia intermediate pre-initiation complex To investigate poxviral intermediate gene expression we modified a previously established method for the isolation of vRNAP complexes from infected HeLa S3 cells 19 , 43 . This procedure relies on the recombinant Vaccinia strain GLV-1h439 expressing the FLAG-tagged vRNAP subunit Rpo132 and allows for the purification of early transcription complexes (i.e. core and complete vRNAPs, Fig. 1A, lane 1) 19 . To selectively enrich intermediate transcription complexes, we modified our purification protocol by infecting cells in presence of the replication inhibitor cytosine β-D-arabinofuranoside (AraC) prior to vRNAP purification 44 . This treatment prevents the progression of viral infection into the replicative stage but allows early transcription and thus enrichment of early gene products including both subunits of VITF-3. vRNAP was affinity-purified from AraC-treated infected cells and its composition was compared with vRNAP isolated from untreated infected cells by SDS-PAGE and mass spectrometry (Fig. 1A, lanes 1 and 2; Fig. 1B; see also Extended Fig. 1A for the investigation of the purified complex by gradient centrifugation). vRNAP core subunits and the heterodimeric CE were equally enriched in both purifications, showing that AraC treatment did not interfere with the expression of early transcripts including those encoding the subunits of the core polymerase. However, the early TFs VETF-s/l, Rap94, NPH-I and E11, all of which are encoded by late genes, were selectively depleted from vRNAP-complexes purified from AraC-treated cells. Instead, vRNAP complexes contained both VITF-3 subunits albeit in sub-stoichiometric amounts (see Fig. 1A for the analysis of isolated vRNAP complexes by SDS-PAGE and Fig. 1B for their analysis by mass spectrometry). The purified complex consisting of vRNAP and CE will be referred to as vRNAP AraC throughout this manuscript. To further enhance the association of VITF-3 with vRNAP AraC we added a 70 bp intermediate promoter scaffold to the lysate of AraC-treated HeLa cells prior to purification (Fig. 1C). This allowed for the efficient isolation of a stable and stoichiometric complex composed of vRNAP, VITF-3, CE and promoter scaffold (Fig. 1A, lane 3, see also Extended Fig. 1B for the analysis of this complex by gradient centrifugation). Based on its composition, the purified complex constitutes a bona fide iPIC or an intermediate initial transcribing complex (iITC). Structure of the iPIC at 2.4 Å resolution We analyzed the purified vRNAP complex by means of cryo-EM. A dataset containing about 9 million particles allowed for a 2.4 Å reconstruction and building of an almost complete model (Fig. 2A, Table 1 for data collection, reconstruction and model refinement statistics; see also Extended Fig. 2). The reconstruction shows density for core vRNAP at very high (< 2 Å local) resolution including the promoter DNA from position − 30 to + 14, as well as the VITF-3 heterodimer and CE. The DNA is bound deep inside the vRNAP cleft with the transcription start site (TSS) in close vicinity to the active site. Since a DNA/RNA hybrid is clearly absent, the structure represents the iPIC rather than an iITC. The bubble region is centered around the active site with both nucleic acid strands widely separated indicating an open complex conformation (Fig. 2B). Remarkably, the heterodimeric VITF-3 forms a ring enclosing the upstream AT-rich element at the promoter from − 25 to -15 and guides the DNA into the vRNAP cleft by introducing a 90° kink in the helix axis. VITF-3 is supported by the vRNAP wall and protrusion domains on one side and by the CE on the other, leading to a rugged integration into the iPIC. While being tightly associated with the iPIC, the CE subunits D1 and D12 are divided into two modules (Fig. 2A and C). The first consists of the N-terminal part of D1, whereas the second module holds the C-terminus of D1 bound to D12. We observed in the 3D classes of the iPIC that module 1 always occupies the same binding surface with Rpo147 and Rpo18, whereas the density of module 2 is either contacting VITF-3s or remains flexible (Fig. 2C and D, see also Extended Fig. 2A). The letter resulted in a particle subset lacking module 2, which we termed iPIC CEm . The iPIC structure resembles the co-transcriptional capping complex Structural comparison of the iPIC with previously resolved vRNAP assemblies showed that it most closely resembles the co-transcriptional capping complex (CCC) that forms during early transcription (compare Fig. 3A and B) 18 , 20 . Both complexes consist of all vRNAP subunits, DNA, and the CE heterodimer, but only the CCC contains nascent mRNA. In the latter, module 2 of the CE interacts with the upstream DNA and Rpo132 on one side of the cleft, while module 1 stably associates with Rpo147 on the other side. In the iPIC, module 1 occupies a similar position as in the CCC but module 2 is displaced upward, as its binding interfaces on the upstream DNA and Rpo132 are occupied by VITF-3. As a result, module 2 either contacts the VITF-3 dimer or remains flexible (Fig. 3A and B, see also Fig. 2). Interestingly, the RNA exit channel that accommodates the nascent RNA chain in the CCC is occupied in the iPIC by the N-terminus of VITF-3s, which constitutes a TFIIB reader-like element (BRLE, see also below). The overall structural similarity between the iPIC and CCC suggests that the iPIC transitions into the CCC upon initiation of transcription and promoter escape, which is further supported by biochemical experiments shown below. In contrast, the iPIC differs significantly from the ePIC in structure and composition (Fig. 3B, C) 18 . In the ePIC, promoter recognition is mediated by the VETF-s/l heterodimer bridging the polymerase cleft, as well as by Rap94, which is wrapped around vRNAP. Unlike the iPIC, the CE is not included in the ePIC but re-associates during initial transcription to facilitate the transition into the CCC 18 . Early and intermediate TFs hence adopt distinct conformations and engage in different interactions, contributing to the pronounced structural differences between the two Vaccinia PIC structures. vRNAP, CE and VITF-3 enable intermediate transcription and co-transcriptional capping in vitro We next investigated whether the assembly of the iPIC leads to productive transcription in an intermediate promoter dependent manner. To assess this question, we performed in vitro transcription assays on templates under the control of early, intermediate, and late promoters using isolated complete vRNAP or vRNAP AraC in presence or absence of recombinant VITF-3 (Fig. 4A and B). As expected, complete vRNAP, which constitutes an “all in one” unit combining vRNAP with early transcription and processing factors, efficiently transcribed the template under control of the early promoter (Fig. 4B, lane 1), whereas no transcription was observed on templates with intermediate ( G8R ) or late ( A9L ) promoters (Fig. 4B, lanes 4 and 7). In contrast, vRNAP AraC failed to transcribe templates with early and late promoters (Fig. 4B, lanes 2 and 8). However, it enabled intermediate transcription albeit at a very low level (Fig. 4B, lane 5), likely due to small amounts of VITF-3 in the vRNAP AraC preparation (see Fig. 1B). Importantly, the addition of recombinant VITF-3 selectively boosted the transcription from intermediate promoters by at least 10-fold (Fig. 4B, lane 6), indicating that vRNAP, CE and VITF-3 are necessary and sufficient for robust transcription from intermediate promoters in vitro . Vaccinia transcripts acquire an m 7 GpppN cap structure when produced in infected cells and co-transcriptional capping has been shown to occur in vitro using complete vRNAP 20 , 42 . To investigate whether co-transcriptional capping also occurs during intermediate transcription, [ 32 P]-labelled mRNAs were generated by complete vRNAP, vRNAP AraC supplemented with recombinant VITF-3 and bacteriophage T7 RNAP as a control. The [ 32 P]-labeled transcripts were pooled and analyzed by immunoprecipitation using monoclonal H-20 antibodies that specifically recognize m 7 G-cap structures (Fig. 4C). Early and intermediate transcripts were immunoprecipitated to approximately 25% and 90% respectively, whereas the uncapped T7 transcript remained quantitatively in the supernatant (Fig. 4C and D, see also Supplementary table 1 ). These results demonstrate that isolated early and intermediate viral transcription complexes efficiently generate m 7 G-capped transcripts in vitro thus faithfully recapitulating the in vivo situation. vRNAP-assisted loading of the ring-shaped VITF-3 onto the upstream promoter To investigate the mechanism of intermediate promoter recognition, we closely examined VITF-3 and its binding to DNA. Sequence analysis and structural studies showed that VITF-3 constitutes an unusual TBP/TFIIB pair with VITF-3l being the TBP-related subunit and VITF-3s the TFIIB-like subunit (Fig. 5A). The TBP-related saddle-like fold in VITF-3l enables the binding of upstream promoter DNA. However, unlike canonical TBP, it features extended “saddle flaps” that allow simultaneous interaction with both sides of VITF-3s to form a ring-shaped complex that encircles the promoter (Fig. 5B). VITF-3s contains a flexible N-terminal tail of 50 amino acids, which harbors a BRLE. As revealed by the iPIC structure, VITF-3 not only embraces the upstream core element but also induces a bend in the DNA helix axis of approximately 90°. Consistent with its DNA-encircling architecture, electrostatic potential mapping showed a uniformly positive charge on the inner surface of the VITF-3 ring (Fig. 5C). DNA binding is mediated by the insertion of aliphatic residues of VITF-3 into the minor groove, without significant groove widening. Specifically, two isoleucine residues intercalate into the DNA at promoter positions − 21/-22 (Fig. 5D) and − 18/-19 (Fig. 5E), disrupting Watson–Crick base pairing. These interactions are primarily directed at the DNA sugar-phosphate backbone and lack obvious base-specific contacts. Because VITF-3 binding disrupts multiple base pairs, it preferentially associates with AT-rich regions of the upstream core element, where base stacking is less stable than in GC-rich sequences. This low sequence specificity is consistent with previous studies that identified the upstream core element as an AT-rich stretch lacking a defined consensus motif 37 . The presence of the VITF-3 ring encircling the core element in the iPIC structure raised the question of its assembly in this position. To investigate the loading mechanism, we performed electrophoretic mobility shift assays (EMSAs) using vRNAP AraC , recombinant VITF-3, and radiolabeled G8R promoter DNA containing a mismatch bubble from − 5 to + 8 relative to the TSS (Fig. 5F; see also Fig. 1C for the DNA architecture). VITF-3 alone did not bind the DNA, despite the presence of an upstream core element within the scaffold (Fig. 5F, lanes 1–4). In contrast, vRNAP AraC exhibited partial DNA binding (Fig. 5F, lanes 5–7), likely reflecting the general affinity of RNAPs for DNA and in particular for DNA containing a mismatch bubble. In contrast, the presence of both VITF-3 and vRNAP AraC led to iPIC formation, as indicated by a slower-migrating complex (Fig. 5F, lanes 8–10), which was also observed using a closed promoter (Fig. S3). However, when a randomized DNA scaffold retaining the same mismatch bubble was used, this higher-order complex did not form (Fig. 5F, lanes 18–20). This indicates that vRNAP AraC is both necessary and sufficient to load the ring-shaped VITF-3 onto the upstream promoter region in vitro . It further shows that promoter recognition is not imparted by the TF itself but rather by the core transcriptional components. Further evidence for an assisted loading mechanism of VITF-3 onto the promoter was obtained from structural studies of the iPIC. The dataset yielded in total three different iPIC conformations including iPIC CEm with mobile CE and iPIC d , which showed deep binding of the DNA within the vRNAP cleft. The third particle subset displayed a slightly shallower binding conformation of the downstream DNA (termed iPIC s ). Structural comparison between iPIC d and iPIC s , which likely represent transitional intermediates in the DNA loading process, suggests a conformational continuum (Supplementary Video 1). The trajectory supports a concerted loading mechanism, wherein vRNAP AraC cooperatively opens the VITF-3 ring to load it onto the upstream promoter. This process forms a stable iPIC, with the VITF-3 ring clamped around the upstream promoter. vRNAP detects the TSS and stabilizes melted DNA strands in the iPIC Inspired by the findings described in the previous chapter, we next investigated the interactions underlying sequence-specific promoter recognition. Guided by VITF-3, the upstream DNA is directly inserted into the vRNAP cleft, where the strands are separated and positioned for transcription initiation. Since the promoter DNA around both fork points displayed a well-defined cryo-EM density in the iPIC structure, we were able to analyze the DNA pathway in detail (Fig. 6A for a schematic overview, Fig. 6B). The upstream fork point at position − 7 is stabilized by fork loop 1 of the Rpo147 clamp domain and by the VITF-3s fork loop (Fig. 6C), which both are simultaneously inserted into the DNA leading to strand separation. Near the downstream fork point, the melted non-template strand stably binds the lobe domain of core vRNAP (Fig. 6D). We found the previously described initiatior element, a TAAA motif at position − 1 to + 3 on the non-template strand, being directly read out by the vRNAP core subunits. The base specificity is generated by an area centered around the Rpo132 lobe, which contacts the bases of the initiator element via His207. This robust binding of the non-template strand stabilizes the downstream fork point and positions the + 1 base of the melted template strand next to the active site. Overall, these resuts indicate that sequence specificity in intermediate transcription is primarily provided by core vRNAP rather than its TFs. At the downstream fork point at position + 4, three residues, Asn450, Val451, and Ile453, from the Rpo147 fork loop 2 play a key role: They separate the DNA bases of the template and non-template strands and protect them from the surrounding solvent. Aside, Asn450 directly contacts the sugar phosphate backbone between position + 4 and + 3 of the non-template strand, where it makes a sharp turn towards the lobe-bound initiator element. In the opposite direction, the template strand is stabilized by the bridge helix of Rpo147, which is inserted between the bases at positions + 3 and + 4 (Fig. 6E). Especially Ser750 and Thr754 stabilize the single-stranded template strand. Starting at the upstream fork point where the fork loop of VITF-3s assists in strand separation, the VITF-3s N-terminal tail is embedded along the outside of vRNAP to the catalytically active module 1 of the CE (Fig. 5F). On this pathway, the VITF-3s helix 3 10 and the BRLE are stabilized by interactions with vRNAP and CE. Interestingly, the comparison of iPIC and CCC showed that the N-terminal domain of VITF-3s in the iPIC occupies the same path as the emerging RNA chain in the CCC (Fig. 3A, B), suggesting a potential promoter escape mechanism (see discussion) 20 . Vaccinia transcription factors evolved from canonical TBP The structures of iPIC and ePIC shed light on the evolutionary trajectory of the TBP fold in the context of cellular and viral PICs. The ancestral TBP prototype likely resembled a monopartite RNA-binding fold as seen in RNase A, which is composed of five antiparallel β-strands and a single α-helix (Fig. 7A, B) 45 . Canonical TBP evolved through gene duplication into a bilobal, pseudo-symmetric structure, with each lobe containing five β-strands and two α-helices 7 . As general TF, TBP plays a central role in the transcription systems of RNAP II, RNAP III, and archaea, where it binds promoter DNA, induces bending, and recruits TFIIB or its homologs 5 , 7 . Strikingly, TBP does not directly interact with the RNAP core in these systems but rather recruits TFIIB or its homologs for this purpose (Fig. 7C) 5 . In the context of Vaccinia early transcription, the domain architecture of the bipartite TBP homolog VETF-l differs from that of canonical TBP by featuring an extended hinge region that connects both domains 19 . As a result, the ePIC differs significantly from archaeal and eukaryotic PICs, both in the trajectory of upstream DNA and in VETF-l simultaneously contacting the DNA and vRNAP 5 , 18 . In Vaccinia intermediate transcription we now found VITF-3l holding a tripartite TBP fold, which manifests in an additional i-lobe and expansion segment giving VITF-3l its characteristic “U”-shape. This expanded structure enables two contact points with the TFIIB homologue VITF-3s to create a closed ring structure. Unlike TBP, VITF-3l has a large interaction surface with vRNAP at the outer side of the i-lobe domain, which is required to close the ring around the promoter. The TBP homologs bend the upstream DNA, thereby priming it for sequence readout, which is carried out by another domain of VETF-l in the ePIC or by vRNAP in the iPIC. Overall, the TBP homologs found in Vaccinia originate from a prototypic TBP fold but developed unique structural and functional features during the host-virus co-evolution. The contrasting architectures of the ePIC and iPIC illustrate how a single RNAP core can be functionally diversified through the co-evolution of stage-specific TFs. These findings not only highlight the adaptability of the viral transcription machinery but also provide a conceptual framework to understand the modular evolution of transcription systems across all domains of life. Discussion In this study, we dissected intermediate-stage transcription of the prototypic poxvirus Vaccinia using a combination of biochemical enrichment, functional assays, and structural analysis. We identified the heterodimeric VITF-3 as a TBP/TFIIB pair with unique features. Unlike canonical TFs that bind the promoter prior to polymerase recruitment and PIC formation, VITF-3 does not recognize the promoter alone. Instead, it cooperates with vRNAP and CE to enable PIC formation. Furthermore, our study shows that vRNAP recognizes the intermediate promoter in a sequence-specific manner, which enables the deposition of VITF-3 onto the upstream promoter element in a clamp-loader-like fashion. This coordinated process generates the iPIC, which is primed to produce m 7 G-capped intermediate transcripts. Previous structural investigation of poxviral transcription focused on early vRNAP complexes as they represent the predominant form of vRNAP when isolated from infected cells 18 – 20 . To investigate intermediate transcription, we established a protocol based on the inhibition of DNA replication, to selectively enrich early viral gene products, such as intermediate TFs and vRNAP subunits 44 , 46 . This protocol caused a nearly quantitative elimination of the early TFs from the purified vRNAP. However, the CE was stably bound to vRNAP under these conditions. In addition, we observed sub-stoichiometric amounts of VITF-3 as part of this complex indicating its intrinsic affinity to vRNAP or CE. Notably, the interaction of VITF-3 and vRNAP was significantly enhanced upon the addition of an intermediate promoter scaffold, which resulted in the formation of a stable iPIC. Previous biochemical studies have provided a detailed understanding of the factors involved in intermediate transcription within cellular extracts. This process was shown to depend on VITF-3, CE, as well as the host factors G3BP1 and p137 24,39–42 . However, our in vitro transcription assays demonstrated robust activity on intermediate templates using only a minimal set of components comprising VITF-3, CE and vRNAP. We therefore propose that G3BP1 and p137 play supportive or regulatory roles in intermediate transcription, without being essential for basal activity. In contrast to the data presented here, partially purified VITF-3 was previously shown to bind the intermediate promoter independently of vRNAP, thereby forming a committed complex 38 . However, we show that VITF-3 forms a closed stable ring even in the absence of DNA, which makes unassisted binding to the promoter rather unlikely. Nevertheless, VITF-3 may remain stably bound to the promoter when vRNAP transitions into the elongation phase, thus enabling efficient re-initiation for the subsequent transcription events. Our structural analysis of the iPIC is consistent with decades-old biochemical studies of the Vaccinia intermediate promoter, highlighting an essential AT-rich, but not sequence-conserved, core element around position − 20 37,38 . This DNA motif is recognized and bent by VITF-3. As we did not observe any sequence-specific interactions between VITF-3 and its bound DNA within the iPIC, we propose that VITF-3 engages the core element through shape-based readout, sensing the physical properties of the AT-rich promoter rather than specific nucleotide identities. The spacer element spanning base pairs − 14 to -2 is not involved in direct protein contacts, but its length of approximately one DNA helical turn is important for exact spatial alignment of VITF-3 and vRNAP AraC on the promoter elements to form the iPIC. At the TSS, the TAAA motif of the initiator element is crucial for transcription initiation, since these four bases are directly recognized by vRNAP. Notably, a similar sequence-specific recognition mechanism has been previously described for RNAP III transcription termination highlighting the coevolution of viral and eukaryotic transcription systems 47 . We note, however, that the TAAA motif appears with high frequency in the Vaccinia genome even outside of intermediate promoters. VITF-3 may hence contribute additional promoter-selectivity by recognizing shape and flexibility of the core element. The availability of high-resolution functional ePIC and iPIC structures enabled their comparison to other known PICs formed by multi-subunit RNAPs and provides insights into the evolution of transcription initiation. Despite extensive divergence, each Vaccinia PIC contains a set of proteins with structurally conserved TBP-like and TFIIB-like folds 18 . Due to minimal sequence conservation, these factors were uncovered only by structural analysis or advanced bioinformatic approaches. Their conserved functionality – the TBPLF binding the upstream DNA, bending and melting the promoter, and the TFBLP bridging between TBPLF and RNAP – mirrors a common PIC architecture observed across all archaeal and eukaryotic systems 1 , 5 , 48 . However, poxviral TBPLFs are markedly divergent owing to increased asymmetry and structural insertions, which support the ring-shaped architecture of VITF-3 in the iPIC, and further sequence adaptations that provide new interaction surfaces. This specialized architecture allows VITF-3 to encircle the core promoter element but necessitates a dedicated mechanism for TF loading. Given the size and organization of the Vaccinia genome, it appears unlikely that the ring slides over a genome end and migrates to cognate promoters, particularly since VITF-3 lacks ATPase activity. Instead, we propose transient opening of the ring that allows its loading onto the DNA, which is supported by our in vitro reconstitution experiments of the iPIC. Furthermore, our experiments suggest that ring opening (and subsequent closing around the DNA) is facilitated by vRNAP AraC . In line, our iPIC shows two slightly different conformations that likely represent snapshots of a dynamic trajectory that might inject force into the VITF-3 ring. At the same time, the two CE modules exhibit high mobility relative to each other, as observed across different transcription complexes 18 . We hence propose a dynamic scenario where the CE acts as the effector that initiates ring opening in the presence of DNA and mediates a clamp-loading reaction in cooperation with vRNAP. Based on our study we deduce a model for the poxviral intermediate transcription cycle. In the first step, the promoter is recognized through a concerted process involving clamp-loading of VITF-3 by vRNAP AraC and positioning of vRNAP at the initiator element. These interactions bend the DNA and promote strand separation in the vRNAP cleft, leading to the formation of the iPIC. Several intermediate promoter elements are necessary for proper positioning of the transcription machinery and ensure sequence specificity. The iPIC structure is remarkably similar to an ITC or CCC with the + 1 base of the template strand positioned next to the active site, which primes the complex for initial transcription 5 , 20 . Our study further suggests that once the nascent RNA is extended to approximately 12 nucleotides, it clashes with the N-terminus of VITF-3s obstructing the RNA exit channel, which likely results in the displacement of VITF-3 followed by promoter escape. Once loaded, VITF-3 may stay bound to the core element, which would allow more efficient transcription re-initiation. Shortly after promoter escape, the nascent RNA reaches the CE, where it acquires a m⁷GpppN cap structure. The elongating intermediate vRNAP complex resembles the early elongation complex, although the CE may remain associated with vRNAP throughout transcription 18 . The molecular mechanism of Vaccinia intermediate transcription termination remains unknown, but an intrinsic termination mechanism appears likely since no dedicated factors have been described so far. Our study provides insight into key mechanisms of Vaccinia intermediate transcription at atomic resolution and offers structural perspectives on the evolutionary innovations of viral transcription systems. Given the high sequence conservation of TFs among orthopoxviruses, our findings are also relevant to the investigation of the human pathogens MPXV and variola virus. Methods Experimental model and study participant details Male African green monkey kidney fibroblasts (CV-1) were purchased from the American Type Culture Collection (ATCC No. CCL-70). Human HeLa S3 cells (female) came from Sigma-Aldrich (87110901). Both cell lines were cultivated routinely in 15 cm plates at 37°C with 5% CO 2 in DMEM (Gibco, 41965062) supplied with 10% FBS (Gibco, 10270106) and 1% Pen/Strep (Gibco, 15140122) if not mentioned otherwise. Infection of HeLa S3 cells with recombinant Vaccinia virus GLV-1h439 in absence and presence of AraC For the infection in absence or presence of AraC (Sigma-Aldrich, C1768), the medium of 80% confluent HeLa S3 cells cultivated in 15 cm dishes was changed to DMEM supplied with 10% FBS, 1% Pen/Strep and 250 µg/ml AraC 44 , 46 , 49 , 50 . After 1 h of incubation, the medium was changed to DMEM supplied with 2% FBS, 1% Pen/Strep and 250 µg/ml AraC, before cells were infected with genetically modified Vaccinia virus GLV-1h439 (Genelux Corporation), expressing FLAG/HA-tagged Rpo132, with an MOI of 10. After 1 h of incubation, DMEM supplied with 18% FBS, 1% Pen/Strep and 250 µg/ml AraC was added to generate a final FBS concentration of 10% and the cells were further incubated at standard conditions. 24 h after infection, the cells were detached from the plate using a cell scraper and centrifuged at 1,800 g and 4°C for 10 min. After discarding the supernatant, the cell pellet was flash-frozen in liquid nitrogen and stored at -80°C. To purify complete vRNAP, HeLa S3 were infected with an MOI of 2 over 48 h using the same virus in absence of AraC 19 , 43 . Purification of FLAG-tagged vRNAP complexes Infected HeLa S3 cells were thawed on ice and resuspended in lysis buffer (50 mM HEPES, pH 7.5, 150 mM NaCl, 1,5 mM MgCl 2 , 0.5% (v/v) NP-40, 1 mM DTT, 10 µM leupeptin, 1.5 µM aprotinin, 0.2 mM PMSF and 0.1 M AEBSF). After centrifugation at 48,000 g for 40 min, the supernatant was incubated for 3 h at 4°C with 200 µl anti-FLAG M2 affinity gel (Sigma-Aldrich, A2220). The beads were washed four times with buffer containing 50 mM HEPES, pH 7.5, 150 mM NaCl, 1.5 mM MgCl 2 , 0.1% (v/v) NP-40 and 1 mM DTT and once with elution buffer (50 mM HEPES, pH 7.5, 150 mM NaCl, 1.5 mM MgCl 2 and 1 mM DTT). The bead-bound protein was eluted with elution buffer supplemented with 200 µg/ml 3 x FLAG peptide (Sigma-Aldrich, F4799) followed by concentrating by a Vivaspin 500 (Sartorius, VS0142) according to the vendor’s protocol. For the purification of vRNAP AraC , aliquots were prepared, flash-frozen in liquid nitrogen and stored at -80°C. To sufficiently purify complete vRNAP, the eluate was further purified by 10–30% sucrose density gradient centrifugation at 194,000 g and 4°C for 16 h 19 . 200 µl fractions were collected manually, analyzed via SDS-PAGE and the fractions containing complete vRNAP were pooled. After concentration in a Vivaspin 500 (Sartorius, VS0142) according to the vendor’s protocol, aliquots were prepared, flash-frozen in liquid nitrogen and stored at -80°C. Purification of the Vaccinia iPIC HeLa S3 cells infected with GLV-1h439 in the presence of AraC were thawed on ice, before resuspending in lysis buffer (150 mM NaCl, 50 mM HEPES pH 7.5, 1.5 mM MgCl 2 , 0.5% (v/v) NP-40, 1 mM DTT, 10 µM leupeptin, 1.5 µM aprotinin, 0.2 mM PMSF and 0.1 M AEBSF) and incubation at 4°C for 20 min. The lysate was cleared by centrifugation at 48,000 g and 4°C for 40 min. The supernatant was supplied with ATP to a final concentration of 4 mM as well as with 10 nmol of annealed G8R promoter DNA containing an artificial mismatch bubble from position − 5 to + 8 (Template strand: 5’CCCCCTTTATGGATTTTTATAGGGATGGAGTAAAATATAATTTGTAAATTATTTAAAGTTAAATGGCTGC3’, Nontemplate strand: 5’GCAGCCATTTAACTTTAAATAATTTACAAAAATTTAAAATGAGCATCCCTATAAAAATCCATAAAGGGGG3’). The sample was incubated at 20°C for 30 min under rotation, before the vRNAP complex was purified via FLAG-IP as described in the section above. The elution fractions were pooled and concentrated in a Vivaspin 500 (Sartorius, VP0142) followed by 5–45% sucrose density gradient centrifugation at 194,000 g and 4°C for 16 h 19 . Fractions were collected manually, before analyzing them via SDS-PAGE and silver staining. The fractions containing co-migrating vRNAP AraC and endogenous VITF-3 were pooled and concentrated in a Vivaspin 500 (Sartorius, VP0142) by centrifugation at 8,000 g and 4°C to a concentration of 1.5 µg/µl. Afterwards, the sample was centrifuged at 15,000 g and 4°C for 5 min, before the supernatant was used for grid preparation. Quantifoil R1.2/1.3 Au 300 grids were glow-discharged for 90s at medium intensity using the Plasma Cleaner model PDC-002 (Harrick Plasma Ithaca, NY/USA). Per grid, 3 µl sample were applied at 4°C and 100% humidity using a Vitrobot Mark IV instrument (FEI Company). The settings used included 0 s wait time, 5 s blotting time and a blot force of 20. The grids were stored in liquid nitrogen till data collection. Cryo-EM structure determination and model building The Cryo-EM dataset of the iPIC sample was collected with a Thermo Fisher Titan Krios G3 equipped with a Falcon III camera (Thermo-Fischer). Data was acquired with EPU at 300 keV and a primary magnification of 75,000 (calibrated pixel size 1.0635 Å) in movie-mode with 25 fractions per movie and integrating the electron-signal. The total exposure was 50 e/Å over an exposure time of 4.5 s with 2 exposures per hole. The dataset was processed with Cryosparc 51 . Two cycles of 2D classification and manual selection of classes based on the appearance of their class averages for clean-up resulted in a stack of 114,430 good particles. An ab-initio map was created from a 50,000 particles subset and the full set subjected to a consensus 3D refinement. The set was then separated into three classes that represented the iPIC in three slightly different conformations (Fig. S1 ). The three particle sets were finally subjected to a non-uniform refinement step and the density was docked with the previously published core vRNAP model (PDB 6RIC) and the coordinates of the two CE modules extracted from the complete vRNAP model (PDB 6RFL). The remaining density was identified as from the VITF-3s and VITF-3l and docked with aphafold2 predictions of the two polypeptides. The resulting model was then further manually adjusted in COOT and automatically refined with Phenix.real_space_refine including an ADP refinement step 52 , 53 . Secondary structure, and mild Ramachandran restraints were imposed. A total of three cycles of manual inspection and automated refinement were performed. Single-pot, solid-phase-enhanced sample preparation (SP3) for mass spectrometry analysis of vRNAP complexes Samples were processed using an adapted SP3 protocol 54 . In brief, the reconstitution solution was added to a final volume of 125 µl. DTT was added to a concentration of 5 mM and the alkylation was performed with 20 mM iodoacetamide. 10 mM additional DTT were used for quenching. Equal volumes of two types of Sera-Mag Speed Beads (Cytiva, 45152101010250 and 65152105050250) were combined, washed with water and 5 µL of the bead mix were added to each sample. 140 µl 100% ethanol were added and the samples were incubated at 24°C for 5 min under shaking at 1,000 rpm. The beads were immobilized on a magnetic rack for 2 min and the supernatant was removed, before two subsequent wash steps with 200 µl 80% ethanol (Chromasolv, Sigma) and one wash step with 1 ml 80% ethanol. The digest was performed on beads with 0.25 µg Trypsin (Gold, Mass Spectrometry Grade, Promega) and 0.25 µg Lys-C (Wako) in a total volume of 100 µl holding 100 mM ammonium bicarbonate at 37°C overnight. Peptides were desalted using C-18 Stage Tips 55 . Each Stage Tip was prepared with three discs of C-18 Empore SPE Discs (3M) in a 200 µl pipette tip. Peptides were eluted with 60% acetonitrile in 0.1% formic acid, dried in a vacuum concentrator (Eppendorf), and stored at -20°C. Peptides were dissolved in 2% acetonitrile / 0.1% formic acid prior to nanoLC-MS/MS analysis. NanoLC-MS/MS analysis NanoLC-MS/MS analysis was performed on an Orbitrap Fusion (Thermo Scientific) equipped with a PicoView Ion Source (New Objective) and coupled to an EASY-nLC 1,000 (Thermo Scientific). The peptides were loaded on a trapping column (2 cm x 150 µm ID, PepSep) and separated on a capillary column (30 cm x 150 µm ID, PepSep), both packed with 1.9 µm C18 ReproSil and separated by a linear gradient from 3–30% acetonitrile and 0.1% formic acid over 120 min with a flow rate of 500 nl/min. Both MS and MS/MS scans were acquired in an Orbitrap analyzer with a resolution of 60,000 for MS scans and 30,000 for MS/MS scans. HCD fragmentation with 35% normalized collision energy was applied. A Top Speed data-dependent MS/MS method with a fixed cycle time of 3 s was used. Dynamic exclusion was applied with a repeat count of 1 and an exclusion duration of 90 s, whereas singly charged precursors were excluded from selection. The minimum signal threshold for precursor selection was set to 50,000. Predictive AGC was used with a target value of 4x10 5 for MS scans and 5x10 4 for MS/MS scans. EASY-IC was used for internal calibration. MS data analysis Raw MS data files were analyzed with MaxQuant version 1.6.2.2 56 . The database search was performed with Andromeda, which is integrated in the utilized version of MaxQuant. We searched against the UniProt Human Proteome database (Release 2022_02, UP000005640, 79,864 proteins) and the UniProt Vaccinia Virus Proteom (Release 2021_09, 257 proteins). Additionally, a database containing common contaminants was used. The search was performed with tryptic cleavage specificity which allowed for 3 mis-cleavages. Protein identification was under control of the false-discovery rate (FDR; < 1% FDR on protein and peptide spectrum match (PSM) level). In addition to MaxQuant default settings, the search was performed against following variable modifications: Protein N-terminal acetylation, Gln to pyro-Glu formation (N-term. Gln) and oxidation (Met). Carbamidomethyl (Cys) was set as fixed modification. Further data analysis was performed using R scripts developed in-house. LFQ intensities were used for protein quantitation 57 . Proteins with less than two razor/unique peptides were removed. Missing LFQ intensities were imputed with values close to the baseline. Data imputation was performed with values from a standard normal distribution with a mean of the 5% quantile of the combined log10-transformed LFQ intensity and a standard deviation of 0.1. The vertical axis was normalized on the Rpo132-FLAG/HA amount since this vRNAP subunit was the target for FLAG-IPs after infections with and without AraC. Three biological replicates were performed, and only viral proteins detected in at least two replicates were shown. Expression and purification of recombinant VITF-3 in E. coli The ORFs of the Vaccinia A8R and A23R genes encoding VITF-3s and VITF-3l respectively, were PCR-amplified from viral genomic DNA using respective primer pairs ( A8R -5’-GGGCGGGATCCATGTTCGAACCAGTACCAGATC-3’, A8R -5’-CCGGCAAGCTTCTAAGTAAAATATTTTAGTAGCGTATCC-3’, A23R -5’-GAACTCATATGATGGATAATCTATTTACCTTTCTAC-3’, A23R -5’-GAACTGCGGCCGCTCATTTTAGAAGCAATTCTTTTAG-3’). The PCR product containing the A8R ORF as well as the vector pET28a were digested with BamHI and HindIII (Thermo Scientific, ER0051 and ER0502). Equally, the A23R PCR product and the vector pET21a were digested with NdeI and NotI (Thermo Scientific, ER0585 and ER0591). The digested DNA was purified via agarose gel electrophoresis followed by DNA recovery using a NucleoSpin Gel and PCR Clean-up kit (Macherey-Nagel, 740609) according to the vendor’s protocol. The digested ORFs of A8R and A23R were ligated into the digested vectors pET28a and pET21a using T4-DNA ligase (NEB, M0202S) to generate A8R -pET28a and A23R -pET21a. Chemically competent BL21(DE3)pLysS cells (Promega Corporation, L1195) were co-transformed with 15 ng of both plasmids in a 50 µl reaction, whereas kanamycin, ampicillin and chloramphenicol resistances were used for selection. About 100 ml SB medium supplied with respective antibiotics were inoculated with BL21(DE3)pLysS cells co-transformed with A8R -pET28a and A23R -pET21a and incubated at 37°C and under shaking overnight. The next day, 2 l of SB medium distributed in two 5 l baffled flasks were inoculated with 1% of overnight pre-culture each and the cells were incubated at 37°C under shaking at 100 rpm. After reaching an OD600 of 0.5, protein expression was induced by adding IPTG to a final concentration of 0.5 mM. The bacteria were further incubated overnight at 16°C under shaking. After collecting cells by centrifugation at 2,800 g at 4°C for 30 min, about 40 ml buffer L (25 mM HEPES pH 8.0, 150 mM NaCl, 15% glycerol, 5 mM β-mercaptoethanol) supplied with 10 mM imidazole, 10 µM leupeptin, 1.5 µM aprotinin, 0.2 mM PMSF and 0.1 M AEBSF were added. The cells were resuspended and lysed by sonication using a 250 Power Supply (Branson Ultrasonics, Danbury, USA) with the following settings: duty cycle 50%, output control 70%, and 5x 60 s with 60 s breaks between. The lysate was cleared upon centrifugation at 48,000 g and 4°C for 120 min and the supernatant was incubated with 4 ml of equilibrated His60 Ni superflow resin (takara, 635660) overnight at 4°C under rotation. The beads were subsequently washed with 20 ml buffer L supplied with 20 mM imidazole, 40 ml buffer L supplied with 20 mM imidazole and 1 M NaCl, 20 ml buffer L supplied with 20 mM imidazole and 40 ml buffer L supplied with 50 mM imidazole. For elution, the beads were incubated with 4 ml buffer L supplied with 500 mM imidazole for about 30 min at 4°C under rotation. The elution fraction was collected, and the procedure was repeated two times, before the eluates were combined and filtered using a 0.2 µm ReliaPrep Syringe Filters (Ahlstrom-Munksjö Germany GmbH, 760516). The NiNTA eluate was further purified via a 1 ml HiTrap Heparin HP affinity column (Cytiva, 17040601) equilibrated with buffer A (25 mM HEPES pH 8.0, 150 mM NaCl, 15% glycerol, 1 mM DTT). After binding of the Ni-NTA eluate at a flow rate of 0.2 ml/min, impurities were removed by a first elution step using buffer A supplemented with 350 mM NaCl. The protein of interest was eluted in buffer A with 1 M NaCl in a second elution step. 0.5 ml fractions were collected and analyzed via SDS-PAGE, before fractions containing pure VITF-3 were pooled and concentrated by a Vivaspin 500 (Sartorius, VP0142) to 20–30 mg/ml. Aliquots were flash-frozen in liquid nitrogen and stored at -80°C. In vitro transcription assay In vitro transcription was carried out in 25 µl reactions containing 40 mM Tris pH 8.0, 6 mM MgCl 2 , 10 mM DTT, 2 mM spermidine, 80 µM S-adenosyl methionine (NEB, B9003S), 20 U RNase Inhibitor (NEB, M0314S,M0314L), 2.5 mM ATP/GTP/CTP (Thermo Scientific, R0481), 0.5 mM UTP and 33.3 nM [α- 32 P]-UTP (Hartman Analytic, SCP-410). The template for Vaccinia early transcription, was pSB24, which was described previously 58 . For intermediate and late template generation, the G8R promoter ranging from − 178 to + 501 and the A9L promoter from − 139 to + 417 were PCR amplified using respective primer pairs ( G8R -5 GAACTGAATTCCCGATTCCTTTTTCGATGC, G8R -3 GAACTGGATCCCTGATGCTGACTAATACACTTG, A9L -5 GAACTGAATTCGTCAAGTCTTACTCATTGATCCG, A9L -3 GAACTGGATCCGAATTATTTACAAAATTCATTAACGAG). The PCR products as well as the pUC19 vector were digested with BamHI and EcoRI (Thermo Scientific, ER0051 and ER0271), before the promoters were ligated into pUC19 by T4 DNA Ligase (NEB, M0569S) to generate G8R -pUC19 and A9L -pUC19. The plasmids pSB24, G8R -pUC19 and A9L -pUC19 were proliferated in XL1blue cells, before linearization at positions + 631, +750 and + 666, respectively using NdeI (Thermo Scientific, ER0585). Per transcription reaction, 500 ng of linearized plasmid, 0.5 µg vRNAP AraC and 0.5 µg recombinant VITF-3 were combined, before the sample was incubated at 30°C for 45 min. To stop the reaction, 25 µl water, 200 µl TRIzol reagent (Sigma-Aldrich, 15596026) and 50 µl chloroform were added. After mixing, the sample was centrifuged at 12,000 g at 4°C for 15 min, before the aqueous phase was transferred into a fresh tube containing 200 µl 2-propanol and 1 µl GlycoBlue Coprecipitant (Invitrogen, AM9516). The solutions were mixed, and the RNA was precipitated at -20°C for at least 10 h. The sample was centrifuged at 12,000 g and 4°C for 15 min and the supernatant was discarded, before the RNA pellet was washed with 180 µl of 70% ethanol. The RNA pellet was dried at 37°C for 5 min and resuspended in 20 µl 1x RNA loading dye (47.5% formamide, 0.025% bromophenol blue, 0.025% xylene cyanole). After heating up to 95°C for 5 min, 10 µl per sample were loaded on a 4% polyacrylamide gel containing 8 M urea. Electrophoresis was carried out at 20 mA in 1x TBE running buffer. After 120 min, the electrophoresis was stopped, the gel was transferred onto Whatman paper and exposed to an Amersham Hyperfilm MP (Cytiva, 28-9068-44) at -80°C. The film was developed using an OPTIMAX X-Ray Film Processor (PROTEC GmbH & Co KG, Oberstenfeld, Germany). Analysis of m 7 G-capping of in vitro transcribed RNA For the investigation of the 5’-end of in vitro transcribed intermediate RNA, early and intermediate RNAs were generated in 125 µl transcription reactions each. Additionally, a third reaction containing 50 µl of T7 transcribed U1 snRNA served as non-capped control 59 , 60 . After precipitation with isopropanol, all RNAs were resuspended in 30 µl water and pooled. 100 µl of Dynabeads Protein G (Invitrogen, 10004D) were washed twice with PBS containing 0.02% Tween20. The beads were incubated with 60 µg H-20 antibody (Reinhard Lührmann) in 400 µl PBS supplied with 0.02% Tween20 for 45 min under shaking at room temperature 61 . After removing unbound antibody, the combined transcripts were added to the beads after taking off 20% for input. The sample was incubated for 70 min under rotation at RT, before the supernatant, which contained unbound RNAs, was taken off. The beads were washed three times with 400 µl PBS supplied with 0.02% Tween20 each, before 50 µl water were added. The RNAs of input, unbound and IP samples were extracted via TRIzol reagent (Sigma-Aldrich, 15596026). Therefore, all samples were filled up with water to 50 µl, before four times the volume TRIzol was added. After mixing, 50 µl chloroform were added and the samples were centrifuged at 12,000 g for 15 min at RT. The aqueous phase was transferred into a fresh tube containing four times the volume 2propanol and 1 µl GlycoBlue Coprecipitant (Invitrogen, AM9516). After mixing, the RNA was precipitated at -20°C for at least 10 h. The sample was centrifuged at 12,000 g at 4°C for 15 min and the supernatant was discarded, before the RNA pellet was washed once with 180 µl 70% ethanol. The RNA pellet was dried at 37°C for 5 min and resuspended in 20 µl 1x RNA loading dye (47.5% formamide, 0.025% bromophenol blue, 0.025% xylene cyanole). After boiling the sample at 95°C for 5 min, 3 µl of input and supernatant, as well as 4 µl of bead sample were loaded on a 4% polyacrylamide gel containing 8 M urea. The sample volumes vary between biological replicates. Electrophoresis was carried out at 20 mA in 1x TBE running buffer. After 120 min, electrophoresis was stopped, and the gel was transferred onto Whatman paper and exposed to an Amersham Hyperfilm MP (Cytiva, 15596026) at -80°C. The film was developed after 7 h using an OPTIMAX X-Ray Film Processor (PROTEC GmbH & Co KG, Oberstenfeld, Germany), before signal intensities were quantified using ImageJ 62 . The signal intensity of the IP fraction was divided by the sum of IP and supernatant, representing the ratio of capped RNA to total RNA. OriginPro 2023 (v10.0.0.154, OriginLab Corporation, Northampton, MA, USA) was used to visualize bars representing mean values ± SD of at least three independent replicates (dots). Declarations Data Availability Coordinate files of iPIC d , iPIC s and iPIC CEm have been deposited in the Protein Data Bank and are available under accession codes 8P0J, 8P0N and 8P0K, respectively. Cryo-EM densities of iPIC d , iPIC s and iPIC CEm have been deposited in the Electron Microscopy Data Bank and are available under accession codes EMD-17334, EMD-17336 and EMD-17335, respectively. This paper analyzes existing, publicly available structural data, accessible under the Protein Data Bank accession codes 7AMV (ePIC) 18 , 6RIE (CCC) 20 , 1FS3 (Ribonuclease A) 45 , 1YTB (TBP/TATA-box complex) 7 , 1AIS (TBP/TFB core/TATA-box complex from Pyrococcus woesei ) 63 , 7EGC (RNAP II PIC) 64 , 6EU0 (RNAP III PIC) 65 . The mass spectrometry proteomics data have been deposited to the ProteomeXchange Consortium via the PRIDE partner repository with the dataset identifier PXD065561 66 . To access the deposited proteomics raw data, reviewers can log in to the PRIDE website using the following details: Project accession: PXD065561 and token: UmSpwZ5o59KK, or alternatively, username: [email protected] and 854 password: zd2RdAPZLcp2. Any additional information required to reanalyze the data reported in this paper is available from the lead contact upon request. Source data are provided with this publication. Code Availability This paper does not report original code. Acknowledgements We would like to thank Reinhard Lührmann for kindly providing the H-20 antibody. Cryo-EM of the iPIC was carried out in the cryo-EM facility of the Julius-Maximilians University Würzburg (Projects INST 93/903-1 #359471283, INST 93/1042-1 #456578072, INST 93/1143-1 x525040890). This work was supported by a DFG grant to UF and CG (Fi 573/27-1) and by Volkswagen-Stiftung (9B813). Author contributions Conceptualization: UF, CG, JB, SJ Complex reconstitution and purification: SJ Biochemical assays: SJ Mass spectrometry: SL, AS Cryo-EM sample preparation and data collection: CG, SJ Data processing, model building, structure analysis and visualization: CG Writing: UF, CG, SJ Funding acquisition: UF, CG Ethics declarations The authors declare no competing interests. References Greber, B.J. & Nogales, E. The Structures of Eukaryotic Transcription Pre-initiation Complexes and Their Functional Implications. 143-192 (Springer International Publishing, 2019). Matsui, T., Segall, J., Weil, P.A. & Roeder, R.G. Multiple factors required for accurate initiation of transcription by purified RNA polymerase II. Journal of Biological Chemistry 255 , 11992-11996 (1980). Kassavetis, G.A. et al. The role of the TATA-binding protein in the assembly and function of the multisubunit yeast RNA polymerase III transcription factor, TFIIIB. Cell 71 , 1055-1064 (1992). Rowlands, T., Baumann, P. & Jackson, S.P. THE TATA-BINDING PROTEIN - A GENERAL TRANSCRIPTION FACTOR IN EUKARYOTES AND ARCHAEBACTERIA. SCIENCE 264 , 1326-1329 (1994). Kramm, K., Engel, C. & Grohmann, D. Transcription initiation factor TBP: old friend new questions. Biochemical Society transactions 47 , 411–423 (2019). Chasman, D.I., Flaherty, K.M., Sharp, P.A. & Kornberg, R.D. Crystal structure of yeast TATA-binding protein and model for interaction with DNA. Proceedings of the National Academy of Sciences 90 , 8174-8178 (1993). Kim, Y., Geiger, J.H., Hahn, S. & Sigler, P.B. Crystal structure of a yeast TBP/TATA-box complex. Nature 365 , 512-520 (1993). Sadian, Y. et al. Structural insights into transcription initiation by yeast RNA polymerase I. The EMBO Journal 36 , 2698-2709 (2017). Keener, J., Josaitis, C.A., Dodd, J.A. & Nomura, M. Reconstitution of Yeast RNA Polymerase I Transcription in Vitro from Purified Components: TATA-BINDING PROTEIN IS NOT REQUIRED FOR BASAL TRANSCRIPTION*. Journal of Biological Chemistry 273 , 33795-33802 (1998). Crowley, T.E. et al. A new factor related to TATA-binding protein has highly restricted expression patterns in Drosophila. Nature 361 , 557-561 (1993). Ohbayashi, T., Makino, Y. & Tamura, T.A. Identification of a mouse TBP-like protein (TLP) distantly related to the Drosophila TBP-related factor. Nucleic Acids Research 27 , 750-755 (1999). Rabenstein, M.D., Zhou, S., Lis, J.T. & Tjian, R. TATA box-binding protein (TBP)-related factor 2 (TRF2), a third member of the TBP family. Proceedings of the National Academy of Sciences of the United States of America 96 , 4791–4796 (1999). Reinberg, D. & Roeder, R.G. Factors involved in specific transcription by mammalian RNA polymerase II. Purification and functional analysis of initiation factors IIB and IIE. Journal of Biological Chemistry 262 , 3310-3321 (1987). Zhang, D.Y. The role of TFIIB-RNA polymerase II interaction in start site selection in yeast cells. Nucleic Acids Research 30 , 3078-3085 (2002). Buratowski, S. & Zhou, H. Functional domains of transcription factor TFIIB. Proceedings of the National Academy of Sciences of the United States of America 90 , 5633–5637 (1993). Colbert, T. & Hahn, S. A yeast TFIIB-related factor involved in RNA polymerase III transcription. Genes & Development 6 , 1940-1949 (1992). Hausner, W., Wettach, J., Hethke, C. & Thomm, M. Two Transcription Factors Related with the Eucaryal Transcription Factors TATA-binding Protein and Transcription Factor IIB Direct Promoter Recognition by an Archaeal RNA Polymerase*. Journal of Biological Chemistry 271 , 30144-30148 (1996). Grimm, C., Bartuli, J., Boettcher, B., Szalay, A.A. & Fischer, U. Structural basis of the complete poxvirus transcription initiation process. Nature structural & molecular biology 28 , 779–788 (2021). Grimm, C. et al. Structural Basis of Poxvirus Transcription: Vaccinia RNA Polymerase Complexes. Cell 179 , 1537-1550.e19 (2019). Hillen, H.S. et al. Structural Basis of Poxvirus Transcription: Transcribing and Capping Vaccinia Complexes. Cell 179 , 1525-1536 e12 (2019). Salzman, N.P. & Sebring, E.D. Sequential Formation of Vaccinia Virus Proteins and Viral Deoxyribonucleic Acid Replication. Journal of Virology 1 , 16-23 (1967). Moss, B., Ahn, B.Y., Amegadzie, B., Gershon, P.D. & Keck, J.G. Cytoplasmic transcription system encoded by vaccinia virus. The Journal of biological chemistry 266 , 1355–1358 (1991). Grimm, C., Bartuli, J. & Fischer, U. Cytoplasmic gene expression: lessons from poxviruses. Trends in biochemical sciences 47 , 892–902 (2022). Broyles, S.S. Vaccinia virus transcription. The Journal of general virology 84 , 2293–2303 (2003). Jones, E.V., Puckett, C. & Moss, B. DNA-dependent RNA polymerase subunits encoded within the vaccinia virus genome. Journal of virology 61 , 1765–1771 (1987). Baroudy, B.M. & Moss, B. Purification and characterization of a DNA-dependent RNA polymerase from vaccinia virions. The Journal of biological chemistry 255 , 4372–4380 (1980). Munyon, W., Paoletti, E. & Grace, J.T. RNA polymerase activity in purified infectious vaccinia virus. Proceedings of the National Academy of Sciences 58 , 2280-2287 (1967). Vos, J.C., Sasker, M. & Stunnenberg, H.G. Vaccinia virus capping enzyme is a transcription initiation factor. The EMBO journal 10 , 2553–2558 (1991). Gershon, P.D., Ahn, B.Y., Garfield, M. & Moss, B. Poly(A) polymerase and a dissociable polyadenylation stimulatory factor encoded by vaccinia virus. Cell 66 , 1269–1278 (1991). Yang, Z., Maruri-Avidal, L., Sisler, J., Stuart, C.A. & Moss, B. Cascade regulation of vaccinia virus gene expression is modulated by multistage promoters. Virology 447 , 213–220 (2013). Yuen, L., Davison, A.J. & Moss, B. Early promoter-binding factor from vaccinia virions. Proceedings of the National Academy of Sciences 84 , 6069-6073 (1987). Gershon, P.D. & Moss, B. Early transcription factor subunits are encoded by vaccinia virus late genes. Proceedings of the National Academy of Sciences 87 , 4401-4405 (1990). Ahn, B.Y. & Moss, B. RNA polymerase-associated transcription specificity factor encoded by vaccinia virus. Proceedings of the National Academy of Sciences 89 , 3536-3540 (1992). Davison, A.J. & Moss, B. Structure of vaccinia virus early promoters. Journal of molecular biology 210 , 749–769 (1989). Venkatesan, S., Baroudy, B.M. & Moss, B. Distinctive nucleotide sequences adjacent to multiple initiation and termination sites of an early vaccinia virus gene. Cell 25 , 805–813 (1981). Harris, N., Rosales, R. & Moss, B. Transcription initiation factor activity of vaccinia virus capping enzyme is independent of mRNA guanylylation. Proceedings of the National Academy of Sciences of the United States of America 90 , 2860–2864 (1993). Baldick, C.J., Keck, J.G. & Moss, B. Mutational analysis of the core, spacer, and initiator regions of vaccinia virus intermediate-class promoters. Journal of virology 66 , 4710–4719 (1992). Vos, J.C., Sasker, M. & Stunnenberg, H.G. Promoter melting by a stage-specific vaccinia virus transcription factor is independent of the presence of RNA polymerase. Cell 65 , 105–113 (1991). Katsafanas, G.C. & Moss, B. Vaccinia virus intermediate stage transcription is complemented by Ras-GTPase-activating protein SH3 domain-binding protein (G3BP) and cytoplasmic activation/proliferation-associated protein (p137) individually or as a heterodimer. The Journal of biological chemistry 279 , 52210–52217 (2004). Sanz, P. & Moss, B. A new vaccinia virus intermediate transcription factor. Journal of virology 72 , 6880–6883 (1998). Sanz, P. & Moss, B. Identification of a transcription factor, encoded by two vaccinia virus early genes, that regulates the intermediate stage of viral gene expression. Proceedings of the National Academy of Sciences of the United States of America 96 , 2692–2697 (1999). Rosales, R., Sutter, G. & Moss, B. A cellular factor is required for transcription of vaccinia viral intermediate-stage genes. Proceedings of the National Academy of Sciences of the United States of America 91 , 3794–3798 (1994). Bartuli, J., Lorenzi, I., Backes, S., Grimm, C. & Fischer, U. A generic protocol for the affinity-purification of native macromolecular complexes from poxvirus-infected cells. STAR protocols 3 , 101116 (2022). Taddie, J.A. & Traktman, P. Genetic characterization of the vaccinia virus DNA polymerase: cytosine arabinoside resistance requires a variable lesion conferring phosphonoacetate resistance in conjunction with an invariant mutation localized to the 3'-5' exonuclease domain. Journal of Virology 67 , 4323-4336 (1993). Chatani, E., Hayashi, R., Moriyama, H. & Ueki, T. Conformational strictness required for maximum activity and stability of bovine pancreatic ribonuclease A as revealed by crystallographic study of three Phe120 mutants at 1.4 Å resolution. Protein Science 11 , 72-81 (2002). Ward, R.L. & Stevens, J.G. Effect of cytosine arabinoside on viral-specific protein synthesis in cells infected with herpes simplex virus. Journal of virology 15 , 71–80 (1975). Girbig, M. et al. Architecture of the yeast Pol III pre-termination complex and pausing mechanism on poly(dT) termination signals. Cell Reports 40 , 111316 (2022). Ravarani, C.N.J. et al. Molecular determinants underlying functional innovations of TBP and their impact on transcription initiation. Nature Communications 11 (2020). Yang, Z. et al. Expression profiling of the intermediate and late stages of poxvirus replication. Journal of virology 85 , 9899–9908 (2011). Keck, J.G., Baldick, C.J. & Moss, B. Role of DNA replication in vaccinia virus gene expression: a naked template is required for transcription of three late trans-activator genes. Cell 61 , 801–809 (1990). Punjani, A., Rubinstein, J.L., Fleet, D.J. & Brubaker, M.A. cryoSPARC: algorithms for rapid unsupervised cryo-EM structure determination. Nature Methods 14 , 290-296 (2017). Liebschner, D. et al. Macromolecular structure determination using X-rays, neutrons and electrons: recent developments in Phenix. Acta Crystallographica Section D Structural Biology 75 , 861-877 (2019). Casañal, A., Lohkamp, B. & Emsley, P. Current developments in Coot for macromolecular model building of Electron Cryo‐microscopy and Crystallographic Data. Protein Science 29 , 1055-1064 (2020). Hughes, C.S. et al. Single-pot, solid-phase-enhanced sample preparation for proteomics experiments. Nature Protocols 14 , 68-85 (2019). Rappsilber, J., Ishihama, Y. & Mann, M. Stop and Go Extraction Tips for Matrix-Assisted Laser Desorption/Ionization, Nanoelectrospray, and LC/MS Sample Pretreatment in Proteomics. Analytical Chemistry 75 , 663-670 (2003). Cox, J. & Mann, M. MaxQuant enables high peptide identification rates, individualized p.p.b.-range mass accuracies and proteome-wide protein quantification. Nature Biotechnology 26 , 1367-1372 (2008). Cox, J. et al. Accurate Proteome-wide Label-free Quantification by Delayed Normalization and Maximal Peptide Ratio Extraction, Termed MaxLFQ*. Molecular & Cellular Proteomics 13 , 2513-2526 (2014). Luo, Y., Hagler, J. & Shuman, S. Discrete functional stages of vaccinia virus early transcription during a single round of RNA synthesis in vitro. Journal of Biological Chemistry 266 , 13303-13310 (1991). Chari, A. et al. An assembly chaperone collaborates with the SMN complex to generate spliceosomal SnRNPs. Cell 135 , 497-509 (2008). Neuenkirchen, N. et al. Reconstitution of the human U sn RNP assembly machinery reveals stepwise Sm protein organization. The EMBO Journal 34 , 1925-1941 (2015). Bochnig, P., Reuter, R., Bringmann, P. & Lührmann, R. A monoclonal antibody against 2,2,7‐trimethylguanosine that reacts with intact, class U, small nuclear ribonucleoproteins as well as with 7‐methylguanosine‐capped RNAs. European Journal of Biochemistry 168 , 461-467 (1987). Schneider, C.A., Rasband, W.S. & Eliceiri, K.W. NIH Image to ImageJ: 25 years of image analysis. Nature Methods 9 , 671-675 (2012). Kosa, P.F., Ghosh, G., Dedecker, B.S. & Sigler, P.B. The 2.1-Å crystal structure of an archaeal preinitiation complex: TATA-box-binding protein/transcription factor (II)B core/TATA-box. Proceedings of the National Academy of Sciences 94 , 6042-6047 (1997). Chen, X. et al. Structural insights into preinitiation complex assembly on core promoters. Science 372 , eaba8490 (2021). Abascal-Palacios, G., Ramsay, E.P., Beuron, F., Morris, E. & Vannini, A. Structural basis of RNA polymerase III transcription initiation. Nature 553 , 301-306 (2018). Perez-Riverol, Y. et al. The PRIDE database at 20 years: 2025 update. Nucleic Acids Research 53 , D543-D553 (2025). Sanchez-Garcia, R. et al. DeepEMhancer: a deep learning solution for cryo-EM volume post-processing. Commun Biol 4 , 874 (2021). Table 1 Table 1 is available in the Supplementary Files section. Additional Declarations There is NO Competing Interest. Supplementary Files Extendeddatalegends.docx Supplementarytable1.xlsx Supplementary table 1 SupplementalVideoS1.mpg Supplementary Video 1 ExtendedDataFigure1II.pdf Extended Data Figure 1 ExtendedDataFigure2II.pdf Extended Data Figure 2 ExtendedDataFigure3II.pdf Extended Data Figure 3 Table1.docx Cite Share Download PDF Status: Published Journal Publication published 18 Feb, 2026 Read the published version in Nature Communications → Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7417495","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":506825396,"identity":"f6586271-9860-4225-8370-382de96f720d","order_by":0,"name":"Utz Fischer","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABI0lEQVRIie2PsUrEQBCGJyyszZ11UuUVJhzkFAt9lEggNgcnpBGEGBGSRnsb38E0EruVhaTZBwhccREhnZDDxgMLRwNWe8J1Ivuxy8LsfPwzAAbDX+UMAehYLYA9VKz0+0FtO6erBoXhFsrwy+2f6m8KLvMWxGniTnduuvNxuQfYhNVqXcq5e8SKVqdUEIBA6T1e1/5irGxSovDWUXK/EDzWxZAiWI8ioE6+GGf2xUMzm4CXSfTSkW9rFRpbYBLgsuMxKeA38zc4HpTpu1ZhQAqjFM7ZoMwYPJHiwsjXre9UEYivXe5VxJw7Ug5VN7Eu1Qki47FusF1ZP7fiI3Gxrqz+NUvAycMXa10eoJtfFb0uhhD6MsoN/Ztx060Vg8Fg+J98AiZZY/9+jRx7AAAAAElFTkSuQmCC","orcid":"https://orcid.org/0000-0002-1465-6591","institution":"University of Würzburg","correspondingAuthor":true,"prefix":"","firstName":"Utz","middleName":"","lastName":"Fischer","suffix":""},{"id":506825397,"identity":"f0e42b0d-f6c4-4099-8b90-384ad41daf9a","order_by":1,"name":"Stefan Jungwirth","email":"","orcid":"https://orcid.org/0000-0002-4787-8115","institution":"University of Würzburg","correspondingAuthor":false,"prefix":"","firstName":"Stefan","middleName":"","lastName":"Jungwirth","suffix":""},{"id":506825398,"identity":"d3997e4e-b553-46cb-a8d0-cce1c95385f6","order_by":2,"name":"Julia Bartuli","email":"","orcid":"","institution":"University of Würzburg","correspondingAuthor":false,"prefix":"","firstName":"Julia","middleName":"","lastName":"Bartuli","suffix":""},{"id":506825399,"identity":"db576bf9-28dd-4f34-8c5d-3f8f51c462cd","order_by":3,"name":"Stephanie Lamer","email":"","orcid":"","institution":"Rudolf Virchow Center for Experimental Biomedicine","correspondingAuthor":false,"prefix":"","firstName":"Stephanie","middleName":"","lastName":"Lamer","suffix":""},{"id":506825400,"identity":"1c4ad0a0-514e-4393-b7f8-62f1cd3cf664","order_by":4,"name":"Andreas Schlosser","email":"","orcid":"","institution":"Rudolf Virchow Center for Experimental Biomedicine","correspondingAuthor":false,"prefix":"","firstName":"Andreas","middleName":"","lastName":"Schlosser","suffix":""},{"id":506825401,"identity":"ef31ca7e-7cab-467b-9ce3-0c0e20c8164d","order_by":5,"name":"Clemens Grimm","email":"","orcid":"https://orcid.org/0000-0001-9085-5130","institution":"University of Würzburg","correspondingAuthor":false,"prefix":"","firstName":"Clemens","middleName":"","lastName":"Grimm","suffix":""}],"badges":[],"createdAt":"2025-08-20 12:30:15","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7417495/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7417495/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1038/s41467-026-69571-1","type":"published","date":"2026-02-18T05:00:00+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":91054089,"identity":"fe5da188-9b8d-4f1d-bec3-5b7d1ce60084","added_by":"auto","created_at":"2025-09-11 07:35:59","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":689932,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ePurification of the Vaccinia iPIC.\u003c/strong\u003e (A) Protein composition of complete vRNAP (lane 1), vRNAP\u003csup\u003eAraC\u003c/sup\u003e (lane 2) and the iPIC (lane 3). Nucleic acid staining is shown below; a molecular weight marker is shown on the left and respective proteins are indicated on the right. In the protein staining, the 70 bp \u003cem\u003eG8R\u003c/em\u003e promoter scaffold is indicated with one asterisk, whereas two asterisks show tRNA\u003csup\u003eGln\u003c/sup\u003e. (B) Mass-spectrometry based protein comparison of FLAG-IP eluates from GLV-1h439 infected HeLa S3 cells in presence and absence of AraC during infection. The log\u003csub\u003e10\u003c/sub\u003e LFQ intensity is plotted against the log\u003csub\u003e2\u003c/sub\u003e ratio of +/- AraC normalized on the FLAG-tagged subunit Rpo132. The early transcription factors Rap94, VETF-s/l, and NPH-I are highlighted orange, the intermediate transcription factor subunits VITF-3s/l are depicted purple and the vRNAP core subunits as well as the capping enzyme D1/D12 shown in cyan. (C) The 70 bp DNA scaffold based on the \u003cem\u003eG8R\u003c/em\u003e promoter ranging from -35 to +35 in respect to the TSS used for the reconstitution of the iPIC. The core element from -26 to -13, initiator element from -1 to +3, as well as the mismatch bubble on the template strand from -5 to +8, are indicated.\u003c/p\u003e","description":"","filename":"Figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-7417495/v1/82d97d69121be48acf97de07.png"},{"id":91055522,"identity":"97b077f4-5fd8-4e07-a134-6e91d9ccbd77","added_by":"auto","created_at":"2025-09-11 07:51:59","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":2449099,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eStructure of the iPIC at 2.4 Å resolution.\u003c/strong\u003e (A) Three orthogonal views of the iPIC cryo EM density enhanced with DeepEMhancer\u003csup\u003e67\u003c/sup\u003e. The core viral RNA polymerase is colored grey, VITF-3s/l are green and magenta respectively, the CE subunits D1/D12 are shown in dark- and lightblue and template and non-template strands are depicted darkblue and blue. This color code remains consistent throughout the figures. (B) The protein content of the iPIC shown as transperent accessable surface model and the solvent-accessible surface of the DNA. Disordered DNA regions were reconstructed manually. The active site Mg\u003csup\u003e2+\u003c/sup\u003e is marked by a magenta sphere. The orientation resembles the middle view of the iPIC in panel (A). (C) Transition of the CE structure found in the iPIC (black outline) into the CCC structure (colored cartoon) by a movement of module 2. The three catalytic centers and the positon of synthesized RNA are indicated. (D) Cryo-EM density of the iPIC\u003csub\u003eCEm\u003c/sub\u003e-subset lacking density for module 2 of the CE.\u003c/p\u003e","description":"","filename":"Figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-7417495/v1/0bcbb68e13cdd91b3615c186.png"},{"id":91055288,"identity":"5558ac66-5318-4023-8965-8bbf93cc5200","added_by":"auto","created_at":"2025-09-11 07:43:59","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":1440136,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe structure of the iPIC (B) more closely resembles the CCC (A) than the ePIC (C).\u003c/strong\u003e Solvent-accessible surface models of vRNAP complexes with cartoon representations of DNA, RNA and TFs on top (PDB entries: CCC: 7AMV, iPIC: 8P0J, ePIC: 6RIE). Schemes of corresponding structures are depicted at the bottom. Protein names and functional elements are indicated.\u003c/p\u003e","description":"","filename":"Figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-7417495/v1/21c64114de499f8dd1435002.png"},{"id":91054091,"identity":"e8d08cee-2cd2-4884-a87c-2245cee66c20","added_by":"auto","created_at":"2025-09-11 07:35:59","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":715106,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003evRNAP, CE and VITF-3 enable intermediate transcription and co-transcriptional capping \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003ein vitro\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e.\u003c/strong\u003e (A) Protein composition of vRNAP complexes used for transcription assays. Complete vRNAP (lane 1), vRNAP\u003csup\u003eAraC\u003c/sup\u003e (lane 2) and vRNAP\u003csup\u003eAraC\u003c/sup\u003e with recombinant VITF-3 (lane 3) were separated by SDS-PAGE and visualized by silver staining. A molecular weight marker and protein names are indicated on the left and right side, respectively. (B) Analysis of the promoter specificity provided by different vRNAP complexes. The vRNAP complexes shown in (A) were tested on early, intermediate (\u003cem\u003eG8R\u003c/em\u003e) and late (\u003cem\u003eA9L\u003c/em\u003e) promoter-containing templates in \u003cem\u003ein vitro\u003c/em\u003e transcription assays\u003csup\u003e37,58\u003c/sup\u003e. The composition of the assay is indicated on top, and the size of RNA products is indicated on the left, whereas early transcription yields a properly terminated product (TP) and a run-off product (RO). (C) Analysis of the 5’-end of \u003cem\u003ein vitro\u003c/em\u003e transcribed intermediate RNAs in respect to m\u003csup\u003e7\u003c/sup\u003eGpppN cap modifications. Transcripts of early, intermediate and T7 reactions were pooled and immunoprecipitated with the m\u003csup\u003e7\u003c/sup\u003eG-cap specific monoclonal antibody H-20\u003csup\u003e61\u003c/sup\u003e. Immunoprecipitated RNAs were separated by PAGE and visualized via radioautography. (D) Quantification of signal intensities from (C). Bars represent means ± SD of at least three biological replicates (dots).\u003c/p\u003e","description":"","filename":"Figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-7417495/v1/6909226332b9c7e938605d8c.png"},{"id":91054100,"identity":"d20acf88-6e84-49cb-9920-877932b24f72","added_by":"auto","created_at":"2025-09-11 07:35:59","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":2472760,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003evRNAP-assisted loading of the ring-shaped VITF-3 onto the upstream promoter.\u003c/strong\u003e (A) Domain architecture of VITF-3s and VITF-3l with functional elements indicated. (B) Cartoon depiction of VITF-3 bound to the upstream promoter in two orthogonal views. Protein names and functional elements are shown. The inserted box shows the location in the iPIC. (C) Electrostatic Poisson-Boltzmann potential mapped on the surface of VITF-3. Blue indicates positive, and red a negative electrostatic potential. (D) Isoleucin 19 of VITF-3l intercalating into the minor groove of the promoter DNA at position -21/-22. (E) Isoleucin 196 of VITF-3l intercalating into the minor groove of the promoter DNA at position -18/-19. (F) Electrophoretic mobility shift assay using radio-labelled intermediate promoter-containing DNA and randomized DNA both holding a DNA mismatch bubble from position -5 to +8. VITF-3, vRNAP\u003csup\u003eAraC\u003c/sup\u003e or both were added as indicated above. Schematic illustrations of formed complexes are given on the right.\u003c/p\u003e","description":"","filename":"Figure5.png","url":"https://assets-eu.researchsquare.com/files/rs-7417495/v1/a6feb2e4afff7f814cc40fd6.png"},{"id":91054090,"identity":"c609d603-b5db-45a1-9526-26ca9e2c8497","added_by":"auto","created_at":"2025-09-11 07:35:59","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":2274328,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003evRNAP detects the TSS and stabilizes melted DNA strands in the iPIC.\u003c/strong\u003e The inserted boxes indicate the location in the iPIC structure. (A) Schematic illustration of the iPIC, wherein important features are indicated. (B) Overview of the DNA scaffold embedded in the vRNAP cleft. The clamp has been removed for clarity and the DNA is depicted as cartoon model surrounded by its cryo-EM density. (C) DNA strand separation by the VITF-3s FL and FL 1 of Rpo147 at the trailing fork point. The DNA is depicted as cartoon model surrounded by its cryo-EM density. (D) Base-specific read-out of the TAAA motif at the leading fork point mediated by the Rpo132 lobe domain. Important domains, residues and bases are indicated. (E) Close-up view into the Rpo147 bridge helix contacting the template strand. (F) Intercalation of the VITF-3s NTD into the RNA exit channel along the outside of vRNAP and CE.\u003c/p\u003e","description":"","filename":"Figure6.png","url":"https://assets-eu.researchsquare.com/files/rs-7417495/v1/a3265d93ec3d0bc210a11aca.png"},{"id":91054098,"identity":"9725b5b5-89f9-4ac6-995c-dad933084cb9","added_by":"auto","created_at":"2025-09-11 07:35:59","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":2735476,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eVaccinia transcription factors evolved from canonical TBP.\u003c/strong\u003e (A) Development of the TBP secondary structure from a monopartite TBP prototype over RNAse A to bipartite canonical TBP and its homologs in Vaccinia. (B) Cartoon illustrations of the structures of RNAse A (1FS3)\u003csup\u003e45\u003c/sup\u003e, TBP (1YTB)\u003csup\u003e7\u003c/sup\u003e, VETF-l (6RFL)\u003csup\u003e19\u003c/sup\u003e and VITF-3 (8P0J). (C) Structural comparison of the TBP/TFIIB pairs and their homologs from PICs of archaeal RNAP (manually modelled from PDB entry 1AIS)\u003csup\u003e63\u003c/sup\u003e, RNAP II (7EGC)\u003csup\u003e64\u003c/sup\u003e, RNAP III (6EU0)\u003csup\u003e65\u003c/sup\u003e, as well as the Vaccinia ePIC (7AMV)\u003csup\u003e18\u003c/sup\u003e and iPIC (8P0J).\u003c/p\u003e","description":"","filename":"Figure7.png","url":"https://assets-eu.researchsquare.com/files/rs-7417495/v1/58d3d39e1a014c73923edaa3.png"},{"id":102977084,"identity":"2a406edd-28f2-4b34-9ebc-7275f7e66922","added_by":"auto","created_at":"2026-02-19 08:06:06","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":17512817,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7417495/v1/5b29aae1-0004-4033-8f06-88e142e5e649.pdf"},{"id":91054087,"identity":"f6706fe2-bbe7-45a6-8426-fff6d1443ee2","added_by":"auto","created_at":"2025-09-11 07:35:59","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":17683,"visible":true,"origin":"","legend":"","description":"","filename":"Extendeddatalegends.docx","url":"https://assets-eu.researchsquare.com/files/rs-7417495/v1/091dbb33c451276726feb8ec.docx"},{"id":91054088,"identity":"afca511a-a0f8-4c00-828e-5dc5cc6fc33e","added_by":"auto","created_at":"2025-09-11 07:35:59","extension":"xlsx","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":11693,"visible":true,"origin":"","legend":"Supplementary table 1","description":"","filename":"Supplementarytable1.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-7417495/v1/1b233c7e3a7d1561db8e02ee.xlsx"},{"id":91055292,"identity":"92c9c1a8-fe69-47e5-be31-48bab8e99fa6","added_by":"auto","created_at":"2025-09-11 07:43:59","extension":"mpg","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":7929770,"visible":true,"origin":"","legend":"Supplementary Video 1","description":"","filename":"SupplementalVideoS1.mpg","url":"https://assets-eu.researchsquare.com/files/rs-7417495/v1/78f2c1638bb9dc8eaf9c90ce.mpg"},{"id":91054094,"identity":"4d277626-8c86-4275-992d-f0d801572da7","added_by":"auto","created_at":"2025-09-11 07:35:59","extension":"pdf","order_by":4,"title":"","display":"","copyAsset":false,"role":"supplement","size":354817,"visible":true,"origin":"","legend":"Extended Data Figure 1","description":"","filename":"ExtendedDataFigure1II.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7417495/v1/3803a9b71bef4d6b23df75fb.pdf"},{"id":91055291,"identity":"bf421eaa-2c89-42a0-8c46-61d9647cccf6","added_by":"auto","created_at":"2025-09-11 07:43:59","extension":"pdf","order_by":5,"title":"","display":"","copyAsset":false,"role":"supplement","size":829343,"visible":true,"origin":"","legend":"Extended Data Figure 2","description":"","filename":"ExtendedDataFigure2II.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7417495/v1/d2f11097b170b974bd991b74.pdf"},{"id":91054097,"identity":"00035ef8-8d18-4eb6-b7bb-d5d59c00cca5","added_by":"auto","created_at":"2025-09-11 07:35:59","extension":"pdf","order_by":6,"title":"","display":"","copyAsset":false,"role":"supplement","size":226452,"visible":true,"origin":"","legend":"Extended Data Figure 3","description":"","filename":"ExtendedDataFigure3II.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7417495/v1/519d04d7d31771ea473c7eeb.pdf"},{"id":91055290,"identity":"29ea09aa-cf23-4d87-9e0f-eb8e19ac728d","added_by":"auto","created_at":"2025-09-11 07:43:59","extension":"docx","order_by":7,"title":"","display":"","copyAsset":false,"role":"supplement","size":17069,"visible":true,"origin":"","legend":"","description":"","filename":"Table1.docx","url":"https://assets-eu.researchsquare.com/files/rs-7417495/v1/4c299bda8b044c7335f834d1.docx"}],"financialInterests":"There is \u003cb\u003eNO\u003c/b\u003e Competing Interest.","formattedTitle":"Cooperative Clamp-Mediated Promoter Recognition by Poxviral RNAP and Its TBP/TFIIB-Like Partner","fulltext":[{"header":"Introduction","content":"\u003cp\u003eThe initiation of transcription is a fundamental process across all domains of life, requiring the assembly of a pre-initiation complex (PIC) at precisely defined regions within gene promoters\u003csup\u003e\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u003c/sup\u003e. Eukaryotic and archaeal multi-subunit DNA-dependent RNA polymerases (RNAPs), including RNAPs II and III utilize a core set of two universally conserved transcription factors (TFs) for transcription initiation\u003csup\u003e\u003cspan additionalcitationids=\"CR3 CR4\" citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u003c/sup\u003e. One of these is TATA-box binding protein (TBP), which binds the TATA box of RNAP II/III genes and connects the polymerase to its cognate promoter\u003csup\u003e\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u003c/sup\u003e. TATA-box binding is mediated by a conserved domain comprising two repeats that fold into a saddle-like structure. This domain interacts with DNA via the minor groove, inducing bending and melting of the duplex to recruit additional factors and stabilize the PIC\u003csup\u003e\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e,\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u003c/sup\u003e. Remarkably, TBP is not strictly required for basal transcription initiation at RNAP I promoters and structural studies show no resolved density for TBP in cryogenic electron microscopy (cryo-EM) reconstructions of RNAP I PICs\u003csup\u003e\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u003c/sup\u003e. Instead, it acts as a coactivator, enhancing initiation rates by stabilizing promoter interactions\u003csup\u003e\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e,\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e\u003c/sup\u003e. In addition to genuine TBP, several TBP-related proteins or TBP-like factors (TBPLFs) have been identified in metazoans, but their mode of action in transcription initiation is understood in only a few cases\u003csup\u003e\u003cspan additionalcitationids=\"CR11\" citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e\u003cp\u003eThe second universally conserved TF belongs to the TFIIB-related protein (TFBRP) family. Its name-giving member TFIIB serves multiple functions in RNAP II transcription, including stabilizing the DNA-TBP complex and assisting RNAP II recruitment to the promoter\u003csup\u003e\u003cspan additionalcitationids=\"CR14\" citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e\u003c/sup\u003e. Other TFBRPs perform similar tasks but employ interactions that differ partially or entirely from the canonical RNAP II system\u003csup\u003e\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e,\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e\u003cp\u003eRecent studies on poxviruses provided unexpected insight into the evolution of TBP/TFIIB pairs involved in the transcription by multi-subunit RNAPs\u003csup\u003e\u003cspan additionalcitationids=\"CR19\" citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e\u003c/sup\u003e. Poxviruses are double-stranded DNA viruses that replicate and express their genomes in the cytoplasm of their hosts using their own transcription and replication machinery\u003csup\u003e\u003cspan additionalcitationids=\"CR22\" citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e\u003c/sup\u003e. Structural and functional investigations on the prototypic poxvirus Vaccinia have revealed an elaborate transcription apparatus centered around a virus-encoded multi-subunit RNA polymerase (vRNAP)\u003csup\u003e\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e,\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e\u003c/sup\u003e. This complex, composed of eight subunits (Rpo147, Rpo132, Rpo35, Rpo30, Rpo22, Rpo19, Rpo18, and Rpo7), transcribes all poxviral genes\u003csup\u003e\u003cspan additionalcitationids=\"CR25 CR26\" citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e\u003c/sup\u003e. For co-transcriptional RNA processing and transcription termination, vRNAP cooperates with further virus-encoded factors including the heterodimeric capping enzyme (CE)\u003csup\u003e\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e,\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e,\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e\u003cp\u003eDuring the viral replication cycle, vRNAP is directed to specific promoters through specialized transcription and processing factors, enabling the coordinated expression of early, intermediate, and late genes\u003csup\u003e\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e,\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e\u003c/sup\u003e. Transcription initiation at early promoters requires the heterodimeric Vaccinia early transcription factor (VETF-l and -s) and Rap94 to assemble the early pre-initiation complex (ePIC)\u003csup\u003e\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e,\u003cspan additionalcitationids=\"CR32 CR33 CR34\" citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e\u003c/sup\u003e. Rap94 is a multifunctional protein containing a TFIIB homology domain, whereas VETF-l possesses a unique TBP-like domain (TBPLD), defining VETF-l and Rap94 as a TBP/TFIIB pair\u003csup\u003e\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e,\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e\u003c/sup\u003e. Unlike the symmetric binding of TBP to the minor groove of the TATA-box, the TBPLD of VETF-l recognizes early gene promoters by asymmetrically contacting the major groove\u003csup\u003e\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e,\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e,\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e\u003c/sup\u003e. The CE is not part of the ePIC but assembles with the elongating vRNAP for co-transcriptional capping and termination\u003csup\u003e\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e,\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e\u003cp\u003eTranscription of intermediate genes relies on a distinct set of virus-encoded factors that act together with vRNAP\u003csup\u003e\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e\u003c/sup\u003e. Intermediate promoters comprise the consensus-lacking, but AT-rich core element separated by a 12-base pair (bp) spacer from the initiator element, which contains the strictly conserved TAAA motif spanning positions \u0026minus;\u0026thinsp;1 to +\u0026thinsp;3\u003csup\u003e37,38\u003c/sup\u003e. Several intermediate TFs have been identified, including CE, Vaccinia intermediate transcription factor 3 (VITF-3) consisting of subunits VITF-3s and VITF-3l as well as the host factors G3BP1 and p137\u003csup\u003e39\u0026ndash;42\u003c/sup\u003e. Biochemical studies suggested that the VITF-3s/l heterodimer recognizes the AT-rich core element, but its precise role in intermediate PIC (iPIC) assembly and its mode of function in transcription remains unknown\u003csup\u003e\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e,\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e\u003cp\u003eIn this study, we established a strategy to isolate Vaccinia intermediate transcription complexes enabling their investigation by biochemical and structural approaches. We identify the heterodimeric VITF-3 as a TBP/TFIIB pair that acts in a radically different manner than other known TBP/TFIIB pairs. The cryo-EM structure of the iPIC shows that the VITF-3 heterodimer forms a closed ring around the AT-rich upstream element, anchoring the vRNAP and the viral CE at the promoter. The biochemical dissection of PIC assembly revealed a previously unknown mechanism that requires VITF-3 loading onto the intermediate promoter and direct promoter recognition facilitated by vRNAP.\u003c/p\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\u003ch2\u003ePurification of the Vaccinia intermediate pre-initiation complex\u003c/h2\u003e\u003cp\u003eTo investigate poxviral intermediate gene expression we modified a previously established method for the isolation of vRNAP complexes from infected HeLa S3 cells\u003csup\u003e\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e,\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e\u003c/sup\u003e. This procedure relies on the recombinant Vaccinia strain GLV-1h439 expressing the FLAG-tagged vRNAP subunit Rpo132 and allows for the purification of early transcription complexes (i.e. core and complete vRNAPs, Fig.\u0026nbsp;1A, lane 1)\u003csup\u003e\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e\u003c/sup\u003e. To selectively enrich intermediate transcription complexes, we modified our purification protocol by infecting cells in presence of the replication inhibitor cytosine β-D-arabinofuranoside (AraC) prior to vRNAP purification\u003csup\u003e\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e\u003c/sup\u003e. This treatment prevents the progression of viral infection into the replicative stage but allows early transcription and thus enrichment of early gene products including both subunits of VITF-3. vRNAP was affinity-purified from AraC-treated infected cells and its composition was compared with vRNAP isolated from untreated infected cells by SDS-PAGE and mass spectrometry (Fig.\u0026nbsp;1A, lanes 1 and 2; Fig.\u0026nbsp;1B; see also Extended Fig.\u0026nbsp;1A for the investigation of the purified complex by gradient centrifugation). vRNAP core subunits and the heterodimeric CE were equally enriched in both purifications, showing that AraC treatment did not interfere with the expression of early transcripts including those encoding the subunits of the core polymerase. However, the early TFs VETF-s/l, Rap94, NPH-I and E11, all of which are encoded by late genes, were selectively depleted from vRNAP-complexes purified from AraC-treated cells. Instead, vRNAP complexes contained both VITF-3 subunits albeit in sub-stoichiometric amounts (see Fig.\u0026nbsp;1A for the analysis of isolated vRNAP complexes by SDS-PAGE and Fig.\u0026nbsp;1B for their analysis by mass spectrometry). The purified complex consisting of vRNAP and CE will be referred to as vRNAP\u003csup\u003eAraC\u003c/sup\u003e throughout this manuscript. To further enhance the association of VITF-3 with vRNAP\u003csup\u003eAraC\u003c/sup\u003e we added a 70 bp intermediate promoter scaffold to the lysate of AraC-treated HeLa cells prior to purification (Fig.\u0026nbsp;1C). This allowed for the efficient isolation of a stable and stoichiometric complex composed of vRNAP, VITF-3, CE and promoter scaffold (Fig.\u0026nbsp;1A, lane 3, see also Extended Fig.\u0026nbsp;1B for the analysis of this complex by gradient centrifugation). Based on its composition, the purified complex constitutes a bona fide iPIC or an intermediate initial transcribing complex (iITC).\u003c/p\u003e\u003c/div\u003e\n\u003ch3\u003eStructure of the iPIC at 2.4 Å resolution\u003c/h3\u003e\n\u003cp\u003eWe analyzed the purified vRNAP complex by means of cryo-EM. A dataset containing about 9\u0026nbsp;million particles allowed for a 2.4 \u0026Aring; reconstruction and building of an almost complete model (Fig.\u0026nbsp;2A, Table\u0026nbsp;1 for data collection, reconstruction and model refinement statistics; see also Extended Fig.\u0026nbsp;2). The reconstruction shows density for core vRNAP at very high (\u0026lt;\u0026thinsp;2 \u0026Aring; local) resolution including the promoter DNA from position \u0026minus;\u0026thinsp;30 to +\u0026thinsp;14, as well as the VITF-3 heterodimer and CE. The DNA is bound deep inside the vRNAP cleft with the transcription start site (TSS) in close vicinity to the active site. Since a DNA/RNA hybrid is clearly absent, the structure represents the iPIC rather than an iITC. The bubble region is centered around the active site with both nucleic acid strands widely separated indicating an open complex conformation (Fig.\u0026nbsp;2B). Remarkably, the heterodimeric VITF-3 forms a ring enclosing the upstream AT-rich element at the promoter from \u0026minus;\u0026thinsp;25 to -15 and guides the DNA into the vRNAP cleft by introducing a 90\u0026deg; kink in the helix axis. VITF-3 is supported by the vRNAP wall and protrusion domains on one side and by the CE on the other, leading to a rugged integration into the iPIC.\u003c/p\u003e\u003cp\u003eWhile being tightly associated with the iPIC, the CE subunits D1 and D12 are divided into two modules (Fig.\u0026nbsp;2A and C). The first consists of the N-terminal part of D1, whereas the second module holds the C-terminus of D1 bound to D12. We observed in the 3D classes of the iPIC that module 1 always occupies the same binding surface with Rpo147 and Rpo18, whereas the density of module 2 is either contacting VITF-3s or remains flexible (Fig.\u0026nbsp;2C and D, see also Extended Fig.\u0026nbsp;2A). The letter resulted in a particle subset lacking module 2, which we termed iPIC\u003csub\u003eCEm\u003c/sub\u003e.\u003c/p\u003e\n\u003ch3\u003eThe iPIC structure resembles the co-transcriptional capping complex\u003c/h3\u003e\n\u003cp\u003eStructural comparison of the iPIC with previously resolved vRNAP assemblies showed that it most closely resembles the co-transcriptional capping complex (CCC) that forms during early transcription (compare Fig.\u0026nbsp;3A and B)\u003csup\u003e\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e,\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e\u003c/sup\u003e. Both complexes consist of all vRNAP subunits, DNA, and the CE heterodimer, but only the CCC contains nascent mRNA. In the latter, module 2 of the CE interacts with the upstream DNA and Rpo132 on one side of the cleft, while module 1 stably associates with Rpo147 on the other side. In the iPIC, module 1 occupies a similar position as in the CCC but module 2 is displaced upward, as its binding interfaces on the upstream DNA and Rpo132 are occupied by VITF-3. As a result, module 2 either contacts the VITF-3 dimer or remains flexible (Fig.\u0026nbsp;3A and B, see also Fig.\u0026nbsp;2). Interestingly, the RNA exit channel that accommodates the nascent RNA chain in the CCC is occupied in the iPIC by the N-terminus of VITF-3s, which constitutes a TFIIB reader-like element (BRLE, see also below). The overall structural similarity between the iPIC and CCC suggests that the iPIC transitions into the CCC upon initiation of transcription and promoter escape, which is further supported by biochemical experiments shown below. In contrast, the iPIC differs significantly from the ePIC in structure and composition (Fig.\u0026nbsp;3B, C)\u003csup\u003e\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u003c/sup\u003e. In the ePIC, promoter recognition is mediated by the VETF-s/l heterodimer bridging the polymerase cleft, as well as by Rap94, which is wrapped around vRNAP. Unlike the iPIC, the CE is not included in the ePIC but re-associates during initial transcription to facilitate the transition into the CCC\u003csup\u003e\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u003c/sup\u003e. Early and intermediate TFs hence adopt distinct conformations and engage in different interactions, contributing to the pronounced structural differences between the two Vaccinia PIC structures.\u003c/p\u003e\u003cp\u003e\u003cb\u003evRNAP, CE and VITF-3 enable intermediate transcription and co-transcriptional capping\u003c/b\u003e \u003cb\u003ein vitro\u003c/b\u003e\u003c/p\u003e\u003cp\u003eWe next investigated whether the assembly of the iPIC leads to productive transcription in an intermediate promoter dependent manner. To assess this question, we performed \u003cem\u003ein vitro\u003c/em\u003e transcription assays on templates under the control of early, intermediate, and late promoters using isolated complete vRNAP or vRNAP\u003csup\u003eAraC\u003c/sup\u003e in presence or absence of recombinant VITF-3 (Fig.\u0026nbsp;4A and B). As expected, complete vRNAP, which constitutes an \u0026ldquo;all in one\u0026rdquo; unit combining vRNAP with early transcription and processing factors, efficiently transcribed the template under control of the early promoter (Fig.\u0026nbsp;4B, lane 1), whereas no transcription was observed on templates with intermediate (\u003cem\u003eG8R\u003c/em\u003e) or late (\u003cem\u003eA9L\u003c/em\u003e) promoters (Fig.\u0026nbsp;4B, lanes 4 and 7). In contrast, vRNAP\u003csup\u003eAraC\u003c/sup\u003e failed to transcribe templates with early and late promoters (Fig.\u0026nbsp;4B, lanes 2 and 8). However, it enabled intermediate transcription albeit at a very low level (Fig.\u0026nbsp;4B, lane 5), likely due to small amounts of VITF-3 in the vRNAP\u003csup\u003eAraC\u003c/sup\u003e preparation (see Fig.\u0026nbsp;1B). Importantly, the addition of recombinant VITF-3 selectively boosted the transcription from intermediate promoters by at least 10-fold (Fig.\u0026nbsp;4B, lane 6), indicating that vRNAP, CE and VITF-3 are necessary and sufficient for robust transcription from intermediate promoters \u003cem\u003ein vitro\u003c/em\u003e.\u003c/p\u003e\u003cp\u003eVaccinia transcripts acquire an m\u003csup\u003e\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u003c/sup\u003eGpppN cap structure when produced in infected cells and co-transcriptional capping has been shown to occur \u003cem\u003ein vitro\u003c/em\u003e using complete vRNAP\u003csup\u003e\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e,\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e\u003c/sup\u003e. To investigate whether co-transcriptional capping also occurs during intermediate transcription, [\u003csup\u003e\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e\u003c/sup\u003eP]-labelled mRNAs were generated by complete vRNAP, vRNAP\u003csup\u003eAraC\u003c/sup\u003e supplemented with recombinant VITF-3 and bacteriophage T7 RNAP as a control. The [\u003csup\u003e\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e\u003c/sup\u003eP]-labeled transcripts were pooled and analyzed by immunoprecipitation using monoclonal H-20 antibodies that specifically recognize m\u003csup\u003e\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u003c/sup\u003eG-cap structures (Fig.\u0026nbsp;4C). Early and intermediate transcripts were immunoprecipitated to approximately 25% and 90% respectively, whereas the uncapped T7 transcript remained quantitatively in the supernatant (Fig.\u0026nbsp;4C and D, see also Supplementary table \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). These results demonstrate that isolated early and intermediate viral transcription complexes efficiently generate m\u003csup\u003e\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u003c/sup\u003eG-capped transcripts \u003cem\u003ein vitro\u003c/em\u003e thus faithfully recapitulating the \u003cem\u003ein vivo\u003c/em\u003e situation.\u003c/p\u003e\n\u003ch3\u003evRNAP-assisted loading of the ring-shaped VITF-3 onto the upstream promoter\u003c/h3\u003e\n\u003cp\u003eTo investigate the mechanism of intermediate promoter recognition, we closely examined VITF-3 and its binding to DNA. Sequence analysis and structural studies showed that VITF-3 constitutes an unusual TBP/TFIIB pair with VITF-3l being the TBP-related subunit and VITF-3s the TFIIB-like subunit (Fig.\u0026nbsp;5A). The TBP-related saddle-like fold in VITF-3l enables the binding of upstream promoter DNA. However, unlike canonical TBP, it features extended \u0026ldquo;saddle flaps\u0026rdquo; that allow simultaneous interaction with both sides of VITF-3s to form a ring-shaped complex that encircles the promoter (Fig.\u0026nbsp;5B). VITF-3s contains a flexible N-terminal tail of 50 amino acids, which harbors a BRLE. As revealed by the iPIC structure, VITF-3 not only embraces the upstream core element but also induces a bend in the DNA helix axis of approximately 90\u0026deg;. Consistent with its DNA-encircling architecture, electrostatic potential mapping showed a uniformly positive charge on the inner surface of the VITF-3 ring (Fig.\u0026nbsp;5C). DNA binding is mediated by the insertion of aliphatic residues of VITF-3 into the minor groove, without significant groove widening. Specifically, two isoleucine residues intercalate into the DNA at promoter positions \u0026minus;\u0026thinsp;21/-22 (Fig.\u0026nbsp;5D) and \u0026minus;\u0026thinsp;18/-19 (Fig.\u0026nbsp;5E), disrupting Watson\u0026ndash;Crick base pairing. These interactions are primarily directed at the DNA sugar-phosphate backbone and lack obvious base-specific contacts. Because VITF-3 binding disrupts multiple base pairs, it preferentially associates with AT-rich regions of the upstream core element, where base stacking is less stable than in GC-rich sequences. This low sequence specificity is consistent with previous studies that identified the upstream core element as an AT-rich stretch lacking a defined consensus motif\u003csup\u003e\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e\u003cp\u003eThe presence of the VITF-3 ring encircling the core element in the iPIC structure raised the question of its assembly in this position. To investigate the loading mechanism, we performed electrophoretic mobility shift assays (EMSAs) using vRNAP\u003csup\u003eAraC\u003c/sup\u003e, recombinant VITF-3, and radiolabeled \u003cem\u003eG8R\u003c/em\u003e promoter DNA containing a mismatch bubble from \u0026minus;\u0026thinsp;5 to +\u0026thinsp;8 relative to the TSS (Fig.\u0026nbsp;5F; see also Fig.\u0026nbsp;1C for the DNA architecture). VITF-3 alone did not bind the DNA, despite the presence of an upstream core element within the scaffold (Fig.\u0026nbsp;5F, lanes 1\u0026ndash;4). In contrast, vRNAP\u003csup\u003eAraC\u003c/sup\u003e exhibited partial DNA binding (Fig.\u0026nbsp;5F, lanes 5\u0026ndash;7), likely reflecting the general affinity of RNAPs for DNA and in particular for DNA containing a mismatch bubble. In contrast, the presence of both VITF-3 and vRNAP\u003csup\u003eAraC\u003c/sup\u003e led to iPIC formation, as indicated by a slower-migrating complex (Fig.\u0026nbsp;5F, lanes 8\u0026ndash;10), which was also observed using a closed promoter (Fig. S3). However, when a randomized DNA scaffold retaining the same mismatch bubble was used, this higher-order complex did not form (Fig.\u0026nbsp;5F, lanes 18\u0026ndash;20). This indicates that vRNAP\u003csup\u003eAraC\u003c/sup\u003e is both necessary and sufficient to load the ring-shaped VITF-3 onto the upstream promoter region \u003cem\u003ein vitro\u003c/em\u003e. It further shows that promoter recognition is not imparted by the TF itself but rather by the core transcriptional components.\u003c/p\u003e\u003cp\u003eFurther evidence for an assisted loading mechanism of VITF-3 onto the promoter was obtained from structural studies of the iPIC. The dataset yielded in total three different iPIC conformations including iPIC\u003csub\u003eCEm\u003c/sub\u003e with mobile CE and iPIC\u003csub\u003ed\u003c/sub\u003e, which showed deep binding of the DNA within the vRNAP cleft. The third particle subset displayed a slightly shallower binding conformation of the downstream DNA (termed iPIC\u003csub\u003es\u003c/sub\u003e). Structural comparison between iPIC\u003csub\u003ed\u003c/sub\u003e and iPIC\u003csub\u003es\u003c/sub\u003e, which likely represent transitional intermediates in the DNA loading process, suggests a conformational continuum (Supplementary Video 1). The trajectory supports a concerted loading mechanism, wherein vRNAP\u003csup\u003eAraC\u003c/sup\u003e cooperatively opens the VITF-3 ring to load it onto the upstream promoter. This process forms a stable iPIC, with the VITF-3 ring clamped around the upstream promoter.\u003c/p\u003e\n\u003ch3\u003evRNAP detects the TSS and stabilizes melted DNA strands in the iPIC\u003c/h3\u003e\n\u003cp\u003eInspired by the findings described in the previous chapter, we next investigated the interactions underlying sequence-specific promoter recognition. Guided by VITF-3, the upstream DNA is directly inserted into the vRNAP cleft, where the strands are separated and positioned for transcription initiation. Since the promoter DNA around both fork points displayed a well-defined cryo-EM density in the iPIC structure, we were able to analyze the DNA pathway in detail (Fig.\u0026nbsp;6A for a schematic overview, Fig.\u0026nbsp;6B). The upstream fork point at position \u0026minus;\u0026thinsp;7 is stabilized by fork loop 1 of the Rpo147 clamp domain and by the VITF-3s fork loop (Fig.\u0026nbsp;6C), which both are simultaneously inserted into the DNA leading to strand separation. Near the downstream fork point, the melted non-template strand stably binds the lobe domain of core vRNAP (Fig.\u0026nbsp;6D). We found the previously described initiatior element, a TAAA motif at position \u0026minus;\u0026thinsp;1 to +\u0026thinsp;3 on the non-template strand, being directly read out by the vRNAP core subunits. The base specificity is generated by an area centered around the Rpo132 lobe, which contacts the bases of the initiator element via His207. This robust binding of the non-template strand stabilizes the downstream fork point and positions the +\u0026thinsp;1 base of the melted template strand next to the active site. Overall, these resuts indicate that sequence specificity in intermediate transcription is primarily provided by core vRNAP rather than its TFs.\u003c/p\u003e\u003cp\u003eAt the downstream fork point at position\u0026thinsp;+\u0026thinsp;4, three residues, Asn450, Val451, and Ile453, from the Rpo147 fork loop 2 play a key role: They separate the DNA bases of the template and non-template strands and protect them from the surrounding solvent. Aside, Asn450 directly contacts the sugar phosphate backbone between position\u0026thinsp;+\u0026thinsp;4 and +\u0026thinsp;3 of the non-template strand, where it makes a sharp turn towards the lobe-bound initiator element. In the opposite direction, the template strand is stabilized by the bridge helix of Rpo147, which is inserted between the bases at positions\u0026thinsp;+\u0026thinsp;3 and +\u0026thinsp;4 (Fig.\u0026nbsp;6E). Especially Ser750 and Thr754 stabilize the single-stranded template strand. Starting at the upstream fork point where the fork loop of VITF-3s assists in strand separation, the VITF-3s N-terminal tail is embedded along the outside of vRNAP to the catalytically active module 1 of the CE (Fig.\u0026nbsp;5F). On this pathway, the VITF-3s helix 3\u003csub\u003e10\u003c/sub\u003e and the BRLE are stabilized by interactions with vRNAP and CE. Interestingly, the comparison of iPIC and CCC showed that the N-terminal domain of VITF-3s in the iPIC occupies the same path as the emerging RNA chain in the CCC (Fig.\u0026nbsp;3A, B), suggesting a potential promoter escape mechanism (see discussion)\u003csup\u003e\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\u003ch2\u003eVaccinia transcription factors evolved from canonical TBP\u003c/h2\u003e\u003cp\u003eThe structures of iPIC and ePIC shed light on the evolutionary trajectory of the TBP fold in the context of cellular and viral PICs. The ancestral TBP prototype likely resembled a monopartite RNA-binding fold as seen in RNase A, which is composed of five antiparallel β-strands and a single α-helix (Fig.\u0026nbsp;7A, B)\u003csup\u003e\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e\u003c/sup\u003e. Canonical TBP evolved through gene duplication into a bilobal, pseudo-symmetric structure, with each lobe containing five β-strands and two α-helices\u003csup\u003e\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u003c/sup\u003e. As general TF, TBP plays a central role in the transcription systems of RNAP II, RNAP III, and archaea, where it binds promoter DNA, induces bending, and recruits TFIIB or its homologs\u003csup\u003e\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e,\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u003c/sup\u003e. Strikingly, TBP does not directly interact with the RNAP core in these systems but rather recruits TFIIB or its homologs for this purpose (Fig.\u0026nbsp;7C)\u003csup\u003e\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e\u003cp\u003eIn the context of Vaccinia early transcription, the domain architecture of the bipartite TBP homolog VETF-l differs from that of canonical TBP by featuring an extended hinge region that connects both domains\u003csup\u003e\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e\u003c/sup\u003e. As a result, the ePIC differs significantly from archaeal and eukaryotic PICs, both in the trajectory of upstream DNA and in VETF-l simultaneously contacting the DNA and vRNAP\u003csup\u003e\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e,\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u003c/sup\u003e. In Vaccinia intermediate transcription we now found VITF-3l holding a tripartite TBP fold, which manifests in an additional i-lobe and expansion segment giving VITF-3l its characteristic \u0026ldquo;U\u0026rdquo;-shape. This expanded structure enables two contact points with the TFIIB homologue VITF-3s to create a closed ring structure. Unlike TBP, VITF-3l has a large interaction surface with vRNAP at the outer side of the i-lobe domain, which is required to close the ring around the promoter. The TBP homologs bend the upstream DNA, thereby priming it for sequence readout, which is carried out by another domain of VETF-l in the ePIC or by vRNAP in the iPIC. Overall, the TBP homologs found in Vaccinia originate from a prototypic TBP fold but developed unique structural and functional features during the host-virus co-evolution. The contrasting architectures of the ePIC and iPIC illustrate how a single RNAP core can be functionally diversified through the co-evolution of stage-specific TFs. These findings not only highlight the adaptability of the viral transcription machinery but also provide a conceptual framework to understand the modular evolution of transcription systems across all domains of life.\u003c/p\u003e\u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eIn this study, we dissected intermediate-stage transcription of the prototypic poxvirus Vaccinia using a combination of biochemical enrichment, functional assays, and structural analysis. We identified the heterodimeric VITF-3 as a TBP/TFIIB pair with unique features. Unlike canonical TFs that bind the promoter prior to polymerase recruitment and PIC formation, VITF-3 does not recognize the promoter alone. Instead, it cooperates with vRNAP and CE to enable PIC formation. Furthermore, our study shows that vRNAP recognizes the intermediate promoter in a sequence-specific manner, which enables the deposition of VITF-3 onto the upstream promoter element in a clamp-loader-like fashion. This coordinated process generates the iPIC, which is primed to produce m\u003csup\u003e\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u003c/sup\u003eG-capped intermediate transcripts.\u003c/p\u003e\u003cp\u003ePrevious structural investigation of poxviral transcription focused on early vRNAP complexes as they represent the predominant form of vRNAP when isolated from infected cells\u003csup\u003e\u003cspan additionalcitationids=\"CR19\" citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e\u003c/sup\u003e. To investigate intermediate transcription, we established a protocol based on the inhibition of DNA replication, to selectively enrich early viral gene products, such as intermediate TFs and vRNAP subunits\u003csup\u003e\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e,\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e\u003c/sup\u003e. This protocol caused a nearly quantitative elimination of the early TFs from the purified vRNAP. However, the CE was stably bound to vRNAP under these conditions. In addition, we observed sub-stoichiometric amounts of VITF-3 as part of this complex indicating its intrinsic affinity to vRNAP or CE. Notably, the interaction of VITF-3 and vRNAP was significantly enhanced upon the addition of an intermediate promoter scaffold, which resulted in the formation of a stable iPIC.\u003c/p\u003e\u003cp\u003ePrevious biochemical studies have provided a detailed understanding of the factors involved in intermediate transcription within cellular extracts. This process was shown to depend on VITF-3, CE, as well as the host factors G3BP1 and p137\u003csup\u003e24,39\u0026ndash;42\u003c/sup\u003e. However, our \u003cem\u003ein vitro\u003c/em\u003e transcription assays demonstrated robust activity on intermediate templates using only a minimal set of components comprising VITF-3, CE and vRNAP. We therefore propose that G3BP1 and p137 play supportive or regulatory roles in intermediate transcription, without being essential for basal activity. In contrast to the data presented here, partially purified VITF-3 was previously shown to bind the intermediate promoter independently of vRNAP, thereby forming a committed complex\u003csup\u003e\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e\u003c/sup\u003e. However, we show that VITF-3 forms a closed stable ring even in the absence of DNA, which makes unassisted binding to the promoter rather unlikely. Nevertheless, VITF-3 may remain stably bound to the promoter when vRNAP transitions into the elongation phase, thus enabling efficient re-initiation for the subsequent transcription events.\u003c/p\u003e\u003cp\u003eOur structural analysis of the iPIC is consistent with decades-old biochemical studies of the Vaccinia intermediate promoter, highlighting an essential AT-rich, but not sequence-conserved, core element around position \u0026minus;\u0026thinsp;20\u003csup\u003e37,38\u003c/sup\u003e. This DNA motif is recognized and bent by VITF-3. As we did not observe any sequence-specific interactions between VITF-3 and its bound DNA within the iPIC, we propose that VITF-3 engages the core element through shape-based readout, sensing the physical properties of the AT-rich promoter rather than specific nucleotide identities. The spacer element spanning base pairs \u0026minus;\u0026thinsp;14 to -2 is not involved in direct protein contacts, but its length of approximately one DNA helical turn is important for exact spatial alignment of VITF-3 and vRNAP\u003csup\u003eAraC\u003c/sup\u003e on the promoter elements to form the iPIC. At the TSS, the TAAA motif of the initiator element is crucial for transcription initiation, since these four bases are directly recognized by vRNAP. Notably, a similar sequence-specific recognition mechanism has been previously described for RNAP III transcription termination highlighting the coevolution of viral and eukaryotic transcription systems\u003csup\u003e\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e\u003c/sup\u003e. We note, however, that the TAAA motif appears with high frequency in the Vaccinia genome even outside of intermediate promoters. VITF-3 may hence contribute additional promoter-selectivity by recognizing shape and flexibility of the core element.\u003c/p\u003e\u003cp\u003eThe availability of high-resolution functional ePIC and iPIC structures enabled their comparison to other known PICs formed by multi-subunit RNAPs and provides insights into the evolution of transcription initiation. Despite extensive divergence, each Vaccinia PIC contains a set of proteins with structurally conserved TBP-like and TFIIB-like folds\u003csup\u003e\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u003c/sup\u003e. Due to minimal sequence conservation, these factors were uncovered only by structural analysis or advanced bioinformatic approaches. Their conserved functionality \u0026ndash; the TBPLF binding the upstream DNA, bending and melting the promoter, and the TFBLP bridging between TBPLF and RNAP \u0026ndash; mirrors a common PIC architecture observed across all archaeal and eukaryotic systems\u003csup\u003e\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e,\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e,\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e\u003c/sup\u003e. However, poxviral TBPLFs are markedly divergent owing to increased asymmetry and structural insertions, which support the ring-shaped architecture of VITF-3 in the iPIC, and further sequence adaptations that provide new interaction surfaces. This specialized architecture allows VITF-3 to encircle the core promoter element but necessitates a dedicated mechanism for TF loading. Given the size and organization of the Vaccinia genome, it appears unlikely that the ring slides over a genome end and migrates to cognate promoters, particularly since VITF-3 lacks ATPase activity. Instead, we propose transient opening of the ring that allows its loading onto the DNA, which is supported by our \u003cem\u003ein vitro\u003c/em\u003e reconstitution experiments of the iPIC. Furthermore, our experiments suggest that ring opening (and subsequent closing around the DNA) is facilitated by vRNAP\u003csup\u003eAraC\u003c/sup\u003e. In line, our iPIC shows two slightly different conformations that likely represent snapshots of a dynamic trajectory that might inject force into the VITF-3 ring. At the same time, the two CE modules exhibit high mobility relative to each other, as observed across different transcription complexes\u003csup\u003e\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u003c/sup\u003e. We hence propose a dynamic scenario where the CE acts as the effector that initiates ring opening in the presence of DNA and mediates a clamp-loading reaction in cooperation with vRNAP.\u003c/p\u003e\u003cp\u003eBased on our study we deduce a model for the poxviral intermediate transcription cycle. In the first step, the promoter is recognized through a concerted process involving clamp-loading of VITF-3 by vRNAP\u003csup\u003eAraC\u003c/sup\u003e and positioning of vRNAP at the initiator element. These interactions bend the DNA and promote strand separation in the vRNAP cleft, leading to the formation of the iPIC. Several intermediate promoter elements are necessary for proper positioning of the transcription machinery and ensure sequence specificity. The iPIC structure is remarkably similar to an ITC or CCC with the +\u0026thinsp;1 base of the template strand positioned next to the active site, which primes the complex for initial transcription\u003csup\u003e\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e,\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e\u003c/sup\u003e. Our study further suggests that once the nascent RNA is extended to approximately 12 nucleotides, it clashes with the N-terminus of VITF-3s obstructing the RNA exit channel, which likely results in the displacement of VITF-3 followed by promoter escape. Once loaded, VITF-3 may stay bound to the core element, which would allow more efficient transcription re-initiation. Shortly after promoter escape, the nascent RNA reaches the CE, where it acquires a m⁷GpppN cap structure. The elongating intermediate vRNAP complex resembles the early elongation complex, although the CE may remain associated with vRNAP throughout transcription\u003csup\u003e\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u003c/sup\u003e. The molecular mechanism of Vaccinia intermediate transcription termination remains unknown, but an intrinsic termination mechanism appears likely since no dedicated factors have been described so far.\u003c/p\u003e\u003cp\u003eOur study provides insight into key mechanisms of Vaccinia intermediate transcription at atomic resolution and offers structural perspectives on the evolutionary innovations of viral transcription systems. Given the high sequence conservation of TFs among orthopoxviruses, our findings are also relevant to the investigation of the human pathogens MPXV and variola virus.\u003c/p\u003e"},{"header":"Methods","content":"\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\u003ch2\u003eExperimental model and study participant details\u003c/h2\u003e\u003cp\u003eMale African green monkey kidney fibroblasts (CV-1) were purchased from the American Type Culture Collection (ATCC No. CCL-70). Human HeLa S3 cells (female) came from Sigma-Aldrich (87110901). Both cell lines were cultivated routinely in 15 cm plates at 37\u0026deg;C with 5% CO\u003csub\u003e2\u003c/sub\u003e in DMEM (Gibco, 41965062) supplied with 10% FBS (Gibco, 10270106) and 1% Pen/Strep (Gibco, 15140122) if not mentioned otherwise.\u003c/p\u003e\u003cp\u003e\u003cb\u003eInfection of HeLa S3 cells with recombinant Vaccinia virus GLV-1h439 in absence and presence of AraC\u003c/b\u003e\u003c/p\u003e\u003cp\u003eFor the infection in absence or presence of AraC (Sigma-Aldrich, C1768), the medium of 80% confluent HeLa S3 cells cultivated in 15 cm dishes was changed to DMEM supplied with 10% FBS, 1% Pen/Strep and 250 \u0026micro;g/ml AraC\u003csup\u003e\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e,\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e,\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e,\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e\u003c/sup\u003e. After 1 h of incubation, the medium was changed to DMEM supplied with 2% FBS, 1% Pen/Strep and 250 \u0026micro;g/ml AraC, before cells were infected with genetically modified Vaccinia virus GLV-1h439 (Genelux Corporation), expressing FLAG/HA-tagged Rpo132, with an MOI of 10. After 1 h of incubation, DMEM supplied with 18% FBS, 1% Pen/Strep and 250 \u0026micro;g/ml AraC was added to generate a final FBS concentration of 10% and the cells were further incubated at standard conditions. 24 h after infection, the cells were detached from the plate using a cell scraper and centrifuged at 1,800 g and 4\u0026deg;C for 10 min. After discarding the supernatant, the cell pellet was flash-frozen in liquid nitrogen and stored at -80\u0026deg;C. To purify complete vRNAP, HeLa S3 were infected with an MOI of 2 over 48 h using the same virus in absence of AraC\u003csup\u003e\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e,\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\u003ch2\u003ePurification of FLAG-tagged vRNAP complexes\u003c/h2\u003e\u003cp\u003eInfected HeLa S3 cells were thawed on ice and resuspended in lysis buffer (50 mM HEPES, pH 7.5, 150 mM NaCl, 1,5 mM MgCl\u003csub\u003e2\u003c/sub\u003e, 0.5% (v/v) NP-40, 1 mM DTT, 10 \u0026micro;M leupeptin, 1.5 \u0026micro;M aprotinin, 0.2 mM PMSF and 0.1 M AEBSF). After centrifugation at 48,000 g for 40 min, the supernatant was incubated for 3 h at 4\u0026deg;C with 200 \u0026micro;l anti-FLAG M2 affinity gel (Sigma-Aldrich, A2220). The beads were washed four times with buffer containing 50 mM HEPES, pH 7.5, 150 mM NaCl, 1.5 mM MgCl\u003csub\u003e2\u003c/sub\u003e, 0.1% (v/v) NP-40 and 1 mM DTT and once with elution buffer (50 mM HEPES, pH 7.5, 150 mM NaCl, 1.5 mM MgCl\u003csub\u003e2\u003c/sub\u003e and 1 mM DTT). The bead-bound protein was eluted with elution buffer supplemented with 200 \u0026micro;g/ml 3 x FLAG peptide (Sigma-Aldrich, F4799) followed by concentrating by a Vivaspin 500 (Sartorius, VS0142) according to the vendor\u0026rsquo;s protocol. For the purification of vRNAP\u003csup\u003eAraC\u003c/sup\u003e, aliquots were prepared, flash-frozen in liquid nitrogen and stored at -80\u0026deg;C. To sufficiently purify complete vRNAP, the eluate was further purified by 10\u0026ndash;30% sucrose density gradient centrifugation at 194,000 g and 4\u0026deg;C for 16 h\u003csup\u003e\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e\u003c/sup\u003e. 200 \u0026micro;l fractions were collected manually, analyzed via SDS-PAGE and the fractions containing complete vRNAP were pooled. After concentration in a Vivaspin 500 (Sartorius, VS0142) according to the vendor\u0026rsquo;s protocol, aliquots were prepared, flash-frozen in liquid nitrogen and stored at -80\u0026deg;C.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e\u003ch2\u003ePurification of the Vaccinia iPIC\u003c/h2\u003e\u003cp\u003eHeLa S3 cells infected with GLV-1h439 in the presence of AraC were thawed on ice, before resuspending in lysis buffer (150 mM NaCl, 50 mM HEPES pH 7.5, 1.5 mM MgCl\u003csub\u003e2\u003c/sub\u003e, 0.5% (v/v) NP-40, 1 mM DTT, 10 \u0026micro;M leupeptin, 1.5 \u0026micro;M aprotinin, 0.2 mM PMSF and 0.1 M AEBSF) and incubation at 4\u0026deg;C for 20 min. The lysate was cleared by centrifugation at 48,000 g and 4\u0026deg;C for 40 min. The supernatant was supplied with ATP to a final concentration of 4 mM as well as with 10 nmol of annealed \u003cem\u003eG8R\u003c/em\u003e promoter DNA containing an artificial mismatch bubble from position \u0026minus;\u0026thinsp;5 to +\u0026thinsp;8 (Template strand: 5\u0026rsquo;CCCCCTTTATGGATTTTTATAGGGATGGAGTAAAATATAATTTGTAAATTATTTAAAGTTAAATGGCTGC3\u0026rsquo;, Nontemplate strand: 5\u0026rsquo;GCAGCCATTTAACTTTAAATAATTTACAAAAATTTAAAATGAGCATCCCTATAAAAATCCATAAAGGGGG3\u0026rsquo;). The sample was incubated at 20\u0026deg;C for 30 min under rotation, before the vRNAP complex was purified via FLAG-IP as described in the section above. The elution fractions were pooled and concentrated in a Vivaspin 500 (Sartorius, VP0142) followed by 5\u0026ndash;45% sucrose density gradient centrifugation at 194,000 g and 4\u0026deg;C for 16 h\u003csup\u003e\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e\u003c/sup\u003e. Fractions were collected manually, before analyzing them via SDS-PAGE and silver staining. The fractions containing co-migrating vRNAP\u003csup\u003eAraC\u003c/sup\u003e and endogenous VITF-3 were pooled and concentrated in a Vivaspin 500 (Sartorius, VP0142) by centrifugation at 8,000 g and 4\u0026deg;C to a concentration of 1.5 \u0026micro;g/\u0026micro;l. Afterwards, the sample was centrifuged at 15,000 g and 4\u0026deg;C for 5 min, before the supernatant was used for grid preparation. Quantifoil R1.2/1.3 Au 300 grids were glow-discharged for 90s at medium intensity using the Plasma Cleaner model PDC-002 (Harrick Plasma Ithaca, NY/USA). Per grid, 3 \u0026micro;l sample were applied at 4\u0026deg;C and 100% humidity using a Vitrobot Mark IV instrument (FEI Company). The settings used included 0 s wait time, 5 s blotting time and a blot force of 20. The grids were stored in liquid nitrogen till data collection.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e\u003ch2\u003eCryo-EM structure determination and model building\u003c/h2\u003e\u003cp\u003eThe Cryo-EM dataset of the iPIC sample was collected with a Thermo Fisher Titan Krios G3 equipped with a Falcon III camera (Thermo-Fischer). Data was acquired with EPU at 300 keV and a primary magnification of 75,000 (calibrated pixel size 1.0635 \u0026Aring;) in movie-mode with 25 fractions per movie and integrating the electron-signal. The total exposure was 50\u0026nbsp;e/\u0026Aring; over an exposure time of 4.5 s with 2 exposures per hole. The dataset was processed with Cryosparc\u003csup\u003e\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e\u003c/sup\u003e. Two cycles of 2D classification and manual selection of classes based on the appearance of their class averages for clean-up resulted in a stack of 114,430 good particles. An ab-initio map was created from a 50,000 particles subset and the full set subjected to a consensus 3D refinement. The set was then separated into three classes that represented the iPIC in three slightly different conformations (Fig. \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e). The three particle sets were finally subjected to a non-uniform refinement step and the density was docked with the previously published core vRNAP model (PDB 6RIC) and the coordinates of the two CE modules extracted from the complete vRNAP model (PDB 6RFL). The remaining density was identified as from the VITF-3s and VITF-3l and docked with aphafold2 predictions of the two polypeptides. The resulting model was then further manually adjusted in COOT and automatically refined with Phenix.real_space_refine including an ADP refinement step\u003csup\u003e\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e,\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e\u003c/sup\u003e. Secondary structure, and mild Ramachandran restraints were imposed. A total of three cycles of manual inspection and automated refinement were performed.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec15\" class=\"Section2\"\u003e\u003ch2\u003eSingle-pot, solid-phase-enhanced sample preparation (SP3) for mass spectrometry analysis of vRNAP complexes\u003c/h2\u003e\u003cp\u003eSamples were processed using an adapted SP3 protocol\u003csup\u003e\u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e\u003c/sup\u003e. In brief, the reconstitution solution was added to a final volume of 125 \u0026micro;l. DTT was added to a concentration of 5 mM and the alkylation was performed with 20 mM iodoacetamide. 10 mM additional DTT were used for quenching. Equal volumes of two types of Sera-Mag Speed Beads (Cytiva, 45152101010250 and 65152105050250) were combined, washed with water and 5 \u0026micro;L of the bead mix were added to each sample. 140 \u0026micro;l 100% ethanol were added and the samples were incubated at 24\u0026deg;C for 5 min under shaking at 1,000 rpm. The beads were immobilized on a magnetic rack for 2 min and the supernatant was removed, before two subsequent wash steps with 200 \u0026micro;l 80% ethanol (Chromasolv, Sigma) and one wash step with 1 ml 80% ethanol. The digest was performed on beads with 0.25 \u0026micro;g Trypsin (Gold, Mass Spectrometry Grade, Promega) and 0.25 \u0026micro;g Lys-C (Wako) in a total volume of 100 \u0026micro;l holding 100 mM ammonium bicarbonate at 37\u0026deg;C overnight. Peptides were desalted using C-18 Stage Tips\u003csup\u003e\u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e55\u003c/span\u003e\u003c/sup\u003e. Each Stage Tip was prepared with three discs of C-18 Empore SPE Discs (3M) in a 200 \u0026micro;l pipette tip. Peptides were eluted with 60% acetonitrile in 0.1% formic acid, dried in a vacuum concentrator (Eppendorf), and stored at -20\u0026deg;C. Peptides were dissolved in 2% acetonitrile / 0.1% formic acid prior to nanoLC-MS/MS analysis.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec16\" class=\"Section2\"\u003e\u003ch2\u003eNanoLC-MS/MS analysis\u003c/h2\u003e\u003cp\u003eNanoLC-MS/MS analysis was performed on an Orbitrap Fusion (Thermo Scientific) equipped with a PicoView Ion Source (New Objective) and coupled to an EASY-nLC 1,000 (Thermo Scientific). The peptides were loaded on a trapping column (2 cm x 150 \u0026micro;m ID, PepSep) and separated on a capillary column (30 cm x 150 \u0026micro;m ID, PepSep), both packed with 1.9 \u0026micro;m C18 ReproSil and separated by a linear gradient from 3\u0026ndash;30% acetonitrile and 0.1% formic acid over 120 min with a flow rate of 500 nl/min. Both MS and MS/MS scans were acquired in an Orbitrap analyzer with a resolution of 60,000 for MS scans and 30,000 for MS/MS scans. HCD fragmentation with 35% normalized collision energy was applied. A Top Speed data-dependent MS/MS method with a fixed cycle time of 3 s was used. Dynamic exclusion was applied with a repeat count of 1 and an exclusion duration of 90 s, whereas singly charged precursors were excluded from selection. The minimum signal threshold for precursor selection was set to 50,000. Predictive AGC was used with a target value of 4x10\u003csup\u003e5\u003c/sup\u003e for MS scans and 5x10\u003csup\u003e4\u003c/sup\u003e for MS/MS scans. EASY-IC was used for internal calibration.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec17\" class=\"Section2\"\u003e\u003ch2\u003eMS data analysis\u003c/h2\u003e\u003cp\u003eRaw MS data files were analyzed with MaxQuant version 1.6.2.2\u003csup\u003e56\u003c/sup\u003e. The database search was performed with Andromeda, which is integrated in the utilized version of MaxQuant. We searched against the UniProt Human Proteome database (Release 2022_02, UP000005640, 79,864 proteins) and the UniProt Vaccinia Virus Proteom (Release 2021_09, 257 proteins). Additionally, a database containing common contaminants was used. The search was performed with tryptic cleavage specificity which allowed for 3 mis-cleavages. Protein identification was under control of the false-discovery rate (FDR; \u0026lt; 1% FDR on protein and peptide spectrum match (PSM) level). In addition to MaxQuant default settings, the search was performed against following variable modifications: Protein N-terminal acetylation, Gln to pyro-Glu formation (N-term. Gln) and oxidation (Met). Carbamidomethyl (Cys) was set as fixed modification. Further data analysis was performed using R scripts developed in-house. LFQ intensities were used for protein quantitation\u003csup\u003e\u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e57\u003c/span\u003e\u003c/sup\u003e. Proteins with less than two razor/unique peptides were removed. Missing LFQ intensities were imputed with values close to the baseline. Data imputation was performed with values from a standard normal distribution with a mean of the 5% quantile of the combined log10-transformed LFQ intensity and a standard deviation of 0.1. The vertical axis was normalized on the Rpo132-FLAG/HA amount since this vRNAP subunit was the target for FLAG-IPs after infections with and without AraC. Three biological replicates were performed, and only viral proteins detected in at least two replicates were shown.\u003c/p\u003e\u003cp\u003e\u003cb\u003eExpression and purification of recombinant VITF-3 in\u003c/b\u003e \u003cb\u003eE. coli\u003c/b\u003e\u003c/p\u003e\u003cp\u003eThe ORFs of the Vaccinia \u003cem\u003eA8R\u003c/em\u003e and \u003cem\u003eA23R\u003c/em\u003e genes encoding VITF-3s and VITF-3l respectively, were PCR-amplified from viral genomic DNA using respective primer pairs (\u003cem\u003eA8R\u003c/em\u003e-5\u0026rsquo;-GGGCGGGATCCATGTTCGAACCAGTACCAGATC-3\u0026rsquo;, \u003cem\u003eA8R\u003c/em\u003e-5\u0026rsquo;-CCGGCAAGCTTCTAAGTAAAATATTTTAGTAGCGTATCC-3\u0026rsquo;, \u003cem\u003eA23R\u003c/em\u003e-5\u0026rsquo;-GAACTCATATGATGGATAATCTATTTACCTTTCTAC-3\u0026rsquo;, \u003cem\u003eA23R\u003c/em\u003e-5\u0026rsquo;-GAACTGCGGCCGCTCATTTTAGAAGCAATTCTTTTAG-3\u0026rsquo;). The PCR product containing the \u003cem\u003eA8R\u003c/em\u003e ORF as well as the vector pET28a were digested with BamHI and HindIII (Thermo Scientific, ER0051 and ER0502). Equally, the \u003cem\u003eA23R\u003c/em\u003e PCR product and the vector pET21a were digested with NdeI and NotI (Thermo Scientific, ER0585 and ER0591). The digested DNA was purified via agarose gel electrophoresis followed by DNA recovery using a NucleoSpin Gel and PCR Clean-up kit (Macherey-Nagel, 740609) according to the vendor\u0026rsquo;s protocol. The digested ORFs of \u003cem\u003eA8R\u003c/em\u003e and \u003cem\u003eA23R\u003c/em\u003e were ligated into the digested vectors pET28a and pET21a using T4-DNA ligase (NEB, M0202S) to generate \u003cem\u003eA8R\u003c/em\u003e-pET28a and \u003cem\u003eA23R\u003c/em\u003e-pET21a. Chemically competent BL21(DE3)pLysS cells (Promega Corporation, L1195) were co-transformed with 15 ng of both plasmids in a 50 \u0026micro;l reaction, whereas kanamycin, ampicillin and chloramphenicol resistances were used for selection. About 100 ml SB medium supplied with respective antibiotics were inoculated with BL21(DE3)pLysS cells co-transformed with \u003cem\u003eA8R\u003c/em\u003e-pET28a and \u003cem\u003eA23R\u003c/em\u003e-pET21a and incubated at 37\u0026deg;C and under shaking overnight. The next day, 2 l of SB medium distributed in two 5 l baffled flasks were inoculated with 1% of overnight pre-culture each and the cells were incubated at 37\u0026deg;C under shaking at 100 rpm. After reaching an OD600 of 0.5, protein expression was induced by adding IPTG to a final concentration of 0.5 mM. The bacteria were further incubated overnight at 16\u0026deg;C under shaking. After collecting cells by centrifugation at 2,800 g at 4\u0026deg;C for 30 min, about 40 ml buffer L (25 mM HEPES pH 8.0, 150 mM NaCl, 15% glycerol, 5 mM β-mercaptoethanol) supplied with 10 mM imidazole, 10 \u0026micro;M leupeptin, 1.5 \u0026micro;M aprotinin, 0.2 mM PMSF and 0.1 M AEBSF were added. The cells were resuspended and lysed by sonication using a 250 Power Supply (Branson Ultrasonics, Danbury, USA) with the following settings: duty cycle 50%, output control 70%, and 5x 60 s with 60 s breaks between. The lysate was cleared upon centrifugation at 48,000 g and 4\u0026deg;C for 120 min and the supernatant was incubated with 4 ml of equilibrated His60 Ni superflow resin (takara, 635660) overnight at 4\u0026deg;C under rotation. The beads were subsequently washed with 20 ml buffer L supplied with 20 mM imidazole, 40 ml buffer L supplied with 20 mM imidazole and 1 M NaCl, 20 ml buffer L supplied with 20 mM imidazole and 40 ml buffer L supplied with 50 mM imidazole. For elution, the beads were incubated with 4 ml buffer L supplied with 500 mM imidazole for about 30 min at 4\u0026deg;C under rotation. The elution fraction was collected, and the procedure was repeated two times, before the eluates were combined and filtered using a 0.2 \u0026micro;m ReliaPrep Syringe Filters (Ahlstrom-Munksj\u0026ouml; Germany GmbH, 760516). The NiNTA eluate was further purified via a 1 ml HiTrap Heparin HP affinity column (Cytiva, 17040601) equilibrated with buffer A (25 mM HEPES pH 8.0, 150 mM NaCl, 15% glycerol, 1 mM DTT). After binding of the Ni-NTA eluate at a flow rate of 0.2 ml/min, impurities were removed by a first elution step using buffer A supplemented with 350 mM NaCl. The protein of interest was eluted in buffer A with 1 M NaCl in a second elution step. 0.5 ml fractions were collected and analyzed via SDS-PAGE, before fractions containing pure VITF-3 were pooled and concentrated by a Vivaspin 500 (Sartorius, VP0142) to 20\u0026ndash;30 mg/ml. Aliquots were flash-frozen in liquid nitrogen and stored at -80\u0026deg;C.\u003c/p\u003e\u003cp\u003e\u003cb\u003eIn vitro\u003c/b\u003e \u003cb\u003etranscription assay\u003c/b\u003e\u003c/p\u003e\u003cp\u003e\u003cem\u003eIn vitro\u003c/em\u003e transcription was carried out in 25 \u0026micro;l reactions containing 40 mM Tris pH 8.0, 6 mM MgCl\u003csub\u003e2\u003c/sub\u003e, 10 mM DTT, 2 mM spermidine, 80 \u0026micro;M S-adenosyl methionine (NEB, B9003S), 20 U RNase Inhibitor (NEB, M0314S,M0314L), 2.5 mM ATP/GTP/CTP (Thermo Scientific, R0481), 0.5 mM UTP and 33.3 nM [α-\u003csup\u003e\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e\u003c/sup\u003eP]-UTP (Hartman Analytic, SCP-410). The template for Vaccinia early transcription, was pSB24, which was described previously\u003csup\u003e\u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e58\u003c/span\u003e\u003c/sup\u003e. For intermediate and late template generation, the \u003cem\u003eG8R\u003c/em\u003e promoter ranging from \u0026minus;\u0026thinsp;178 to +\u0026thinsp;501 and the \u003cem\u003eA9L\u003c/em\u003e promoter from \u0026minus;\u0026thinsp;139 to +\u0026thinsp;417 were PCR amplified using respective primer pairs (\u003cem\u003eG8R\u003c/em\u003e-5 GAACTGAATTCCCGATTCCTTTTTCGATGC, \u003cem\u003eG8R\u003c/em\u003e-3 GAACTGGATCCCTGATGCTGACTAATACACTTG, \u003cem\u003eA9L\u003c/em\u003e-5 GAACTGAATTCGTCAAGTCTTACTCATTGATCCG, \u003cem\u003eA9L\u003c/em\u003e-3 GAACTGGATCCGAATTATTTACAAAATTCATTAACGAG). The PCR products as well as the pUC19 vector were digested with BamHI and EcoRI (Thermo Scientific, ER0051 and ER0271), before the promoters were ligated into pUC19 by T4 DNA Ligase (NEB, M0569S) to generate \u003cem\u003eG8R\u003c/em\u003e-pUC19 and \u003cem\u003eA9L\u003c/em\u003e-pUC19. The plasmids pSB24, \u003cem\u003eG8R\u003c/em\u003e-pUC19 and \u003cem\u003eA9L\u003c/em\u003e-pUC19 were proliferated in XL1blue cells, before linearization at positions\u0026thinsp;+\u0026thinsp;631, +750 and +\u0026thinsp;666, respectively using NdeI (Thermo Scientific, ER0585). Per transcription reaction, 500 ng of linearized plasmid, 0.5 \u0026micro;g vRNAP\u003csup\u003eAraC\u003c/sup\u003e and 0.5 \u0026micro;g recombinant VITF-3 were combined, before the sample was incubated at 30\u0026deg;C for 45 min. To stop the reaction, 25 \u0026micro;l water, 200 \u0026micro;l TRIzol reagent (Sigma-Aldrich, 15596026) and 50 \u0026micro;l chloroform were added. After mixing, the sample was centrifuged at 12,000 g at 4\u0026deg;C for 15 min, before the aqueous phase was transferred into a fresh tube containing 200 \u0026micro;l 2-propanol and 1 \u0026micro;l GlycoBlue Coprecipitant (Invitrogen, AM9516). The solutions were mixed, and the RNA was precipitated at -20\u0026deg;C for at least 10 h. The sample was centrifuged at 12,000 g and 4\u0026deg;C for 15 min and the supernatant was discarded, before the RNA pellet was washed with 180 \u0026micro;l of 70% ethanol. The RNA pellet was dried at 37\u0026deg;C for 5 min and resuspended in 20 \u0026micro;l 1x RNA loading dye (47.5% formamide, 0.025% bromophenol blue, 0.025% xylene cyanole). After heating up to 95\u0026deg;C for 5 min, 10 \u0026micro;l per sample were loaded on a 4% polyacrylamide gel containing 8 M urea. Electrophoresis was carried out at 20 mA in 1x TBE running buffer. After 120 min, the electrophoresis was stopped, the gel was transferred onto Whatman paper and exposed to an Amersham Hyperfilm MP (Cytiva, 28-9068-44) at -80\u0026deg;C. The film was developed using an OPTIMAX X-Ray Film Processor (PROTEC GmbH \u0026amp; Co KG, Oberstenfeld, Germany).\u003c/p\u003e\u003cp\u003e\u003cb\u003eAnalysis of m\u003c/b\u003e\u003csup\u003e\u003cb\u003e\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u003c/b\u003e\u003c/sup\u003e\u003cb\u003eG-capping of\u003c/b\u003e \u003cb\u003ein vitro\u003c/b\u003e \u003cb\u003etranscribed RNA\u003c/b\u003e\u003c/p\u003e\u003cp\u003eFor the investigation of the 5\u0026rsquo;-end of \u003cem\u003ein vitro\u003c/em\u003e transcribed intermediate RNA, early and intermediate RNAs were generated in 125 \u0026micro;l transcription reactions each. Additionally, a third reaction containing 50 \u0026micro;l of T7 transcribed U1 snRNA served as non-capped control\u003csup\u003e\u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e59\u003c/span\u003e,\u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e60\u003c/span\u003e\u003c/sup\u003e. After precipitation with isopropanol, all RNAs were resuspended in 30 \u0026micro;l water and pooled. 100 \u0026micro;l of Dynabeads Protein G (Invitrogen, 10004D) were washed twice with PBS containing 0.02% Tween20. The beads were incubated with 60 \u0026micro;g H-20 antibody (Reinhard L\u0026uuml;hrmann) in 400 \u0026micro;l PBS supplied with 0.02% Tween20 for 45 min under shaking at room temperature\u003csup\u003e\u003cspan citationid=\"CR61\" class=\"CitationRef\"\u003e61\u003c/span\u003e\u003c/sup\u003e. After removing unbound antibody, the combined transcripts were added to the beads after taking off 20% for input. The sample was incubated for 70 min under rotation at RT, before the supernatant, which contained unbound RNAs, was taken off. The beads were washed three times with 400 \u0026micro;l PBS supplied with 0.02% Tween20 each, before 50 \u0026micro;l water were added. The RNAs of input, unbound and IP samples were extracted via TRIzol reagent (Sigma-Aldrich, 15596026). Therefore, all samples were filled up with water to 50 \u0026micro;l, before four times the volume TRIzol was added. After mixing, 50 \u0026micro;l chloroform were added and the samples were centrifuged at 12,000 g for 15 min at RT. The aqueous phase was transferred into a fresh tube containing four times the volume 2propanol and 1 \u0026micro;l GlycoBlue Coprecipitant (Invitrogen, AM9516). After mixing, the RNA was precipitated at -20\u0026deg;C for at least 10 h. The sample was centrifuged at 12,000 g at 4\u0026deg;C for 15 min and the supernatant was discarded, before the RNA pellet was washed once with 180 \u0026micro;l 70% ethanol. The RNA pellet was dried at 37\u0026deg;C for 5 min and resuspended in 20 \u0026micro;l 1x RNA loading dye (47.5% formamide, 0.025% bromophenol blue, 0.025% xylene cyanole). After boiling the sample at 95\u0026deg;C for 5 min, 3 \u0026micro;l of input and supernatant, as well as 4 \u0026micro;l of bead sample were loaded on a 4% polyacrylamide gel containing 8 M urea. The sample volumes vary between biological replicates. Electrophoresis was carried out at 20 mA in 1x TBE running buffer. After 120 min, electrophoresis was stopped, and the gel was transferred onto Whatman paper and exposed to an Amersham Hyperfilm MP (Cytiva, 15596026) at -80\u0026deg;C. The film was developed after 7 h using an OPTIMAX X-Ray Film Processor (PROTEC GmbH \u0026amp; Co KG, Oberstenfeld, Germany), before signal intensities were quantified using ImageJ\u003csup\u003e\u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e62\u003c/span\u003e\u003c/sup\u003e. The signal intensity of the IP fraction was divided by the sum of IP and supernatant, representing the ratio of capped RNA to total RNA. OriginPro 2023 (v10.0.0.154, OriginLab Corporation, Northampton, MA, USA) was used to visualize bars representing mean values\u0026thinsp;\u0026plusmn;\u0026thinsp;SD of at least three independent replicates (dots).\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003eData Availability\u003c/p\u003e\n\u003cp\u003eCoordinate files of iPIC\u003csub\u003ed\u003c/sub\u003e, iPIC\u003csub\u003es\u003c/sub\u003e and iPIC\u003csub\u003eCEm\u003c/sub\u003e have been deposited in the Protein Data Bank and are available under accession codes 8P0J, 8P0N and 8P0K, respectively. Cryo-EM densities of iPIC\u003csub\u003ed\u003c/sub\u003e, iPIC\u003csub\u003es\u003c/sub\u003e and iPIC\u003csub\u003eCEm\u003c/sub\u003e have been deposited in the Electron Microscopy Data Bank and are available under accession codes EMD-17334, EMD-17336 and EMD-17335, respectively. This paper analyzes existing, publicly available structural data, accessible under the Protein Data Bank accession codes 7AMV (ePIC)\u003csup\u003e18\u003c/sup\u003e, 6RIE (CCC)\u003csup\u003e20\u003c/sup\u003e, 1FS3 (Ribonuclease A)\u003csup\u003e45\u003c/sup\u003e, 1YTB (TBP/TATA-box complex)\u003csup\u003e7\u003c/sup\u003e, 1AIS (TBP/TFB core/TATA-box complex from \u003cem\u003ePyrococcus woesei\u003c/em\u003e)\u003csup\u003e63\u003c/sup\u003e, 7EGC (RNAP II PIC)\u003csup\u003e64\u003c/sup\u003e, 6EU0 (RNAP III PIC)\u003csup\u003e65\u003c/sup\u003e. The mass spectrometry proteomics data have been deposited to the ProteomeXchange Consortium via the PRIDE partner repository with the dataset identifier PXD065561\u003csup\u003e66\u003c/sup\u003e. To access the deposited proteomics raw data, reviewers can log in to the PRIDE website using the following details: Project accession: PXD065561 and token: UmSpwZ5o59KK, or alternatively, username:
[email protected] and 854 password: zd2RdAPZLcp2. Any additional information required to reanalyze the data reported in this paper is available from the lead contact upon request. Source data are provided with this publication.\u003c/p\u003e\n\u003cp\u003eCode Availability\u003c/p\u003e\n\u003cp\u003eThis paper does not report original code.\u003c/p\u003e\u003cp\u003eAcknowledgements\u003c/p\u003e\n\u003cp\u003eWe would like to thank Reinhard L\u0026uuml;hrmann for kindly providing the H-20 antibody. Cryo-EM of the iPIC was carried out in the cryo-EM facility of the Julius-Maximilians University W\u0026uuml;rzburg (Projects INST 93/903-1 #359471283, INST 93/1042-1 #456578072, INST 93/1143-1 x525040890). This work was supported by a DFG grant to UF and CG (Fi 573/27-1) and by Volkswagen-Stiftung (9B813).\u003c/p\u003e\n\u003cp\u003eAuthor contributions\u003c/p\u003e\n\u003cul\u003e\n \u003cli\u003eConceptualization: UF, CG, JB, SJ\u003c/li\u003e\n \u003cli\u003eComplex reconstitution and purification: SJ\u003c/li\u003e\n \u003cli\u003eBiochemical assays: SJ\u003c/li\u003e\n \u003cli\u003eMass spectrometry: SL, AS\u003c/li\u003e\n \u003cli\u003eCryo-EM sample preparation and data collection: CG, SJ\u003c/li\u003e\n \u003cli\u003eData processing, model building, structure analysis and visualization: CG\u003c/li\u003e\n \u003cli\u003eWriting: UF, CG, SJ\u003c/li\u003e\n \u003cli\u003eFunding acquisition: UF, CG\u003c/li\u003e\n\u003c/ul\u003e\n\u003cp\u003eEthics declarations\u003c/p\u003e\n\u003cp\u003eThe authors declare no competing interests.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n \u003cli\u003eGreber, B.J. \u0026amp; Nogales, E. The Structures of Eukaryotic Transcription Pre-initiation Complexes and Their Functional Implications. 143-192 (Springer International Publishing, 2019).\u003c/li\u003e\n \u003cli\u003eMatsui, T., Segall, J., Weil, P.A. \u0026amp; Roeder, R.G. Multiple factors required for accurate initiation of transcription by purified RNA polymerase II. \u003cem\u003eJournal of Biological Chemistry\u003c/em\u003e \u003cstrong\u003e255\u003c/strong\u003e, 11992-11996 (1980).\u003c/li\u003e\n \u003cli\u003eKassavetis, G.A. et al. The role of the TATA-binding protein in the assembly and function of the multisubunit yeast RNA polymerase III transcription factor, TFIIIB. \u003cem\u003eCell\u003c/em\u003e \u003cstrong\u003e71\u003c/strong\u003e, 1055-1064 (1992).\u003c/li\u003e\n \u003cli\u003eRowlands, T., Baumann, P. \u0026amp; Jackson, S.P. THE TATA-BINDING PROTEIN - A GENERAL TRANSCRIPTION FACTOR IN EUKARYOTES AND ARCHAEBACTERIA. \u003cem\u003eSCIENCE\u003c/em\u003e \u003cstrong\u003e264\u003c/strong\u003e, 1326-1329 (1994).\u003c/li\u003e\n \u003cli\u003eKramm, K., Engel, C. \u0026amp; Grohmann, D. Transcription initiation factor TBP: old friend new questions. \u003cem\u003eBiochemical Society transactions\u003c/em\u003e \u003cstrong\u003e47\u003c/strong\u003e, 411\u0026ndash;423 (2019).\u003c/li\u003e\n \u003cli\u003eChasman, D.I., Flaherty, K.M., Sharp, P.A. \u0026amp; Kornberg, R.D. Crystal structure of yeast TATA-binding protein and model for interaction with DNA. \u003cem\u003eProceedings of the National Academy of Sciences\u003c/em\u003e \u003cstrong\u003e90\u003c/strong\u003e, 8174-8178 (1993).\u003c/li\u003e\n \u003cli\u003eKim, Y., Geiger, J.H., Hahn, S. \u0026amp; Sigler, P.B. Crystal structure of a yeast TBP/TATA-box complex. \u003cem\u003eNature\u003c/em\u003e \u003cstrong\u003e365\u003c/strong\u003e, 512-520 (1993).\u003c/li\u003e\n \u003cli\u003eSadian, Y. et al. Structural insights into transcription initiation by yeast RNA polymerase I. \u003cem\u003eThe EMBO Journal\u003c/em\u003e \u003cstrong\u003e36\u003c/strong\u003e, 2698-2709 (2017).\u003c/li\u003e\n \u003cli\u003eKeener, J., Josaitis, C.A., Dodd, J.A. \u0026amp; Nomura, M. Reconstitution of Yeast RNA Polymerase I Transcription in Vitro from Purified Components: TATA-BINDING PROTEIN IS NOT REQUIRED FOR BASAL TRANSCRIPTION*. \u003cem\u003eJournal of Biological Chemistry\u003c/em\u003e \u003cstrong\u003e273\u003c/strong\u003e, 33795-33802 (1998).\u003c/li\u003e\n \u003cli\u003eCrowley, T.E. et al. A new factor related to TATA-binding protein has highly restricted expression patterns in Drosophila. \u003cem\u003eNature\u003c/em\u003e \u003cstrong\u003e361\u003c/strong\u003e, 557-561 (1993).\u003c/li\u003e\n \u003cli\u003eOhbayashi, T., Makino, Y. \u0026amp; Tamura, T.A. Identification of a mouse TBP-like protein (TLP) distantly related to the Drosophila TBP-related factor. \u003cem\u003eNucleic Acids Research\u003c/em\u003e \u003cstrong\u003e27\u003c/strong\u003e, 750-755 (1999).\u003c/li\u003e\n \u003cli\u003eRabenstein, M.D., Zhou, S., Lis, J.T. \u0026amp; Tjian, R. TATA box-binding protein (TBP)-related factor 2 (TRF2), a third member of the TBP family. \u003cem\u003eProceedings of the National Academy of Sciences of the United States of America\u003c/em\u003e \u003cstrong\u003e96\u003c/strong\u003e, 4791\u0026ndash;4796 (1999).\u003c/li\u003e\n \u003cli\u003eReinberg, D. \u0026amp; Roeder, R.G. Factors involved in specific transcription by mammalian RNA polymerase II. Purification and functional analysis of initiation factors IIB and IIE. \u003cem\u003eJournal of Biological Chemistry\u003c/em\u003e \u003cstrong\u003e262\u003c/strong\u003e, 3310-3321 (1987).\u003c/li\u003e\n \u003cli\u003eZhang, D.Y. The role of TFIIB-RNA polymerase II interaction in start site selection in yeast cells. \u003cem\u003eNucleic Acids Research\u003c/em\u003e \u003cstrong\u003e30\u003c/strong\u003e, 3078-3085 (2002).\u003c/li\u003e\n \u003cli\u003eBuratowski, S. \u0026amp; Zhou, H. Functional domains of transcription factor TFIIB. \u003cem\u003eProceedings of the National Academy of Sciences of the United States of America\u003c/em\u003e \u003cstrong\u003e90\u003c/strong\u003e, 5633\u0026ndash;5637 (1993).\u003c/li\u003e\n \u003cli\u003eColbert, T. \u0026amp; Hahn, S. A yeast TFIIB-related factor involved in RNA polymerase III transcription. \u003cem\u003eGenes \u0026amp;amp; Development\u003c/em\u003e \u003cstrong\u003e6\u003c/strong\u003e, 1940-1949 (1992).\u003c/li\u003e\n \u003cli\u003eHausner, W., Wettach, J., Hethke, C. \u0026amp; Thomm, M. Two Transcription Factors Related with the Eucaryal Transcription Factors TATA-binding Protein and Transcription Factor IIB Direct Promoter Recognition by an Archaeal RNA Polymerase*. \u003cem\u003eJournal of Biological Chemistry\u003c/em\u003e \u003cstrong\u003e271\u003c/strong\u003e, 30144-30148 (1996).\u003c/li\u003e\n \u003cli\u003eGrimm, C., Bartuli, J., Boettcher, B., Szalay, A.A. \u0026amp; Fischer, U. Structural basis of the complete poxvirus transcription initiation process. \u003cem\u003eNature structural \u0026amp; molecular biology\u003c/em\u003e \u003cstrong\u003e28\u003c/strong\u003e, 779\u0026ndash;788 (2021).\u003c/li\u003e\n \u003cli\u003eGrimm, C. et al. Structural Basis of Poxvirus Transcription: Vaccinia RNA Polymerase Complexes. \u003cem\u003eCell\u003c/em\u003e \u003cstrong\u003e179\u003c/strong\u003e, 1537-1550.e19 (2019).\u003c/li\u003e\n \u003cli\u003eHillen, H.S. et al. Structural Basis of Poxvirus Transcription: Transcribing and Capping Vaccinia Complexes. \u003cem\u003eCell\u003c/em\u003e \u003cstrong\u003e179\u003c/strong\u003e, 1525-1536 e12 (2019).\u003c/li\u003e\n \u003cli\u003eSalzman, N.P. \u0026amp; Sebring, E.D. Sequential Formation of Vaccinia Virus Proteins and Viral Deoxyribonucleic Acid Replication. \u003cem\u003eJournal of Virology\u003c/em\u003e \u003cstrong\u003e1\u003c/strong\u003e, 16-23 (1967).\u003c/li\u003e\n \u003cli\u003eMoss, B., Ahn, B.Y., Amegadzie, B., Gershon, P.D. \u0026amp; Keck, J.G. Cytoplasmic transcription system encoded by vaccinia virus. \u003cem\u003eThe Journal of biological chemistry\u003c/em\u003e \u003cstrong\u003e266\u003c/strong\u003e, 1355\u0026ndash;1358 (1991).\u003c/li\u003e\n \u003cli\u003eGrimm, C., Bartuli, J. \u0026amp; Fischer, U. Cytoplasmic gene expression: lessons from poxviruses. \u003cem\u003eTrends in biochemical sciences\u003c/em\u003e \u003cstrong\u003e47\u003c/strong\u003e, 892\u0026ndash;902 (2022).\u003c/li\u003e\n \u003cli\u003eBroyles, S.S. Vaccinia virus transcription. \u003cem\u003eThe Journal of general virology\u003c/em\u003e \u003cstrong\u003e84\u003c/strong\u003e, 2293\u0026ndash;2303 (2003).\u003c/li\u003e\n \u003cli\u003eJones, E.V., Puckett, C. \u0026amp; Moss, B. DNA-dependent RNA polymerase subunits encoded within the vaccinia virus genome. \u003cem\u003eJournal of virology\u003c/em\u003e \u003cstrong\u003e61\u003c/strong\u003e, 1765\u0026ndash;1771 (1987).\u003c/li\u003e\n \u003cli\u003eBaroudy, B.M. \u0026amp; Moss, B. Purification and characterization of a DNA-dependent RNA polymerase from vaccinia virions. \u003cem\u003eThe Journal of biological chemistry\u003c/em\u003e \u003cstrong\u003e255\u003c/strong\u003e, 4372\u0026ndash;4380 (1980).\u003c/li\u003e\n \u003cli\u003eMunyon, W., Paoletti, E. \u0026amp; Grace, J.T. RNA polymerase activity in purified infectious vaccinia virus. \u003cem\u003eProceedings of the National Academy of Sciences\u003c/em\u003e \u003cstrong\u003e58\u003c/strong\u003e, 2280-2287 (1967).\u003c/li\u003e\n \u003cli\u003eVos, J.C., Sasker, M. \u0026amp; Stunnenberg, H.G. Vaccinia virus capping enzyme is a transcription initiation factor. \u003cem\u003eThe EMBO journal\u003c/em\u003e \u003cstrong\u003e10\u003c/strong\u003e, 2553\u0026ndash;2558 (1991).\u003c/li\u003e\n \u003cli\u003eGershon, P.D., Ahn, B.Y., Garfield, M. \u0026amp; Moss, B. Poly(A) polymerase and a dissociable polyadenylation stimulatory factor encoded by vaccinia virus. \u003cem\u003eCell\u003c/em\u003e \u003cstrong\u003e66\u003c/strong\u003e, 1269\u0026ndash;1278 (1991).\u003c/li\u003e\n \u003cli\u003eYang, Z., Maruri-Avidal, L., Sisler, J., Stuart, C.A. \u0026amp; Moss, B. Cascade regulation of vaccinia virus gene expression is modulated by multistage promoters. \u003cem\u003eVirology\u003c/em\u003e \u003cstrong\u003e447\u003c/strong\u003e, 213\u0026ndash;220 (2013).\u003c/li\u003e\n \u003cli\u003eYuen, L., Davison, A.J. \u0026amp; Moss, B. Early promoter-binding factor from vaccinia virions. \u003cem\u003eProceedings of the National Academy of Sciences\u003c/em\u003e \u003cstrong\u003e84\u003c/strong\u003e, 6069-6073 (1987).\u003c/li\u003e\n \u003cli\u003eGershon, P.D. \u0026amp; Moss, B. Early transcription factor subunits are encoded by vaccinia virus late genes. \u003cem\u003eProceedings of the National Academy of Sciences\u003c/em\u003e \u003cstrong\u003e87\u003c/strong\u003e, 4401-4405 (1990).\u003c/li\u003e\n \u003cli\u003eAhn, B.Y. \u0026amp; Moss, B. RNA polymerase-associated transcription specificity factor encoded by vaccinia virus. \u003cem\u003eProceedings of the National Academy of Sciences\u003c/em\u003e \u003cstrong\u003e89\u003c/strong\u003e, 3536-3540 (1992).\u003c/li\u003e\n \u003cli\u003eDavison, A.J. \u0026amp; Moss, B. Structure of vaccinia virus early promoters. \u003cem\u003eJournal of molecular biology\u003c/em\u003e \u003cstrong\u003e210\u003c/strong\u003e, 749\u0026ndash;769 (1989).\u003c/li\u003e\n \u003cli\u003eVenkatesan, S., Baroudy, B.M. \u0026amp; Moss, B. Distinctive nucleotide sequences adjacent to multiple initiation and termination sites of an early vaccinia virus gene. \u003cem\u003eCell\u003c/em\u003e \u003cstrong\u003e25\u003c/strong\u003e, 805\u0026ndash;813 (1981).\u003c/li\u003e\n \u003cli\u003eHarris, N., Rosales, R. \u0026amp; Moss, B. Transcription initiation factor activity of vaccinia virus capping enzyme is independent of mRNA guanylylation. \u003cem\u003eProceedings of the National Academy of Sciences of the United States of America\u003c/em\u003e \u003cstrong\u003e90\u003c/strong\u003e, 2860\u0026ndash;2864 (1993).\u003c/li\u003e\n \u003cli\u003eBaldick, C.J., Keck, J.G. \u0026amp; Moss, B. Mutational analysis of the core, spacer, and initiator regions of vaccinia virus intermediate-class promoters. \u003cem\u003eJournal of virology\u003c/em\u003e \u003cstrong\u003e66\u003c/strong\u003e, 4710\u0026ndash;4719 (1992).\u003c/li\u003e\n \u003cli\u003eVos, J.C., Sasker, M. \u0026amp; Stunnenberg, H.G. Promoter melting by a stage-specific vaccinia virus transcription factor is independent of the presence of RNA polymerase. \u003cem\u003eCell\u003c/em\u003e \u003cstrong\u003e65\u003c/strong\u003e, 105\u0026ndash;113 (1991).\u003c/li\u003e\n \u003cli\u003eKatsafanas, G.C. \u0026amp; Moss, B. Vaccinia virus intermediate stage transcription is complemented by Ras-GTPase-activating protein SH3 domain-binding protein (G3BP) and cytoplasmic activation/proliferation-associated protein (p137) individually or as a heterodimer. \u003cem\u003eThe Journal of biological chemistry\u003c/em\u003e \u003cstrong\u003e279\u003c/strong\u003e, 52210\u0026ndash;52217 (2004).\u003c/li\u003e\n \u003cli\u003eSanz, P. \u0026amp; Moss, B. A new vaccinia virus intermediate transcription factor. \u003cem\u003eJournal of virology\u003c/em\u003e \u003cstrong\u003e72\u003c/strong\u003e, 6880\u0026ndash;6883 (1998).\u003c/li\u003e\n \u003cli\u003eSanz, P. \u0026amp; Moss, B. Identification of a transcription factor, encoded by two vaccinia virus early genes, that regulates the intermediate stage of viral gene expression. \u003cem\u003eProceedings of the National Academy of Sciences of the United States of America\u003c/em\u003e \u003cstrong\u003e96\u003c/strong\u003e, 2692\u0026ndash;2697 (1999).\u003c/li\u003e\n \u003cli\u003eRosales, R., Sutter, G. \u0026amp; Moss, B. A cellular factor is required for transcription of vaccinia viral intermediate-stage genes. \u003cem\u003eProceedings of the National Academy of Sciences of the United States of America\u003c/em\u003e \u003cstrong\u003e91\u003c/strong\u003e, 3794\u0026ndash;3798 (1994).\u003c/li\u003e\n \u003cli\u003eBartuli, J., Lorenzi, I., Backes, S., Grimm, C. \u0026amp; Fischer, U. A generic protocol for the affinity-purification of native macromolecular complexes from poxvirus-infected cells. \u003cem\u003eSTAR protocols\u003c/em\u003e \u003cstrong\u003e3\u003c/strong\u003e, 101116 (2022).\u003c/li\u003e\n \u003cli\u003eTaddie, J.A. \u0026amp; Traktman, P. Genetic characterization of the vaccinia virus DNA polymerase: cytosine arabinoside resistance requires a variable lesion conferring phosphonoacetate resistance in conjunction with an invariant mutation localized to the 3\u0026apos;-5\u0026apos; exonuclease domain. \u003cem\u003eJournal of Virology\u003c/em\u003e \u003cstrong\u003e67\u003c/strong\u003e, 4323-4336 (1993).\u003c/li\u003e\n \u003cli\u003eChatani, E., Hayashi, R., Moriyama, H. \u0026amp; Ueki, T. Conformational strictness required for maximum activity and stability of bovine pancreatic ribonuclease A as revealed by crystallographic study of three Phe120 mutants at 1.4 \u0026Aring; resolution. \u003cem\u003eProtein Science\u003c/em\u003e \u003cstrong\u003e11\u003c/strong\u003e, 72-81 (2002).\u003c/li\u003e\n \u003cli\u003eWard, R.L. \u0026amp; Stevens, J.G. Effect of cytosine arabinoside on viral-specific protein synthesis in cells infected with herpes simplex virus. \u003cem\u003eJournal of virology\u003c/em\u003e \u003cstrong\u003e15\u003c/strong\u003e, 71\u0026ndash;80 (1975).\u003c/li\u003e\n \u003cli\u003eGirbig, M. et al. Architecture of the yeast Pol III pre-termination complex and pausing mechanism on poly(dT) termination signals. \u003cem\u003eCell Reports\u003c/em\u003e \u003cstrong\u003e40\u003c/strong\u003e, 111316 (2022).\u003c/li\u003e\n \u003cli\u003eRavarani, C.N.J. et al. Molecular determinants underlying functional innovations of TBP and their impact on transcription initiation. \u003cem\u003eNature Communications\u003c/em\u003e \u003cstrong\u003e11\u003c/strong\u003e(2020).\u003c/li\u003e\n \u003cli\u003eYang, Z. et al. Expression profiling of the intermediate and late stages of poxvirus replication. \u003cem\u003eJournal of virology\u003c/em\u003e \u003cstrong\u003e85\u003c/strong\u003e, 9899\u0026ndash;9908 (2011).\u003c/li\u003e\n \u003cli\u003eKeck, J.G., Baldick, C.J. \u0026amp; Moss, B. Role of DNA replication in vaccinia virus gene expression: a naked template is required for transcription of three late trans-activator genes. \u003cem\u003eCell\u003c/em\u003e \u003cstrong\u003e61\u003c/strong\u003e, 801\u0026ndash;809 (1990).\u003c/li\u003e\n \u003cli\u003ePunjani, A., Rubinstein, J.L., Fleet, D.J. \u0026amp; Brubaker, M.A. cryoSPARC: algorithms for rapid unsupervised cryo-EM structure determination. \u003cem\u003eNature Methods\u003c/em\u003e \u003cstrong\u003e14\u003c/strong\u003e, 290-296 (2017).\u003c/li\u003e\n \u003cli\u003eLiebschner, D. et al. Macromolecular structure determination using X-rays, neutrons and electrons: recent developments in Phenix. \u003cem\u003eActa Crystallographica Section D Structural Biology\u003c/em\u003e \u003cstrong\u003e75\u003c/strong\u003e, 861-877 (2019).\u003c/li\u003e\n \u003cli\u003eCasa\u0026ntilde;al, A., Lohkamp, B. \u0026amp; Emsley, P. Current developments in Coot for macromolecular model building of Electron Cryo‐microscopy and Crystallographic Data. \u003cem\u003eProtein Science\u003c/em\u003e \u003cstrong\u003e29\u003c/strong\u003e, 1055-1064 (2020).\u003c/li\u003e\n \u003cli\u003eHughes, C.S. et al. Single-pot, solid-phase-enhanced sample preparation for proteomics experiments. \u003cem\u003eNature Protocols\u003c/em\u003e \u003cstrong\u003e14\u003c/strong\u003e, 68-85 (2019).\u003c/li\u003e\n \u003cli\u003eRappsilber, J., Ishihama, Y. \u0026amp; Mann, M. Stop and Go Extraction Tips for Matrix-Assisted Laser Desorption/Ionization, Nanoelectrospray, and LC/MS Sample Pretreatment in Proteomics. \u003cem\u003eAnalytical Chemistry\u003c/em\u003e \u003cstrong\u003e75\u003c/strong\u003e, 663-670 (2003).\u003c/li\u003e\n \u003cli\u003eCox, J. \u0026amp; Mann, M. MaxQuant enables high peptide identification rates, individualized p.p.b.-range mass accuracies and proteome-wide protein quantification. \u003cem\u003eNature Biotechnology\u003c/em\u003e \u003cstrong\u003e26\u003c/strong\u003e, 1367-1372 (2008).\u003c/li\u003e\n \u003cli\u003eCox, J. et al. Accurate Proteome-wide Label-free Quantification by Delayed Normalization and Maximal Peptide Ratio Extraction, Termed MaxLFQ*. \u003cem\u003eMolecular \u0026amp; Cellular Proteomics\u003c/em\u003e \u003cstrong\u003e13\u003c/strong\u003e, 2513-2526 (2014).\u003c/li\u003e\n \u003cli\u003eLuo, Y., Hagler, J. \u0026amp; Shuman, S. Discrete functional stages of vaccinia virus early transcription during a single round of RNA synthesis in vitro. \u003cem\u003eJournal of Biological Chemistry\u003c/em\u003e \u003cstrong\u003e266\u003c/strong\u003e, 13303-13310 (1991).\u003c/li\u003e\n \u003cli\u003eChari, A. et al. An assembly chaperone collaborates with the SMN complex to generate spliceosomal SnRNPs. \u003cem\u003eCell\u003c/em\u003e \u003cstrong\u003e135\u003c/strong\u003e, 497-509 (2008).\u003c/li\u003e\n \u003cli\u003eNeuenkirchen, N. et al. Reconstitution of the human U sn \u0026lt;scp\u0026gt;RNP\u0026lt;/scp\u0026gt; assembly machinery reveals stepwise Sm protein organization. \u003cem\u003eThe EMBO Journal\u003c/em\u003e \u003cstrong\u003e34\u003c/strong\u003e, 1925-1941 (2015).\u003c/li\u003e\n \u003cli\u003eBochnig, P., Reuter, R., Bringmann, P. \u0026amp; L\u0026uuml;hrmann, R. A monoclonal antibody against 2,2,7‐trimethylguanosine that reacts with intact, class U, small nuclear ribonucleoproteins as well as with 7‐methylguanosine‐capped RNAs. \u003cem\u003eEuropean Journal of Biochemistry\u003c/em\u003e \u003cstrong\u003e168\u003c/strong\u003e, 461-467 (1987).\u003c/li\u003e\n \u003cli\u003eSchneider, C.A., Rasband, W.S. \u0026amp; Eliceiri, K.W. NIH Image to ImageJ: 25 years of image analysis. \u003cem\u003eNature Methods\u003c/em\u003e \u003cstrong\u003e9\u003c/strong\u003e, 671-675 (2012).\u003c/li\u003e\n \u003cli\u003eKosa, P.F., Ghosh, G., Dedecker, B.S. \u0026amp; Sigler, P.B. The 2.1-Å crystal structure of an archaeal preinitiation complex: TATA-box-binding protein/transcription factor (II)B core/TATA-box. \u003cem\u003eProceedings of the National Academy of Sciences\u003c/em\u003e \u003cstrong\u003e94\u003c/strong\u003e, 6042-6047 (1997).\u003c/li\u003e\n \u003cli\u003eChen, X. et al. Structural insights into preinitiation complex assembly on core promoters. \u003cem\u003eScience\u003c/em\u003e \u003cstrong\u003e372\u003c/strong\u003e, eaba8490 (2021).\u003c/li\u003e\n \u003cli\u003eAbascal-Palacios, G., Ramsay, E.P., Beuron, F., Morris, E. \u0026amp; Vannini, A. Structural basis of RNA polymerase III transcription initiation. \u003cem\u003eNature\u003c/em\u003e \u003cstrong\u003e553\u003c/strong\u003e, 301-306 (2018).\u003c/li\u003e\n \u003cli\u003ePerez-Riverol, Y. et al. The PRIDE database at 20 years: 2025 update. \u003cem\u003eNucleic Acids Research\u003c/em\u003e \u003cstrong\u003e53\u003c/strong\u003e, D543-D553 (2025).\u003c/li\u003e\n \u003cli\u003eSanchez-Garcia, R. et al. DeepEMhancer: a deep learning solution for cryo-EM volume post-processing. \u003cem\u003eCommun Biol\u003c/em\u003e \u003cstrong\u003e4\u003c/strong\u003e, 874 (2021).\u003c/li\u003e\n\u003c/ol\u003e"},{"header":"Table 1","content":"\u003cp\u003eTable 1 is available in the Supplementary Files section.\u003c/p\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":true,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"nature-portfolio","isNatureJournal":true,"hasQc":false,"allowDirectSubmit":false,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"","title":"Nature Portfolio","twitterHandle":"","acdcEnabled":false,"dfaEnabled":false,"editorialSystem":"ejp","reportingPortfolio":"","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"","lastPublishedDoi":"10.21203/rs.3.rs-7417495/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7417495/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eThe recruitment of RNA polymerase (RNAP) to gene promoters is a critical step in gene expression. For RNAP II, this process is initiated by the TATA-box binding protein (TBP) and transcription factor IIB (TFIIB), with homologs of these TBP/TFIIB pairs found in all known multi-subunit RNAP systems. Here, we describe a previously unknown mode of promoter recognition by the poxviral intermediate transcription factor 3 (VITF-3). This heterodimeric factor comprises an atypical TBP/TFIIB pair forming a stable ring structure inert towards DNA in the absence of viral RNAP (vRNAP). Promoter recognition instead requires concerted VITF-3 and vRNAP binding, as revealed by cryo-EM analysis of the intermediate pre-initiation complex (iPIC). During iPIC formation, vRNAP facilitates ring opening and loading of VITF-3 onto the promoter, anchoring the polymerase at the transcription start site. Our findings propose vRNAP as a clamp loader for VITF-3 and reveal a thus far unknown transcription initiation mechanism.\u003c/p\u003e","manuscriptTitle":"Cooperative Clamp-Mediated Promoter Recognition by Poxviral RNAP and Its TBP/TFIIB-Like Partner","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-09-11 07:35:54","doi":"10.21203/rs.3.rs-7417495/v1","editorialEvents":[],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"nature-communications","isNatureJournal":true,"hasQc":false,"allowDirectSubmit":false,"externalIdentity":"NCOMMS","sideBox":"Learn more about [Nature Communications](http://www.nature.com/ncomms/)","snPcode":"","submissionUrl":"https://mts-ncomms.nature.com/","title":"Nature Communications","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"ejp","reportingPortfolio":"Nature Communications","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"45963e0f-7453-43b7-b4d1-e0bbddcae9c2","owner":[],"postedDate":"September 11th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[{"id":53832824,"name":"Biological sciences/Structural biology/Electron microscopy/Cryoelectron microscopy"},{"id":53832825,"name":"Biological sciences/Biochemistry/Enzymes/Multienzyme complexes"},{"id":53832826,"name":"Biological sciences/Molecular biology/Transcription/Transcriptional regulatory elements"}],"tags":[],"updatedAt":"2026-02-19T08:05:52+00:00","versionOfRecord":{"articleIdentity":"rs-7417495","link":"https://doi.org/10.1038/s41467-026-69571-1","journal":{"identity":"nature-communications","isVorOnly":false,"title":"Nature Communications"},"publishedOn":"2026-02-18 05:00:00","publishedOnDateReadable":"February 18th, 2026"},"versionCreatedAt":"2025-09-11 07:35:54","video":"","vorDoi":"10.1038/s41467-026-69571-1","vorDoiUrl":"https://doi.org/10.1038/s41467-026-69571-1","workflowStages":[]},"version":"v1","identity":"rs-7417495","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7417495","identity":"rs-7417495","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.