Molecular characterization of virulence genes in quorum sensing system of different pathogenic strains of Pseudomonas aeruginosa from neonates with pulmonary infections using PCR as efficient technique

Molecular characterization of virulence genes in quorum sensing system of different pathogenic strains of Pseudomonas aeruginosa from neonates with pulmonary infections using PCR as efficient technique | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Molecular characterization of virulence genes in quorum sensing system of different pathogenic strains of Pseudomonas aeruginosa from neonates with pulmonary infections using PCR as efficient technique Maham Chaudhry, Safia Rehman, Sehar Zahid, Nazish Mazhar Ali, and 3 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-5234762/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background: The expectation from the current research study was to genetically identify the virulence genes involved in quorum sensing (QS) in different strains of Pseudomonas aeruginosa, as the QS controls production of many virulence factors. Objective: The intention of current research study was to isolate the pathogenic strains of P. aeruginosa from sputum samples of neonates and infants and their molecular characterization . Methods: P. aeruginosa were obtained from Microbiology Laboratory, Department of Zoology, Government College University Lahore were grown on selective media. Biochemical and molecular characterization was done. Molecular characterization was done by specific primers of quorum sensing virulent genes. Amplified genes were sequenced, and accession numbers were obtained from the NCBI site. Genes lasR, lasI, rhlR, and rhlI were identified in P. aeruginosa strains (ss5, ss6, and ss11). Results: Current study revealed that these virulence genes are the main contributors of resistance of P. aeruginosa strains against different antibacterial agents. Conclusion: P. aeruginosa is a Gram-negative bacterium with diverse metabolic capacity to regulate survival under many different conditions and can be highly resistant to antibiotics, facilitating its spread in diverse habitats, particularly in hospitals. These virulent genes contribute to the overall pathogenic potential of P. aeruginosa that facilitates its ability to cause disease. P. aeruginosa Virulence genes Pulmonary infections neonates Quorum sensing lasR lasI rhlR and rhlI Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Figure 10 Figure 11 INTRODUCTION Bacteria are interesting microorganisms that have changed the course of the planet's history and play a significant role in many aspects of existence. They are often considered the oldest living lineage on Earth. Bacteria are famous for spreading diseases and infections, and they play a crucial role in maintaining the health of many other environmental systems [ 1 , 2 ]. They participate in processes like nitrogen cycling and decomposition. Gram-negative bacteria are classified based on their staining properties after a chemical technique, commonly referred to as Gram staining [ 3 ]. Gram-negative bacteria maintain pink stains, while gram-positive bacteria maintain blue stains. Gram-negative bacilli are bacteria shaped like rods. These bacteria include Escherichia coli, Pseudomonas, Klebsiella, Salmonella, Citrobacter , and others [ 4 – 6 ]. Mucosal cells and hair-like cells called cilia play important roles in the immune system's respiratory system. They irritate the upper respiratory tract, including the nose and throat, and work together to capture and destroy airborne pathogens, viruses, and bacteria [ 7 ]. The lower respiratory tract produces phlegm, trapping foreign particles like pollutants and dust, which later get expelled through coughing or transferred upwards for removal via the cilia. Defensive cells in the respiratory system, such as neutrophils, lymphocytes, and macrophages, actively identify and eliminate attacks and infections. Respiratory tract is affected by Gram-negative bacteria in various ways, from mild discomfort to severe infections [ 8 – 10 ]. P. aeruginosa causes two main types of respiratory tract infections: acute (especially if the patient has been breathing for a long time) and chronic (if the patient has cystic fibrosis or a similar lung disease) [ 11 , 12 ].The main factors involved in morbidity and mortality are the type three secretion factors (TTSS), ExoS, ExoT, and ExoU, particularly as validated in murine acute respiratory infection models. The presence or absence of TTSS components may influence the outcome of human infection. P.aeruginosa secretes pyocyanin, a blue pigment that has antibacterial properties against other microbial pathogens. Intranasal infection of adult CD-1 mice showed that pyocyanin production also caused severe lung injury. Quorum-sensing systems in P.aeruginosa involving LasI and LasR and RhlI also contribute to acute infections [ 13 – 16 ]. Many other acute infection models show that a deficiency in quorum-sensing capacity, notably LasR mutants, leads to reduced virulence compared to wild-type strains. Additional results showed that the loss of LasR function led to increased antibiotic resistance by mechanisms such as increased beta-lactamase activity. The loss of LasR function can also reduce the production of various virulence factors via this single mutation leading to strains better fit to cause chronic infections [ 17 – 21 ]. P. aeruginosa initially colonizes host tissues in the planktonic form, but the cells subsequently convert to the sessile state in biofilms. Biofilms have heterogeneous populations with phenotypic and genotypic diversification and can be formed by more than one species. P. aeruginosais one of the dominant pathogens along with other pathogens such as the Gram-negative Burkholderiacenocepacia and Gram-positive S. aureus. The heterogeneous bacterial populations in. P.aeruginosa biofilms often occupy distinct microenvironments [ 22 , 23 ]. Metabolically active cells are mostly found in the periphery and consume most of the oxygen, creating an oxygen gradient in the biofilm. The upper layers of the biofilm contain less metabolically active organisms and are anoxic. Therefore, peripheral bacterial cells actively growing in a biofilm are more susceptible to antibiotics, which have difficulty penetrating the mucus layer of the biofilm to reach deeper cell [ 24 ]. These help maintain channels and void spaces in mature biofilms so some nutrients can flow thought the matrix and are also involved in dispersion of cells from biofilms. Thus, various factors that modulate the properties of biofilms need to be produced by isolates of P. aeruginosa in order to maximize its ability to chronically colonize and infect human lungs [ 25 – 28 ]. METHODOLOGY Sample Collection: Sputum samples from neonates and infants suffering from RDS associated pneumonia were collected from Fatima Memorial Hospital Lahore by qualified and experienced pulmonologists with the consent of parents and guardians of the infants. Samples were transported to microbiology lab in Government College University Lahore in insulated ice bags. Study was approved by Board of studies (BOS), Department of Zoology and Advance Studies and Research Board, Government College University, Lahore (REG-ACAD-ASRB/57/24/021) with the approval of Office of Research Innovation and Commercialization, Government College University, Lahore (ORIC, GCUL) vide number 9390/ORIC/24. Isolation of Bacteria: MacConkey agar was prepared and samples were streaked on agar plates and incubated for overnight at 37 o C. Plates were checked after incubation period to confirm whether the bacteria are gram negative or gram positive [25]. Eosine Methylene blue agar (EMB Agar): EMB was used as a differential as well as selective media for isolation of negative gram bacteria. EMB inhibits the growth of gram positive bacteria and gram negative bacteria show pinkish colonies. For confirmation of P.aeruginosa, EMB agar test was also performed, to confirm whether gram negative bacteria present or not, for this isolated colonies were streaked on EMB agr plates and incubated for overnight at 37 o C [26] (Fig 1). Gram’s and Endospore staining To differentiate Gram negative and gram positive bacteria, Gran staining was done. Shape of bacterial colonies were identified under microscope (Fig 2). Qualitative Assay: For confirmation of P. aeruginosa in samples, preparation of King B agar media was done, bacterial colonies were streaked on the media and incubated for 24 hours at 37 o C. After incubation period, colonies were checked under trans-illuminator to check the production of fluorescein and pyocyanin [27, 29] (Fig 3). Isolation of Pure culture: For isolation of pure colonies of P.aeruginosa cetrimide agar media was prepared and sterilized. After sterilization, media was poured into plates and let the media to get settle down. After solidification of media, bacterial colonies were picked up with sterilized inoculating loop and streaked on the cetrimide agar pates. After streaking, plates were inverted and incubated for 48 hours at 37 o C. After incubation period, Plates were checked to confirm whether the bacterial colonies grow on cetrimide agar or not [30] (Fig 4). Preparation of inoculums and glycerol stock of bacterial strains: Nutrient broth media was prepared and sterilized. After sterilization, brith was poure into falcon tubes and bacterial colony was inoculated into nutrient broth. Nutrient broth culture was incubated for overnight at 37℃. For glycerol stock preparation, 200µl glycerol was added into Eppendorf and sterilized, after sterilization 800µl of bacterial strain was inoculated into sterilized glycerol and glycerol stock of bacterial strains were prepared and stored at 20 o C [26]. Pathogenicity Test: For isolation of pathogenic strains of P.aeruginosa , Blood agar test which is also known as pathogenicity test was performed. For this test, Nutrient agar media was prepared and sterilized in autoclave. After sterilization, as the media become normal cool at room temperature non-coagulated blood was added into nutrient agar media to make blood agar media. After mixing of blood into nutrient agar, media was poured into plates and let the plates to get solid. After solidification, pure colonies of P.aeruginosa were picked up with inoculating loop and streaked on blood agar plates. After streaking, Plates were incubated and type of hemolysis were checked after 24 hours [31] (Fig 5) Molecular characterization of virulence genes P.aeruginosa: Molecular characterization of virulence genes was done by isolationg genomic DNA from bacterial strains. DNA Extraction (Phenol: Choloroform extraction) Bacterial genomic DNA was extracted by the phenol-chloroform method. Lysogeny broth medium was inoculated with separate areas of bacteria grown on agar and cultured with shaking overnight at 37 °C. Centrifuge 10 ml of culture medium at 10,000 rpm (12,000 × g) for 20 min to pellet the brain. Remove the supernatant and resuspend the pellet in 400 μL of TEN buffer. Centrifuge the suspension at 12,000 × g for 10 min. Remove the supernatant, suspend the pellet in SET buffer (200 μL) and add 120 μL of lysozyme (20 mg/ml). Incubate the reaction mixture at 37°C for half an hour. Then add 200 μL of TEN buffer and 10 μL of 25% SDS solution. As, the mixture became normally cool 5M solution of NaCl (20 ul) was added in the mixture and then equal quantity 1:1 of phenol: chloroform was added into the mixture and centrifuge at 12,000 x g for 20 min to form a separate aqueous layer on top of the matte degraded protein. Aqueous layer was then transferred into the new pre- labeled Eppendorf, and then chloroform of equal volume was added into the Eppendorf. Centrifuge at 12,000 × g for 15 min to separate the aqueous phase from the chloroform. Place the top layer back into a new tube and soak overnight with two volumes of chilled ethanol. After that, Eppendorf was centrifuged at the speed of 12000rpm for 10 minutes, after centrifugation, supernatant was thrown away and with 70% ethanol was used to wash the pellet. After washing with ethanol, Eppendorf was air dried to avoid any contamination. DNA was adhere along the walls of Eppendorf.Store the DNA pellet in 50 µl of deionized water or TE buffer at ≤20°C until further use. [29, 32, 33]. Amplification of specific genes in P. aeruginosa : Amplification was performed in a 25-μl volume containing DNA sample (50 ng), Taq buffer (1X), DMSO (dimethyl sulfoxide), magnesium chloride (2 mM), each primer (10 pM/μl) (Table 1), nucleotides (dATP, dCTP, dGTP, dTTP) (200 μM, Thermo Scientific), and Taq polymerase (1 U/μl, FIR. Amplification was performed in a thermal cycler for 30 cycles, including predenaturation, denaturation, and annealing represented in fig 1. Primers listed in table 1 were used to amplify the QS genes lasI, lasR, rhlI and rhlR . A DNA Ladder of 1 kb plus 100 bp was used for comparison of DNA bands. For gel electrophoresis 1 gram agarose (1% agarose gel electrophoresis) was dissolved in the 2 % 50X TAE buffer and mixed well followed by heating in a microwave oven for 1 mint to boil the solution which was then poured into the casting tray. After solidifying, a fixed comb was used to make wells into which the amplified PCR product was loaded along with dye and the DNA ladder used to determine fragment sizes. The agarose gel was run at 90 volts for 30-40 minutes. After electrophoresis, the DNA in the gel was visualized under a UV trans-illuminator for observation of the amplified product. The bands of DNA were cut and gene clean was used to extract the DNA [34, 35]. Sequencing of PCR Products The PCR products from the clinical bacterial strains were sent for sequencing to the first BASE Laboratories, Malaysia for detailed analysis. RESULTS On Maconkey agar media, pinkish colonies showed the presence of gram negative bacteria and showed that the bacteria in samples were lactose fermented bacteria. Pinkish colonies on Eosin Methylene Blue Agar (EMB) showed positive result of presence of P.aeruginosa (Fig 1). Gram staining showed that bacterial strains retain oink colour which is the indication of gram negative bacteria (Fig 2). Under transilluminator, colonies of Pseudomonas aeruginosa showed yellow-green and bright green color due to fluorescein and pyocyanin production (Fig 3) On cetrimide agar media, isolated colonies of Pseudomonas aeruginosa were grown (Fig 4). All strains of Pseudomonas aeruginosa showed β-hemolysis (Fig 5). Extracted DNA samples were run on agarose gel and the bands observed in a trans-illuminator under ultraviolet radiations (figure 6) .The bacterial genes amplified were the identified by sequencing of the amplified products Using specific primer BLAST analyses of the nucleotide sequences there was 97-100% homology of the amplified sequences with previously published sequences. All PCR strains were identified and assigned an NCBI accession number (Table 2-4). Phylogenetic relationships of identified organisms were plotted in a dendrogram (Fig 7-11). DISCUSSION All strains had a lasB gene homologous to the LasB gene sequence in strain PA01 at the same chromosomal location and with sequence identities of 95–99%. Quorum sensing is regulated by LasB, and a lack of quorum sensing genes affects LasB expression. Quorum sensing genes LasR, LasI , rhlR, and rhlI all were identified at the same chromosomal locations in genomes of all the clinical strains of P.aeruginosa [ 36 ]. The sequences displayed identities of 98–100%. A mutation in the mvfR gene, which encodes an important regulator of quorum sensing, was found in the genome of strain PA7. The same mutation is also present in the mvfR gene but is absent in many strains and therefore lacks LasB activity. The LasB sequences and quorum sensing reports cannot be explained without LasB activity [ 37 ]. It is known that virulence factors such as extracellular proteases are produced by P. aeruginosa during late development and that their production is controlled by quorum sensing. P. aeruginosa causes severe diseases. LasR mutants have been studied for various properties. LasR mutants can grow in selective carbon and nitrogen sites compared to the wild type. The results showed that the loss of LasR function led to an increase in antibiotic resistance. In beta-lactamase activity, increased resistance was noted. This showed the loss of function of LasR . LasB , is a pseudolysin, which is an extracellular protease damages the tissue in P. aeruginosa infections [ 38 ]. Virulence factors LasB and AprA are regulated by the Las quorum system. Rhl quorum system also regulate LasB . AprA and LasB proteases require calcium for functioning and stability. LasB is more sensitive to calcium depletion. Protein structure of these two proteases are different; AprA contains eight calcium ion binding sites, and LasB has one. LasB produced a precursor protein involved autocatalytic processing and exported across the outer membrane. During infection, the high amount of extracellular DNA present in the extracellular matrix of P. aeruginosa biofilms has been shown to effectively chelate cations such as calcium, thus creating a cation-limited environment. Loss of LasB is observed when LasR and RhlR inactivate LasB [ 39 ]. CONCLUSION Isolates of P. aeruginosa from the Lahore region showed presence of virulence genes involved in resistance to many of the commercially available antibiotics. Mutation of these genes may develop more resistant strains. To control the infections caused by P.aeruginosa , a detailed study of the expression of genes is required. Declarations Consent for publication There is no conflict of interest among authors Availability of data and material Available Conflict of Interest No competing interests among authors Funding None Ethical Approval The study was approved by Board of studies (BOS), department of Zoology and Advance Studies and Research Board, Government College University Lahore (REG-ACAD-ASRB/57/24/021). Certificate of from ethical committee is available. Patients’ approval There was no research work on humans. Only sputum samples were collected from expert doctors who took samples with consent of patients. Authors’ contributions: N.M.A. prepared first and final draft of manuscript. M.C. and S.R. worked on figures. N.R. and I.L. did methodology and references section. S.Z. contributed in final draft of manuscript in results section. References Magnabosco C, Husain F, Paoletti MM, Parsons C, Payette JG, Schwartz SL, Fournier GP (2024) Toward a Natural History of Microbial Life. Annu Rev Earth Planet Sci 52(1):85–108 Wess L (2023) The Curious World of Bacteria. Greystone Books Ltd. Parasuraman P, Busi S, Lee JK (2024) Standard Microbiological Techniques (Staining, Morphological and Cultural Characteristics, Biochemical Properties, and Serotyping) in the Detection of ESKAPE Pathogens. ESKAPE Pathogens: Detection, Mechanisms and Treatment Strategies. Springer Nature Singapore, Singapore, pp 119–155 Kohlerschmidt DJ, Mingle LA, Dumas NB, Nattanmai G (2021) Identification of aerobic Gram-negative bacteria. Practical handbook of microbiology. CRC, pp 59–70 Sharma K, Singh R, Tripathi PN (2023) Isolation and enumeration of bacteria from common green vegetables available in nearby market at Ayodhya: Isolation of Bacteria. Sci Temper 14(01):128–141 Simukoko H (2021) Refocusing Functional Anatomy and Immunology of the Respiratory Mucosa in the Advent of Covid-19. Biotechnology to Combat COVID-19. IntechOpen, p 299 Legendre M, Zaragosi LE, Mitchison HM (2021) February) Motile cilia and airway disease. Seminars in cell & developmental biology, vol 110. Academic, pp 19–33 Honish RL (2021) Chest and Lung Diseases. Over 55. Psychology, pp 81–100 Abbott KA (2024) Diseases of the Respiratory System. Sheep Veterinary Practice. CRC, pp 483–508 Deshmukh R, Bandyopadhyay N, Abed SN, Bandopadhyay S, Pal Y, Deb PK (2020) Strategies for pulmonary delivery of drugs. Drug Delivery Systems. Academic, pp 85–129 Berglund LG, Rissanen S, Jussila K, Kaufman JW, Piirilä P, Savolainen KM, Juvonen R (2020) Physiological and toxicological considerations. Industrial ventilation design guidebook. Academic, pp 111–226 Conceição-Silva F, Reis CS, De Luca PM, Leite-Silva J, Santiago MA, Morrot A, Morgado FN (2021) The immune system throws its traps: cells and their extracellular traps in disease and protection. Cells 10(8):1891 Akhand AA, Ahsan N (2023) Cells and Organs of the Immune System. Immunol Dentistry 1–12 Govers C, Calder PC, Savelkoul HF, Albers R, van Neerven RJ (2022) Ingestion, immunity, and infection: nutrition and viral respiratory tract infections. Front Immunol 13:841532 Ali NM, Rehman S, Mazhar SA, Liaqat I, Mazhar B (2020) Psuedomonas aeruginosa-associated acute and chronic pulmonary infections. In Pathogenic Bacteria. IntechOpen Morin CD, Déziel E, Gauthier J, Levesque RC, Lau GW (2021) An organ system-based synopsis of Pseudomonas aeruginosa virulence. Virulence 12(1):1469–1507 Pelegrin AC, Palmieri M, Mirande C, Oliver A, Moons P, Goossens H, van Belkum A (2021) Pseudomonas aeruginosa: a clinical and genomics update. FEMS Microbiol Rev 45(6):fuab026 Chaudhry M, Shafique M, Ali NM, Munir S, Wasif M, Hayee S, Riaz S (2024) Prevalence of Pseudomonas aeruginosa associated chronic and acute respiratory infections and role of antibiotics as antibacterial agents against isolated pathogens Short title: P. aeruginosa associated respiratory infections. Hist Med 10(2):1128–1145 Wu T, Zhang Z, Li T, Dong X, Wu D, Zhu L, Zhang Y (2024) The type III secretion system facilitates systemic infections of Pseudomonas aeruginosa in the clinic. Microbiol Spectr 12(1):e02224–e02223 Shouman H, Said HS, Kenawy HI, Hassan R (2023) Molecular and biological characterization of pyocyanin from clinical and environmental Pseudomonas aeruginosa. Microb Cell Fact 22(1):166 Thi MTT, Wibowo D, Rehm BH (2020) Pseudomonas aeruginosa biofilms. Int J Mol Sci 21(22):8671 Guillaume O, Butnarasu C, Visentin S, Reimhult E (2022) Interplay between biofilm microenvironment and pathogenicity of Pseudomonas aeruginosa in cystic fibrosis lung chronic infection. Biofilm 4:100089 Jo J, Price-Whelan A, Dietrich LE (2022) Gradients and consequences of heterogeneity in biofilms. Nat Rev Microbiol 20(10):593–607 Jurado-Martín I, Sainz-Mejías M, McClean S (2021) Pseudomonas aeruginosa: an audacious pathogen with an adaptable arsenal of virulence factors. Int J Mol Sci 22(6):3128 Michael G, Garba L, Adamu MT, Manga MM, Yerima AA, Isa S (2023) Detection of Multidrug-Resistant Acinetobacter baumannii among Gram-Negative Bacteria Isolated from Clinical Samples Karmegham N, Vellasamy S, Natesan B, Sharma MP, Al Farraj DA, Elshikh MS (2020) Characterization of antifungal metabolite phenazine from rice rhizosphere fluorescent pseudomonads (FPs) and their effect on sheath blight of rice. Saudi J Biol Sci 27(12):3313–3326 Awari VG, Umeoduagu ND, Agu KC, Obasi CJ, Okonkwo NN, Chidozie CP (2024) Antibiogram of Pathogenic Pseudomonas aeruginosa Isolated from Hospital Environment. Int Refereed J Eng Sci 13(2):1 SÜER D (2021) Molecular Detection of Some Virulence Genes In Pseudomonas aeruginosa Isolated From Clinical Source (Doctoral dissertation, Doctoral dissertation, NEAR EAST UNIVERSITY) Gautam A (2022) Phenol-chloroform DNA isolation method. DNA and RNA Isolation Techniques for Non-Experts. Springer International Publishing, Cham, pp 33–39 Sawa T, Momiyama K, Mihara T, Kainuma A, Kinoshita M, Moriyama K (2020) Molecular epidemiology of clinically high-risk Pseudomonas aeruginosa strains: Practical overview. Microbiol Immunol 64(5):331–344 Wang C, Ye Q, Jiang A, Zhang J, Shang Y, Li F, Wang J (2022) Pseudomonas aeruginosa detection using conventional PCR and quantitative real-time PCR based on species-specific novel gene targets identified by pangenome analysis. Front Microbiol 13:820431 Bogiel T, Prażyńska M, Kwiecińska-Piróg J, Mikucka A, Gospodarek-Komkowska E (2020) Carbapenem-resistant Pseudomonas aeruginosa strains-distribution of the essential enzymatic virulence factors genes. Antibiotics 10(1):8 Scott B (2022) Uncovering the role of Macrophage Infectivity Potentiator (Mip) proteins in Pseudomonas aeruginosa (PA01) virulence (Doctoral dissertation, University of East Anglia) Asfahl KL, Smalley NE, Chang AP, Dandekar AA (2022) Genetic and transcriptomic characteristics of RhlR-dependent quorum sensing in cystic fibrosis isolates of Pseudomonas aeruginosa. Msystems 7(2):e00113–e00122 Khan F (2024) Multifaceted strategies for alleviating Pseudomonas aeruginosa infection by targeting protease activity: Natural and synthetic molecules. Int J Biol Macromol 134533 Everett MJ, Davies DT (2021) Pseudomonas aeruginosa elastase (LasB) as a therapeutic target. Drug Discovery Today 26(9):2108–2123 Nag M, Lahiri D, Mukherjee D, Garai S, Banerjee R, Ray RR (2021) Biofilms and acute and chronic infections. Biofilm-Mediated Diseases: Causes Controls 73–100 Sionov RV, Steinberg D (2022) Targeting the holy triangle of quorum sensing, biofilm formation, and antibiotic resistance in pathogenic bacteria. Microorganisms 10(6):1239 Sarkar S (2020) Release mechanisms and molecular interactions of Pseudomonas aeruginosa extracellular DNA. Appl Microbiol Biotechnol 104(15):6549–6564 Tables Table1. Primers used for detection of virulence genes involved in quorum sensing of P. aeruginosa Sr. no. Gene Primer Nucleotide sequence 1 Universal forward 16S-27F 5´-AGAGTTTGATCMTGGCTCAG-3´ reverse 16S-1492R 5´-TACGGYTACCTTGTTACGACTT-3´ 2 rhlR forward 5’ TGCATTTTATCGATCAGGGC 3’ reverse 5’ CACTTCCTTTTCCAGGACG 3’ 3 lasI forward 5’ CGTGCTCAAGTGTTCAAGG 3’ reverse 5’ TACAGTCGGAAAAGCCCAG 3’ 4 rhlI forward 5’ TTCATCCTCCTTTAGTCTTCCC 3’ reverse 5’ TTCCAGCGATTCAGAGAGC 3’ 5 rhlB forward 5’ GCCCACGACCAGTTCGAC 3’ reverse 5’ CATCCCCCTCCCTATGAC 3’. 6 lasR forward 5’ AAGTGGAAAATTGGAGTGGAG 3’ reverse 5’ GTAGTTGCCGACGACGATGAAG 3’ 7 rhlA forward 5’GATCGAGCTGGACGACAAGTC3’ reverse 5’GCTGATGGTTGCTGGCTTTC3’ Table 2. Virulence genes of P. aeruginosa (ss5) Sr. no. Gene Accession no rhlR MH373641 lasI MH373643 rhlI MH373645 rhlB MH373647 lasR MH373649 rhlA MH333800 Table 3. Virulence genes of P. aeruginosa (ss6) Sr. no. Gene Accession no rhlR MH373642 lasI MH373644 rhlI MH373646 rhlB MH373648 lasR MH373650 rhlA MH349090 Table 4. Virulence genes of P. aeruginosa (ss11) Sr. no. Gene Accession no rlhR MH388293 lasI MH373651 rlhI MH388292 rhlB MH388291 lasR MH373652 rhlA MH373653 Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-5234762","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":365208865,"identity":"52e34c28-a0e1-4e1b-87ad-87c2d946ea1f","order_by":0,"name":"Maham Chaudhry","email":"","orcid":"","institution":"Government College University","correspondingAuthor":false,"prefix":"","firstName":"Maham","middleName":"","lastName":"Chaudhry","suffix":""},{"id":365208866,"identity":"9164a8c1-31d5-46b2-870a-5907a02884a6","order_by":1,"name":"Safia Rehman","email":"","orcid":"","institution":"University of Punjab","correspondingAuthor":false,"prefix":"","firstName":"Safia","middleName":"","lastName":"Rehman","suffix":""},{"id":365208867,"identity":"f26d8008-1d54-43a6-926b-bde63896434f","order_by":2,"name":"Sehar Zahid","email":"","orcid":"","institution":"RLMC Lahore","correspondingAuthor":false,"prefix":"","firstName":"Sehar","middleName":"","lastName":"Zahid","suffix":""},{"id":365208868,"identity":"10332464-7f26-488b-a21a-d40279099852","order_by":3,"name":"Nazish Mazhar Ali","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABBElEQVRIiWNgGAWjYJCCA4wNQFICiD9ABAyAOIE4LYwziNXCANPCzEOMFnP24w8P/tyxTV5+dvOzzza/7BIb2Ju3STDuSMOpxbInIeEw75nbho1zjhnPzu1LTmzgOVYmwXgmB6cWgwMJBw4ztt1mbJZIMGbO7TmQ2CCRYybB2FaBW8v5hw0Hf7bdtm+TSP/MbAnSIv+GgJYbyQwHeNtuJ/ZI5BgzM/wA2cID0oLHYTeeMRwGakmeIZFTzNjbkGzcxpNWbJF4Brf3Dc6nP/4IdJjt/Bnpmxl+/LGT7Wc/vPHGxx3JOLWgAsY2BgY2ECOxgUgdDAx/YHqJ1zIKRsEoGAXDHwAABSZcEfaNyzgAAAAASUVORK5CYII=","orcid":"","institution":"Government College University","correspondingAuthor":true,"prefix":"","firstName":"Nazish","middleName":"Mazhar","lastName":"Ali","suffix":""},{"id":365208869,"identity":"955255de-f752-4743-81e9-c5b3bb4e6edc","order_by":4,"name":"Nabila Ruhi","email":"","orcid":"","institution":"University of Punjab","correspondingAuthor":false,"prefix":"","firstName":"Nabila","middleName":"","lastName":"Ruhi","suffix":""},{"id":365208870,"identity":"7f44d33a-0597-4e9d-bb9b-2692326b1508","order_by":5,"name":"Iram Liaqat","email":"","orcid":"","institution":"Government College University","correspondingAuthor":false,"prefix":"","firstName":"Iram","middleName":"","lastName":"Liaqat","suffix":""},{"id":365208871,"identity":"7d8c2ef5-a9e3-4caa-8437-441ac8a84183","order_by":6,"name":"Samreen Riaz","email":"","orcid":"","institution":"University of Punjab","correspondingAuthor":false,"prefix":"","firstName":"Samreen","middleName":"","lastName":"Riaz","suffix":""}],"badges":[],"createdAt":"2024-10-09 19:23:13","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-5234762/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-5234762/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":67203230,"identity":"fbb9fcc9-ed03-49f3-a825-937700796e41","added_by":"auto","created_at":"2024-10-22 10:24:39","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":513939,"visible":true,"origin":"","legend":"\u003cp\u003ePinkish colonies of \u003cem\u003eP.aeruginosa\u003c/em\u003e on EMB\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-5234762/v1/8f8f75e1b046775507b08a27.png"},{"id":67203225,"identity":"8149c114-7c81-46a6-a458-eb97415514e8","added_by":"auto","created_at":"2024-10-22 10:24:39","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":581769,"visible":true,"origin":"","legend":"\u003cp\u003eShows Gram’s stain results \u003cem\u003eof P.aeruginosa\u003c/em\u003e (Gram negative rods of Pink or red colour)\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-5234762/v1/485c4568955563502c17672a.png"},{"id":67203960,"identity":"80a20bdc-9fd1-4ffb-bc1f-138f83c4dc21","added_by":"auto","created_at":"2024-10-22 10:32:39","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":612644,"visible":true,"origin":"","legend":"\u003cp\u003eShows pyocyanin pigment extract\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-5234762/v1/df14027b54f868e6d45a60cb.png"},{"id":67203966,"identity":"7c115aff-fef1-471b-bf81-ea5f43c567c0","added_by":"auto","created_at":"2024-10-22 10:32:39","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":453867,"visible":true,"origin":"","legend":"\u003cp\u003eColonies of \u003cem\u003eP.aeruginosa\u003c/em\u003e on cetrimide agar\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-5234762/v1/85d884a328bee27cfb101a61.png"},{"id":67203961,"identity":"e70def82-7cd7-4903-a3ca-dfc98ac145ac","added_by":"auto","created_at":"2024-10-22 10:32:39","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":713804,"visible":true,"origin":"","legend":"\u003cp\u003ePathogenic test of \u003cem\u003eP.aeruginosa\u003c/em\u003e on Blood agar showing Beta hemolysis\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-5234762/v1/ccac0e00443581a7653182d2.png"},{"id":67203959,"identity":"c3bd5c61-7e1f-4915-89fa-0e25dce4eaa3","added_by":"auto","created_at":"2024-10-22 10:32:39","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":307384,"visible":true,"origin":"","legend":"\u003cp\u003eGel electrophoresis showing Genomic DNAbands.\u003c/p\u003e","description":"","filename":"6.png","url":"https://assets-eu.researchsquare.com/files/rs-5234762/v1/29e90f97c398175b304b0100.png"},{"id":67203231,"identity":"86b0f404-5576-456b-8325-7157de15175b","added_by":"auto","created_at":"2024-10-22 10:24:39","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":228910,"visible":true,"origin":"","legend":"\u003cp\u003eGel electrophoresis showing amplified gene product. (L=DNAladder)\u003c/p\u003e","description":"","filename":"7.png","url":"https://assets-eu.researchsquare.com/files/rs-5234762/v1/7676645e5fd54c8b47e5736f.png"},{"id":67203962,"identity":"53426956-2347-48ad-b0f1-707bc4de0730","added_by":"auto","created_at":"2024-10-22 10:32:39","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":230632,"visible":true,"origin":"","legend":"\u003cp\u003ePhylogenetic tree of bacterial strains ss5, ss6, ss11 (\u003cem\u003eP. aeruginosa)\u003c/em\u003e\u003c/p\u003e","description":"","filename":"8.png","url":"https://assets-eu.researchsquare.com/files/rs-5234762/v1/326b861ed8912a5f034f2ddb.png"},{"id":67204721,"identity":"a7d2981c-aa4f-4ea3-88cc-e6b215c91585","added_by":"auto","created_at":"2024-10-22 10:40:39","extension":"png","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":264316,"visible":true,"origin":"","legend":"\u003cp\u003ePhylogenetic tree of bacterial strains ss5 (\u003cem\u003eP. aeruginosa)\u003c/em\u003e\u003c/p\u003e","description":"","filename":"9.png","url":"https://assets-eu.researchsquare.com/files/rs-5234762/v1/2b1a886ceeb0a1927f3dc559.png"},{"id":67204787,"identity":"e435224e-58a2-4e61-9518-4c0a00fe0102","added_by":"auto","created_at":"2024-10-22 10:48:39","extension":"png","order_by":10,"title":"Figure 10","display":"","copyAsset":false,"role":"figure","size":228023,"visible":true,"origin":"","legend":"\u003cp\u003ePhylogenetic tree of bacterial strains ss5 (\u003cem\u003eP. aeruginosa\u003c/em\u003e)\u003c/p\u003e","description":"","filename":"10.png","url":"https://assets-eu.researchsquare.com/files/rs-5234762/v1/56eb6ac0fdbb0a8c4a54359f.png"},{"id":67203965,"identity":"839f48d5-0c2b-47e4-b882-80ba0c68d4eb","added_by":"auto","created_at":"2024-10-22 10:32:39","extension":"png","order_by":11,"title":"Figure 11","display":"","copyAsset":false,"role":"figure","size":268150,"visible":true,"origin":"","legend":"\u003cp\u003ePhylogenetic tree of bacterial strains ss5, ss6, and ss11 (\u003cem\u003eP. aeruginosa\u003c/em\u003e)\u003c/p\u003e","description":"","filename":"11.png","url":"https://assets-eu.researchsquare.com/files/rs-5234762/v1/339bfec5e558c6688009b994.png"},{"id":67932080,"identity":"3d19ae12-0534-4523-8b58-a35677bb6109","added_by":"auto","created_at":"2024-10-31 09:54:36","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":6380281,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-5234762/v1/81a5f0a9-f2ec-4c7c-bcf2-c3b394a1f261.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"\u003cp\u003e\u003cstrong\u003eMolecular characterization of virulence genes in quorum sensing system of different pathogenic strains of \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003ePseudomonas aeruginosa\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e from neonates with pulmonary infections using PCR as efficient technique\u003c/strong\u003e\u003c/p\u003e","fulltext":[{"header":"INTRODUCTION","content":"\u003cp\u003eBacteria are interesting microorganisms that have changed the course of the planet's history and play a significant role in many aspects of existence. They are often considered the oldest living lineage on Earth. Bacteria are famous for spreading diseases and infections, and they play a crucial role in maintaining the health of many other environmental systems [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. They participate in processes like nitrogen cycling and decomposition. Gram-negative bacteria are classified based on their staining properties after a chemical technique, commonly referred to as Gram staining [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. Gram-negative bacteria maintain pink stains, while gram-positive bacteria maintain blue stains. Gram-negative bacilli are bacteria shaped like rods. These bacteria include \u003cem\u003eEscherichia coli, Pseudomonas, Klebsiella, Salmonella, Citrobacter\u003c/em\u003e, and others [\u003cspan additionalcitationids=\"CR5\" citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eMucosal cells and hair-like cells called cilia play important roles in the immune system's respiratory system. They irritate the upper respiratory tract, including the nose and throat, and work together to capture and destroy airborne pathogens, viruses, and bacteria [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. The lower respiratory tract produces phlegm, trapping foreign particles like pollutants and dust, which later get expelled through coughing or transferred upwards for removal via the cilia. Defensive cells in the respiratory system, such as neutrophils, lymphocytes, and macrophages, actively identify and eliminate attacks and infections. Respiratory tract is affected by Gram-negative bacteria in various ways, from mild discomfort to severe infections [\u003cspan additionalcitationids=\"CR9\" citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e].\u003c/p\u003e \u003cp\u003e \u003cem\u003eP. aeruginosa\u003c/em\u003e causes two main types of respiratory tract infections: acute (especially if the patient has been breathing for a long time) and chronic (if the patient has cystic fibrosis or a similar lung disease) [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e].The main factors involved in morbidity and mortality are the type three secretion factors (TTSS), ExoS, ExoT, and ExoU, particularly as validated in murine acute respiratory infection models. The presence or absence of TTSS components may influence the outcome of human infection. \u003cem\u003eP.aeruginosa\u003c/em\u003e secretes pyocyanin, a blue pigment that has antibacterial properties against other microbial pathogens. Intranasal infection of adult CD-1 mice showed that pyocyanin production also caused severe lung injury. Quorum-sensing systems in \u003cem\u003eP.aeruginosa\u003c/em\u003e involving \u003cem\u003eLasI\u003c/em\u003e and \u003cem\u003eLasR\u003c/em\u003e and \u003cem\u003eRhlI\u003c/em\u003e also contribute to acute infections [\u003cspan additionalcitationids=\"CR14 CR15\" citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eMany other acute infection models show that a deficiency in quorum-sensing capacity, notably \u003cem\u003eLasR\u003c/em\u003e mutants, leads to reduced virulence compared to wild-type strains. Additional results showed that the loss of \u003cem\u003eLasR\u003c/em\u003e function led to increased antibiotic resistance by mechanisms such as increased beta-lactamase activity. The loss of \u003cem\u003eLasR\u003c/em\u003e function can also reduce the production of various virulence factors via this single mutation leading to strains better fit to cause chronic infections [\u003cspan additionalcitationids=\"CR18 CR19 CR20\" citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e].\u003c/p\u003e \u003cp\u003e \u003cem\u003eP. aeruginosa\u003c/em\u003e initially colonizes host tissues in the planktonic form, but the cells subsequently convert to the sessile state in biofilms. Biofilms have heterogeneous populations with phenotypic and genotypic diversification and can be formed by more than one species. \u003cem\u003eP. aeruginosais\u003c/em\u003e one of the dominant pathogens along with other pathogens such as the Gram-negative \u003cem\u003eBurkholderiacenocepacia\u003c/em\u003e and Gram-positive \u003cem\u003eS. aureus.\u003c/em\u003e The heterogeneous bacterial populations in. \u003cem\u003eP.aeruginosa\u003c/em\u003e biofilms often occupy distinct microenvironments [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e, \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eMetabolically active cells are mostly found in the periphery and consume most of the oxygen, creating an oxygen gradient in the biofilm. The upper layers of the biofilm contain less metabolically active organisms and are anoxic. Therefore, peripheral bacterial cells actively growing in a biofilm are more susceptible to antibiotics, which have difficulty penetrating the mucus layer of the biofilm to reach deeper cell [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. These help maintain channels and void spaces in mature biofilms so some nutrients can flow thought the matrix and are also involved in dispersion of cells from biofilms. Thus, various factors that modulate the properties of biofilms need to be produced by isolates of \u003cem\u003eP. aeruginosa\u003c/em\u003e in order to maximize its ability to chronically colonize and infect human lungs [\u003cspan additionalcitationids=\"CR26 CR27\" citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e].\u003c/p\u003e"},{"header":"METHODOLOGY","content":"\u003cp\u003e\u003cstrong\u003eSample Collection:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSputum samples from neonates and infants suffering from RDS associated pneumonia were collected from Fatima Memorial Hospital Lahore by qualified and experienced pulmonologists with the consent of parents and guardians of the infants. Samples were transported to microbiology lab in Government College University Lahore in insulated ice bags. Study was approved by Board of studies (BOS), Department of Zoology and Advance Studies and Research Board, Government College University, Lahore (REG-ACAD-ASRB/57/24/021) with the approval of Office of Research Innovation and Commercialization, Government College University, Lahore (ORIC, GCUL) vide number 9390/ORIC/24.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eIsolation of Bacteria:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eMacConkey agar was prepared and samples were streaked on agar plates and incubated for overnight at 37\u003csup\u003eo\u003c/sup\u003eC. Plates were checked after incubation period to confirm whether the bacteria are gram negative or gram positive\u003csup\u003e\u0026nbsp;\u003c/sup\u003e[25].\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEosine Methylene blue agar (EMB Agar):\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eEMB was used as a differential as well as selective media for isolation of negative gram bacteria. EMB inhibits the growth of gram positive bacteria and gram negative bacteria show pinkish colonies. For confirmation of \u003cem\u003eP.aeruginosa,\u003c/em\u003e EMB agar test was also performed, to confirm whether gram negative bacteria present or not, for this isolated colonies were streaked on EMB agr plates and incubated for overnight at 37\u003csup\u003eo\u003c/sup\u003eC\u003csup\u003e\u0026nbsp;\u003c/sup\u003e[26] (Fig 1).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eGram\u0026rsquo;s and Endospore staining\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo differentiate Gram negative and gram positive bacteria, Gran staining was done. Shape of bacterial colonies were identified under microscope (Fig 2).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eQualitative Assay:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFor confirmation of \u003cem\u003eP. aeruginosa\u003c/em\u003e in samples, preparation of King B agar media was done, bacterial colonies were streaked on the media and incubated for 24 hours at 37\u003csup\u003eo\u003c/sup\u003eC. After incubation period, colonies were checked under trans-illuminator to check the production of fluorescein and pyocyanin\u003csup\u003e\u0026nbsp;\u003c/sup\u003e[27, 29] (Fig 3).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eIsolation of Pure culture:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFor isolation of pure colonies of \u003cem\u003eP.aeruginosa\u003c/em\u003e cetrimide agar media was prepared and sterilized. After sterilization, media was poured into plates and let the media to get settle down. After solidification of media, bacterial colonies were picked up with sterilized inoculating loop and streaked on the cetrimide agar pates. After streaking, plates were inverted and incubated for 48 hours at 37\u003csup\u003eo\u003c/sup\u003eC. After incubation period, Plates were checked to confirm whether the bacterial colonies grow on cetrimide agar or not\u003csup\u003e\u0026nbsp;\u003c/sup\u003e[30] (Fig 4).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ePreparation of inoculums and glycerol stock of bacterial strains:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNutrient broth media was prepared and sterilized. After sterilization, brith was poure into falcon tubes and bacterial colony was inoculated into nutrient broth. Nutrient broth culture was incubated for overnight at 37℃.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eFor glycerol stock preparation, 200\u0026micro;l glycerol was added into Eppendorf and sterilized, after sterilization 800\u0026micro;l of bacterial strain was inoculated into sterilized glycerol and glycerol stock of bacterial strains were prepared and stored at 20\u003csup\u003eo\u003c/sup\u003eC\u003csup\u003e\u0026nbsp;\u003c/sup\u003e[26].\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ePathogenicity Test:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFor isolation of pathogenic strains of \u003cem\u003eP.aeruginosa\u003c/em\u003e, Blood agar test which is also known as pathogenicity test was performed. For this test, Nutrient agar media was prepared and sterilized in autoclave. After sterilization, as the media become normal cool at room temperature non-coagulated blood was added into nutrient agar media to make blood agar media. After mixing of blood into nutrient agar, media was poured into plates and let the plates to get solid. After solidification, pure colonies of \u003cem\u003eP.aeruginosa\u0026nbsp;\u003c/em\u003ewere picked up with inoculating loop and streaked on blood agar plates. After streaking, Plates were incubated and type of hemolysis were checked after 24 hours\u003csup\u003e\u0026nbsp;\u003c/sup\u003e[31] (Fig 5)\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMolecular characterization of virulence genes \u003cem\u003eP.aeruginosa:\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eMolecular characterization of virulence genes was done by isolationg genomic DNA from bacterial strains.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDNA Extraction (Phenol: Choloroform extraction)\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eBacterial genomic DNA was extracted by the phenol-chloroform method. Lysogeny broth medium was inoculated with separate areas of bacteria grown on agar and cultured with shaking overnight at 37 \u0026deg;C. Centrifuge 10 ml of culture medium at 10,000 rpm (12,000 \u0026times; g) for 20 min to pellet the brain. Remove the supernatant and resuspend the pellet in 400 \u0026mu;L of TEN buffer. Centrifuge the suspension at 12,000 \u0026times; g for 10 min. Remove the supernatant, suspend the pellet in SET buffer (200 \u0026mu;L) and add 120 \u0026mu;L of lysozyme (20 mg/ml). Incubate the reaction mixture at 37\u0026deg;C for half an hour. Then add 200 \u0026mu;L of TEN buffer and 10 \u0026mu;L of 25% SDS solution. As, the mixture became normally cool 5M solution of NaCl (20 ul) was added in the mixture and then equal quantity 1:1 of phenol: chloroform was added into the mixture and centrifuge at 12,000 x g for 20 min to form a separate aqueous layer on top of the matte degraded protein. Aqueous layer was then transferred into the new pre- labeled Eppendorf, and then chloroform of equal volume was added into the Eppendorf. Centrifuge at 12,000 \u0026times; g for 15 min to separate the aqueous phase from the chloroform. Place the top layer back into a new tube and soak overnight with two volumes of chilled ethanol. After that, Eppendorf was centrifuged at the speed of 12000rpm for 10 minutes, after centrifugation, supernatant was thrown away and with 70% ethanol was used to wash the pellet. After washing with ethanol, Eppendorf was air dried to avoid any contamination. DNA was adhere along the walls of Eppendorf.Store the DNA pellet in 50 \u0026micro;l of deionized water or TE buffer at \u0026le;20\u0026deg;C until further use. [29, 32, 33].\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAmplification of specific genes in \u003cem\u003eP. aeruginosa\u003c/em\u003e\u003c/strong\u003e:\u003c/p\u003e\n\u003cp\u003eAmplification was performed in a 25-\u0026mu;l volume containing DNA sample (50 ng), Taq buffer (1X), DMSO (dimethyl sulfoxide), magnesium chloride (2 mM), each primer (10 pM/\u0026mu;l) (Table 1), nucleotides (dATP, dCTP, dGTP, dTTP) (200 \u0026mu;M, Thermo Scientific), and Taq polymerase (1 U/\u0026mu;l, FIR. Amplification was performed in a thermal cycler for 30 cycles, including predenaturation, denaturation, and annealing represented in fig 1. \u0026nbsp;Primers listed in table 1 were used to amplify the QS genes \u003cem\u003elasI, lasR, rhlI\u003c/em\u003e and \u003cem\u003erhlR\u003c/em\u003e.\u0026nbsp;A DNA Ladder of 1 kb plus 100 bp was used for comparison of DNA bands. For gel electrophoresis 1 gram agarose (1% agarose gel electrophoresis) was dissolved in the 2 % 50X TAE buffer and mixed well followed by heating in a microwave oven for 1 mint to boil the solution which was then poured into the casting tray. After solidifying, a fixed comb was used to make wells into which the amplified PCR product was loaded along with dye and the DNA ladder used to determine fragment sizes. \u0026nbsp;The agarose gel was run at 90 volts for 30-40 minutes. After electrophoresis, the DNA in the gel was visualized under a UV trans-illuminator for observation of the amplified product. The bands of DNA were cut and gene clean was used to extract the DNA\u003csup\u003e\u0026nbsp;\u003c/sup\u003e[34, 35].\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eSequencing of PCR Products\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe PCR products from the clinical bacterial strains were sent for sequencing to the first BASE Laboratories, Malaysia for detailed analysis.\u003c/p\u003e"},{"header":"RESULTS","content":"\u003cp\u003eOn Maconkey agar media, pinkish colonies showed the presence of gram negative bacteria and showed that the bacteria in samples were lactose fermented bacteria.\u003c/p\u003e\n\u003cp\u003ePinkish colonies on\u0026nbsp;Eosin\u0026nbsp;Methylene\u0026nbsp;Blue\u0026nbsp;Agar (EMB)\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003eshowed positive result of presence of\u0026nbsp;\u003cem\u003eP.aeruginosa\u0026nbsp;\u003c/em\u003e(Fig 1).\u003c/p\u003e\n\u003cp\u003eGram staining showed that bacterial strains retain oink colour which is the indication of gram negative bacteria (Fig 2).\u003c/p\u003e\n\u003cp\u003eUnder transilluminator, colonies of\u0026nbsp;\u003cem\u003ePseudomonas aeruginosa\u0026nbsp;\u003c/em\u003eshowed\u003cem\u003e\u0026nbsp;\u003c/em\u003eyellow-green and bright green color due to fluorescein and pyocyanin production (Fig 3)\u003c/p\u003e\n\u003cp\u003eOn cetrimide agar media, isolated colonies of\u0026nbsp;\u003cem\u003ePseudomonas aeruginosa\u0026nbsp;\u003c/em\u003ewere grown (Fig 4).\u003c/p\u003e\n\u003cp\u003eAll strains of\u0026nbsp;\u003cem\u003ePseudomonas aeruginosa\u0026nbsp;\u003c/em\u003eshowed \u0026beta;-hemolysis (Fig 5).\u003c/p\u003e\n\u003cp\u003eExtracted DNA samples were run on agarose gel and the bands observed in a trans-illuminator under ultraviolet radiations (figure 6) .The bacterial genes amplified were the identified by sequencing of the amplified products Using specific primer BLAST analyses of the nucleotide sequences there was 97-100% homology of the amplified sequences with previously published sequences. All PCR strains were identified and assigned an NCBI accession number (Table 2-4). Phylogenetic relationships of identified organisms were plotted in a dendrogram (Fig 7-11).\u003c/p\u003e"},{"header":"DISCUSSION","content":"\u003cp\u003eAll strains had a \u003cem\u003elasB\u003c/em\u003e gene homologous to the \u003cem\u003eLasB\u003c/em\u003e gene sequence in strain PA01 at the same chromosomal location and with sequence identities of 95\u0026ndash;99%. Quorum sensing is regulated by LasB, and a lack of quorum sensing genes affects \u003cem\u003eLasB\u003c/em\u003e expression. Quorum sensing genes \u003cem\u003eLasR, LasI\u003c/em\u003e, \u003cem\u003erhlR, and rhlI\u003c/em\u003e all were identified at the same chromosomal locations in genomes of all the clinical strains of \u003cem\u003eP.aeruginosa\u003c/em\u003e [\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]. The sequences displayed identities of 98\u0026ndash;100%. A mutation in the mvfR gene, which encodes an important regulator of quorum sensing, was found in the genome of strain PA7. The same mutation is also present in the mvfR gene but is absent in many strains and therefore lacks \u003cem\u003eLasB\u003c/em\u003e activity. The \u003cem\u003eLasB\u003c/em\u003e sequences and quorum sensing reports cannot be explained without \u003cem\u003eLasB\u003c/em\u003e activity [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eIt is known that virulence factors such as extracellular proteases are produced by \u003cem\u003eP. aeruginosa\u003c/em\u003e during late development and that their production is controlled by quorum sensing. \u003cem\u003eP. aeruginosa\u003c/em\u003e causes severe diseases. \u003cem\u003eLasR\u003c/em\u003e mutants have been studied for various properties. \u003cem\u003eLasR\u003c/em\u003e mutants can grow in selective carbon and nitrogen sites compared to the wild type. The results showed that the loss of \u003cem\u003eLasR\u003c/em\u003e function led to an increase in antibiotic resistance. In beta-lactamase activity, increased resistance was noted. This showed the loss of function of \u003cem\u003eLasR\u003c/em\u003e. \u003cem\u003eLasB\u003c/em\u003e, is a pseudolysin, which is an extracellular protease damages the tissue in \u003cem\u003eP. aeruginosa\u003c/em\u003e infections [\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e]. Virulence factors \u003cem\u003eLasB\u003c/em\u003e and \u003cem\u003eAprA\u003c/em\u003e are regulated by the Las quorum system. \u003cem\u003eRhl\u003c/em\u003e quorum system also regulate \u003cem\u003eLasB\u003c/em\u003e. \u003cem\u003eAprA\u003c/em\u003e and \u003cem\u003eLasB\u003c/em\u003e proteases require calcium for functioning and stability. \u003cem\u003eLasB\u003c/em\u003e is more sensitive to calcium depletion. Protein structure of these two proteases are different; \u003cem\u003eAprA\u003c/em\u003e contains eight calcium ion binding sites, and \u003cem\u003eLasB\u003c/em\u003e has one. \u003cem\u003eLasB\u003c/em\u003e produced a precursor protein involved autocatalytic processing and exported across the outer membrane. During infection, the high amount of extracellular DNA present in the extracellular matrix of \u003cem\u003eP. aeruginosa\u003c/em\u003e biofilms has been shown to effectively chelate cations such as calcium, thus creating a cation-limited environment. Loss of \u003cem\u003eLasB\u003c/em\u003e is observed when \u003cem\u003eLasR\u003c/em\u003e and \u003cem\u003eRhlR\u003c/em\u003e inactivate \u003cem\u003eLasB\u003c/em\u003e [\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e].\u003c/p\u003e"},{"header":"CONCLUSION","content":"\u003cp\u003eIsolates of \u003cem\u003eP. aeruginosa\u003c/em\u003e from the Lahore region showed presence of virulence genes involved in resistance to many of the commercially available antibiotics. Mutation of these genes may develop more resistant strains. To control the infections caused by \u003cem\u003eP.aeruginosa\u003c/em\u003e, a detailed study of the expression of genes is required.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThere is no conflict of interest among authors\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and material\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAvailable\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflict of Interest\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNo competing interests among authors\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNone\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthical Approval\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe study was approved by Board of studies (BOS), department of Zoology and Advance Studies and Research Board, Government College University Lahore (REG-ACAD-ASRB/57/24/021). Certificate of from ethical committee is available.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ePatients\u0026rsquo; approval\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThere was no research work on humans. Only sputum samples were collected from expert doctors who took samples with consent of patients.\u0026nbsp;\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eAuthors\u0026rsquo; contributions:\u0026nbsp;\u003c/strong\u003eN.M.A. prepared first and final draft of manuscript. M.C. and S.R. worked on figures. N.R. and I.L. did methodology and references section. S.Z. contributed in final draft of manuscript in results section.\u003c/p\u003e\n\u003cp\u003e\u003cbr\u003e\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eMagnabosco C, Husain F, Paoletti MM, Parsons C, Payette JG, Schwartz SL, Fournier GP (2024) Toward a Natural History of Microbial Life. Annu Rev Earth Planet Sci 52(1):85\u0026ndash;108\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWess L (2023) The Curious World of Bacteria. Greystone Books Ltd.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eParasuraman P, Busi S, Lee JK (2024) Standard Microbiological Techniques (Staining, Morphological and Cultural Characteristics, Biochemical Properties, and Serotyping) in the Detection of ESKAPE Pathogens. ESKAPE Pathogens: Detection, Mechanisms and Treatment Strategies. Springer Nature Singapore, Singapore, pp 119\u0026ndash;155\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKohlerschmidt DJ, Mingle LA, Dumas NB, Nattanmai G (2021) Identification of aerobic Gram-negative bacteria. Practical handbook of microbiology. CRC, pp 59\u0026ndash;70\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSharma K, Singh R, Tripathi PN (2023) Isolation and enumeration of bacteria from common green vegetables available in nearby market at Ayodhya: Isolation of Bacteria. Sci Temper 14(01):128\u0026ndash;141\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSimukoko H (2021) Refocusing Functional Anatomy and Immunology of the Respiratory Mucosa in the Advent of Covid-19. Biotechnology to Combat COVID-19. IntechOpen, p 299\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLegendre M, Zaragosi LE, Mitchison HM (2021) February) Motile cilia and airway disease. Seminars in cell \u0026amp; developmental biology, vol 110. Academic, pp 19\u0026ndash;33\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHonish RL (2021) Chest and Lung Diseases. Over 55. Psychology, pp 81\u0026ndash;100\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAbbott KA (2024) Diseases of the Respiratory System. Sheep Veterinary Practice. CRC, pp 483\u0026ndash;508\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDeshmukh R, Bandyopadhyay N, Abed SN, Bandopadhyay S, Pal Y, Deb PK (2020) Strategies for pulmonary delivery of drugs. Drug Delivery Systems. Academic, pp 85\u0026ndash;129\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBerglund LG, Rissanen S, Jussila K, Kaufman JW, Piiril\u0026auml; P, Savolainen KM, Juvonen R (2020) Physiological and toxicological considerations. Industrial ventilation design guidebook. Academic, pp 111\u0026ndash;226\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eConcei\u0026ccedil;\u0026atilde;o-Silva F, Reis CS, De Luca PM, Leite-Silva J, Santiago MA, Morrot A, Morgado FN (2021) The immune system throws its traps: cells and their extracellular traps in disease and protection. Cells 10(8):1891\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAkhand AA, Ahsan N (2023) Cells and Organs of the Immune System. Immunol Dentistry 1\u0026ndash;12\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGovers C, Calder PC, Savelkoul HF, Albers R, van Neerven RJ (2022) Ingestion, immunity, and infection: nutrition and viral respiratory tract infections. Front Immunol 13:841532\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAli NM, Rehman S, Mazhar SA, Liaqat I, Mazhar B (2020) Psuedomonas aeruginosa-associated acute and chronic pulmonary infections. In Pathogenic Bacteria. IntechOpen\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMorin CD, D\u0026eacute;ziel E, Gauthier J, Levesque RC, Lau GW (2021) An organ system-based synopsis of Pseudomonas aeruginosa virulence. Virulence 12(1):1469\u0026ndash;1507\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePelegrin AC, Palmieri M, Mirande C, Oliver A, Moons P, Goossens H, van Belkum A (2021) Pseudomonas aeruginosa: a clinical and genomics update. FEMS Microbiol Rev 45(6):fuab026\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChaudhry M, Shafique M, Ali NM, Munir S, Wasif M, Hayee S, Riaz S (2024) Prevalence of Pseudomonas aeruginosa associated chronic and acute respiratory infections and role of antibiotics as antibacterial agents against isolated pathogens Short title: P. aeruginosa associated respiratory infections. Hist Med 10(2):1128\u0026ndash;1145\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWu T, Zhang Z, Li T, Dong X, Wu D, Zhu L, Zhang Y (2024) The type III secretion system facilitates systemic infections of Pseudomonas aeruginosa in the clinic. Microbiol Spectr 12(1):e02224\u0026ndash;e02223\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShouman H, Said HS, Kenawy HI, Hassan R (2023) Molecular and biological characterization of pyocyanin from clinical and environmental Pseudomonas aeruginosa. Microb Cell Fact 22(1):166\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eThi MTT, Wibowo D, Rehm BH (2020) Pseudomonas aeruginosa biofilms. Int J Mol Sci 21(22):8671\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGuillaume O, Butnarasu C, Visentin S, Reimhult E (2022) Interplay between biofilm microenvironment and pathogenicity of Pseudomonas aeruginosa in cystic fibrosis lung chronic infection. Biofilm 4:100089\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJo J, Price-Whelan A, Dietrich LE (2022) Gradients and consequences of heterogeneity in biofilms. Nat Rev Microbiol 20(10):593\u0026ndash;607\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJurado-Mart\u0026iacute;n I, Sainz-Mej\u0026iacute;as M, McClean S (2021) Pseudomonas aeruginosa: an audacious pathogen with an adaptable arsenal of virulence factors. Int J Mol Sci 22(6):3128\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMichael G, Garba L, Adamu MT, Manga MM, Yerima AA, Isa S (2023) Detection of Multidrug-Resistant Acinetobacter baumannii among Gram-Negative Bacteria Isolated from Clinical Samples\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKarmegham N, Vellasamy S, Natesan B, Sharma MP, Al Farraj DA, Elshikh MS (2020) Characterization of antifungal metabolite phenazine from rice rhizosphere fluorescent pseudomonads (FPs) and their effect on sheath blight of rice. Saudi J Biol Sci 27(12):3313\u0026ndash;3326\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAwari VG, Umeoduagu ND, Agu KC, Obasi CJ, Okonkwo NN, Chidozie CP (2024) Antibiogram of Pathogenic Pseudomonas aeruginosa Isolated from Hospital Environment. Int Refereed J Eng Sci 13(2):1\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eS\u0026Uuml;ER D (2021) Molecular Detection of Some Virulence Genes In Pseudomonas aeruginosa Isolated From Clinical Source (Doctoral dissertation, Doctoral dissertation, NEAR EAST UNIVERSITY)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGautam A (2022) Phenol-chloroform DNA isolation method. DNA and RNA Isolation Techniques for Non-Experts. Springer International Publishing, Cham, pp 33\u0026ndash;39\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSawa T, Momiyama K, Mihara T, Kainuma A, Kinoshita M, Moriyama K (2020) Molecular epidemiology of clinically high-risk Pseudomonas aeruginosa strains: Practical overview. Microbiol Immunol 64(5):331\u0026ndash;344\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang C, Ye Q, Jiang A, Zhang J, Shang Y, Li F, Wang J (2022) Pseudomonas aeruginosa detection using conventional PCR and quantitative real-time PCR based on species-specific novel gene targets identified by pangenome analysis. Front Microbiol 13:820431\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBogiel T, Prażyńska M, Kwiecińska-Pir\u0026oacute;g J, Mikucka A, Gospodarek-Komkowska E (2020) Carbapenem-resistant Pseudomonas aeruginosa strains-distribution of the essential enzymatic virulence factors genes. Antibiotics 10(1):8\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eScott B (2022) Uncovering the role of Macrophage Infectivity Potentiator (Mip) proteins in Pseudomonas aeruginosa (PA01) virulence (Doctoral dissertation, University of East Anglia)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAsfahl KL, Smalley NE, Chang AP, Dandekar AA (2022) Genetic and transcriptomic characteristics of RhlR-dependent quorum sensing in cystic fibrosis isolates of Pseudomonas aeruginosa. Msystems 7(2):e00113\u0026ndash;e00122\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKhan F (2024) Multifaceted strategies for alleviating Pseudomonas aeruginosa infection by targeting protease activity: Natural and synthetic molecules. Int J Biol Macromol 134533\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEverett MJ, Davies DT (2021) Pseudomonas aeruginosa elastase (LasB) as a therapeutic target. Drug Discovery Today 26(9):2108\u0026ndash;2123\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNag M, Lahiri D, Mukherjee D, Garai S, Banerjee R, Ray RR (2021) Biofilms and acute and chronic infections. Biofilm-Mediated Diseases: Causes Controls 73\u0026ndash;100\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSionov RV, Steinberg D (2022) Targeting the holy triangle of quorum sensing, biofilm formation, and antibiotic resistance in pathogenic bacteria. Microorganisms 10(6):1239\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSarkar S (2020) Release mechanisms and molecular interactions of Pseudomonas aeruginosa extracellular DNA. Appl Microbiol Biotechnol 104(15):6549\u0026ndash;6564\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"},{"header":"Tables","content":"\u003cp\u003e\u003cstrong\u003eTable1. Primers used for detection of virulence genes involved in quorum sensing of \u003cem\u003eP. aeruginosa\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cdiv align=\"center\"\u003e\n \u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"100%\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 10.2041%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eSr. no.\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 13.2653%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eGene\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 11.2245%;\"\u003e\n \u003cp\u003e\u003cstrong\u003ePrimer\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 65.3061%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eNucleotide sequence\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 10.2041%;\"\u003e\n \u003cp\u003e\u003cstrong\u003e1\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 13.2653%;\"\u003e\n \u003cp\u003eUniversal\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 11.2245%;\"\u003e\n \u003cp\u003eforward\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 65.3061%;\"\u003e\n \u003cp\u003e16S-27F \u0026nbsp;5\u0026acute;-AGAGTTTGATCMTGGCTCAG-3\u0026acute;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 10.2041%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 13.2653%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 11.2245%;\"\u003e\n \u003cp\u003ereverse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 65.3061%;\"\u003e\n \u003cp\u003e16S-1492R 5\u0026acute;-TACGGYTACCTTGTTACGACTT-3\u0026acute;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 10.2041%;\"\u003e\n \u003cp\u003e\u003cstrong\u003e2\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 13.2653%;\"\u003e\n \u003cp\u003e\u003cem\u003erhlR\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 11.2245%;\"\u003e\n \u003cp\u003eforward\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 65.3061%;\"\u003e\n \u003cp\u003e5\u0026rsquo; TGCATTTTATCGATCAGGGC 3\u0026rsquo;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 10.2041%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 13.2653%;\"\u003e\n \u003cp\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 11.2245%;\"\u003e\n \u003cp\u003ereverse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 65.3061%;\"\u003e\n \u003cp\u003e5\u0026rsquo; CACTTCCTTTTCCAGGACG 3\u0026rsquo;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 10.2041%;\"\u003e\n \u003cp\u003e\u003cstrong\u003e3\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 13.2653%;\"\u003e\n \u003cp\u003e\u003cem\u003elasI\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 11.2245%;\"\u003e\n \u003cp\u003eforward\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 65.3061%;\"\u003e\n \u003cp\u003e5\u0026rsquo; CGTGCTCAAGTGTTCAAGG 3\u0026rsquo;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 10.2041%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 13.2653%;\"\u003e\n \u003cp\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 11.2245%;\"\u003e\n \u003cp\u003ereverse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 65.3061%;\"\u003e\n \u003cp\u003e5\u0026rsquo; TACAGTCGGAAAAGCCCAG 3\u0026rsquo;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 10.2041%;\"\u003e\n \u003cp\u003e\u003cstrong\u003e4\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 13.2653%;\"\u003e\n \u003cp\u003e\u003cem\u003erhlI\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 11.2245%;\"\u003e\n \u003cp\u003eforward\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 65.3061%;\"\u003e\n \u003cp\u003e5\u0026rsquo; TTCATCCTCCTTTAGTCTTCCC 3\u0026rsquo;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 10.2041%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 13.2653%;\"\u003e\n \u003cp\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 11.2245%;\"\u003e\n \u003cp\u003ereverse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 65.3061%;\"\u003e\n \u003cp\u003e5\u0026rsquo; TTCCAGCGATTCAGAGAGC 3\u0026rsquo;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 10.2041%;\"\u003e\n \u003cp\u003e\u003cstrong\u003e5\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 13.2653%;\"\u003e\n \u003cp\u003e\u003cem\u003erhlB\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 11.2245%;\"\u003e\n \u003cp\u003eforward\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 65.3061%;\"\u003e\n \u003cp\u003e5\u0026rsquo; GCCCACGACCAGTTCGAC 3\u0026rsquo;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 10.2041%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 13.2653%;\"\u003e\n \u003cp\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 11.2245%;\"\u003e\n \u003cp\u003ereverse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 65.3061%;\"\u003e\n \u003cp\u003e5\u0026rsquo; CATCCCCCTCCCTATGAC 3\u0026rsquo;.\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 10.2041%;\"\u003e\n \u003cp\u003e\u003cstrong\u003e6\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 13.2653%;\"\u003e\n \u003cp\u003e\u003cem\u003elasR\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 11.2245%;\"\u003e\n \u003cp\u003eforward\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 65.3061%;\"\u003e\n \u003cp\u003e5\u0026rsquo; AAGTGGAAAATTGGAGTGGAG 3\u0026rsquo;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 10.2041%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 13.2653%;\"\u003e\n \u003cp\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 11.2245%;\"\u003e\n \u003cp\u003ereverse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 65.3061%;\"\u003e\n \u003cp\u003e5\u0026rsquo; GTAGTTGCCGACGACGATGAAG 3\u0026rsquo;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 10.2041%;\"\u003e\n \u003cp\u003e\u003cstrong\u003e7\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 13.2653%;\"\u003e\n \u003cp\u003e\u003cem\u003erhlA\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 11.2245%;\"\u003e\n \u003cp\u003eforward\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 65.3061%;\"\u003e\n \u003cp\u003e5\u0026rsquo;GATCGAGCTGGACGACAAGTC3\u0026rsquo;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 10.2041%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 13.2653%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 11.2245%;\"\u003e\n \u003cp\u003ereverse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 65.3061%;\"\u003e\n \u003cp\u003e5\u0026rsquo;GCTGATGGTTGCTGGCTTTC3\u0026rsquo;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n\u003c/div\u003e\n\u003cp\u003e\u003cbr\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 2. Virulence genes of \u003cem\u003eP. aeruginosa (ss5)\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"100%\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 13.2653%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eSr. no.\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 20.4082%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eGene\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 66.3265%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eAccession no\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 13.2653%;\"\u003e\n \u003col\u003e\n \u003cli\u003e\u0026nbsp;\u003c/li\u003e\n \u003c/ol\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 20.4082%;\"\u003e\n \u003cp\u003e\u003cem\u003erhlR\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 66.3265%;\"\u003e\n \u003cp\u003eMH373641\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 13.2653%;\"\u003e\n \u003col start=\"2\"\u003e\n \u003cli\u003e\u0026nbsp;\u003c/li\u003e\n \u003c/ol\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 20.4082%;\"\u003e\n \u003cp\u003e\u003cem\u003elasI\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 66.3265%;\"\u003e\n \u003cp\u003eMH373643\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 13.2653%;\"\u003e\n \u003col start=\"3\"\u003e\n \u003cli\u003e\u0026nbsp;\u003c/li\u003e\n \u003c/ol\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 20.4082%;\"\u003e\n \u003cp\u003e\u003cem\u003erhlI\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 66.3265%;\"\u003e\n \u003cp\u003eMH373645\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 13.2653%;\"\u003e\n \u003col start=\"4\"\u003e\n \u003cli\u003e\u0026nbsp;\u003c/li\u003e\n \u003c/ol\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 20.4082%;\"\u003e\n \u003cp\u003e\u003cem\u003erhlB\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 66.3265%;\"\u003e\n \u003cp\u003eMH373647\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 13.2653%;\"\u003e\n \u003col start=\"5\"\u003e\n \u003cli\u003e\u0026nbsp;\u003c/li\u003e\n \u003c/ol\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 20.4082%;\"\u003e\n \u003cp\u003e\u003cem\u003elasR\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 66.3265%;\"\u003e\n \u003cp\u003eMH373649\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 13.2653%;\"\u003e\n \u003col start=\"6\"\u003e\n \u003cli\u003e\u0026nbsp;\u003c/li\u003e\n \u003c/ol\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 20.4082%;\"\u003e\n \u003cp\u003e\u003cem\u003erhlA\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 66.3265%;\"\u003e\n \u003cp\u003eMH333800\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003cbr\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 3. Virulence genes of \u003cem\u003eP. aeruginosa (ss6)\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"100%\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 13.2653%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eSr. no.\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 20.4082%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eGene\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 66.3265%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eAccession no\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 13.2653%;\"\u003e\n \u003col\u003e\n \u003cli\u003e\u0026nbsp;\u003c/li\u003e\n \u003c/ol\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 20.4082%;\"\u003e\n \u003cp\u003e\u003cem\u003erhlR\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 66.3265%;\"\u003e\n \u003cp\u003eMH373642\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 13.2653%;\"\u003e\n \u003col start=\"2\"\u003e\n \u003cli\u003e\u0026nbsp;\u003c/li\u003e\n \u003c/ol\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 20.4082%;\"\u003e\n \u003cp\u003e\u003cem\u003elasI\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 66.3265%;\"\u003e\n \u003cp\u003eMH373644\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 13.2653%;\"\u003e\n \u003col start=\"3\"\u003e\n \u003cli\u003e\u0026nbsp;\u003c/li\u003e\n \u003c/ol\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 20.4082%;\"\u003e\n \u003cp\u003e\u003cem\u003erhlI\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 66.3265%;\"\u003e\n \u003cp\u003eMH373646\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 13.2653%;\"\u003e\n \u003col start=\"4\"\u003e\n \u003cli\u003e\u0026nbsp;\u003c/li\u003e\n \u003c/ol\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 20.4082%;\"\u003e\n \u003cp\u003e\u003cem\u003erhlB\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 66.3265%;\"\u003e\n \u003cp\u003eMH373648\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 13.2653%;\"\u003e\n \u003col start=\"5\"\u003e\n \u003cli\u003e\u0026nbsp;\u003c/li\u003e\n \u003c/ol\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 20.4082%;\"\u003e\n \u003cp\u003e\u003cem\u003elasR\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 66.3265%;\"\u003e\n \u003cp\u003eMH373650\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 13.2653%;\"\u003e\n \u003col start=\"6\"\u003e\n \u003cli\u003e\u0026nbsp;\u003c/li\u003e\n \u003c/ol\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 20.4082%;\"\u003e\n \u003cp\u003e\u003cem\u003erhlA\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 66.3265%;\"\u003e\n \u003cp\u003eMH349090\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003cbr\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 4. Virulence genes of \u003cem\u003eP. aeruginosa (ss11)\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"100%\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 14.1414%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eSr. no.\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 18.1818%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eGene\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 67.6768%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eAccession no\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 14.1414%;\"\u003e\n \u003col\u003e\n \u003cli\u003e\u0026nbsp;\u003c/li\u003e\n \u003c/ol\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 18.1818%;\"\u003e\n \u003cp\u003e\u003cem\u003erlhR\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 67.6768%;\"\u003e\n \u003cp\u003eMH388293\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 14.1414%;\"\u003e\n \u003col start=\"2\"\u003e\n \u003cli\u003e\u0026nbsp;\u003c/li\u003e\n \u003c/ol\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 18.1818%;\"\u003e\n \u003cp\u003e\u003cem\u003elasI\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 67.6768%;\"\u003e\n \u003cp\u003eMH373651\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 14.1414%;\"\u003e\n \u003col start=\"3\"\u003e\n \u003cli\u003e\u0026nbsp;\u003c/li\u003e\n \u003c/ol\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 18.1818%;\"\u003e\n \u003cp\u003e\u003cem\u003erlhI\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 67.6768%;\"\u003e\n \u003cp\u003eMH388292\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 14.1414%;\"\u003e\n \u003col start=\"4\"\u003e\n \u003cli\u003e\u0026nbsp;\u003c/li\u003e\n \u003c/ol\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 18.1818%;\"\u003e\n \u003cp\u003e\u003cem\u003erhlB\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 67.6768%;\"\u003e\n \u003cp\u003eMH388291\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 14.1414%;\"\u003e\n \u003col start=\"5\"\u003e\n \u003cli\u003e\u0026nbsp;\u003c/li\u003e\n \u003c/ol\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 18.1818%;\"\u003e\n \u003cp\u003e\u003cem\u003elasR\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 67.6768%;\"\u003e\n \u003cp\u003eMH373652\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 14.1414%;\"\u003e\n \u003col start=\"6\"\u003e\n \u003cli\u003e\u0026nbsp;\u003c/li\u003e\n \u003c/ol\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 18.1818%;\"\u003e\n \u003cp\u003e\u003cem\u003erhlA\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 67.6768%;\"\u003e\n \u003cp\u003eMH373653\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"P. aeruginosa, Virulence genes, Pulmonary infections, neonates, Quorum sensing, lasR, lasI, rhlR, and rhlI","lastPublishedDoi":"10.21203/rs.3.rs-5234762/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-5234762/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003eBackground:\u003c/strong\u003e The expectation from the current research study was to genetically identify the virulence genes involved in quorum sensing (QS) in different strains of \u003cem\u003ePseudomonas aeruginosa,\u003c/em\u003e as the QS controls production of many virulence factors.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eObjective: \u003c/strong\u003eThe intention of current research study was to isolate the\u003cstrong\u003e \u003c/strong\u003epathogenic strains of \u003cem\u003eP. aeruginosa \u003c/em\u003efrom sputum samples of neonates and infants and their molecular characterization\u003cem\u003e.\u003c/em\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMethods:\u003c/strong\u003e \u003cem\u003eP. aeruginosa\u003c/em\u003ewere obtained from Microbiology Laboratory, Department of Zoology, Government College University Lahore were grown on selective media. Biochemical and molecular characterization was done. Molecular characterization was done by specific primers of quorum sensing virulent genes. Amplified genes were sequenced, and accession numbers were obtained from the NCBI site. Genes \u003cem\u003elasR, lasI, rhlR,\u003c/em\u003e and \u003cem\u003erhlI \u003c/em\u003ewere identified in \u003cem\u003eP. aeruginosa\u003c/em\u003e strains (ss5, ss6, and ss11).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eResults:\u003c/strong\u003e Current study revealed that these virulence genes are the main contributors of resistance of P. aeruginosa strains against different antibacterial agents.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConclusion:\u003c/strong\u003e P. aeruginosa is a Gram-negative bacterium with diverse metabolic capacity to regulate survival under many different conditions and can be highly resistant to antibiotics, facilitating its spread in diverse habitats, particularly in hospitals. These virulent genes contribute to the overall pathogenic potential of \u003cem\u003eP. aeruginosa\u003c/em\u003e that facilitates its ability to cause disease.\u003c/p\u003e","manuscriptTitle":"Molecular characterization of virulence genes in quorum sensing system of different pathogenic strains of Pseudomonas aeruginosa from neonates with pulmonary infections using PCR as efficient technique","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-10-22 10:24:34","doi":"10.21203/rs.3.rs-5234762/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"e6a78092-fea7-47cb-935c-6f45eca754ee","owner":[],"postedDate":"October 22nd, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-10-31T09:54:11+00:00","versionOfRecord":[],"versionCreatedAt":"2024-10-22 10:24:34","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-5234762","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-5234762","identity":"rs-5234762","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}