Novel DPY19L2 mutation locus causes globozoospermia | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Short Report Novel DPY19L2 mutation locus causes globozoospermia Hongjing Li, Jun He, Chaojun Chen, Yong Zhang, Zongjian Tan, Weiming Chen This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4105020/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Spermatozoa acrosome abnormalities are a rare and severe form of male infertility caused by structural abnormalities of the sperm acrosome or acrosomal enzyme abnormalities, which usually present as round-headed spermatozoa with loss of sperm insemination. Variation in the DPY19L2 gene is highly correlated with known cases of conchoidal spermatidosis, and there is extensive evidence that heterozygous variants cause spermatozoa abnormalities, although fewer cases have been reported for purely homozygous variants of the locus. In our study, we identified and clinically confirmed a single spermatozoa cytoplasmic injection combined with calcium carrier-assisted oocyte activation pregnancy in a patient with congenital spermatidosis, resulting in a live birth and transposition of the great arteries. Whole-exome testing identified and reported for the first time the DPY19L2c.63dupG (p.Arg22Alafs*66) mutant locus, which was confirmed by combining the family history of consanguineous marriages with the family lineage of exomes. a pure mutation in the DPY19L2 gene and caused sterility in all of his siblings. In summary, our study identified DPY19L2c.63dupG(p.Arg22Alafs*66) as the causative mutation site for structural abnormalities in the acrosome and may lead to severe offspring disease. DPY19L2 globozoospermia whole-exome sequence inbreeding Figures Figure 1 Figure 2 Introduction Round head spermatidosis (MIN102530) is a rare male infertility disease, which is mainly characterized by sperm morphology suggesting the loss of rounded sperm head and acrosomal structure, in which the acrosomal structure is either partially or completely lost, resulting in an abnormal acrosomal reaction that leads to the loss of fertilization function 1–2 . The acrosome develops as a specialized membrane structure formed by the attachment of Golgi bodies to the nuclear surface of spermatocytes, and its main function is to store acrosomal enzymes involved in the fertilization process. Although there is evidence that several genes are involved in acrosome formation and are essential for the sperm plasticity process, such as the PICK1 gene, the SPATA16 gene, and the DYP19L2 gene 3 , the related molecular mechanisms still need to be further elucidated. There is evidence that a pure mutation in the DYP19L2 gene makes spermatozoa acrosome structurally deficient, resulting in round-headed spermatozoa, and in recent years more and more studies have been reported both in China and abroad, including DYP19L2 nonsense mutation, missense mutation, and truncation of the protein due to nucleotide deletion that makes round-headed spermatidosis occur. In our study, we confirmed the clinical diagnosis of a consanguineous family with reference to ICSI(In intracytoplasmic sperm injection) and AOA(artificial oocyte activation) assisted reproduction outcomes using exome sequencing and familial exome sequencing to confirm that the DYP19L2 insertion mutation is a new evidence for the development of round-headed spermatidosis,which provides new insights into the solution to the treatment of male infertility caused by this gene mutation. Patients and methods The patients were recruited from Hepzang County People's Hospital, and the ethical review was conducted by the Ethics Committee of Hepzang County People's Hospital. All the studies were conducted in accordance with the Declaration of Helsinki and the ethical review standards, and the patients signed an informed consent form. History: Male, 33 years old, 4 years ago, ICSI-assisted fertilization for "abnormal spermatidosis", early follicular phase, long-lasting long protocol, 11 eggs were obtained, and 0 eggs were fertilized; 3 years ago, ICSI-assisted fertilization for "abnormal spermatidosis", follicular phase, long protocol, 10 eggs were obtained, and 0 eggs were fertilized after ICSI. ICSI with egg AOA was performed 2 years ago, 9 eggs were obtained, 5 eggs were fertilized and 2 embryos were available. 12 days after the transfer, the woman was pregnant with a single fetus in utero, and the ultrasound at 24 weeks of pregnancy indicated "transposition of the fetal heart artery". 37 weeks + 4 days of pregnancy was due to " hypertension in pregnancy". At 37 weeks + 4 days of gestation, a cesarean section was performed for "hypertension in pregnancy", and one child was delivered; cardiac surgery was performed on the 6th day of life, and the patient died during the operation. Male examination: no abnormalities were found in the male partner's physical examination and male specialty examination; there was no history of bad habits such as smoking, alcoholism and drug allergy; the family marriage history investigation suggested that his grandparents and parents were inbred in the same lineage for two generations. Ultrasound of the testes and epididymis indicated varicocele on the left side; semen analysis was performed according to the WHO Laboratory Manual for the Examination and Processing of Human Semen, 5th edition reference standards. Peripheral blood chromosome examination; whole exome sequencing was performed on both spouses and the male brother, and mutation site validation was performed using one generation of Sanger sequencing with the following sequencing primers: Primer Sequence: 3’-5’:DPY19L2-63F:TTTCACAGTCGCCATGACGAC 5’-3’:DPY19L2-63R:CTTTTCGCTCTTTCAGACTTTGGAT Results 1 Family marriage survey suggests consanguineous marriage Family marriage history and genetic history survey suggested no history of genetic disease in I-IV and normal reproductive history; as shown in Figure 1, there was one collateral consanguineous marriage in generation III, and another collateral consanguineous marriage in generation IV in the case of consanguineous marriage in generation III. V1 and V2 were included in the study as investigated. V1 was a preterm, underwent ICSI once and was unfertilized; ICSI+AOA once, and had one male fetus born alive with a cardiac transposition of the great arteries; V2 had two separate non-marital spouses who were infertile and participated in family exome testing. 2 Male semen examination suggestive of morphologic abnormalities Semen routine and morphological examination of the partner at an interval of 4 months suggested normal ejaculate volume, density, and viability, and morphological examination suggested 100% aberrant sperm head as shown in Table 1. Sperm biochemical examination suggested normal sperm DNA fragmentation and normal acrosomal enzyme activity as shown in Table 2; HE staining microscopy suggested 100% aberrant head of the spermatozoa with missing acrosomal structure, and spermatozoa were in the form of a rounded head as shown in Fig. 1b. Table 1 Results of routine semen examination of the male partner Volum(ml) Density(10 6 ) forward motion total motility morphology 1.5±1.1 60.7±20.5 32.5±6.24 45±10.2 100% head deformity Table 2 Results of biochemical examination of male semen progrom standard result acrosome enzyme activity >64.9 79.8 Sperm DNA fragmentation index <30% 23.2 Highly stainable DNA ≤5.8% 5.1 3 Genetic examination The peripheral blood karyotypes of both parties were 46, XY in male; 46, XX in female. Whole exome examination revealed the DPY19L2 gene mutation DPY19L2c.63dupG (p.Arg22Alafs*66) in the male V1 precursor; the female had no abnormality, and review of the pannel showed no abnormality; one-generation sequencing verified that the male V1 and the younger brother of V2 DPY19L2c.63dupG (p.Arg22Alafs*66), the pilot sequence is: GCCAGTCTAAGGG, as shown in Figure 2. Discussion In recent years, the incidence of infertility has gradually increased, and studies have shown that male factors account for about 50% of the causes of infertility and are related to sperm quantity and quality [ 4 ]. The acrosome is a lysosome-associated organelle unique to spermatozoa, located in the head of the spermatozoa, which contains a variety of soluble hydrolytic enzymes necessary for penetration of the oocyte, such as acrosomal enzymes, hyaluronidase, etc. and insoluble matrix molecules, which play an important role in the fertilization process [ 5 ]. Therefore, abnormal acrosomal structure and reduced acrosomal enzyme activity prevent sperm from crossing the zona pellucida and binding to the oocyte, leading to infertility,results as shown. Pathogenic variants in the genes PICK1, SPATA16 and DPY19L2 have been shown to cause complete acrosomal deletion and round head spermatidosis in human spermatozoa 3, 6 . DPY19L2, a member of the DPY19 gene family, is a transmembrane protein expressed specifically in the testis and is formed by the duplication of DPY19L1 located on chromosome 7 and then re-located on chromosome 12. It contains 22 exons connecting the sperm acrosomal membrane to the nuclear membrane, and deletion of DPY19L2 protein expression results in separation of the sperm acrosome from the nucleus during the sperm deformation stage, leading to disruption of vesicle transport, failure of the sperm nucleus to take shape, elimination of unbound acrosomal vesicles, and ultimately the production of acrosomal-less round-headed spermatozoa 7–8 . The routine whole exome testing in this case suggested the mutant locus of the DPY19L2 gene, which resulted in the sperm acrosome defect in this male, and this assertion was laterally corroborated by exome sequencing of the family line confirming the pure mutation of DPY19L2c.63dupG (p.Arg22Alafs*66). Patients with acrosomal structural defects have no other characteristic clinical manifestations compared to the normal population. The main manifestation was male infertility with decreased sperm motility compared to normal fertile men. In our case, the sperm viability was slightly lower than that of normal patients, and the acrosomal enzyme concentration and total number were not significantly different from those of the normal population, which is consistent with those reported in the relevant literature 9–10 . Patients with acrosomal structural defects are currently considered to have ICSI as the method of choice for their offspring due to low fertility or even inability to have children naturally, but the fertilization rate is low and the failure rate of complete fertilization is high, which may be due to the failure of egg activation. In recent years, the proposed ICSI combined with artificial oocyte activation (AOA) technique helps to improve the fertilization rate of oocytes, which is suitable for patients with low fertilization rate or even complete failure, but there are still some patients with complete fertilization failure 11 . Pure mutation in the DPY19L2 gene is the main cause of roundhead spermatosis, and the success of such patients in obtaining clinical pregnancies and producing offspring by performing ICSI has been reported both at home and abroad, but the majority of the cases were carriers of the mutation in this gene 12–13 . In the study, it was found that patients of this family line presented typical mutation results, and the result of insertion mutation directly led to the mutation of amino acid 22 from arg to ala, and the downstream protein structure was typically mutated. It has been shown that more than dozens of mutation patterns have been reported in the DPY19L2 gene, and new mutation patterns are constantly being discovered, but our discovery of this mutation is the first report, which enriches the evidence for the study of the pathogenicity of this gene in roundhead spermatosis. Of interest is the history of consanguineous marriage in the family of our patient, with the patient's grandparents and parents being consanguineous and her parents being heterozygous carriers of the DPY19L2 mutation. Genetics has shown that offspring of consanguineous marriages have a higher probability of developing genetic diseases than offspring of non-consanguineous marriages, and that consanguineous marriages increase the probability of prenatal fetal death 14 . Phenotypically normal humans may carry multiple recessive disease-causing genes, and consanguineous relatives are likely to have the same recessive disease-causing genes. When the genes are heterozygous, the dominant genes are expressed in normal traits, the recessive genes are not expressed, and the human body behaves normally; consanguineous marriages increase the level of purity in the recessive disease-causing genes of the offspring, and they express the disease-causing traits, i.e., the genetic disease 15 . In our case, the offspring born after ICSI-assisted conception was born with congenital cardiac malformation and died 6 days after birth, and it was hypothesized that the causative cause of the disease might be related to consanguineous marriage. The DPY19L2 gene mutation in spherospermia is a biallelic gene mutation, and the genetic mode of this gene is likely to be recessive homozygous pathogenic. Therefore, in the reproductive clinic, normal carriers will not show infertility induced by spherospermia. The main pathogenic risk of this gene is that the wife as a carrier leads to homozygous infertility in male offspring. Declarations Data available No available data in this paper. Competing Interest declaration. All authors declared no competing interest. Funding support. Guizhou provincial people’s hospital youth funding, GZSYQN[2016]05. Guizhou Provincial Health Commission Fund, Fund No. gzwjkj2016-1-044. Acknowledgement. Thank the support of all patients and their family. Thanks to Hezhang County People's Hospital for providing ethical review support. Author contribution. H.L., J.H., C.C. contributed the clinical management and information collection, Z.T. lead genetic test and information variation, W.C. design the research and draft writing. References [1]Han F , Liu C, Zhang L , et al. Globozoospermia and lack of acrosome formation in GM130-deficient mice.Cell Death Dis.2017,8(1):e2532. [2]Abouhaila A , Tulsiani DR. Mammalian sperm acrosome:Formation, contents, and function. Arch Biochem Biophys, 2000,279(2):173-182. [3]Fujihara Y, Oji A, Larasati T, et al. Human globozoospermiarelated gene spata16 is required for sperm formation revealed by CRISPR/Cas9-mediated mouse models. Int J Mol Sci.2017, 18(10):2208. [4]Agawal A,Baskaran S,Parekh N,et al.Male infertility[J]. Lancet, 2021,97(10271):319-333. [5] Fesahata F , Henkel R, Agarwal A. Globozoospermia syndrome: An update[J]. Andrologia,2020,52(2):e13459. [6]Zhu F, Gong F, Lin G, et al. DPY19L2 gene mutations are a major cause of globozoospermia: Identification of three novel point mutations. Mol Hum Repord, 2013, 19(6): 395-404. [7] Koscinski I,Elinati E,Fossard C,et al. DPY19L2 deletion as a major cause of globozoospermia. Am J Hum Genet,2011,88 (3): 344-350. [8] Alimohammadi F, Nasab ME, Rafaee A, et al. Corrigendum to: Deletion of dpy-19 like 2(DPY19L2)gene is associated with total but not partial globozoospermia[J].Reprod Fertil Dev,2020,32:805. [9] Ghasemzadeh J,Talebi AR,Khalili MA,et al.Sperm parameters,protamine deficiency,and apoptosis in total globozoospermia.Iran J Reprod Med,2015,13 (8):495-502. [10] Kochhar PK,Ghosh P.Intracytoplasmic sperm injection with assisted oocyte activation resulting in successful pregnancies and live birth in couples with globozoospermia:A report of two cases.J Hum Reprod Sci,2018,11(1):72-74. [11] Kuentz P,Vanden Meerschaut F,Elinati E,et al.Assisted oocyte activation overcomes fertilization failure in globozoospermic patients regardless of the DPY19L2 status.Hum Reprod,2013,28(4):1054-1061. [12] Lundin K,Sjogren A,Nilsson L,et al.Fertilization and pregnancy after intracytoplasmic microinjection of acrosomeless spermatozoa.Fertil Steril,1994,62(6):1266-1267. [13] Kuentz P,Vanden Meerschaut F,Elinati E,et al.Assisted oocyte activation overcomes fertilization failure in globozoospermic patients regardless of the DPY19L2 status.Hum Reprod,2013,28(4):1054-1061. [14]Myriam K, Muin K. Inbreeding and Diseases: Demographic, Genetic,and Epidemiologic Perspectives.Epidemiologic Reviews,1991,13(1):28-41. [15]Mohd F,et al. Genetics of consanguinity and inbreeding in health and disease.Ann Hum Biol,2017,44(2):99-107. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4105020","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Short Report","associatedPublications":[],"authors":[{"id":281025432,"identity":"314ef075-94dc-45bd-b1db-4d445a942420","order_by":0,"name":"Hongjing Li","email":"","orcid":"","institution":"Medical School of Guizhou University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Hongjing","middleName":"","lastName":"Li","suffix":""},{"id":281025433,"identity":"9a0bd9a4-c460-4677-9967-d6cb0539f330","order_by":1,"name":"Jun He","email":"","orcid":"","institution":"Guizhou Provincial People's Hospital","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Jun","middleName":"","lastName":"He","suffix":""},{"id":281025434,"identity":"2bc64f69-8c7f-43eb-9fc1-1bcfb38196e3","order_by":2,"name":"Chaojun Chen","email":"","orcid":"","institution":"Guizhou Provincial People's Hospital","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Chaojun","middleName":"","lastName":"Chen","suffix":""},{"id":281025435,"identity":"d6e70745-397e-4659-ab64-1e53a5a7b2c3","order_by":3,"name":"Yong Zhang","email":"","orcid":"","institution":"Guizhou Provincial People's Hospital","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Yong","middleName":"","lastName":"Zhang","suffix":""},{"id":281025436,"identity":"143651db-30ea-4402-8905-f7e41d89f28d","order_by":4,"name":"Zongjian Tan","email":"","orcid":"","institution":"Guizhou Provincial People's Hospital","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Zongjian","middleName":"","lastName":"Tan","suffix":""},{"id":281025437,"identity":"121f72ce-bfed-41f2-abaf-ec2c35ad51c5","order_by":5,"name":"Weiming Chen","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA5UlEQVRIiWNgGAWjYHACAxCRwMDAfADCP0C8FrYEkrXwGBCnRbe9eQMzb45dHr90z+eXP9sY5PhuJDB+LsCjxezMsQJm3m3JxZJzzm6zkGxjMJa8kcAsPQOflhs5Bsy52w4kbriRu83AsI0ByEhgY+bBp+X+G4iW/TdynhkktjHUE9Zygwdqi0QO84ODbQwJBgS1nEkrOPx3W3LijBtpZowN5yQMZ5552CyNV8vxwxsfztxml9g/I/nxxx9lNvJ8x5MPfsanBQQOQGk2CQYGIGJgbCCgAQGYPxCtdBSMglEwCkYUAABGCFFrj+/6uAAAAABJRU5ErkJggg==","orcid":"","institution":"Medical School of Guizhou University","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"Weiming","middleName":"","lastName":"Chen","suffix":""}],"badges":[],"createdAt":"2024-03-15 05:32:05","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4105020/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4105020/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":53194983,"identity":"8238cce6-0d71-4a9c-9436-9d986edfa136","added_by":"auto","created_at":"2024-03-21 18:16:29","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":348167,"visible":true,"origin":"","legend":"\u003cp\u003eFamily tree and sperm morphological examination. Fig 1a shows the male lineage map, which reveals that 1 consanguineous marriage occurred in generation III and IV, respectively; b shows the HE staining examination of sperm morphology of the prior witness.\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-4105020/v1/0c020e2b94f0303d1e5a58fd.png"},{"id":53194982,"identity":"a8c1f6a3-f216-47bd-894d-a165879f542f","added_by":"auto","created_at":"2024-03-21 18:16:29","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":119985,"visible":true,"origin":"","legend":"\u003cp\u003eOne-generation sequencing validation of mutant loci in generation V. In the figure, a indicates a small family line of generation V; b indicates the validation of the locus in V1; and c is the validation of the locus in V2.\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-4105020/v1/c3830894f0333d306d0f24d0.png"},{"id":54040087,"identity":"8cad21ab-e011-4785-bdfc-8e6e361fd0e6","added_by":"auto","created_at":"2024-04-03 17:29:29","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":832734,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4105020/v1/c5a5e009-ad65-41dc-af9f-8824d066e4c0.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Novel DPY19L2 mutation locus causes globozoospermia","fulltext":[{"header":"Introduction","content":"\u003cp\u003eRound head spermatidosis (MIN102530) is a rare male infertility disease, which is mainly characterized by sperm morphology suggesting the loss of rounded sperm head and acrosomal structure, in which the acrosomal structure is either partially or completely lost, resulting in an abnormal acrosomal reaction that leads to the loss of fertilization function\u003csup\u003e1–2\u003c/sup\u003e. The acrosome develops as a specialized membrane structure formed by the attachment of Golgi bodies to the nuclear surface of spermatocytes, and its main function is to store acrosomal enzymes involved in the fertilization process. Although there is evidence that several genes are involved in acrosome formation and are essential for the sperm plasticity process, such as the PICK1 gene, the SPATA16 gene, and the DYP19L2 gene\u003csup\u003e3\u003c/sup\u003e, the related molecular mechanisms still need to be further elucidated.\u003c/p\u003e \u003cp\u003eThere is evidence that a pure mutation in the DYP19L2 gene makes spermatozoa acrosome structurally deficient, resulting in round-headed spermatozoa, and in recent years more and more studies have been reported both in China and abroad, including DYP19L2 nonsense mutation, missense mutation, and truncation of the protein due to nucleotide deletion that makes round-headed spermatidosis occur. In our study, we confirmed the clinical diagnosis of a consanguineous family with reference to ICSI(In intracytoplasmic sperm injection) and AOA(artificial oocyte activation) assisted reproduction outcomes using exome sequencing and familial exome sequencing to confirm that the DYP19L2 insertion mutation is a new evidence for the development of round-headed spermatidosis,which provides new insights into the solution to the treatment of male infertility caused by this gene mutation.\u003c/p\u003e "},{"header":"Patients and methods","content":"\u003cp\u003eThe patients were recruited from Hepzang County People\u0026apos;s Hospital, and the ethical review was conducted by the Ethics Committee of Hepzang County People\u0026apos;s Hospital. All the studies were conducted in accordance with the Declaration of Helsinki and the ethical review standards, and the patients signed an informed consent form.\u003c/p\u003e\n\u003cp\u003eHistory: Male, 33 years old, 4 years ago, ICSI-assisted fertilization for \u0026quot;abnormal spermatidosis\u0026quot;, early follicular phase, long-lasting long protocol, 11 eggs were obtained, and 0 eggs were fertilized; 3 years ago, ICSI-assisted fertilization for \u0026quot;abnormal spermatidosis\u0026quot;, follicular phase, long protocol, 10 eggs were obtained, and 0 eggs were fertilized after ICSI. ICSI with egg AOA was performed 2 years ago, 9 eggs were obtained, 5 eggs were fertilized and 2 embryos were available. 12 days after the transfer, the woman was pregnant with a single fetus in utero, and the ultrasound at 24 weeks of pregnancy indicated \u0026quot;transposition of the fetal heart artery\u0026quot;. 37 weeks\u0026thinsp;+\u0026thinsp;4 days of pregnancy was due to \u0026quot; hypertension in pregnancy\u0026quot;. At 37 weeks\u0026thinsp;+\u0026thinsp;4 days of gestation, a cesarean section was performed for \u0026quot;hypertension in pregnancy\u0026quot;, and one child was delivered; cardiac surgery was performed on the 6th day of life, and the patient died during the operation.\u003c/p\u003e\n\u003cp\u003eMale examination: no abnormalities were found in the male partner\u0026apos;s physical examination and male specialty examination; there was no history of bad habits such as smoking, alcoholism and drug allergy; the family marriage history investigation suggested that his grandparents and parents were inbred in the same lineage for two generations. Ultrasound of the testes and epididymis indicated varicocele on the left side; semen analysis was performed according to the WHO Laboratory Manual for the Examination and Processing of Human Semen, 5th edition reference standards.\u003c/p\u003e\n\u003cp\u003ePeripheral blood chromosome examination; whole exome sequencing was performed on both spouses and the male brother, and mutation site validation was performed using one generation of Sanger sequencing with the following sequencing primers:\u003c/p\u003e\n\u003cp\u003ePrimer Sequence: \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u003c/p\u003e\n\u003cp\u003e3\u0026rsquo;-5\u0026rsquo;:DPY19L2-63F:TTTCACAGTCGCCATGACGAC\u003c/p\u003e\n\u003cp\u003e5\u0026rsquo;-3\u0026rsquo;:DPY19L2-63R:CTTTTCGCTCTTTCAGACTTTGGAT\u003c/p\u003e\n\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\u003cbr\u003e\u003c/div\u003e"},{"header":"Results","content":"\u003cp\u003e1 Family marriage survey suggests consanguineous marriage\u003c/p\u003e\n\u003cp\u003eFamily marriage history and genetic history survey suggested no history of genetic disease in I-IV and normal reproductive history; as shown in Figure 1, there was one collateral consanguineous marriage in generation III, and another collateral consanguineous marriage in generation IV in the case of consanguineous marriage in generation III. V1 and V2 were included in the study as investigated. V1 was a preterm, underwent ICSI once and was unfertilized; ICSI+AOA once, and had one male fetus born alive with a cardiac transposition of the great arteries; V2 had two separate non-marital spouses who were infertile and participated in family exome testing.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e2 Male semen examination suggestive of morphologic abnormalities\u003c/p\u003e\n\u003cp\u003eSemen routine and morphological examination of the partner at an interval of 4 months suggested normal ejaculate volume, density, and viability, and morphological examination suggested 100% aberrant sperm head as shown in Table 1. Sperm biochemical examination suggested normal sperm DNA fragmentation and normal acrosomal enzyme activity as shown in Table 2; HE staining microscopy suggested 100% aberrant head of the spermatozoa with missing acrosomal structure, and spermatozoa were in the form of a rounded head as shown in Fig. 1b.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 1 Results of routine semen examination of the male partner\u003c/strong\u003e\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"15.370705244122966%\" valign=\"top\"\u003e\n \u003cp\u003eVolum(ml)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.806509945750452%\" valign=\"top\"\u003e\n \u003cp\u003eDensity(10\u003csup\u003e6\u003c/sup\u003e)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.806509945750452%\" valign=\"top\"\u003e\n \u003cp\u003eforward motion\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.869801084990957%\" valign=\"top\"\u003e\n \u003cp\u003etotal motility\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.146473779385172%\" valign=\"top\"\u003e\n \u003cp\u003emorphology\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"15.370705244122966%\" valign=\"top\"\u003e\n \u003cp\u003e1.5\u0026plusmn;1.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.806509945750452%\" valign=\"top\"\u003e\n \u003cp\u003e60.7\u0026plusmn;20.5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.806509945750452%\" valign=\"top\"\u003e\n \u003cp\u003e32.5\u0026plusmn;6.24\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.869801084990957%\" valign=\"top\"\u003e\n \u003cp\u003e45\u0026plusmn;10.2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.146473779385172%\" valign=\"top\"\u003e\n \u003cp\u003e100%\u0026nbsp;head deformity\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eTable 2 Results of biochemical examination of male semen\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"558\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"43.64937388193202%\" valign=\"bottom\"\u003e\n \u003cp\u003eprogrom\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"28.443649373881932%\" valign=\"bottom\"\u003e\n \u003cp\u003estandard\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"27.906976744186046%\" valign=\"bottom\"\u003e\n \u003cp\u003eresult\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"43.64937388193202%\" valign=\"bottom\"\u003e\n \u003cp\u003eacrosome enzyme activity\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"28.443649373881932%\" valign=\"bottom\"\u003e\n \u003cp\u003e\u0026gt;64.9\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"27.906976744186046%\" valign=\"bottom\"\u003e\n \u003cp\u003e79.8\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"43.64937388193202%\" valign=\"bottom\"\u003e\n \u003cp\u003eSperm DNA fragmentation index\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"28.443649373881932%\" valign=\"bottom\"\u003e\n \u003cp\u003e\u0026lt;30%\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"27.906976744186046%\" valign=\"bottom\"\u003e\n \u003cp\u003e23.2\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"43.64937388193202%\" valign=\"bottom\"\u003e\n \u003cp\u003eHighly stainable DNA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"28.443649373881932%\" valign=\"bottom\"\u003e\n \u003cp\u003e\u0026le;5.8%\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"27.906976744186046%\" valign=\"bottom\"\u003e\n \u003cp\u003e5.1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e3 Genetic examination\u003c/p\u003e\n\u003cp\u003eThe peripheral blood karyotypes of both parties were 46, XY in male; 46, XX in female. Whole exome examination revealed the DPY19L2 gene mutation DPY19L2c.63dupG (p.Arg22Alafs*66) in the male V1 precursor; the female had no abnormality, and review of the pannel showed no abnormality; one-generation sequencing verified that the male V1 and the younger brother of V2 DPY19L2c.63dupG (p.Arg22Alafs*66), the pilot sequence is: GCCAGTCTAAGGG, as shown in Figure 2.\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eIn recent years, the incidence of infertility has gradually increased, and studies have shown that male factors account for about 50% of the causes of infertility and are related to sperm quantity and quality [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. The acrosome is a lysosome-associated organelle unique to spermatozoa, located in the head of the spermatozoa, which contains a variety of soluble hydrolytic enzymes necessary for penetration of the oocyte, such as acrosomal enzymes, hyaluronidase, etc. and insoluble matrix molecules, which play an important role in the fertilization process [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. Therefore, abnormal acrosomal structure and reduced acrosomal enzyme activity prevent sperm from crossing the zona pellucida and binding to the oocyte, leading to infertility,results as shown.\u003c/p\u003e \u003cp\u003ePathogenic variants in the genes PICK1, SPATA16 and DPY19L2 have been shown to cause complete acrosomal deletion and round head spermatidosis in human spermatozoa\u003csup\u003e3, 6\u003c/sup\u003e. DPY19L2, a member of the DPY19 gene family, is a transmembrane protein expressed specifically in the testis and is formed by the duplication of DPY19L1 located on chromosome 7 and then re-located on chromosome 12. It contains 22 exons connecting the sperm acrosomal membrane to the nuclear membrane, and deletion of DPY19L2 protein expression results in separation of the sperm acrosome from the nucleus during the sperm deformation stage, leading to disruption of vesicle transport, failure of the sperm nucleus to take shape, elimination of unbound acrosomal vesicles, and ultimately the production of acrosomal-less round-headed spermatozoa\u003csup\u003e7\u0026ndash;8\u003c/sup\u003e. The routine whole exome testing in this case suggested the mutant locus of the DPY19L2 gene, which resulted in the sperm acrosome defect in this male, and this assertion was laterally corroborated by exome sequencing of the family line confirming the pure mutation of DPY19L2c.63dupG (p.Arg22Alafs*66). Patients with acrosomal structural defects have no other characteristic clinical manifestations compared to the normal population. The main manifestation was male infertility with decreased sperm motility compared to normal fertile men. In our case, the sperm viability was slightly lower than that of normal patients, and the acrosomal enzyme concentration and total number were not significantly different from those of the normal population, which is consistent with those reported in the relevant literature\u003csup\u003e9\u0026ndash;10\u003c/sup\u003e. Patients with acrosomal structural defects are currently considered to have ICSI as the method of choice for their offspring due to low fertility or even inability to have children naturally, but the fertilization rate is low and the failure rate of complete fertilization is high, which may be due to the failure of egg activation. In recent years, the proposed ICSI combined with artificial oocyte activation (AOA) technique helps to improve the fertilization rate of oocytes, which is suitable for patients with low fertilization rate or even complete failure, but there are still some patients with complete fertilization failure\u003csup\u003e11\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003ePure mutation in the DPY19L2 gene is the main cause of roundhead spermatosis, and the success of such patients in obtaining clinical pregnancies and producing offspring by performing ICSI has been reported both at home and abroad, but the majority of the cases were carriers of the mutation in this gene\u003csup\u003e12\u0026ndash;13\u003c/sup\u003e. In the study, it was found that patients of this family line presented typical mutation results, and the result of insertion mutation directly led to the mutation of amino acid 22 from arg to ala, and the downstream protein structure was typically mutated. It has been shown that more than dozens of mutation patterns have been reported in the DPY19L2 gene, and new mutation patterns are constantly being discovered, but our discovery of this mutation is the first report, which enriches the evidence for the study of the pathogenicity of this gene in roundhead spermatosis.\u003c/p\u003e \u003cp\u003eOf interest is the history of consanguineous marriage in the family of our patient, with the patient's grandparents and parents being consanguineous and her parents being heterozygous carriers of the DPY19L2 mutation. Genetics has shown that offspring of consanguineous marriages have a higher probability of developing genetic diseases than offspring of non-consanguineous marriages, and that consanguineous marriages increase the probability of prenatal fetal death\u003csup\u003e14\u003c/sup\u003e. Phenotypically normal humans may carry multiple recessive disease-causing genes, and consanguineous relatives are likely to have the same recessive disease-causing genes. When the genes are heterozygous, the dominant genes are expressed in normal traits, the recessive genes are not expressed, and the human body behaves normally; consanguineous marriages increase the level of purity in the recessive disease-causing genes of the offspring, and they express the disease-causing traits, i.e., the genetic disease\u003csup\u003e15\u003c/sup\u003e. In our case, the offspring born after ICSI-assisted conception was born with congenital cardiac malformation and died 6 days after birth, and it was hypothesized that the causative cause of the disease might be related to consanguineous marriage.\u003c/p\u003e \u003cp\u003eThe DPY19L2 gene mutation in spherospermia is a biallelic gene mutation, and the genetic mode of this gene is likely to be recessive homozygous pathogenic. Therefore, in the reproductive clinic, normal carriers will not show infertility induced by spherospermia. The main pathogenic risk of this gene is that the wife as a carrier leads to homozygous infertility in male offspring.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003eData available\u003c/p\u003e\n\u003cp\u003eNo available data in this paper.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eCompeting Interest declaration.\u003c/p\u003e\n\u003cp\u003eAll authors declared no competing interest.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eFunding support.\u003c/p\u003e\n\u003cp\u003eGuizhou provincial people\u0026rsquo;s hospital youth funding, GZSYQN[2016]05.\u003c/p\u003e\n\u003cp\u003eGuizhou Provincial Health Commission Fund, Fund No. gzwjkj2016-1-044.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eAcknowledgement.\u003c/p\u003e\n\u003cp\u003eThank the support of all patients and their family. Thanks to Hezhang County People\u0026apos;s Hospital for providing ethical review support.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eAuthor contribution.\u003c/p\u003e\n\u003cp\u003eH.L., J.H., C.C. contributed the clinical management and information collection, Z.T. lead genetic test and information variation, W.C. design the research and draft writing.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003e[1]Han F , Liu C, Zhang L , et al. Globozoospermia and lack of acrosome formation in GM130-deficient mice.Cell Death Dis.2017,8(1):e2532.\u003c/li\u003e\n\u003cli\u003e[2]Abouhaila A , Tulsiani DR. Mammalian sperm acrosome:Formation, contents, and function. Arch Biochem Biophys, 2000,279(2):173-182.\u003c/li\u003e\n\u003cli\u003e[3]Fujihara Y, Oji A, Larasati T, et al. Human globozoospermiarelated gene spata16 is required for sperm formation revealed by CRISPR/Cas9-mediated mouse models. Int J Mol Sci.2017, 18(10):2208.\u003c/li\u003e\n\u003cli\u003e[4]Agawal A,Baskaran S,Parekh N,et al.Male infertility[J]. Lancet, 2021,97(10271):319-333.\u003c/li\u003e\n\u003cli\u003e[5] Fesahata F , Henkel R, Agarwal A. Globozoospermia syndrome: An update[J]. Andrologia,2020,52(2):e13459.\u003c/li\u003e\n\u003cli\u003e[6]Zhu F, Gong F, Lin G, et al. DPY19L2 gene mutations are a major cause of globozoospermia: Identification of three novel point mutations. Mol Hum Repord, 2013, 19(6): 395-404.\u003c/li\u003e\n\u003cli\u003e[7] Koscinski I,Elinati E,Fossard C,et al. DPY19L2 deletion as a major cause of globozoospermia. Am J Hum Genet,2011,88 (3): 344-350.\u003c/li\u003e\n\u003cli\u003e[8] Alimohammadi F, Nasab ME, Rafaee A, et al. Corrigendum to: Deletion of dpy-19 like 2(DPY19L2)gene is associated with total but not partial globozoospermia[J].Reprod Fertil Dev,2020,32:805.\u003c/li\u003e\n\u003cli\u003e[9] Ghasemzadeh J,Talebi AR,Khalili MA,et al.Sperm parameters,protamine deficiency,and apoptosis in total globozoospermia.Iran J Reprod Med,2015,13 (8):495-502.\u003c/li\u003e\n\u003cli\u003e[10] Kochhar PK,Ghosh P.Intracytoplasmic sperm injection with assisted oocyte activation resulting in successful pregnancies and live birth in couples with globozoospermia:A report of two cases.J Hum Reprod Sci,2018,11(1):72-74.\u003c/li\u003e\n\u003cli\u003e[11] Kuentz P,Vanden Meerschaut F,Elinati E,et al.Assisted oocyte activation overcomes fertilization failure in globozoospermic patients regardless of the DPY19L2 status.Hum Reprod,2013,28(4):1054-1061.\u003c/li\u003e\n\u003cli\u003e[12] Lundin K,Sjogren A,Nilsson L,et al.Fertilization and pregnancy after intracytoplasmic microinjection of acrosomeless spermatozoa.Fertil Steril,1994,62(6):1266-1267. \u003c/li\u003e\n\u003cli\u003e[13] Kuentz P,Vanden Meerschaut F,Elinati E,et al.Assisted oocyte activation overcomes fertilization failure in globozoospermic patients regardless of the DPY19L2 status.Hum Reprod,2013,28(4):1054-1061.\u003c/li\u003e\n\u003cli\u003e[14]Myriam K, Muin K. Inbreeding and Diseases: Demographic, Genetic,and Epidemiologic Perspectives.Epidemiologic Reviews,1991,13(1):28-41.\u003c/li\u003e\n\u003cli\u003e[15]Mohd F,et al. Genetics of consanguinity and inbreeding in health and disease.Ann Hum Biol,2017,44(2):99-107.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"DPY19L2, globozoospermia, whole-exome sequence, inbreeding","lastPublishedDoi":"10.21203/rs.3.rs-4105020/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4105020/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003eSpermatozoa acrosome abnormalities are a rare and severe form of male infertility caused by structural abnormalities of the sperm acrosome or acrosomal enzyme abnormalities, which usually present as round-headed spermatozoa with loss of sperm insemination. Variation in the DPY19L2 gene is highly correlated with known cases of conchoidal spermatidosis, and there is extensive evidence that heterozygous variants cause spermatozoa abnormalities, although fewer cases have been reported for purely homozygous variants of the locus. In our study, we identified and clinically confirmed a single spermatozoa cytoplasmic injection combined with calcium carrier-assisted oocyte activation pregnancy in a patient with congenital spermatidosis, resulting in a live birth and transposition of the great arteries. Whole-exome testing identified and reported for the first time the DPY19L2c.63dupG (p.Arg22Alafs*66) mutant locus, which was confirmed by combining the family history of consanguineous marriages with the family lineage of exomes. a pure mutation in the DPY19L2 gene and caused sterility in all of his siblings. In summary, our study identified DPY19L2c.63dupG(p.Arg22Alafs*66) as the causative mutation site for structural abnormalities in the acrosome and may lead to severe offspring disease.\u003c/strong\u003e\u003c/p\u003e","manuscriptTitle":"Novel DPY19L2 mutation locus causes globozoospermia","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-03-21 18:16:25","doi":"10.21203/rs.3.rs-4105020/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"7f153b10-6ade-470e-8210-09b5c93c4c94","owner":[],"postedDate":"March 21st, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-04-03T17:21:22+00:00","versionOfRecord":[],"versionCreatedAt":"2024-03-21 18:16:25","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4105020","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4105020","identity":"rs-4105020","version":["v1"]},"buildId":"7rjqhiLT3MXkJMwkYKINL","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.