Loss of retinal stem cell reserve and lipofuscin accumulation accelerates cone-rod degeneration and replicates Stargardt disease in abca4b null zebrafish

preprint OA: closed CC-BY-4.0
📄 Open PDF Full text JSON View at publisher
Full text 212,720 characters · extracted from preprint-html · click to expand
Loss of retinal stem cell reserve and lipofuscin accumulation accelerates cone-rod degeneration and replicates Stargardt disease in abca4b null zebrafish | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Loss of retinal stem cell reserve and lipofuscin accumulation accelerates cone-rod degeneration and replicates Stargardt disease in abca4b null zebrafish Divya Pidishetty, Santhosh Kumar Damera, Murali Murugavel, Praveen Joseph Susaimanickam, and 6 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7346082/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 21 Nov, 2025 Read the published version in Scientific Reports → Version 1 posted 10 You are reading this latest preprint version Abstract Mutations in ABCA4 gene causes Stargardt macular degeneration, which manifests with toxic lipofuscin deposits in the outer retina, gradual atrophy of RPE cells, followed by photoreceptor cell loss. The cone-enriched retina, with macula-like ‘area-temporalis’ of zebrafish are better models than rodents for studying human macular dystrophies. Here, we generated abca4b knockout zebrafish model using CRISPR/Cas9 editing and evaluated the early and late-stage retinal changes. In adult abca4b −/− mutants, the RPE cells exhibited hyperpigmentation, altered retinomotor behaviour and lipofuscin accumulation, but they remained viable. However, the photoreceptors underwent progressive degeneration, with a sequential loss of blue and UV cones, followed by red and green cones and finally the rod cells. This triggered the chronic activation and early depletion of retinal stem cells at the ciliary marginal zone of mutants and resulted in accelerated outer-retinal degeneration and severe visual defects, despite them retaining the Müller glia-dependant retinal repair potential. Biological sciences/Cell biology Biological sciences/Developmental biology Health sciences/Diseases Biological sciences/Neuroscience Biological sciences/Stem cells Retinal Degeneration Zebrafish abca4b CRISPR editing Stargardt Macular Degeneration Retinal Stem Cells Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Introduction Retinal dystrophies are a group of progressive genetic disorder resulting in gradual degeneration of rod and cone photoreceptor (PR) cells of the retina, causing symptoms such as night blindness, colour blindness, gradual vision loss, leading to a total vision impairment. The prevalence of Inherited Retinal Dystrophies (IRDs) is approximately 1 in 2000 and affects more than 2 million people worldwide 1 . Mutations in over 300 genes involved in retinal development, phototransduction, visual cycle, primary cilium biogenesis, Vitamin A metabolism, phagocytosis, etc. are linked to IRDs as suggested at RetNet -Retinal Information Network ( https://retnet.org/ ). Among the IRD genes, mutations in ABCA4 cause a spectrum of retinal phenotypes termed as Stargardt disease (STGD1), with over 800 pathogenic variants reported so far 2 . STGD1 is characterized by delayed dark-adaptation, progressive loss of central vision with pisciform flecks 3 . ABCA4 is a member of the ATP-binding cassette (ABC) superfamily of transporters, and an integral transmembrane protein located in the rod and cone photoreceptor outer segment (POS) disc membranes. It functions as an inward flippase that transports the visual cycle intermediate, N-retinylidene-phosphoethanolamine (NR-PE), a covalent adduct of all-trans retinal and phosphatidylethanolamine (PE) from the disc membranes into the cytoplasmic side of POS. The all-trans retinal is then converted to all-trans retinol by the cytosolic enzymes and gets transported to retinal pigmented epithelial (RPE) cells for its further conversion and recycling to form the visual pigment, 11- cis retinal. Dysfunction of ABCA4 leads to the retention of toxic NR-PE in POS disc membranes, which are shed and phagocytosed by RPE cells, where they get accumulated as unmetabolized lipofuscin deposits, resulting in cytotoxicity, primary RPE atrophy and secondary PR loss 3 . A previous study has also demonstrated the expression of ABCA4 in mice RPE cell membranes 4 . Human induced pluripotent stem cells (hiPSCs) based in vitro knockout models of ABCA4 have demonstrated defective phagocytosis of POS by RPE cells and impaired lipid metabolism as the causal mechanism for STGD1 pathogenesis 5 . Animal models of STGD1, particularly the Abca4 null mice exhibit lipofuscin accumulation in RPE, progressive PR degeneration and delayed dark-adaptation 6 – 8 . However, rodents are nocturnal, having rod-dominant retina and lacks a functional macula. This limits their utility as disease models for studying cone PR-based human diseases such as Stargardt Macular Degeneration (SMD) 9 . Large animal models such as canine, feline, porcine, and non-human primates with area centralis are more suitable to evaluate macular diseases 10 , 11 . However, the high maintenance costs, slower reproduction cycles, and longer duration for disease progression have limited their broader utility. Zebrafish have now emerged as a valuable and cost-effective model for studying human retinal diseases due to their cone-enriched retina and macula-like ‘area temporalis’ 12 . Many studies have used morpholinos to create transient knockdown models of retinal diseases in zebrafish 13 . However, their off-target effects and embryonic toxicity further confounds the precise interpretations of genotype-phenotype correlations. Here, we report the generation and characterization of a stable abca4b knockout zebrafish model using CRISPR/Cas9 editing, to investigate the early retinal changes and progressive degeneration phenotypes. Our model recapitulates the key features of STGD1, including lipofuscin accumulation in RPE cells, gradual retinal degeneration, starting with cone followed by rod cell loss and severe vision impairment. Importantly, we report an early depletion of ciliary marginal zone (CMZ) retinal stem cells (RSCs) and the retention of Müller glia-dependent injury repair response in abca4b −/− zebrafish. This highlights the inability of Müller-driven regenerative potential in preventing ongoing degeneration in mutant zebrafish retinas. Materials and methods Ethics Statement This study was reviewed and approved by the Institutional Animal Ethics Committee (IAEC Ref No. 04-22-001) and the Institutional Biosafety Committee (IBSC Ref No. 06-21-010) of LV Prasad Eye Institute, and all animal experiments were performed with care in compliance with CPCSEA and ARRIVE guidelines ( https://arriveguidelines.org ). Zebrafish maintenance and breeding The wildtype (Tubingen) TU-AB strain and abca4b mutant zebrafish stocks were maintained at 26–28°C with 14-hour light, 10-hour dark cycle and grown at a density of 5–8 adult fish per litre of water. The experimental animals were euthanized after anesthetizing with 0.5% MS-222 (tricaine methanesulfonate; Sigma Aldrich A-5040) or by ice bath immersion for hypothermic shock and the tissues were excised for histology and molecular analysis. Synthesis of CRISPR/Cas9 gRNA The guide RNAs (gRNAs) to target exon 2 of the zebrafish abca4b (gene ID: 555506) were designed using CHOPCHOP ( https://chopchop.cbu.uib.no/ ) , with suitable BsaI site overhangs for oligo synthesis and cloning. The target sequences for sgRNAs are (gRNA1- GTTGATTGGTGGCCCCTGCG gRNA2- GATCTGACGGCCCGTGCTCA and gRNA3- GTCTGCTGCTCTGGAAGAAC). For cloning, 100 pmol of the sense and antisense oligos were mixed at equimolar ratios and denatured at 95°C for 5 min and allowed to cool gradually to enable oligo annealing. The annealed oligos with compatible overhangs were cloned into BsaI site of DR274 vector (Addgene plasmid #42250) and the positive clones were confirmed by Sanger sequencing. The guide RNA encoded plasmids were digested using HindIII (New England BioLabs), to cleave the vector downstream of the gRNA scaffold and the linearized DNA was purified and used as templates for in vitro transcription using the Ambion™ Maxiscript™ T7 kit, as per the manufacturer’s instructions. The synthesized gRNAs were purified and quantified using NanoDrop™ (Thermo Fisher Scientific). In vitro cleavage (IVC) assay The gRNA (50–100 ng) and recombinant spCas9 protein (50 nM) were mixed and incubated at 25º C for 10 minutes along with in vitro cleavage assay buffer (20 mM Tris-Cl, pH 8.0, 200 mM KCl, 10 mM MgCl2), for the formation of the ribonucleoprotein (RNP) complex. The DNA substrate or the target region PCR amplicon (300 ng) was then added to the RNP complex and incubated at 37°C for 1 hour. Post incubation, 1 µL of 20 mg/mL RNase and 2 µL of 20 mg/mL of proteinase K were added and incubated at 37°C for 30 min, to digest and remove all gRNA and spCas9 protein. The cleaved DNA products in the reaction mix were then analysed on 2.5% agarose gels, to confirm the target specificity of gRNAs. Microinjection of CRISPR-RNP mix into zebrafish embryos The ribonucleoprotein (RNP) mix containing the gRNA (300 ng) and recombinant spCas9 protein (3 µg) along with 0.05% phenol red (for visual guidance) and 10 mM KCl was prepared in 10 µL volume and about 2–3 nL volume was injected into single cell-staged fertilized embryo, into yolk sac or at the cell body and yolk sac interphase. The injections were done with the help of a glass microcapillary needle prepared using a vertical micropipette puller (P-30, Sutter Instrument, USA), fitted to a semi-automatic micromanipulator (InjectMan® 4, Eppendorf India) and a programmable microinjector with an external pressure supply (FemtoJet® 4x, Eppendorf India). The microinjections were done while visualizing the embryos under a stereo-zoom microscope (SZX10, Olympus Corporation, Japan), connected to a CCD camera (RETIGA R1, QImaging, UK) for live imaging and video recording. The injected embryos were then collected into a dish containing fish water and allowed to develop at 28°C inside a BOD incubator. After 24 hours, the dead and unfertilized eggs were removed, and the live embryos were allowed to develop to reach adulthood. The genetic screening for homozygous null mutants was done by genomic DNA isolation using the tail fins, and the target site edits were confirmed by PCR and Sanger sequencing. Immunohistochemistry was performed on both paraffin and OCT embedded sections of abca4b −/− mutants. These methods are described in detail in Supplementary Methodology. Retinal injury model of adult zebrafish The adult animals were transiently anaesthetized using 0.02% MS-222 solution until a noticeable reduction in gill movement was observed. The anesthetized fish were placed on a paper towel with the right side facing upward and observed under a stereo-zoom microscope. The dorsal side of the eyeball was gently tilted using forceps and a 30-gauge needle was used to make a single pass prick injury at the ventral edge of the right eye. The fish were revived in fish water tank and allowed to recover and repair the damaged tissue. The test animals were euthanized after 4 days and the heads with intact eyeballs were excised, fixed and processed for histology by cryosectioning. Feed capture response paradigm A rectangular maze (30×10×10 cm; L×W×H) or Y-maze with three arms (25×10×10 cm; L×W×H for each arm) was placed on top of a stage, lit from the base by a white LED light source with an intensity regulator to avoid reflections interfering with image/video capture. The videos were recorded using a camera (Logitech C920 HD 1080p, 30 fps), mounted on a stand, right above the tank and positioned at an optimal height to cover the entire area of the maze. For feed capture response assessments, an individual fish was first restrained by a glass divider at the start point. For rectangular maze recordings, the feed was added at the distal end and for Y-maze recordings, the feed was added at the distal end of either the left or the right arm at random. The feed capture response and directional movements served as an indirect measure of visual behaviour of age-matched zebrafish (wildtype or mutants, N = 5, n = 4). The tanks were thoroughly cleaned, and fresh water was added for repeat recordings. The fish movements were recorded by the camera (mp4 encoding) at 30 fps with uniform illumination. The videos were uncompressed, cropped along the edges of the tank and converted to grayscale format via custom MATLAB R2017a (Mathworks, Natick, MA) scripts employing calls to the ffmpeg library ( https://ffmpeg.org/ ). Fully automated threshold-based tracking of the individual fish was done using python and bash shell scripts (Ubuntu 20.04 LTS, Python 3.7, Open CV, https://doi.org/10.1038/srep12678 ). The Cartesian pixel coordinates of the centroid of the tracked fish in each individual frame were then mapped to physical dimensions of the tank via simple linear mapping. In combination with the fixed time interval between each uncompressed video frame (1/30 seconds) and an investigator marking key event frames, these centroid locations were used to quantify preselected variables of interest such as time taken to detect the feed for the first time, time spent in the arm containing the feed, directed movement towards the arm containing the feed and the total distance travelled in each arm. Optokinetic response (OKR) assessment OKR is a useful measure of spatial visual sensitivity of larval and adult zebrafish. To generate these OKR, in this study a PMMA drum of 8 cm diameter was custom-designed and fitted on top of the illuminated stage of a stereo-zoom microscope (SZX10, Olympus Corporation, Japan). A sinewave grating with 0.3 cycles/degree (cpd) spatial frequency and 100% luminance contrast was printed and pasted onto the inner surface of the drum. The rotational speed of the drum was regulated by an external motor, with a speed regulator and digital display to enable variable speed range settings between 1–22 rpm. A control switch enabled either clockwise or anti-clockwise rotation of the drum, to assess visual responses to changes in the direction of moving targets. The drum rotation at operating speed ranges between 1–22 rpm is calibrated using a contact-type digital tachometer (‎HTM 590, Syscon Electro Tech India Pvt Ltd). To record the eye movements, a slit was created within a wet soft sponge and a 12-months-old adult zebrafish was immobilized and held gently in between, with its head and gills projecting outside. This setup was then immersed in a 35 mm petri dish containing fish water, to keep the animals alive. For larval recordings, 10 dpf larvae were immobilized in carboxymethylcellulose sodium eye drops (Allergan) or in 1.5% low melting agarose in a dish. The dish was then placed on the microscope stage, at the centre of the OKR drum, to enable live recording of visual responses and resulting OKR. The microscope was connected to a CCD camera (RETIGA R1, Q Imaging, UK) that recorded live videos at 30 fps at a full resolution of 1360 x 1024 pixels. For eliciting the OKR, the drum containing the sine wave grating was rotated at 12 rpm (for adults) and at 5 rpm (for larvae) in the clockwise direction. The eye movement responses elicited by the fish was recorded for 11 seconds, using the Ocular software interface of the microscope. This procedure was repeated for adult fish and larvae (N = 10) to assess for reproducibility of OKR behaviour. The videos were then manually analysed for the fast-phase OKR in both wildtype and mutant fish. The videos were analysed and the number of fast-phases were counted manually by two independent observers who were naive to the study objectives and are masked about the test fish cohort, to ensure unbiased assessments. The authors recognize the availability of open-source software for quantifying the OKR responses ( https://www.mathworks.com/help/matlab/ref/videoreader.html ). However, these are optimized only for the larvae and not for adult fish and thus not used for quantifying the OKR behaviour in the present study. Statistics All test values were reported as mean ± standard deviation and the values were plotted using GraphPad Prism 10. The data points were analysed using the unpaired t-test for statistical significance. Significant differences are shown as * p < 0.05, **p < 0.01, ***p < 0.001, **** p 0.05. Results Generation of stable abca4b knockout zebrafish models The zebrafish ( Danio rerio ) has two orthologs of the human ABCA4 gene namely, abca4a and abca4b . The abca4b loci on chromosome 2 (gene ID: 555506) has 51 exons and codes for the full-length protein. It has two transmembrane domains (TMD) composed of 6 transmembrane helices each; two glycosylated exocytoplasmic domains (ECD) and two cytoplasmic nucleotide binding domains (NBD), which shares > 65% identity with the human protein. However, the abca4a loci on chromosome 24 (gene ID: 798993) has 8 exons and shares only partial homology with exon 2–8 of abca4b and codes for a truncated protein with a single TMD and a partial ECD. Therefore, to create zebrafish STGD1 models, three gRNAs were designed to target the exon 2 of abca4b ( Fig. 1 A ) , to achieve in-del/frame-shift mutations by CRISPR/Cas9-mediated genome editing. The gRNA1 targeted the 5’UTR region, upstream of the ATG start codon. Whereas the gRNA2 and gRNA3 targeted the coding regions downstream of the ATG (in exon 2) ( Fig. 1 A &B) . The edit efficiency of the guides was assessed by in vitro cleavage assay and the results confirmed target specific binding and efficient double strand cleavage of the template DNA (266 bp) by all three guides tested ( Fig. 1 C ) . The gRNA2 with a single predicted off-target site showed higher edit efficiency and total cleavage of the template DNA and was selected for further editing of zebrafish embryos (see Table no. 2). The gRNA2-SpCas9 RNP complex was microinjected into freshly fertilized wildtype zebrafish embryos (TU-AB strain) at single cell-stage and were allowed to develop. The juvenile fish at 2 months were screened for their genotypes at the target locus for the identification of mosaic founder fish (F 0 ) ( Fig. 1 D ) . Sanger sequencing chromatograms displayed overlapping peaks starting from 3 bp upstream of the PAM site, which confirmed the presence of in-del changes in founder animals 1 and 2 ( Fig. 1 E ) . Cloning and sequencing of target region amplicons revealed a spectrum of mutations in the founder animals, which suggested possible tissue mosaicism. The founder animal 1 carried mutant alleles with 13 bp deletion ( abca4b del 13), 2 bp insertion ( abca4b ins 2) and 54 bp deletion ( abca4b del 54), while the founder animal 2 carried a 11 bp deletion ( abca4b del 11) and 3 bp deletion ( abca4b del 3) ( Fig. 1 F ) . Germline transmission of edits was assessed by backcross breeding of founders with wildtype zebrafish. Genotyping of the heterozygous F 1 embryos revealed the germline transmission of 13 bp deletion and 2 bp insertion. The F 1 heterozygotes carrying the same mutation were then interbred to generate F 2 homozygous null mutants. Further immunohistological evaluations and visual behavior studies were carried out using the abca4b ins 2 mutant, where the presence of two base “CG” insertion right after the translational start site (ATG) has resulted in frame-shift and early termination of protein synthesis ( Fig. 1 G ) . Histological evaluation of retinal morphology and retinomotor movements Loss of function of ABCA4 is known to cause retinal hyperpigmentation, lipofuscin deposition, RPE cell atrophy, slow degeneration of the outer-retina and delayed dark-adaptation at advanced stages of the disease in Stargardt patients 14 and rodent models 6 , 8 . To assess the effects of abca4b mutation, the gross retinal sections of 24-month-old wildtype and abca4b −/− mutants were analysed by histology and H&E staining. When compared to age-matched wildtype controls ( Fig. 2 A-i ) , the mutant retinas displayed gross structural changes such as reduced outer-retinal thickness and increased pigmentation in RPE cells ( Fig. 2 A i-ii) . Unlike in mammals, the zebrafish retina undergoes distinct structural changes in PR myoids and pigment granules (melanosomes) migration within RPE cells, which are collectively termed as “retinomotor movements” and this phenomenon is regulated both by circadian rhythm and light signals. During bright light conditions, the rod myoids elongate and insert their outer segments (OS) into the RPE microvilli processes, while the cone myoids contract and are placed in the front to absorb the bright light. Conversely, under dim light, the rod myoids contract to position their OS proximally for maximal photon absorption and the cone myoids elongate and get distally positioned. Similarly, the melanosome within RPE cells migrate to the apical surface of microvilli structures that surround the cone outer segments (COS) and protect the rod outer segments (ROS) from photobleaching during daytime. Conversely, the melanosome gets sequestered to the base of RPE cells to support maximal light absorption by the rods during night-time (Supp. Figure 1 C ) . These structural changes are predominantly regulated by light-dependent mechanisms in rods and RPE and by the internal circadian rhythm in cones via the dopamine and prostaglandin-mediated signalling pathways that regulates the cytoskeletal dynamics 15 , 16 . Zebrafish iris lacks the pupillary sphincter muscles to control light entry and therefore the retinomotor movements plays a crucial role in maximizing light-capture under dark and in protecting the rod PRs from photobleaching under photopic conditions. We evaluated the retinomotor responses of PR and RPE cells of wildtype and mutants, maintained under controlled photopic and scotopic conditions. This was done to examine the outer-retinal changes and light sensitivity-dependent responses. Upon light-adaptation, the rod myoids elongated while cone myoids contracted in both wildtype and mutant retinas, reflecting normal retinomotor behaviour ( Fig. 2 A i-ii) . Likewise, the melanosomes in RPE cells migrated to the apical side, surrounding the COS ( Fig. 2 A-p ) . In contrast, the abca4b −/− mutant retinas exhibited increased pigmentation, with melanosomes dispersed throughout the RPE cell bodies ( Fig. 2 A-q ) . This suggested an increased stress response in RPE cells, possibly an outcome of reduced light sensitivity of COS and excess unabsorbed photons in the outer-retina. Upon dark-adaptation, both wildtype and mutants displayed typical PR retinomotor movements, wherein the rod myoids contracted and cone myoids elongated and positioned the ROS proximally and COS distally ( Fig. 2 A iii-iv) . However, the RPE cells in mutants appeared abnormal, with reduced or absent arborizations in their apical microvilli structures ( Fig. 2 A-r &s) . Morphometric analysis of the outer-retina confirmed a significant decrease in the (i) thickness of pigment free zone in RPE, (ii) length of cone inner and OS (iii) length of rod inner and OS and (iv) thickness of the rod nuclear layer (RNL) ( Fig. 2 C i-iv) . These findings collectively demonstrate progressive degeneration of the outer-retinal layers in mutants, confirming defects both in photoreceptors and RPE cells. Morphology and spatial organization of photoreceptor cells in zebrafish retina To visualize the spatial arrangement of rod and cone PRs in zebrafish eyes, the retinal sections of the wildtype fish were stained with Alexa Fluor™ 488-conjugated Peanut Agglutinin (PNA). The PNA lectin binds to specific glycosylated protein and lipids in the membranes of all cone and rod PR inner segments (IS) and outer segments (OS) ( Fig. 3 A-i ) . Based on the OS staining, the four distinct cone sub-types could be clearly identified such as, the ultraviolet sensitive cones (white arrowhead; UVS or UV cones), short wavelength sensitive cones (yellow arrowhead, SWS or blue cones), long and middle wavelength sensitive cones (square bracket, LWS/MWS or R/G cones or double cones) ( Fig. 3 A-i ) . PNA staining also revealed the distally positioned ROS (magenta arrowhead), which were interspersed among the microvilli projections of the RPE cells along the distal retinal margins ( Fig. 3 A i-ii) . Counterstaining with DAPI highlighted two distinct PR nuclear layers, which are spatially separated by the outer limiting membrane (OLM). The rod nuclear layer (RNL) is composed of 2–3 layers of circular nuclei of rod cells and the cone nuclear layer (CNL) consists of a single row of elongated cone nuclei, positioned apical to the OLM ( Fig. 3 A ii-iii) . The nuclei of UVS-cones are of inverted triangle or V-shaped ( Fig. 3 A-i ii, white asterisk) and are located along the distal margins of the RNL and their OS are positioned in between the elongated nuclei of the SWS/MWS/LWS cones in the CNL ( Fig. 3 A-i ) . The SWS COS are positioned medially between the UVS and MWS/LWS cones. The MWS and LWS cones exist as doublets and their OS are distally positioned. Unlike the rodents with inverted chromatin architecture of rod nucleus, the zebrafish rod nuclei display uniformly distributed, homogeneous chromatin. However, the nuclei of all cones show a granular chromatin architecture, like that of the human retina 17 ( Fig. 3 A-i ii) . Degeneration of UVS and SWS cones in abca4b −/− null mutants To assess for the status of PR cells and their degeneration in abca4b −/− null mutants, the retinal sections of wildtype and mutant fishes were stained with FITC-labelled PNA at 3, 6, 12 months of adulthood. Wildtype retinas displayed the characteristic mosaic pattern of COS, with typical conical morphology, alongside the well-formed cylindrical ROS ( Fig. 3 B i-iii & vii-ix) . However, mutant retinas at 3M displayed shortened and shrunken UVS and SWS-COS, which suggested the onset of retinal degeneration (RD) (Fig. 3 B x). At 6M and 12M, the mutants displayed a marked reduction in PNA staining intensity, and accelerated COS degeneration of UVS and SWS cones, followed by double cones ( Fig. 3 B xi) . Further, a significant degeneration of ROS was also observed at advanced ages ( Fig. 3 B ii) . Quantification of cone nuclei in wildtype and mutants at different stages has revealed no significant changes at 3M, indicating that the OS undergo degeneration initially (Supp. Figure 2 A i-iii) . However, at 6M and 12M, there was a rapid and significant decline in all cone PR types, which confirmed the cone-rod pattern of progressive degeneration (Supp Fig. 2 A iv-ix) . These results demonstrate that abca4b −/− zebrafish undergo a slow but progressive RD, starting with early structural defects in COS and culminating in widespread loss of cones and rods with advancing age. Progressive degeneration of all cones in abca4b −/− null mutants ABCA4 protein is localized to PR disc membranes, where the photon sensing opsins are localized and together they play a crucial role in visual cycle. To assess the structural integrity of POS in abca4b −/− mutants, retinal sections were stained with antibodies specific to each of the UVS, SWS, LWS and MWS-COS. The anti-RHO (MAB5356, clone 1D4), labels the rod PR in rodents and humans. However, it is known to specifically label the LWS-COS in zebrafish (LWS opsin, Supp. Figure 2 B i ) 18 . Similarly, the anti-RHO (ab232934, clone EPR21876) labels ROS in rodents and humans but, selectively labels the MWS-COS in zebrafish (Supp. Figure 2 B i) . The anti-RPE65 antibody, (ab23178) labels all COS in zebrafish (Supp. Figure 2 B ii) . Finally, the anti-R/G-opsin (AB5405) marks the LWS/MWS opsins in mouse and human retinas, but we observed that it labels all PR-OS in zebrafish (Supp. Figure 2 B iii) . Immunohistochemistry of LWS and MWS-COS in 3M and 12M wildtype retinas, displayed their adjacent placement and appeared as doublets at regular intervals (Fig. 4 A & B i-iii) . However, the 3M-old mutants showed early degeneration of double COS, predominantly affecting the MWS-COS ( Fig. 4 A v-vii) . By 12M, MWS-COS were significantly lost, while the LWS-COS remained, but with distorted morphology (Fig. 4 B v-vii ). In addition to the OS loss in mutants, the cone nuclei morphology was also altered. In wildtype retina, the nuclei of UVS cones appeared as inverted triangle shape and are located along the distal margins of RNL, while the SWS, MWS and LWS cone nuclei in the CNL are elongated and oblong shaped ( Fig. 4 A &B-iv) . In 3M-old mutants, the UV cone nuclei lost their inverted triangular morphology and appeared irregular and at 12M they became rounded and lost their structural integrity. The other cone nuclei also lost their elongated shape and became shorter and disorganized ( Fig. 4 A &B-viii) . Further, the immunostaining of all COS displayed degeneration in 3M mutant retinas and the residual OS were found to be mislocalized (Fig. 4 C i-ii ). To evaluate cone integrity, the retinal sections were stained with anti-arr3b, which labels Cone arrestin expressed in double cone cell bodies. Bright-field images of wildtype retinas at 6M and 12M showed specific labelling of the inner segments and cell bodies of double cones ( Fig. 4 D i-ii) . However, the mutants displayed significantly reduced PR layer thickness (ROS, CNL, RNL) and abnormal double cone IS at 6M ( Fig. 4 D -iii) , which got severely degenerated further at 12M ( Fig. 4 D -iv) . Additionally, the mutant RPE cells showed increased pigmentation, with melanosomes dispersed throughout the cell body under photopic conditions, which indicates potential diminished light sensitivity of the retina ( Fig. 4 D i-iii) . Under bright light conditions, the double COS of 12M wildtype retina were positioned proximal to the OLM for maximal light capture ( Fig. 4 E-i ) . However, in mutants, the double COS have undergone degeneration, and the residual LWS-COS appear dispersed and are positioned distal to the OLM and are deeply buried within the RPE layer ( Fig. 4 E-i i) . This confirmed that the degenerated outer-retinal architecture of mutants have adapted to low light responses and assumed a permanent dark-adapted state, likely due to cone degeneration and diminished sensitivity to bright light. Together these findings revealed progressive degeneration of IS and OS, altered nuclear structure and cell loss of all cones in abca4b −/− mutants. Prolonged exposure to unabsorbed light photons seemed to trigger chronic stress in RPE cells, leading to persistent dark-adapted responses under photopic conditions such as, the myoid elongation in LWS/MWS cones and melanosome accumulation in RPE cells. Rod photoreceptor degeneration in null homozygous mutants To further assess the rod degeneration in mutants, the retinal sections of 24-month-old, dark-adapted animals were immunostained with FITC-labelled PNA, which labelled all POS. Under dark-adapted conditions, the ROS are proximally positioned close to OLM to support maximal light absorption ( Fig. 5 A-i ) . However, in mutant retinal sections, considerable loss of both ROS and COS were observed and the residual OS appeared shorter in size ( Fig. 5 A-i i) . Further, to specifically assess ROS degeneration, light-adapted retinas at 12M were stained with anti-R/G-opsin (AB5405) that detects all PR-OS ( Fig. 5 B-i ) . The wildtypes displayed tubular ROS structures at the distal end of the retina ( Fig. 5 B-p ) . Whereas the mutants showed shorter ROS with signs of degeneration, in addition to an extensive loss of all COS ( Fig. 5 B-q ) . Unlike the tubular ROS structures seen in wildtype retinas ( Fig. 5 B-r ) , the mutants ROS showed structural deformities such as atypical bulges with hollow lumen ( Fig. 5 B-s ) . It is interesting to note that these structural abnormalities are clearly observed with anti-R/G-opsin, which specifically marked all PR-OS, while the membrane glycoprotein labelling with FITC-PNA only helped to examine the POS integrity. These results confirmed that the ROS are also undergoing degeneration at advanced stages of the disease, with structural deformities, leading to an overall reduction in the thickness of the outer nuclear layer (ONL). Lipofuscin deposits in the retina of abca4b −/− mutants In STGD1/ARRD patients, the loss of ABCA4 leads to the accumulation of the A2E, a bisretinoid complex that remain undigested by the lysosomal enzymes within RPE cells and appear as autofluorescent lipofuscin deposits 19 . This causes RPE cell stress and gradual atrophy, followed by secondary loss of PRs and vision impairment. We therefore checked for the presence of autofluorescent lipofuscin accumulation in unstained cryosections of both wildtype and abca4b −/− mutant retinas of 12M-old fish. The unstained retinal sections were excited at 488 nm and the autofluorescent emissions were collected from 500–700 nm 8 . While the wildtype retinal sections had a few autofluorescent lipofuscin deposits in the choroidal regions ( Fig. 6 A i-ii & p) , the mutants displayed an increased accumulation, which are evident both in the choroidal region and within RPE cells ( Fig. 6 A iii-iv & q) . Since oxidized lipids are the primary component of lipofuscin deposits, we evaluated for intracellular lipid peroxide accumulation using a lipophilic probe (BODIPY 665/676), which exhibits a shift in its absorption and emission spectra from 665/676 nm to 580/605 nm upon binding to oxidized lipids. To detect the toxic lipid peroxides, BODIPY stained retinal sections were excited with 561 nm laser and the emission spectra from oxidized lipids were collected from 580–660 nm. The confocal microscopic images confirmed the absence of BODIPY stained oxidized lipids in wildtype retinas ( Fig. 6 B i-ii & r) , while an increased accumulation of toxic lipid intermediates was noted within POS, beneath RPE cells and in choroidal regions of mutant retinal sections ( Fig. 6 B iii-iv & s) , which further confirmed the RPE cell stress. Despite the accumulation of toxic lipids, the RPE cells in mutant retina remained viable, even at 12M, but developed hyperpigmentation and their melanosomes exhibited slightly altered retinomotor responses under light-adapted conditions. However, the progressive PR degeneration was evident, as marked by significant changes in nuclear and outer segment structures and cell loss at advanced stages ( Fig. 3 B & Supp. Figure 2 A ) . This observation contrasts with the human STGD1 physiology, wherein the RPE degeneration typically precedes the PR cell loss. Taken together, it suggests that the PR degeneration in abca4b null mutants is a primary effect, due to the accumulation of toxic A2E in PR disc membranes and not a secondary effect of lipofuscin deposits and lysosomal stress leading to RPE cell death. Early loss of retinal stem cells in abca4b −/− mutants Adult zebrafish retina has immense regenerative potential unlike that of humans. During zebrafish retinogenesis, the newly formed retinal neurons originate from the ciliary margin zone (CMZ) that contains mitotically active retina stem cells (RSCs) along the retinal periphery. The RSCs present in CMZ contributes to the retinal growth and formation of different retinal cell types during eye development 20 . We therefore asked if the RSCs participates in adult retinal regeneration and attempts to maintain the tissue integrity, in response to the ongoing cell loss in abca4b −/− mutants. To investigate this, the retinal sections of the wildtype and mutant fish were immunostained for PCNA at early developmental stages (2, 3, 4, 15 dpf) and during adulthood (3, 6 and 12M). Immunohistochemistry of wildtype and mutant retinas to detect nuclear PCNA expression at 2 dpf displayed proliferating retinal progenitors that are distributed throughout the developing retina. However, from 3 dpf, the pcna + cells were confined to the peripheral retina (CMZ) and its expression was lost in the fully differentiated cells in the central retina. Between 4–15 dpf, a gradual decline in the pcna + cells was observed in the CMZ region (Supp. Figure 3 A ) , which confirmed that the early retinal development, RSC proliferation and differentiation are normal in mutants, as compared to the wildtype. It is well known that the proliferative pool of CMZ stem cells declines with age and are totally extinguished in wildtype by 3–4 years 21 . In wildtype fish retinas, a compact cluster of PCNA positive proliferating cells were present at the CMZ (13 ± 4.6) at 3M ( Fig. 7 A i) which gradually decreased at 6M (9.6 ± 0.57) and 12M (2 ± 1) (n = 3), with rare PCNA positive cells being retained at the CMZ ( Fig. 7 A ii, iii) . However, in age-matched mutant retinas, we observed an early depletion in the number of PCNA positive cells in 3M (6.6 ± 1.1) and 6M (4.33 ± 1.1) (n = 3) ( Fig. 7 A iv, v) , and we observed a complete loss of pcna + cells at 12M ( Fig. 7 A vi) . Similarly, the immunostaining for Phospho Histone H3 (phh3) also confirmed a decrease in phh3 + mitotic cells in 3M mutants (Supp. Figure B i-ii) . Further, a notable reduction in the sox2 + Müller glial cells at the CMZ and inner nuclear layer (INL) was observed in 3M mutants, which indicated an early exhaustion of RSCs (Supp. Figure C i-iv). We could also detect a few pcna + cells in the ONL of wildtype retinas, which are likely to be Müller-derived rod progenitors (RPs) ( Fig. 7 B i) and were found to be reduced in mutant retinas ( Fig. 7 B ii) . These observations together suggests that the ongoing degeneration in mutant retinas might be subjecting the RSCs to chronic activation, expansion and differentiation to replace the lost PR cells, thus resulting in an accelerated loss of reserve stem cell pool during early adulthood. Progenitor and mature cell marker expression in developing and adult zebrafish To understand the temporal expression of abca4b and other retina-specific genes, we evaluated the transcripts in wildtype and abca4b −/− mutant retinas during early larval development and in adulthood by semi-quantitative RT-PCR. The expression of abca4b mRNA started at around 72 hours post fertilization (hpf) and peaked at 7 dpf in wt. However, the expression could be detected only from 7 dpf and at lower levels in mutant retinas (Fig. 7 C-i), which suggested that the mutant transcripts may be rendered unstable due to frame shift and pre-mature stop codons (Supp. Figure 4 A i-iv) . The RT-PCR analysis of early progenitor retinal markers such as chx10 and pax6 displayed an increased expression in both wildtype and mutants starting from 24 hpf and peaked at 72 hpf, when the retina is fully formed. As the progenitor cells start differentiating and committing to mature retinal cell types, a decline in pax6 and chx10 expression was observed from 7 dpf onwards and was only expressed at base levels in adults at 12M, which confirmed that their expression is retained only in a small fraction of mature retinal cells. In abca4b −/− mutants, the temporal expression pattern of chx10 and pax6 was identical to wildtype during early development. However, at 12M, we observed a significant upregulation in pax6 and chx10 expression, which suggested possible activation of progenitors in mutant retinas and triggered likely by the degeneration in ONL. Similarly, an elevated expression of crx , a PR precursor marker was also observed at 12M in abca4b −/− mutants, which suggested the activation of molecular pathways that induce the formation of multipotent retinal progenitors (Fig. 7 C ii ). We further evaluated the retinal tissues for the expression of different mature photoreceptor and RPE-specific transcripts. The wildtypes showed the expression of all mature cell transcripts starting from 12 hpf, which peaked at 72 hpf and remained constant until 12M. In abca4b −/− retinas, we observed a delayed onset of expression of uvs and mws opsin at 72 hpf, which plateaued at 7 dpf and the levels are further comparable to wt expression till 12M (Supp. Figure 4 B i) . However, the expression patterns of other mature retinal gene such as lws opsin, sws opsin, arr3 and rpe65 were comparable between wildtype and mutant retinas (Supp. Figure 4 B ii). The upregulation of pax6 , chx10 and crx transcripts in mutant retinas at 12M suggests possible activation of regenerative pathways and could partly explain the early loss of reserve stem cells at the CMZ. These results suggested that the rapid depletion of CMZ-RSCs could further accelerate the retinal ONL degeneration in older abca4b −/− mutants. Retention of wound healing and regenerative response in abca4b −/− mutant retinas Apart from the RSCs present in the CMZ, the MGCs can dedifferentiate and generate multipotent, self-renewing RSCs in adult zebrafish retina. As abca4b −/− animals displayed an early loss of proliferating PCNA positive cells at the CMZ and in the ONL layers during adulthood, we assessed if the injury-induced, Müller-driven regeneration ability is active in these mutants. To assess for the emergence of proliferative RPCs, the retinal sections of the uninjured and needle prick injured wildtype and mutant retinal sections were stained with anti-PCNA. The uninjured retinas of 24M-old wildtype and the mutants had only rare pcna + cells in the ONL and none at the CMZ ( Fig. 8 A i, ii) . However, upon injury, both the wildtype and mutant retinas showed a massive increase in the numbers of pcna + cells across all retinal layers, suggesting that the MGCs-driven, injury response is active and can support the regeneration and repair of damaged retinal tissues ( Fig. 8 B i-ii) . These results confirmed that although the abca4b −/− mutants displayed a faster depletion of RSCs at CMZ, the Müller glia-driven regenerative ability remained active to support retinal injury repair. However, it warrants further evaluations during post injury recovery, to understand if the regenerated retina gets properly laminated and the PR cells in ONL layers undergo morphological maturation to restore normal retinal functions. Delayed feed-capture response in abca4b −/− mutants The UVS cones are important for high resolution prey-capture behaviour in zebrafish. Since we observed an early loss of UVS cones in abca4b −/− mutant retinas, we asked if the cellular defects could affect retinal functions and gross visual behaviours. To assess the feed-capture responses, we custom-designed a rectangular and Y-maze for age-matched wildtype (Supp. video file 1A, 2A, 3A, 4A) and mutant fish (Supp. video file 1B, 2B, 3B, 4B) , using both the dry and live feeds. The results revealed that the wildtypes displayed a directed approach towards the feed and remained hovering around the spot, for a focussed feeding. In contrast, the abca4b −/− mutants exhibited random movements throughout the maze. The fish movements were video recorded, and the representative videos are shown here. The videos were deidentified and examined by two independent assessors (naive to the study) to record the time duration at which the animals have first identified and consumed the feed. The results confirmed that the wildtype could rapidly recognize the feed, whereas the mutants demonstrated a significant delay in feed-capture ( Fig. 9 A i-ii) . Spatial-navigation and learned decision making abilities were also evaluated using Y-maze, where the ability of the animals to identify the correct arm where the feed was dropped was assessed. In live feed test, wildtypes chose the correct arm in 60% of the attempts (12/20), thus demonstrating normal visual and spatial perception in detecting the actively moving prey. However, the mutants were able to choose the correct arm in 25% of the attempts (5/20), possibly due to random chance (50%) or aided by other sensory stimuli such as olfaction and nociception. This suggests that the loss of UVS cones affects the ability of mutants in detecting and responding to smaller and dynamic live prey. In case of dry feed test, wildtypes chose the correct arm in 70% of the attempts (14/20) and the mutants chose the correct arm in 50% of the attempts (10/20), which suggested that the relatively less dynamic and floating larger pellets of dry feeds are easier to detect even by the mutants with severe UVS cone loss ( Fig. 9 A iii-iv) . Further, the fish movements along the maze were tracked using a threshold-based video tracking algorithm created using Python, resulting in the generation of locational trajectory plots. The trajectory plots of both the mazes have confirmed that the wildtypes have predominantly remained around the feed drop area, as indicated by the densely populated regions in the representative heat maps and histogram plots ( Fig. 9 B i-iv) . Whereas, the mutants demonstrated random movements throughout the tank, with minimal mobility around the feed drop area, as shown in the representative heat maps and histogram plots ( Fig. 9 B v-viii) . Taken together, the mutants displayed an increased latency in feed recognition, abnormal response in focussed feeding and spatial navigation. Despite these defects, the mutants survived and displayed normal growth, development and fertility, possibly because the other sensory functions such as mechanosensation and olfaction were intact, which enabled them to feed and mate effectively under the controlled laboratory conditions, with unlimited food supply and absence of competitive predators. Additionally, both sexes of mutants were fertile and when interbred, they produced progenies that developed normally and helped in successful expansion of mutant colonies. This confirmed that the visual perception and visuomotor responses play a primary role in immediate feed-capture behaviour in teleost, while the other sensory systems, although important, are likely to play a secondary role in supporting the feeding and mating behaviour. Defective optokinetic response (OKR) in abca4b −/− mutants Upon visual function quantification, adult wildtype zebrafish (1-year old) displayed a typical OKR, with a slow-phase in the direction of grating motion and a fast-resetting phase in the opposite direction (Supp. video file 5A , Fig. 9 C i-iii white arrows) . In contrast, 7 out of 10 age-matched mutants displayed no detectable eye movements in response to the moving drum (Supp. video file 5B) while the remaining 3 animals displayed a few erratic and random eye movements (Supp. video file 5C) . Quantitatively, the wildtypes showed a fast-phase count of 25.3 ± 4.84 (mean ± SD), while the mutants showed only 13.1 ± 2.54 fast-phases over a period of 11 seconds (p < 0.05) ( Fig. 9 D ) , which confirmed a significantly impaired OKR response in mutants. The 5 dpf larval abca4b −/− mutants also displayed incomplete saccades in comparison to age-matched wildtype larvae, despite their normal retinal histology at early larval stages (Supp. video file 6A-C) . Discussion The cone-enriched retina of zebrafish ( Danio rerio ) resembles the human macula and are therefore better models than rodents for studying various macular and cone-rod dystrophies, including STGD1 caused by mutations in ABCA4. A recent report has shown that the knockout of abca4a had no effects on retinal PRs and RPE cells and most of the abca4 protein in zebrafish is encoded by abca4b 22 . Therefore, we targeted the zebrafish abca4b gene using isoform-specific CRISPR-gRNAs to create a knockout model of STGD1. The adult mutants displayed gross structural and morphological abnormalities in outer retinal layers, with reduced OS thickness and increased pigmentation in RPE cells. The retinomotor associated changes in myoid lengths of PR cells and pigment granule migration (melanosome) within RPE cells are known to be jointly regulated by the circadian rhythm and incident light in teleost. This mechanism can serve as an indirect measure of retinal light sensitivity response. The PR myoids of adult mutants exhibited near normal retinomotor behaviour. This may be because the zebrafish retina is cone-enriched and the cone responses are predominantly regulated by the circadian rhythm, while the rod and RPE cell responses are mainly controlled by the light 15 , 16 , 23 . Nevertheless, the significant OS reduction, both under photopic and scotopic conditions indicated PR degeneration. These outer retinal defects could result in reduced light absorption by the PRs and the excess (unabsorbed) photons may induce chronic photo-oxidative stress and could trigger increased melanin production, as an immediate cytoprotective response in RPE cells. However, the involvement of circadian rhythm in retinal regulation and cone responses has made it difficult to isolate the light-mediated responses in abca4b null mutants. The dark-adapted abca4b −/− RPE cells appeared atypical, with loss of apical microvilli structures, which are critical for phagocytosis and recycling of shed POS. Also, the light-adapted mutant RPE displayed increased pigmentation, with melanosomes dispersed from the basal cytoplasm to apical microvilli structures. Thus, the reduced light sensitivity of the mutant retinas seems to adopt the RPE cells to a dark-adapted retinomotor responses, even under photopic conditions. A similar “expanded melanophores” phenomenon was reported in blind zebrafish, where the pigment cells (melanophores) of the skin are larger and distributed, leading to their darker appearance. This is because, the vision impaired animals lack the ability to adapt their skin pigmentation in response to ambient light levels. Higher the pigmentation, greater is the visual impairment and vice versa and this has been used as a simple screening tool to identify vision mutants in large library screens 24 . A study on rhodopsin P23H mutants has reported an increase in oxidative stress response and altered circadian gene expression in both cone and RPE cells 25 . FITC-labelled PNA staining of abca4b −/− mutants displayed early outer-retinal degeneration, starting from 3-months. They exhibited shortened OS with progressive thinning, culminating in total loss of all cone and rod OS at advanced adulthood. Detailed analysis of mutant retinas at different timepoints revealed structural deformities in cone cell nuclei and outer segments. Under bright light, the COS of wildtype are aligned proximal to the OLM for maximal light absorption. However, in mutants, the degenerating COS are seen buried deeper within the RPE, thus confirming the reduced light sensitivity of cones, which led to increased pigmentation and persistent dark-adapted retinomotor responses in RPE cells. A recent report also displayed COS dysmorphology in abca4b −/− mutants, with elongation, thinning, disrupted disk-packing, reduced COS shedding and ‘eat-me’ signals on POS (externalized phosphatidylserine), affecting their phagocytosis and clearance by RPE cells 22 . The abca4 protein was also shown to localize in a stripe pattern along the COS length, predicting a structural role, apart from the well-known retinal transport function in POS during phototransduction 26 and in processing the shed POS and lipids inside RPE lysosomes 5 . The Abca4 −/− mice model have demonstrated progressive PR degeneration, with delayed onset at 6M and an extensive ONL loss at 12M 27 . Mice are nocturnal with rod-enriched retinas. This required the development of Abca4 −/− Nrl −/− mice models to engineer cone-dominant retinas, to understand the effects of Abca4 loss on cone cell functions 28 . The abca4b −/− zebrafish model revealed that the cones are more sensitive to photooxidative stress than rods, with degeneration starting as early as 1M, unlike the delayed onset in Abca4 −/− mice. We further confirm that the cones are the first cell type to be affected in abca4b −/− mutants, while rod degeneration is apparent only at advanced adulthood. The key pathological features in STGD1 patients and Abca4 −/− mice are delayed dark-adaptation, drusen deposits or lipofuscin accumulation in RPE cells, increased oxidative stress leading to RPE cell death; followed by secondary PR layer degeneration and vision loss 7 , 8 . Similarly, the abca4b −/− zebrafish retinas accumulate autofluorescent lipid peroxides within the choroid, RPE and POS. Interestingly, despite these toxic deposits, the mutant RPE cells remained viable and highly pigmented for up to 24M. However, the effects of abca4b loss on PRs, particularly the COS degeneration was evident as early as 3M. This suggests that the early degenerative changes in the PRs are a direct and primary effect of intracellular A2E toxicity and excess all-trans retinal accumulation in POS and not due to RPE cell loss dependant secondary effects. The Abca4 −/− Nrl −/− mice retina also displayed accelerated A2E production, inefficient clearance and impaired transport to RPE, resulting in A2E accumulation and cone toxicity 28 . Most teleost retina has immense regenerative capacity supported by two distinct stem cell niches: 1) the RSCs at the CMZ and 2) the MGCs in the INL 20 . Additionally, the RPE cells can regenerate from the peripheral cells upon injury 29 . RSCs in the CMZ are competent to generate all retinal neurons except the rods. However, a few rod progenitors reside in the ONL and are derived from the slow-dividing MGCs and contribute to rod maintenance and homeostasis 30 . ScRNA-seq experiments in rhodopsin P23H mutant, (rod degeneration model) reported a gradual increase of cell clusters expressing progenitor and rod cell-markers, indicating rod regeneration. This model also reported extensive RPE degeneration 25 . However, we observed that the RPE cells remained viable and the ONL degeneration progressed with age in abca4b −/− mutants, despite the regenerative potential of zebrafish retinas. The activated RSCs undergo asymmetric division, to maintain the stem cell pool and generate transiently amplifying progenitors that differentiate and gives rise to all retinal neurons, except the rods. These RSCs contribute to the retinal growth during development and for retinal tissue repair and maintenance during adult tissue homeostasis 20 , 31 , 32 . In abca4b −/− mutants, we observed that the chronic retinal degeneration has led to the premature depletion of PCNA + , pHH3 + and SOX2 + stem cell reserve at the CMZ and INL. In the uninjured retina, the MGCs generates PAX6 + late-stage progenitors, which migrate to the ONL and differentiate into rods 20 , 30 , 33 . In adult abca4b −/− zebrafish mutants, we observed a significant reduction in rod progenitors (RPs), with only a few rare PCNA + cells identified in the ONL, and none in the INL. Previous studies have shown that the rod degeneration does not induce the MGC proliferation in the INL 34 . This suggests that rod regeneration primarily relies on the RPs in the ONL and gets depleted with age. Thus, the early depletion of RSCs at the CMZ and RPs in the ONL explained the slow but progressive degeneration of the outer-retina in abca4b −/− mutants. Studies have shown that the MGC-derived progenitors in the INL express an array of genes associated with RPs ( pax6, rx1, vsx2, crx, notch, delta and N-cadherin) in response to PR degeneration 20 , 35 . We observed an upregulation of RSC-specific ( pax6, vsx2 ) and PR precursor cell specific ( crx ) transcripts in abca4b −/− mutants, which indicated the presence of regenerative signals in mutant retinas at 12M. It further suggests an attempt to activate MGCs in the INL, but we did not detect any PCNA + cells in the INL under uninjured conditions. However, upon retinal injury, we observed a surge in PCNA + cells in both INL and ONL. Such Muller-driven regenerative ability was retained in bbs2 mutants upon light ablation 36 . In teleost models where rods were selectively destroyed, they displayed an increased proliferation in ONL, possibly suggesting an expansion of MGC-derived rod progenitors 37 , 38 . In an inducible model of rod toxicity, complete loss of all rod cells has triggered massive MGCs proliferation in the INL, indicating that an extensive rod loss can activate the quiescent MGCs 34 . Similarly, selective cone ablation was shown to activate the MGCs 39 – 41 . These findings suggests that a critical threshold of tissue damage or injury is required to trigger the activation of MGC-driven retinal regeneration. In uninjured, aging abca4b −/− mutants, the slow ONL degeneration appear to be insufficient to achieve the critical threshold required for the robust activation of MGCs. We also hypothesize that, additional extrinsic cues such as injury-induced inflammation may be required to activate MGC-driven regenerative responses. Taken together, these findings highlight that the resident RSCs at the CMZ and RPs in the ONL compensate for PR cell loss. However, they get depleted precociously under chronic degenerative conditions. Given that an acute injury is required to trigger activation and reprogramming of MGCs, degeneration continues in the ONL of abca4b −/− mutants, leading to progressive vision loss. Larval zebrafish under natural environments feed on transparent but UV-bright microorganisms and zooplanktons that are illuminated by sunlight. Thus, the UVS cone-enriched, strike-zone region (area temporalis) of the zebrafish retina is required for their normal prey-capture behaviour and navigation 42 . These cones connect to UV-responsive, ON-sustained RGCs which forms a dedicated achromatic pathway that processes UV signals to guide precise prey-capture behaviour 43 . Therefore, the loss of UVS-cones in mutants has greatly affected their feed-capture behaviour. Using the rectangular and Y-maze, we demonstrate that the mutants displayed greater difficulty in feeding live artemia larvae, which requires UVS-cone dependent vision for prey detection and a directed chase-response for successful capture. However, with dry feeds, the visual performance of the mutants has relatively improved, which suggests that the mutants are moderately competent to detect larger feed pellets and stationary objects, despite severe UVS-cone loss. It is also possible that the blind fish can rely on other sensory inputs such as olfaction and mechanosensation. The lack of competition for feed under laboratory conditions has supported sufficient feeding and survival to late adulthood. This confirms that the visual perception and visuomotor responses play a primary role in feed-capture behaviour, while the other sensory systems are likely to play a secondary role to support zebrafish feeding and mating behaviour. The OKR test in abca4b −/− mutants displayed severe visual defects, with no detectable eye movements, while a few animals with partial vision had shown random and irregular eye movements. It is important to note that the OKR setup was illuminated by white light and the photopic responses reflect the functions of residual LWS/MWS-COS that are sensitive to visible wavelengths of light 44 . Since the abca4b −/− mutants show an early loss of UVS and SWS cones, it may be feasible to isolate and quantify the visual responses of different cones using lights of different wavelengths such as 360 nm (for UVS cones), 415–420 nm, (for SWS cones) 480–490 nm (for MWS cones), 560–590 nm (for LWS cones) and 730 nm (for scotopic) conditions. Also, the gradual changes in the visual acuity and contrast sensitivity of mutants at different stages of degeneration may require assessments using a range of spatial frequency gratings (0.3, 0.15, 0.075, 0.03 cpd) and a range of contrast settings (30%, 50%, 70%, 100%). In summary, we highlight that the abca4b −/− mutants display extensive cone degeneration followed by rod, a hallmark of STGD1. The RPE cells remain viable but accumulate drusen deposits, which causes cellular stress and persistent dark-adapted retinomotor responses. The resident stem cells at the CMZ and ONL are precociously lost in mutants, leading to continued degeneration in the outer-retina, resulting in severe vision loss, despite retaining the MGC-dependant regenerative potential. Finally, we conclude that the abca4b −/− zebrafish reported here can serve as valuable in vivo model for evaluating newer drugs for the treatment of lipofuscin-induced retinal degenerative conditions such as SMD and AMD. Declarations Declaration of competing interests: All authors declare no conflict of interest. Author Contributions: DP, DS, PJS, IM conceived the project, designed, and carried out the experiments related to the generation of transgenic zebrafish models; DP, DS, PJS, GK, PS participated in the methods standardization and protocol development; DP and DS carried out the visual behaviour and function tests; DP, SNSHC and SB participated in the custom design of feed-capture maze and OKR set up; DP, MM carried out the image and video analysis for quantification of zebrafish visual responses; RM and IM managed the project and acquired the funding; DP, IM compiled the data and drafted the manuscript. All authors participated in the review and approval of the contents of the manuscript. Acknowledgements: The authors thank Sreedhar Rao Boyinpally and Tirupathi Rao Mocherla for technical support with IHC; Udayachandrika Kamepalli for confocal imaging. Manasa Kalivemula, Manogna Vangipuram, Rojalin Das, Devaraju and Ayush Kumar for the custom-design of feed capture maze and OKR imaging setup. Funding: This study was supported by R&D grants to RM and IM from the Department of Biotechnology (DBT)- (BT/PR13644/GET/119/32/2015), Government of India; Intramural grant from the Hyderabad Eye Research Foundation (HERF) and Senior Research Fellowship to DP from the Indian Council of Medical Research (ICMR), Government of India. Data availability All data generated and analysed during this study are included in this manuscript and in supplementary information files. Raw data are available upon request from the corresponding author, Dr. Indumathi Mariappan ( [email protected] ). The zebrafish mutant line used in this study has been deposited in the Zebrafish Information Network (ZFIN) database (https://zfin.org/). The exon 2 gene sequence of the abca4b mutant have been deposited in the GenBank (https://www.ncbi.nlm.nih.gov/WebSub/?form=history&tool=genbank) References Chen, T. C. et al. Genetic characteristics and epidemiology of inherited retinal degeneration in Taiwan. NPJ Genom Med 6 , 16, doi:10.1038/s41525-021-00180-1 (2021). Cornelis, S. S. et al. Compendium of Clinical Variant Classification for 2,246 Unique ABCA4 Variants to Clarify Variant Pathogenicity in Stargardt Disease Using a Modified ACMG/AMP Framework. Hum Mutat 2023 , 6815504, doi:10.1155/2023/6815504 (2023). Quazi, F., Lenevich, S. & Molday, R. S. ABCA4 is an N-retinylidene-phosphatidylethanolamine and phosphatidylethanolamine importer. Nat Commun 3 , 925, doi:10.1038/ncomms1927 (2012). Lenis, T. L. et al. Expression of ABCA4 in the retinal pigment epithelium and its implications for Stargardt macular degeneration. Proc Natl Acad Sci U S A 115 , E11120-e11127, doi:10.1073/pnas.1802519115 (2018). Farnoodian, M. et al. Cell-autonomous lipid-handling defects in Stargardt iPSC-derived retinal pigment epithelium cells. Stem Cell Reports 17 , 2438-2450, doi:10.1016/j.stemcr.2022.10.001 (2022). Weng, J. et al. Insights into the function of Rim protein in photoreceptors and etiology of Stargardt's disease from the phenotype in abcr knockout mice. Cell 98 , 13-23, doi:10.1016/s0092-8674(00)80602-9 (1999). Radu, R. A. et al. Accelerated accumulation of lipofuscin pigments in the RPE of a mouse model for ABCA4-mediated retinal dystrophies following Vitamin A supplementation. Invest Ophthalmol Vis Sci 49 , 3821-3829, doi:10.1167/iovs.07-1470 (2008). Charbel Issa, P. et al. Fundus autofluorescence in the Abca4(-/-) mouse model of Stargardt disease--correlation with accumulation of A2E, retinal function, and histology. Invest Ophthalmol Vis Sci 54 , 5602-5612, doi:10.1167/iovs.13-11688 (2013). Bibliowicz, J., Tittle, R. K. & Gross, J. M. Toward a better understanding of human eye disease insights from the zebrafish, Danio rerio. Prog Mol Biol Transl Sci 100 , 287-330, doi:10.1016/b978-0-12-384878-9.00007-8 (2011). Mäkeläinen, S. et al. An ABCA4 loss-of-function mutation causes a canine form of Stargardt disease. PLoS Genet 15 , e1007873, doi:10.1371/journal.pgen.1007873 (2019). Bellingrath, J. S. et al. Large animal model species in pluripotent stem cell therapy research and development for retinal diseases: a systematic review. Frontiers in ophthalmology 4 , 1377098, doi:10.3389/fopht.2024.1377098 (2024). Noel, N. C. L., MacDonald, I. M. & Allison, W. T. Zebrafish Models of Photoreceptor Dysfunction and Degeneration. Biomolecules 11 , doi:10.3390/biom11010078 (2021). Huckenpahler, A. L. et al. Noninvasive Imaging of Cone Ablation and Regeneration in Zebrafish. Translational vision science & technology 9 , 18, doi:10.1167/tvst.9.10.18 (2020). Fishman, G. A., Farbman, J. S. & Alexander, K. R. Delayed rod dark adaptation in patients with Stargardt's disease. Ophthalmology 98 , 957-962, doi:10.1016/s0161-6420(91)32196-1 (1991). Burnside, B., Adler, R. & O'Connor, P. Retinomotor pigment migration in the teleost retinal pigment epithelium. I. Roles for actin and microtubules in pigment granule transport and cone movement. Invest Ophthalmol Vis Sci 24 , 1-15 (1983). Burnside, B. & Basinger, S. Retinomotor pigment migration in the teleost retinal pigment epithelium. II. Cyclic-3',5'-adenosine monophosphate induction of dark-adaptive movement in vitro. Invest Ophthalmol Vis Sci 24 , 16-23 (1983). Solovei, I. et al. Nuclear architecture of rod photoreceptor cells adapts to vision in mammalian evolution. Cell 137 , 356-368, doi:10.1016/j.cell.2009.01.052 (2009). Yin, J. et al. The 1D4 antibody labels outer segments of long double cone but not rod photoreceptors in zebrafish. Invest Ophthalmol Vis Sci 53 , 4943-4951, doi:10.1167/iovs.12-9511 (2012). Cideciyan, A. V. et al. Mutations in ABCA4 result in accumulation of lipofuscin before slowing of the retinoid cycle: a reappraisal of the human disease sequence. Hum Mol Genet 13 , 525-534, doi:10.1093/hmg/ddh048 (2004). Raymond, P. A., Barthel, L. K., Bernardos, R. L. & Perkowski, J. J. Molecular characterization of retinal stem cells and their niches in adult zebrafish. BMC Dev Biol 6 , 36, doi:10.1186/1471-213x-6-36 (2006). Hernandez-Nunez, I. et al. Decline in Constitutive Proliferative Activity in the Zebrafish Retina with Ageing. Int J Mol Sci 22 , doi:10.3390/ijms222111715 (2021). Willoughby, J. J. & Jensen, A. M. Abca4, mutated in Stargardt disease, is required for structural integrity of cone outer segments. Dis Model Mech 18 , doi:10.1242/dmm.052052 (2025). Menger, G. J., Koke, J. R. & Cahill, G. M. Diurnal and circadian retinomotor movements in zebrafish. Visual neuroscience 22 , 203-209, doi:10.1017/s0952523805222083 (2005). Neuhauss, S. C. et al. Genetic disorders of vision revealed by a behavioral screen of 400 essential loci in zebrafish. J Neurosci 19 , 8603-8615, doi:10.1523/jneurosci.19-19-08603.1999 (1999). Santhanam, A., Shihabeddin, E., Wei, H., Wu, J. & O'Brien, J. Molecular basis of retinal remodeling in a zebrafish model of retinitis pigmentosa. Cell Mol Life Sci 80 , 362, doi:10.1007/s00018-023-05021-1 (2023). Molday, R. S. ATP-binding cassette transporter ABCA4: molecular properties and role in vision and macular degeneration. J Bioenerg Biomembr 39 , 507-517, doi:10.1007/s10863-007-9118-6 (2007). Wu, L., Nagasaki, T. & Sparrow, J. R. Photoreceptor cell degeneration in Abcr (-/-) mice. Adv Exp Med Biol 664 , 533-539, doi:10.1007/978-1-4419-1399-9_61 (2010). Conley, S. M. et al. Increased cone sensitivity to ABCA4 deficiency provides insight into macular vision loss in Stargardt's dystrophy. Biochim Biophys Acta 1822 , 1169-1179, doi:10.1016/j.bbadis.2011.10.007 (2012). Hanovice, N. J. et al. Regeneration of the zebrafish retinal pigment epithelium after widespread genetic ablation. PLoS Genet 15 , e1007939, doi:10.1371/journal.pgen.1007939 (2019). Bernardos, R. L., Barthel, L. K., Meyers, J. R. & Raymond, P. A. Late-stage neuronal progenitors in the retina are radial Müller glia that function as retinal stem cells. J Neurosci 27 , 7028-7040, doi:10.1523/jneurosci.1624-07.2007 (2007). Raymond, P. A. & Rivlin, P. K. Germinal cells in the goldfish retina that produce rod photoreceptors. Dev Biol 122 , 120-138, doi:10.1016/0012-1606(87)90338-1 (1987). Meyer, R. L. Evidence from thymidine labeling for continuing growth of retina and tectum in juvenile goldfish. Experimental neurology 59 , 99-111, doi:10.1016/0014-4886(78)90204-2 (1978). Otteson, D. C., D'Costa, A. R. & Hitchcock, P. F. Putative stem cells and the lineage of rod photoreceptors in the mature retina of the goldfish. Dev Biol 232 , 62-76, doi:10.1006/dbio.2001.0163 (2001). Montgomery, J. E., Parsons, M. J. & Hyde, D. R. A novel model of retinal ablation demonstrates that the extent of rod cell death regulates the origin of the regenerated zebrafish rod photoreceptors. J Comp Neurol 518 , 800-814, doi:10.1002/cne.22243 (2010). Wu, D. M. et al. Cones regenerate from retinal stem cells sequestered in the inner nuclear layer of adult goldfish retina. Invest Ophthalmol Vis Sci 42 , 2115-2124 (2001). Song, P., Fogerty, J., Cianciolo, L. T., Stupay, R. & Perkins, B. D. Cone Photoreceptor Degeneration and Neuroinflammation in the Zebrafish Bardet-Biedl Syndrome 2 (bbs2) Mutant Does Not Lead to Retinal Regeneration. Front Cell Dev Biol 8 , 578528, doi:10.3389/fcell.2020.578528 (2020). Braisted, J. E., Essman, T. F. & Raymond, P. A. Selective regeneration of photoreceptors in goldfish retina. Development 120 , 2409-2419, doi:10.1242/dev.120.9.2409 (1994). Morris, A. C., Scholz, T. L., Brockerhoff, S. E. & Fadool, J. M. Genetic dissection reveals two separate pathways for rod and cone regeneration in the teleost retina. Developmental neurobiology 68 , 605-619, doi:10.1002/dneu.20610 (2008). Fraser, B., DuVal, M. G., Wang, H. & Allison, W. T. Regeneration of cone photoreceptors when cell ablation is primarily restricted to a particular cone subtype. PLoS One 8 , e55410, doi:10.1371/journal.pone.0055410 (2013). Hagerman, G. F. et al. Rapid Recovery of Visual Function Associated with Blue Cone Ablation in Zebrafish. PLoS One 11 , e0166932, doi:10.1371/journal.pone.0166932 (2016). D'Orazi, F. D., Suzuki, S. C., Darling, N., Wong, R. O. & Yoshimatsu, T. Conditional and biased regeneration of cone photoreceptor types in the zebrafish retina. J Comp Neurol 528 , 2816-2830, doi:10.1002/cne.24933 (2020). Yoshimatsu, T., Schröder, C., Nevala, N. E., Berens, P. & Baden, T. Fovea-like Photoreceptor Specializations Underlie Single UV Cone Driven Prey-Capture Behavior in Zebrafish. Neuron 107 , 320-337.e326, doi:10.1016/j.neuron.2020.04.021 (2020). Zhou, M. et al. Zebrafish Retinal Ganglion Cells Asymmetrically Encode Spectral and Temporal Information across Visual Space. Curr Biol 30 , 2927-2942.e2927, doi:10.1016/j.cub.2020.05.055 (2020). Haug, M. F., Biehlmaier, O., Mueller, K. P. & Neuhauss, S. C. Visual acuity in larval zebrafish: behavior and histology. Frontiers in zoology 7 , 8, doi:10.1186/1742-9994-7-8 (2010). Additional Declarations No competing interests reported. Supplementary Files SupplementaryFiles17thAugust2025.pdf Cite Share Download PDF Status: Published Journal Publication published 21 Nov, 2025 Read the published version in Scientific Reports → Version 1 posted Editorial decision: Revision requested 06 Oct, 2025 Reviews received at journal 01 Oct, 2025 Reviewers agreed at journal 27 Sep, 2025 Reviews received at journal 16 Sep, 2025 Reviewers agreed at journal 06 Sep, 2025 Reviewers invited by journal 19 Aug, 2025 Editor assigned by journal 19 Aug, 2025 Editor invited by journal 19 Aug, 2025 Submission checks completed at journal 18 Aug, 2025 First submitted to journal 18 Aug, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7346082","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":505348208,"identity":"883d2d17-4dc9-4e57-b406-c763ab1840ee","order_by":0,"name":"Divya Pidishetty","email":"","orcid":"","institution":"L V Prasad Eye Institute","correspondingAuthor":false,"prefix":"","firstName":"Divya","middleName":"","lastName":"Pidishetty","suffix":""},{"id":505348210,"identity":"52eaf26b-458a-40c1-8c6e-0a0d73f140b4","order_by":1,"name":"Santhosh Kumar Damera","email":"","orcid":"","institution":"L V Prasad Eye Institute","correspondingAuthor":false,"prefix":"","firstName":"Santhosh","middleName":"Kumar","lastName":"Damera","suffix":""},{"id":505348212,"identity":"c13d5564-1789-4843-9241-5f6ebd7aca5f","order_by":2,"name":"Murali Murugavel","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Murali","middleName":"","lastName":"Murugavel","suffix":""},{"id":505348214,"identity":"bb7db2ba-b2b2-4e0d-8e4b-81a0039d380e","order_by":3,"name":"Praveen Joseph Susaimanickam","email":"","orcid":"","institution":"L V Prasad Eye Institute","correspondingAuthor":false,"prefix":"","firstName":"Praveen","middleName":"Joseph","lastName":"Susaimanickam","suffix":""},{"id":505348220,"identity":"05ea265a-4448-4bbd-bbce-2831cb6719cf","order_by":4,"name":"Sai Naga Sri Harsha Chittajallu","email":"","orcid":"","institution":"L V Prasad Eye Institute","correspondingAuthor":false,"prefix":"","firstName":"Sai","middleName":"Naga Sri Harsha","lastName":"Chittajallu","suffix":""},{"id":505348222,"identity":"80ac7b84-ec62-4888-9eed-1ba42574b598","order_by":5,"name":"Gopal Kushawah","email":"","orcid":"","institution":"Centre for Cellular and Molecular Biology","correspondingAuthor":false,"prefix":"","firstName":"Gopal","middleName":"","lastName":"Kushawah","suffix":""},{"id":505348223,"identity":"e3ff6abc-8f9d-4162-a68a-99ef15d01d20","order_by":6,"name":"Puja Sarkar","email":"","orcid":"","institution":"L V Prasad Eye Institute","correspondingAuthor":false,"prefix":"","firstName":"Puja","middleName":"","lastName":"Sarkar","suffix":""},{"id":505348226,"identity":"756e761d-466f-4732-bcb8-5b28bb401717","order_by":7,"name":"Shrikant Bharadwaj","email":"","orcid":"","institution":"L V Prasad Eye Institute","correspondingAuthor":false,"prefix":"","firstName":"Shrikant","middleName":"","lastName":"Bharadwaj","suffix":""},{"id":505348227,"identity":"7d924159-9f58-4e62-b0bf-eaa152ec3e2c","order_by":8,"name":"Rakesh Mishra","email":"","orcid":"","institution":"Centre for Cellular and Molecular Biology","correspondingAuthor":false,"prefix":"","firstName":"Rakesh","middleName":"","lastName":"Mishra","suffix":""},{"id":505348228,"identity":"ae71ee59-14ac-4c97-aa90-1c99999bca21","order_by":9,"name":"Indumathi Mariappan","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA2klEQVRIiWNgGAWjYBACNgYGAxCdwMbe3ACkJYjWYpDAxnOQSC0MMC0MEokNxDmMT7p5m9SNmj95fJIP26QLKiwY+KWPX8DvMJljZdI5xwyK2aQT26RnnJFgkOzLKcCvRSLHTDqHzQCoPrHZmLdNgsHgDE8CEVr+AbVIHgRq+Uesltw2oBYJxsbHvA0gLewHCGhJK7bO7TNObONJbHw845gEj2QPD14dDPIzkjfezvkmlzi//fCBwwU1dXL8POwP8OtBBsxADLSCx4A0LUBAii2jYBSMglEwEgAApZA8xPBKbbAAAAAASUVORK5CYII=","orcid":"","institution":"L V Prasad Eye Institute","correspondingAuthor":true,"prefix":"","firstName":"Indumathi","middleName":"","lastName":"Mariappan","suffix":""}],"badges":[],"createdAt":"2025-08-11 11:53:36","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7346082/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7346082/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1038/s41598-025-28951-1","type":"published","date":"2025-11-21T15:58:02+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":90016837,"identity":"8aabab57-6130-4970-a43b-b9c2e34137f5","added_by":"auto","created_at":"2025-08-27 12:07:47","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":647805,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003e\u003cstrong\u003eGeneration of abca4b\u003c/strong\u003e\u003c/em\u003e\u003csup\u003e\u003cem\u003e-/-\u003c/em\u003e\u003c/sup\u003e\u003cem\u003e\u003cstrong\u003e zebrafish model. A. \u003c/strong\u003e\u003c/em\u003e\u003cem\u003eAn illustration showing the gRNAs target sites within the exon 2 of abca4b. \u003c/em\u003e\u003cem\u003e\u003cstrong\u003eB.\u003c/strong\u003e\u003c/em\u003e\u003cem\u003e Genomic DNA sequence of abca4b target loci displaying PCR primer, gRNA target sequences and protospacer adjacent motif (PAM). \u003c/em\u003e\u003cem\u003e\u003cstrong\u003eC\u003c/strong\u003e\u003c/em\u003e\u003cem\u003e. Agarose gel image showing the invitro cleavage assay products of three abca4b targeting gRNAs (g1, g2 and g3) (red arrowheads), uncleaved target DNA (yellow arrowhead). Note the complete cleavage of target DNA by g2 (yellow asterisk) \u003c/em\u003e\u003cem\u003e\u003cstrong\u003eD. \u003c/strong\u003e\u003c/em\u003e\u003cem\u003eSchematic representation of embryo microinjection and screening process for the identification of founder mutants. \u003c/em\u003e\u003cem\u003e\u003cstrong\u003eE.\u003c/strong\u003e\u003c/em\u003e\u003cem\u003e Chromatogram of reverse primer sequences of the wildtype (i), founder animals 1 and 2 (ii-iii), displaying overlapping and noisy peaks beyond the gRNA-specific edit region in founder animals. \u003c/em\u003e\u003cem\u003e\u003cstrong\u003eF.\u003c/strong\u003e\u003c/em\u003e\u003cem\u003e DNA sequences displaying the spectrum of mutations seen in the two founder animals with 13 bp deletion, 2 bp insertion, 54 bp deletion in Founder 1 (i).\u003c/em\u003e\u003cem\u003e\u003cstrong\u003e \u003c/strong\u003e\u003c/em\u003e\u003cem\u003e11 bp and 3 bp deletion in Founder 2 (ii). \u003c/em\u003e\u003cem\u003e\u003cstrong\u003eG. \u003c/strong\u003e\u003c/em\u003e\u003cem\u003eChromatogram of abca4b\u003c/em\u003e\u003csup\u003e\u003cem\u003e-/-\u003c/em\u003e\u003c/sup\u003e\u003cem\u003e mutant showing the insertion of 2 bp immediately after the ATG start codon leading to a frameshift downstream.\u0026nbsp;\u003c/em\u003e\u003c/p\u003e","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-7346082/v1/aaf60da29d1d490041b32a62.png"},{"id":90016833,"identity":"0daba536-3e34-4ad8-962c-b496958e75f6","added_by":"auto","created_at":"2025-08-27 12:07:47","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":1041930,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003e\u003cstrong\u003eHyperpigmentation and outer retinal changes in abca4b mutant retinas. A. \u003c/strong\u003e\u003c/em\u003e\u003cem\u003eH\u0026amp;E-stained full thickness retinal sections of\u003c/em\u003e\u003cem\u003e\u003cstrong\u003e \u003c/strong\u003e\u003c/em\u003e\u003cem\u003e24M old adult zebrafish.\u003c/em\u003e\u003cem\u003e\u003cstrong\u003e \u003c/strong\u003e\u003c/em\u003e\u003cem\u003eLight-adapted wildtype zebrafish retina highlighting the apically migrated RPE melanosomes and the pigment free basal zone (white asterisk) (i). Light-adapted mutant retina displaying dispersed pigmentation throughout the RPE cells (yellow asterisk) (ii). Scale bar: 50µm.\u003c/em\u003e\u003cem\u003e\u003cstrong\u003e \u003c/strong\u003e\u003c/em\u003e\u003cem\u003eZoomed views of the insets are shown in panel p and q. Scale bar: 10µm.\u003c/em\u003e\u003cem\u003e\u003cstrong\u003e \u003c/strong\u003e\u003c/em\u003e\u003cem\u003e\u0026nbsp;Dark-adapted wt retinas showing the apical microvilli projections of RPE (white arrowheads) (iii). Dark-adapted mutant retina displaying the loss of apical microvilli projections in RPE (yellow arrowheads) (iv). Scale bar: 50µm.\u003c/em\u003e\u003cem\u003e\u003cstrong\u003e \u003c/strong\u003e\u003c/em\u003e\u003cem\u003eZoomed views of the insets are shown in panel r and s. Scale bar: 10µm.\u003c/em\u003e\u003cem\u003e\u003cstrong\u003e B.\u003c/strong\u003e\u003c/em\u003e\u003cem\u003e Morphometric measurements of different photoreceptor cell layers using\u003c/em\u003e\u003cem\u003e\u003cstrong\u003e \u003c/strong\u003e\u003c/em\u003e\u003cem\u003eH\u0026amp;E-stained full thickness sections of\u003c/em\u003e\u003cem\u003e\u003cstrong\u003e \u003c/strong\u003e\u003c/em\u003e\u003cem\u003elight-adapted wildtype retina (i) and mutant retina (ii). Scale bar: 20µm. \u003c/em\u003e\u003cem\u003e\u003cstrong\u003eC.\u003c/strong\u003e\u003c/em\u003e\u003cem\u003e Violin plots of morphometric data of multiple retinal sections (n=5) of different animals (N=4) for the RPE pigment free zone (i); Cone and rod photoreceptor inner and outer segments (ii, iii); Rod nuclear layer of the wild type and mutant retinas (iv) (**** p\u0026lt;0.0001).\u003c/em\u003e\u003c/p\u003e","description":"","filename":"floatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-7346082/v1/3547e8b8888ec745b7a9898f.png"},{"id":90016448,"identity":"fc82ab34-57fa-4daf-b81b-c5208f070bf8","added_by":"auto","created_at":"2025-08-27 11:59:46","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":1161388,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003e\u003cstrong\u003eOuter retinal layer and photoreceptor outer segment morphology in abca4b\u003c/strong\u003e\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u003cstrong\u003e-/-\u003c/strong\u003e\u003c/em\u003e\u003c/sup\u003e\u003cem\u003e\u003cstrong\u003e retinas. A. \u003c/strong\u003e\u003c/em\u003e\u003cem\u003eConfocal images of retinal sections of 3M old wt zebrafish stained with FITC-PNA and DAPI to label all photoreceptor outer segments (green) and cell nuclei (blue) (i). Magenta arrowhead indicates the ROS; red square brackets indicate the LWS/MWS-COS (magenta and red dotted lines); yellow arrowhead indicates the SWS-COS (yellow dotted lines); white arrowhead indicates the UVS-COS (white dotted lines). Note the UVS cone nuclei located within the RNL (white asterisk). The phase contrast and DAPI merged image displays the distinct RNL and CNL, separated by the outer limiting membrane (OLM, dashed line), with the pigmented RPE layer at the distal end (ii). Zoomed view of DAPI stained ONL highlighting the inverted triangle shaped UV cone nuclei, with granular chromatin (white asterisk) that are distinct from the circular rod nuclei with uniform chromatin organization within the RNL. The elongated nuclei with granular chromatin of other three cone subtypes (SWS, LWS and MWS cones) are positioned outside the OLM (dashed line) Scale bar: 20 µm (iii).\u003c/em\u003e\u003cem\u003e\u003cstrong\u003e B. \u003c/strong\u003e\u003c/em\u003e\u003cem\u003eCross-sectional view of FITC-PNA-stained\u003c/em\u003e\u003cem\u003e\u003cstrong\u003e \u003c/strong\u003e\u003c/em\u003e\u003cem\u003eretinal sections displaying all POS (green) in 3M, 6M, 12M old wt and mutant zebrafish (i-vi); Zoomed view of the wt retinal sections displaying well-formed and spatially organized COS at 3M (vii), 6M (viii), 12M (ix). Zoomed view of the mutant retinal sections at 3M with shortened COS (x); at 6M with complete loss of UVS-COS (white arrowhead), SWS-COS (yellow arrowhead) and residual LWS/MWS-COS (red arrowhead) (xi); and at 12M showing total degeneration of all COS and most ROS (xii). Scale bar: 20 µm, N=3.\u003c/em\u003e\u003cem\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/em\u003e\u003c/p\u003e","description":"","filename":"floatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-7346082/v1/9d76cd5cd0727fc87c87aa74.png"},{"id":90016450,"identity":"3f737b7e-da95-4cb4-ad28-192cad363fe9","added_by":"auto","created_at":"2025-08-27 11:59:46","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":1024717,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003e\u003cstrong\u003eGradual degeneration of cone-OS in abca4b\u003c/strong\u003e\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u003cstrong\u003e-/-\u003c/strong\u003e\u003c/em\u003e\u003c/sup\u003e\u003cem\u003e\u003cstrong\u003e retinas.\u003c/strong\u003e\u003c/em\u003e\u003cem\u003e \u003c/em\u003e\u003cem\u003e\u003cstrong\u003eA. \u003c/strong\u003e\u003c/em\u003e\u003cem\u003eConfocal images of immunostained retinal sections of 3M old Wt (i-iii) and mutant (v-vii) retinas showed LWS opsins (in magenta) and MWS opsins (in green) expression in their outer segments. Scale bar: 20µm. The zoomed view of insets are displayed in p, q. Scale bar: 5 µm. DAPI counterstained images of wt depicted the inverted triangular shaped UVS cone nuclei and the elongated nuclei of all remaining cones (dashed line) (iv). Mutant retinal sections displayed early changes in nuclear morphology at 3M (viii). Scale bar: 20µm. The zoomed view of insets are displayed in a, b. Scale bar: 5 µm. \u003c/em\u003e\u003cem\u003e\u003cstrong\u003eB. \u003c/strong\u003e\u003c/em\u003e\u003cem\u003eConfocal images of immunostained retinal sections of 12M old wt (i-iii) and mutant retinas (v-vii) which showed disorderly arranged OS, with significant degeneration. Scale bar: 20µm. The zoomed view of insets are displayed in r, s. Scale bar: 5 µm. DAPI counterstained images of wt (iv) and mutant retinal sections (viii) which displayed shortened and rounded morphology (viii). Scale bar: 20µm. The zoomed view of insets are displayed in c, d. Scale bar: 5 µm.\u003c/em\u003e\u003cem\u003e\u003cstrong\u003e C. \u003c/strong\u003e\u003c/em\u003e\u003cem\u003eConfocal images of retinal sections immunostained with RPE65 antibody which labelled all COS in wt (i) and mutants (ii), which showed degeneration of LWS/MWS-OS (red arrowhead) and SWS-OS (yellow arrowhead) and a complete loss of UVS-COS (white arrowhead). Scale bar: 20µm. \u003c/em\u003e\u003cem\u003e\u003cstrong\u003eD. \u003c/strong\u003e\u003c/em\u003e\u003cem\u003eConfocal images of wt retinal sections that display cone arrestin expression in the cell bodies and inner segments of all double cones (in brown) at 6M (i) and 12M (ii). Note the reduction in PR cell layer thickness (yellow square brackets), increased RPE pigmentation (yellow asterisks), disintegration of cone inner segments (white asterisks) and changes in LWS/MWS cone cell morphology in mutant retinas at 6M (iii) and 12M (iv). Scale bar: 20µm. \u003c/em\u003e\u003cem\u003e\u003cstrong\u003eE. \u003c/strong\u003e\u003c/em\u003e\u003cem\u003eConfocal images of immunostained sections of 12M retinas that display orderly arranged doublets of LWS/MWS-COS, that are proximally positioned close to OLM in wt (i); and the loss of MWS-COS and randomly displaced residual LWS-COS (white arrowheads) that are buried within RPE layer in mutants (ii). Scale bar: 10µm, N=3.\u003c/em\u003e\u003c/p\u003e","description":"","filename":"floatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-7346082/v1/686a5f3e20d2ac9fc02ba181.png"},{"id":90016829,"identity":"26e5271b-cf3f-4246-b284-5f614cd20744","added_by":"auto","created_at":"2025-08-27 12:07:46","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":849585,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003e\u003cstrong\u003eRod degeneration in 12M abca4b\u003c/strong\u003e\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u003cstrong\u003e-/-\u003c/strong\u003e\u003c/em\u003e\u003c/sup\u003e\u003cem\u003e\u003cstrong\u003e mutant retina. A. \u003c/strong\u003e\u003c/em\u003e\u003cem\u003eConfocal images of\u003c/em\u003e\u003cem\u003e\u003cstrong\u003e \u003c/strong\u003e\u003c/em\u003e\u003cem\u003ePNA-stained dark-adapted\u003c/em\u003e\u003cem\u003e\u003cstrong\u003e \u003c/strong\u003e\u003c/em\u003e\u003cem\u003eretina of wt display well-formed POS in green (i) and the mutant retina display a significant loss of ROS, along with shortened and distorted COS morphology (red arrowhead) (ii). Scale bar: 20 μm. \u003c/em\u003e\u003cem\u003e\u003cstrong\u003eB.\u003c/strong\u003e\u003c/em\u003e\u003cem\u003e Confocal images of\u003c/em\u003e\u003cem\u003e\u003cstrong\u003e \u003c/strong\u003e\u003c/em\u003e\u003cem\u003eretinal sections stained with R-G opsin antibody highlighting all cone and rod POS (magenta) in wt (i) and the mutant retina display reduced ROS lengths (white arrowheads) (ii). Zoomed view of insets in wt (p) and mutant (q) photoreceptor layer displaying a drastic reduction in ROS thickness. Scale bar: 20 μm. Zoomed view of the cylindrical ROS in wt (r) and the atypical, bulged structures with hollow lumen in mutant ROS (white arrow) (s). Scale bar: 10 μm, N=3.\u003c/em\u003e\u003c/p\u003e","description":"","filename":"floatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-7346082/v1/128fa3b94f5d3db1d3301b36.png"},{"id":90016453,"identity":"afcd035c-9953-4f83-a67e-4c2340e9115f","added_by":"auto","created_at":"2025-08-27 11:59:46","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":882146,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003e\u003cstrong\u003eLipofuscin autofluorescence and lipid peroxides in abca4b\u003c/strong\u003e\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u003cstrong\u003e-/-\u003c/strong\u003e\u003c/em\u003e\u003c/sup\u003e\u003cem\u003e\u003cstrong\u003emutants.\u003c/strong\u003e\u003c/em\u003e\u003cem\u003e \u003c/em\u003e\u003cem\u003e\u003cstrong\u003eA. \u003c/strong\u003e\u003c/em\u003e\u003cem\u003eUnstained retinal sections of 12M adult fishes to identify autofluorescent lipofuscin deposits (488 nm excitation, 500-700 nm emission). Note the presence of a few deposits in wt (i), while the mutants display a significant increase in autofluorescent deposits (green) in the choroid and RPE layers (iii).\u0026nbsp; The merged view of phase contrast and fluorescence images display the choroid and RPE layer boundaries (ii, iv).\u0026nbsp; Scale bar: 20µm. Zoomed view of insets in wt retina (p) and mutant retina (q) displaying\u003c/em\u003e\u003cem\u003e\u003cstrong\u003e \u003c/strong\u003e\u003c/em\u003e\u003cem\u003eautofluorescent deposits (green spots) within the choroid and RPE layers.\u003c/em\u003e\u003cem\u003e\u003cstrong\u003e \u003c/strong\u003e\u003c/em\u003e\u003cem\u003eScale bar: 10µm.\u003c/em\u003e\u003cem\u003e\u003cstrong\u003e B.\u003c/strong\u003e\u003c/em\u003e\u003cem\u003e Bodipy-stained retinal sections of 12M adult fishes to label the peroxidised lipid deposits (561 nm excitation, 580-660 nm emission). Note the presence of a few deposits in wt (i), while the mutants display a significant increase in lipid peroxide deposits (magenta) within the choroid, RPE and cone-rod outer segment layer (yellow, magenta, white, green arrowheads) (iii). The merged view of phase contrast and fluorescence images display the choroid and RPE layer boundaries (ii, iv).\u0026nbsp; Scale bar: 20µm. Zoomed view of insets in wt retina (r) and mutant retina (s) display\u003c/em\u003e\u003cem\u003e\u003cstrong\u003e \u003c/strong\u003e\u003c/em\u003e\u003cem\u003ethe bright lipid peroxide deposits (magenta spots), Scale bar: 10µm. N=3.\u003c/em\u003e\u003c/p\u003e","description":"","filename":"floatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-7346082/v1/e67f14d3377a850bc1ae76e0.png"},{"id":90016463,"identity":"aaca1e28-c643-402d-a488-ef5a020c7cf4","added_by":"auto","created_at":"2025-08-27 11:59:46","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":589822,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003e\u003cstrong\u003ePremature depletion of PCNA\u003c/strong\u003e\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/em\u003e\u003c/sup\u003e\u003cem\u003e\u003cstrong\u003e cells and activation of retinal progenitor-specific gene expression in mutant adult retinas.\u003c/strong\u003e\u003c/em\u003e\u003cem\u003e \u003c/em\u003e\u003cem\u003e\u003cstrong\u003eA. \u003c/strong\u003e\u003c/em\u003e\u003cem\u003eConfocal images of adult retinal sections showing \u003c/em\u003epcna\u003csup\u003e\u003cem\u003e+\u003c/em\u003e\u003c/sup\u003e\u003cem\u003e proliferating RSCs (green) at the CMZ of 3M (i), 6M (ii) and 12M (iii) old retinas of wt fishes. Note the gradual decline in the numbers of \u003c/em\u003epcna\u003csup\u003e\u003cem\u003e+\u003c/em\u003e\u003c/sup\u003e\u003cem\u003e cells with age and a significant reduction in mutants as compared to wt tissues at 3M (iv) and 6M (v) and were undetectable in 12M mutant retina (vi). Scale bar: 10µm. \u003c/em\u003e\u003cem\u003e\u003cstrong\u003eB. \u003c/strong\u003e\u003c/em\u003e\u003cem\u003eConfocal image of the central retinal section of 6M old animals displaying the presence of scattered \u003c/em\u003epcna\u003csup\u003e\u003cem\u003e+\u003c/em\u003e\u003c/sup\u003e\u003cem\u003e cells (green) in wt (i), which are likely to be Muller-derived rod progenitors. The age-matched mutant retinas display rare \u003c/em\u003epcna\u003csup\u003e\u003cem\u003e+\u003c/em\u003e\u003c/sup\u003e\u003cem\u003e cells (green) in the entire RNL (white arrowheads). Scale bar: 20µm, N=3. \u003c/em\u003e\u003cem\u003e\u003cstrong\u003eC. \u003c/strong\u003e\u003c/em\u003e\u003cem\u003eAgarose gel images of RT-PCR products of various retinal transcripts expressed at 12, 24, 48, 72 hpf, 7D, 15D and 12M of wt and mutant retinas.\u003c/em\u003e\u003cem\u003e\u003cstrong\u003e \u003c/strong\u003e\u003c/em\u003e\u003cem\u003eThe\u003c/em\u003e\u003cem\u003e\u003cstrong\u003e \u003c/strong\u003e\u003c/em\u003e\u003cem\u003eabca4b expression are detected from 72 hpf in wt, but delayed and detectable at lower levels from 7 dpf in mutants (i). RT-PCR profiles of early progenitor (pax6, chx10) and photoreceptor precursor (crx) specific transcripts in wt and mutant retinas. Note the comparable expression at early larval developmental stages (till 7 dpf) and an upregulated expression levels in mutant retinas during adulthood (12M) (red box) (ii). The cDNA samples at different developmental stages were normalized using gapdh, the housekeeping gene control (iii).\u0026nbsp; N=4.\u003c/em\u003e\u003c/p\u003e","description":"","filename":"floatimage7.png","url":"https://assets-eu.researchsquare.com/files/rs-7346082/v1/6ead2e9a8cf61d2aca66fb05.png"},{"id":90017586,"identity":"8a2a8b5d-4e3e-4842-a221-2e0fd4fa870a","added_by":"auto","created_at":"2025-08-27 12:15:47","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":917821,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003e\u003cstrong\u003eRetention of Müller-driven regenerative ability in abca4b\u003c/strong\u003e\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u003cstrong\u003e-/-\u003c/strong\u003e\u003c/em\u003e\u003c/sup\u003e\u003cem\u003e\u003cstrong\u003e mutants. A. \u003c/strong\u003e\u003c/em\u003e\u003cem\u003eConfocal images of PCNA antibody labelled retinal sections of uninjured wt animals (i) and mutant animals (ii). Note the absence of \u003c/em\u003epcna\u003csup\u003e\u003cem\u003e+\u003c/em\u003e\u003c/sup\u003e\u003cem\u003e proliferating cells at the CMZ and in the ONL of central retina of both\u003c/em\u003e\u003cem\u003e\u003cstrong\u003e \u003c/strong\u003e\u003c/em\u003e\u003cem\u003ewt and mutant animals at 24M. \u003c/em\u003e\u003cem\u003e\u003cstrong\u003eB.\u003c/strong\u003e\u003c/em\u003e\u003cem\u003e Confocal images of PCNA antibody labelled sections of retina at 4 days post needle prick injury of wt animals (i) and mutant animals (ii). Note the significant increase in \u003c/em\u003epcna\u003csup\u003e\u003cem\u003e+\u003c/em\u003e\u003c/sup\u003e\u003cem\u003e proliferating cells (green) at the injury site (white arrowheads) across the entire retinal thickness both in wt and mutant animals. Scale bar: 50µm, N=5.\u003c/em\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"floatimage8.png","url":"https://assets-eu.researchsquare.com/files/rs-7346082/v1/ce24a3c376412acef04d8eab.png"},{"id":90016464,"identity":"d63f76a4-2bfb-459d-b664-4dbd0fb8ef7a","added_by":"auto","created_at":"2025-08-27 11:59:46","extension":"png","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":604997,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003e\u003cstrong\u003eVisual behavioural and functional defects in abca4b\u003c/strong\u003e\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u003cstrong\u003e-/-\u003c/strong\u003e\u003c/em\u003e\u003c/sup\u003e\u003cem\u003e\u003cstrong\u003e mutants. A. \u003c/strong\u003e\u003c/em\u003e\u003cem\u003eViolin plots showing the time taken to first detect and capture the dry feed pellets and live artemia larval feed by wt and mutant fishes in rectangular maze experiments (i-ii) and Y-maze experiments (iii-iv). Note that the mutants displayed significant delays in detecting the feed.\u003c/em\u003e\u003cem\u003e\u003cstrong\u003e B.\u003c/strong\u003e\u003c/em\u003e\u003cem\u003e Representative trajectory plots of dry feed and live artemia larval feed capture behaviour of wt fishes in rectangular maze (i-ii) and in Y-maze (iii-iv) and mutant fishes in rectangular maze (v-vi) and in Y-maze (vii-viii) experiments. Note the feed directed movements and hovering around the feed drop zone in wt fishes, when compared to the random mobility of mutants across the entire maze area. All experiments are repeated multiple times (n=4) on different animals (N=5) and all 20 data points are represented in violin plots. (****p\u0026lt;0.0001, **p\u0026lt;0.01). \u003c/em\u003e\u003cem\u003e\u003cstrong\u003eC. \u003c/strong\u003e\u003c/em\u003e\u003cem\u003eSequential images of\u003c/em\u003e\u003cem\u003e\u003cstrong\u003e \u003c/strong\u003e\u003c/em\u003e\u003cem\u003ethe eye movement of an adult wildtype fish, first towards the right (i), then to the left (ii) and then to the right (white arrows) (iii).\u003c/em\u003e\u003cem\u003e\u003cstrong\u003e D. \u003c/strong\u003e\u003c/em\u003e\u003cem\u003eViolin plots representing the number of synchronized saccadic eye movements evoked in the wildtype and mutant fishes over a period of 11 seconds (N=3) (*p\u0026lt;0.05).\u003c/em\u003e\u003c/p\u003e","description":"","filename":"floatimage9.png","url":"https://assets-eu.researchsquare.com/files/rs-7346082/v1/f52ead9163f62145c7d347f0.png"},{"id":96650342,"identity":"c5aa3a47-8f6a-4d0e-bac2-044675d5145f","added_by":"auto","created_at":"2025-11-24 16:11:19","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":9729657,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7346082/v1/3ccb7b36-2e37-4552-b7e2-1459192db572.pdf"},{"id":90016830,"identity":"e47cfa5b-7c68-4cb1-84f1-e0a46a8dd687","added_by":"auto","created_at":"2025-08-27 12:07:46","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"supplement","size":2801959,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryFiles17thAugust2025.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7346082/v1/c763ccd19c708a2451bd3058.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Loss of retinal stem cell reserve and lipofuscin accumulation accelerates cone-rod degeneration and replicates Stargardt disease in abca4b null zebrafish","fulltext":[{"header":"Introduction","content":"\u003cp\u003eRetinal dystrophies are a group of progressive genetic disorder resulting in gradual degeneration of rod and cone photoreceptor (PR) cells of the retina, causing symptoms such as night blindness, colour blindness, gradual vision loss, leading to a total vision impairment. The prevalence of Inherited Retinal Dystrophies (IRDs) is approximately 1 in 2000 and affects more than 2\u0026nbsp;million people worldwide \u003csup\u003e\u003cb\u003e\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u003c/b\u003e\u003c/sup\u003e. Mutations in over 300 genes involved in retinal development, phototransduction, visual cycle, primary cilium biogenesis, Vitamin A metabolism, phagocytosis, etc. are linked to IRDs as suggested at RetNet -Retinal Information Network (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://retnet.org/\u003c/span\u003e\u003cspan address=\"https://retnet.org/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eAmong the IRD genes, mutations in \u003cem\u003eABCA4\u003c/em\u003e cause a spectrum of retinal phenotypes termed as Stargardt disease (STGD1), with over 800 pathogenic variants reported so far \u003csup\u003e\u003cb\u003e\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u003c/b\u003e\u003c/sup\u003e. STGD1 is characterized by delayed dark-adaptation, progressive loss of central vision with pisciform flecks \u003csup\u003e\u003cb\u003e\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e\u003c/b\u003e\u003c/sup\u003e. ABCA4 is a member of the ATP-binding cassette (ABC) superfamily of transporters, and an integral transmembrane protein located in the rod and cone photoreceptor outer segment (POS) disc membranes. It functions as an inward flippase that transports the visual cycle intermediate, N-retinylidene-phosphoethanolamine (NR-PE), a covalent adduct of \u003cem\u003eall-trans\u003c/em\u003e retinal and phosphatidylethanolamine (PE) from the disc membranes into the cytoplasmic side of POS. The \u003cem\u003eall-trans retinal\u003c/em\u003e is then converted to \u003cem\u003eall-trans\u003c/em\u003e retinol by the cytosolic enzymes and gets transported to retinal pigmented epithelial (RPE) cells for its further conversion and recycling to form the visual pigment, 11-\u003cem\u003ecis\u003c/em\u003e retinal. Dysfunction of ABCA4 leads to the retention of toxic NR-PE in POS disc membranes, which are shed and phagocytosed by RPE cells, where they get accumulated as unmetabolized lipofuscin deposits, resulting in cytotoxicity, primary RPE atrophy and secondary PR loss \u003csup\u003e\u003cb\u003e\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e\u003c/b\u003e\u003c/sup\u003e. A previous study has also demonstrated the expression of \u003cem\u003eABCA4\u003c/em\u003e in mice RPE cell membranes \u003csup\u003e\u003cb\u003e\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e\u003c/b\u003e\u003c/sup\u003e. Human induced pluripotent stem cells (hiPSCs) based \u003cem\u003ein vitro\u003c/em\u003e knockout models of \u003cem\u003eABCA4\u003c/em\u003e have demonstrated defective phagocytosis of POS by RPE cells and impaired lipid metabolism as the causal mechanism for STGD1 pathogenesis \u003csup\u003e\u003cb\u003e\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u003c/b\u003e\u003c/sup\u003e.\u003c/p\u003e\u003cp\u003eAnimal models of STGD1, particularly the \u003cem\u003eAbca4\u003c/em\u003e null mice exhibit lipofuscin accumulation in RPE, progressive PR degeneration and delayed dark-adaptation \u003csup\u003e\u003cb\u003e\u003cspan additionalcitationids=\"CR7\" citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u003c/b\u003e\u003c/sup\u003e. However, rodents are nocturnal, having rod-dominant retina and lacks a functional macula. This limits their utility as disease models for studying cone PR-based human diseases such as Stargardt Macular Degeneration (SMD) \u003csup\u003e\u003cb\u003e\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e\u003c/b\u003e\u003c/sup\u003e. Large animal models such as canine, feline, porcine, and non-human primates with area centralis are more suitable to evaluate macular diseases \u003csup\u003e\u003cb\u003e\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e,\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e\u003c/b\u003e\u003c/sup\u003e. However, the high maintenance costs, slower reproduction cycles, and longer duration for disease progression have limited their broader utility.\u003c/p\u003e\u003cp\u003eZebrafish have now emerged as a valuable and cost-effective model for studying human retinal diseases due to their cone-enriched retina and macula-like \u0026lsquo;area temporalis\u0026rsquo; \u003csup\u003e\u003cb\u003e\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e\u003c/b\u003e\u003c/sup\u003e. Many studies have used morpholinos to create transient knockdown models of retinal diseases in zebrafish \u003csup\u003e\u003cb\u003e\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u003c/b\u003e\u003c/sup\u003e. However, their off-target effects and embryonic toxicity further confounds the precise interpretations of genotype-phenotype correlations.\u003c/p\u003e\u003cp\u003eHere, we report the generation and characterization of a stable \u003cem\u003eabca4b\u003c/em\u003e knockout zebrafish model using CRISPR/Cas9 editing, to investigate the early retinal changes and progressive degeneration phenotypes. Our model recapitulates the key features of STGD1, including lipofuscin accumulation in RPE cells, gradual retinal degeneration, starting with cone followed by rod cell loss and severe vision impairment. Importantly, we report an early depletion of ciliary marginal zone (CMZ) retinal stem cells (RSCs) and the retention of M\u0026uuml;ller glia-dependent injury repair response in \u003cem\u003eabca4b\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003ezebrafish. This highlights the inability of M\u0026uuml;ller-driven regenerative potential in preventing ongoing degeneration in mutant zebrafish retinas.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\u003ch2\u003eEthics Statement\u003c/h2\u003e\u003cp\u003e This study was reviewed and approved by the Institutional Animal Ethics Committee (IAEC Ref No. 04-22-001) and the Institutional Biosafety Committee (IBSC Ref No. 06-21-010) of LV Prasad Eye Institute, and all animal experiments were performed with care in compliance with CPCSEA and ARRIVE guidelines (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://arriveguidelines.org\u003c/span\u003e\u003cspan address=\"https://arriveguidelines.org\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e).\u003c/p\u003e\u003c/div\u003e\n\u003ch3\u003eZebrafish maintenance and breeding\u003c/h3\u003e\n\u003cp\u003e\u003cdiv class=\"BlockQuote\"\u003e\u003cp\u003eThe wildtype (Tubingen) TU-AB strain and \u003cem\u003eabca4b\u003c/em\u003e mutant zebrafish stocks were maintained at 26\u0026ndash;28\u0026deg;C with 14-hour light, 10-hour dark cycle and grown at a density of 5\u0026ndash;8 adult fish per litre of water. The experimental animals were euthanized after anesthetizing with 0.5% MS-222 (tricaine methanesulfonate; Sigma Aldrich A-5040) or by ice bath immersion for hypothermic shock and the tissues were excised for histology and molecular analysis.\u003c/p\u003e\u003c/div\u003e\u003c/p\u003e\n\u003ch3\u003eSynthesis of CRISPR/Cas9 gRNA\u003c/h3\u003e\n\u003cp\u003eThe guide RNAs (gRNAs) to target exon 2 of the zebrafish \u003cem\u003eabca4b\u003c/em\u003e (gene ID: 555506) were designed using CHOPCHOP (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://chopchop.cbu.uib.no/\u003c/span\u003e\u003cspan address=\"https://chopchop.cbu.uib.no/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003e)\u003c/span\u003e, with suitable BsaI site overhangs for oligo synthesis and cloning. The target sequences for sgRNAs are (gRNA1- GTTGATTGGTGGCCCCTGCG gRNA2- GATCTGACGGCCCGTGCTCA and gRNA3- GTCTGCTGCTCTGGAAGAAC). For cloning, 100 pmol of the sense and antisense oligos were mixed at equimolar ratios and denatured at 95\u0026deg;C for 5 min and allowed to cool gradually to enable oligo annealing. The annealed oligos with compatible overhangs were cloned into BsaI site of DR274 vector (Addgene plasmid #42250) and the positive clones were confirmed by Sanger sequencing. The guide RNA encoded plasmids were digested using HindIII (New England BioLabs), to cleave the vector downstream of the gRNA scaffold and the linearized DNA was purified and used as templates for \u003cem\u003ein vitro\u003c/em\u003e transcription using the Ambion\u0026trade; Maxiscript\u0026trade; T7 kit, as per the manufacturer\u0026rsquo;s instructions. The synthesized gRNAs were purified and quantified using NanoDrop\u0026trade; (Thermo Fisher Scientific).\u003c/p\u003e\u003cp\u003e\u003cb\u003eIn vitro\u003c/b\u003e \u003cb\u003ecleavage (IVC) assay\u003c/b\u003e\u003c/p\u003e\u003cp\u003eThe gRNA (50\u0026ndash;100 ng) and recombinant spCas9 protein (50 nM) were mixed and incubated at 25\u0026ordm; C for 10 minutes along with \u003cem\u003ein vitro\u003c/em\u003e cleavage assay buffer (20 mM Tris-Cl, pH 8.0, 200 mM KCl, 10 mM MgCl2), for the formation of the ribonucleoprotein (RNP) complex. The DNA substrate or the target region PCR amplicon (300 ng) was then added to the RNP complex and incubated at 37\u0026deg;C for 1 hour. Post incubation, 1 \u0026micro;L of 20 mg/mL RNase and 2 \u0026micro;L of 20 mg/mL of proteinase K were added and incubated at 37\u0026deg;C for 30 min, to digest and remove all gRNA and spCas9 protein. The cleaved DNA products in the reaction mix were then analysed on 2.5% agarose gels, to confirm the target specificity of gRNAs.\u003c/p\u003e\n\u003ch3\u003eMicroinjection of CRISPR-RNP mix into zebrafish embryos\u003c/h3\u003e\n\u003cp\u003eThe ribonucleoprotein (RNP) mix containing the gRNA (300 ng) and recombinant spCas9 protein (3 \u0026micro;g) along with 0.05% phenol red (for visual guidance) and 10 mM KCl was prepared in 10 \u0026micro;L volume and about 2\u0026ndash;3 nL volume was injected into single cell-staged fertilized embryo, into yolk sac or at the cell body and yolk sac interphase. The injections were done with the help of a glass microcapillary needle prepared using a vertical micropipette puller (P-30, Sutter Instrument, USA), fitted to a semi-automatic micromanipulator (InjectMan\u0026reg; 4, Eppendorf India) and a programmable microinjector with an external pressure supply (FemtoJet\u0026reg; 4x, Eppendorf India). The microinjections were done while visualizing the embryos under a stereo-zoom microscope (SZX10, Olympus Corporation, Japan), connected to a CCD camera (RETIGA R1, QImaging, UK) for live imaging and video recording. The injected embryos were then collected into a dish containing fish water and allowed to develop at 28\u0026deg;C inside a BOD incubator. After 24 hours, the dead and unfertilized eggs were removed, and the live embryos were allowed to develop to reach adulthood. The genetic screening for homozygous null mutants was done by genomic DNA isolation using the tail fins, and the target site edits were confirmed by PCR and Sanger sequencing. Immunohistochemistry was performed on both paraffin and OCT embedded sections of \u003cem\u003eabca4b\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e mutants. These methods are described in detail in \u003cb\u003eSupplementary Methodology.\u003c/b\u003e\u003c/p\u003e\n\u003ch3\u003eRetinal injury model of adult zebrafish\u003c/h3\u003e\n\u003cp\u003eThe adult animals were transiently anaesthetized using 0.02% MS-222 solution until a noticeable reduction in gill movement was observed. The anesthetized fish were placed on a paper towel with the right side facing upward and observed under a stereo-zoom microscope. The dorsal side of the eyeball was gently tilted using forceps and a 30-gauge needle was used to make a single pass prick injury at the ventral edge of the right eye. The fish were revived in fish water tank and allowed to recover and repair the damaged tissue. The test animals were euthanized after 4 days and the heads with intact eyeballs were excised, fixed and processed for histology by cryosectioning.\u003c/p\u003e\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\u003ch2\u003eFeed capture response paradigm\u003c/h2\u003e\u003cp\u003eA rectangular maze (30\u0026times;10\u0026times;10 cm; L\u0026times;W\u0026times;H) or Y-maze with three arms (25\u0026times;10\u0026times;10 cm; L\u0026times;W\u0026times;H for each arm) was placed on top of a stage, lit from the base by a white LED light source with an intensity regulator to avoid reflections interfering with image/video capture. The videos were recorded using a camera (Logitech C920 HD 1080p, 30 fps), mounted on a stand, right above the tank and positioned at an optimal height to cover the entire area of the maze. For feed capture response assessments, an individual fish was first restrained by a glass divider at the start point. For rectangular maze recordings, the feed was added at the distal end and for Y-maze recordings, the feed was added at the distal end of either the left or the right arm at random. The feed capture response and directional movements served as an indirect measure of visual behaviour of age-matched zebrafish (wildtype or mutants, N\u0026thinsp;=\u0026thinsp;5, n\u0026thinsp;=\u0026thinsp;4). The tanks were thoroughly cleaned, and fresh water was added for repeat recordings. The fish movements were recorded by the camera (mp4 encoding) at 30 fps with uniform illumination. The videos were uncompressed, cropped along the edges of the tank and converted to grayscale format via custom MATLAB R2017a (Mathworks, Natick, MA) scripts employing calls to the ffmpeg library (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://ffmpeg.org/\u003c/span\u003e\u003cspan address=\"https://ffmpeg.org/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e ). Fully automated threshold-based tracking of the individual fish was done using python and bash shell scripts (Ubuntu 20.04 LTS, Python 3.7, Open CV, \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/srep12678\u003c/span\u003e\u003cspan address=\"10.1038/srep12678\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e ). The Cartesian pixel coordinates of the centroid of the tracked fish in each individual frame were then mapped to physical dimensions of the tank via simple linear mapping. In combination with the fixed time interval between each uncompressed video frame (1/30 seconds) and an investigator marking key event frames, these centroid locations were used to quantify preselected variables of interest such as time taken to detect the feed for the first time, time spent in the arm containing the feed, directed movement towards the arm containing the feed and the total distance travelled in each arm.\u003c/p\u003e\u003c/div\u003e\n\u003ch3\u003eOptokinetic response (OKR) assessment\u003c/h3\u003e\n\u003cp\u003eOKR is a useful measure of spatial visual sensitivity of larval and adult zebrafish. To generate these OKR, in this study a PMMA drum of 8 cm diameter was custom-designed and fitted on top of the illuminated stage of a stereo-zoom microscope (SZX10, Olympus Corporation, Japan). A sinewave grating with 0.3 cycles/degree (cpd) spatial frequency and 100% luminance contrast was printed and pasted onto the inner surface of the drum. The rotational speed of the drum was regulated by an external motor, with a speed regulator and digital display to enable variable speed range settings between 1\u0026ndash;22 rpm. A control switch enabled either clockwise or anti-clockwise rotation of the drum, to assess visual responses to changes in the direction of moving targets. The drum rotation at operating speed ranges between 1\u0026ndash;22 rpm is calibrated using a contact-type digital tachometer (\u0026lrm;HTM 590, Syscon Electro Tech India Pvt Ltd). To record the eye movements, a slit was created within a wet soft sponge and a 12-months-old adult zebrafish was immobilized and held gently in between, with its head and gills projecting outside. This setup was then immersed in a 35 mm petri dish containing fish water, to keep the animals alive. For larval recordings, 10 dpf larvae were immobilized in carboxymethylcellulose sodium eye drops (Allergan) or in 1.5% low melting agarose in a dish. The dish was then placed on the microscope stage, at the centre of the OKR drum, to enable live recording of visual responses and resulting OKR. The microscope was connected to a CCD camera (RETIGA R1, Q Imaging, UK) that recorded live videos at 30 fps at a full resolution of 1360 x 1024 pixels.\u003c/p\u003e\u003cp\u003eFor eliciting the OKR, the drum containing the sine wave grating was rotated at 12 rpm (for adults) and at 5 rpm (for larvae) in the clockwise direction. The eye movement responses elicited by the fish was recorded for 11 seconds, using the Ocular software interface of the microscope. This procedure was repeated for adult fish and larvae (N\u0026thinsp;=\u0026thinsp;10) to assess for reproducibility of OKR behaviour. The videos were then manually analysed for the fast-phase OKR in both wildtype and mutant fish. The videos were analysed and the number of fast-phases were counted manually by two independent observers who were naive to the study objectives and are masked about the test fish cohort, to ensure unbiased assessments. The authors recognize the availability of open-source software for quantifying the OKR responses (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.mathworks.com/help/matlab/ref/videoreader.html\u003c/span\u003e\u003cspan address=\"https://www.mathworks.com/help/matlab/ref/videoreader.html\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). However, these are optimized only for the larvae and not for adult fish and thus not used for quantifying the OKR behaviour in the present study.\u003c/p\u003e\n\u003ch3\u003eStatistics\u003c/h3\u003e\n\u003cp\u003eAll test values were reported as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation and the values were plotted using GraphPad Prism 10. The data points were analysed using the unpaired t-test for statistical significance. Significant differences are shown as * p\u0026thinsp;\u0026lt;\u0026thinsp;0.05, **p\u0026thinsp;\u0026lt;\u0026thinsp;0.01, ***p\u0026thinsp;\u0026lt;\u0026thinsp;0.001, **** p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001 and non-significant difference (ns) for p\u0026thinsp;\u0026gt;\u0026thinsp;0.05.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cb\u003eGeneration of stable\u003c/b\u003e \u003cb\u003eabca4b\u003c/b\u003e \u003cb\u003eknockout zebrafish models\u003c/b\u003e\u003c/p\u003e\u003cp\u003eThe zebrafish (\u003cem\u003eDanio rerio\u003c/em\u003e) has two orthologs of the human \u003cem\u003eABCA4\u003c/em\u003e gene namely, \u003cem\u003eabca4a\u003c/em\u003e and \u003cem\u003eabca4b\u003c/em\u003e. The \u003cem\u003eabca4b\u003c/em\u003e loci on chromosome 2 (gene ID: 555506) has 51 exons and codes for the full-length protein. It has two transmembrane domains (TMD) composed of 6 transmembrane helices each; two glycosylated exocytoplasmic domains (ECD) and two cytoplasmic nucleotide binding domains (NBD), which shares\u0026thinsp;\u0026gt;\u0026thinsp;65% identity with the human protein. However, the \u003cem\u003eabca4a\u003c/em\u003e loci on chromosome 24 (gene ID: 798993) has 8 exons and shares only partial homology with exon 2\u0026ndash;8 of \u003cem\u003eabca4b\u003c/em\u003e and codes for a truncated protein with a single TMD and a partial ECD. Therefore, to create zebrafish STGD1 models, three gRNAs were designed to target the exon 2 of \u003cem\u003eabca4b\u003c/em\u003e \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA\u003cb\u003e)\u003c/b\u003e, to achieve in-del/frame-shift mutations by CRISPR/Cas9-mediated genome editing.\u003c/p\u003e\u003cp\u003eThe gRNA1 targeted the 5\u0026rsquo;UTR region, upstream of the ATG start codon. Whereas the gRNA2 and gRNA3 targeted the coding regions downstream of the ATG (in exon 2) \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA\u003cb\u003e\u0026amp;B)\u003c/b\u003e. The edit efficiency of the guides was assessed by \u003cem\u003ein vitro\u003c/em\u003e cleavage assay and the results confirmed target specific binding and efficient double strand cleavage of the template DNA (266 bp) by all three guides tested \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC\u003cb\u003e)\u003c/b\u003e. The gRNA2 with a single predicted off-target site showed higher edit efficiency and total cleavage of the template DNA and was selected for further editing of zebrafish embryos (see Table no. 2). The gRNA2-SpCas9 RNP complex was microinjected into freshly fertilized wildtype zebrafish embryos (TU-AB strain) at single cell-stage and were allowed to develop. The juvenile fish at 2 months were screened for their genotypes at the target locus for the identification of mosaic founder fish (F\u003csub\u003e0\u003c/sub\u003e) \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD\u003cb\u003e)\u003c/b\u003e. Sanger sequencing chromatograms displayed overlapping peaks starting from 3 bp upstream of the PAM site, which confirmed the presence of in-del changes in founder animals 1 and 2 \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eE\u003cb\u003e)\u003c/b\u003e. Cloning and sequencing of target region amplicons revealed a spectrum of mutations in the founder animals, which suggested possible tissue mosaicism. The founder animal 1 carried mutant alleles with 13 bp deletion (\u003cem\u003eabca4b del\u003c/em\u003e 13), 2 bp insertion (\u003cem\u003eabca4b ins\u003c/em\u003e 2) and 54 bp deletion (\u003cem\u003eabca4b del\u003c/em\u003e 54), while the founder animal 2 carried a 11 bp deletion (\u003cem\u003eabca4b del\u003c/em\u003e 11) and 3 bp deletion (\u003cem\u003eabca4b del\u003c/em\u003e 3) \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eF\u003cb\u003e)\u003c/b\u003e. Germline transmission of edits was assessed by backcross breeding of founders with wildtype zebrafish. Genotyping of the heterozygous F\u003csub\u003e1\u003c/sub\u003e embryos revealed the germline transmission of 13 bp deletion and 2 bp insertion. The F\u003csub\u003e1\u003c/sub\u003e heterozygotes carrying the same mutation were then interbred to generate F\u003csub\u003e2\u003c/sub\u003e homozygous null mutants. Further immunohistological evaluations and visual behavior studies were carried out using the \u003cem\u003eabca4b ins 2\u003c/em\u003e mutant, where the presence of two base \u0026ldquo;CG\u0026rdquo; insertion right after the translational start site (ATG) has resulted in frame-shift and early termination of protein synthesis \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eG\u003cb\u003e)\u003c/b\u003e.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\u003ch2\u003eHistological evaluation of retinal morphology and retinomotor movements\u003c/h2\u003e\u003cp\u003eLoss of function of \u003cem\u003eABCA4\u003c/em\u003e is known to cause retinal hyperpigmentation, lipofuscin deposition, RPE cell atrophy, slow degeneration of the outer-retina and delayed dark-adaptation at advanced stages of the disease in Stargardt patients \u003csup\u003e\u003cb\u003e\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e\u003c/b\u003e\u003c/sup\u003e and rodent models \u003csup\u003e\u003cb\u003e\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e,\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u003c/b\u003e\u003c/sup\u003e. To assess the effects of \u003cem\u003eabca4b\u003c/em\u003e mutation, the gross retinal sections of 24-month-old wildtype and \u003cem\u003eabca4b\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u0026minus;/\u0026minus;\u003c/em\u003e\u003c/sup\u003e mutants were analysed by histology and H\u0026amp;E staining. When compared to age-matched wildtype controls \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA-i\u003cb\u003e)\u003c/b\u003e, the mutant retinas displayed gross structural changes such as reduced outer-retinal thickness and increased pigmentation in RPE cells \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA \u003cb\u003ei-ii)\u003c/b\u003e.\u003c/p\u003e\u003cp\u003eUnlike in mammals, the zebrafish retina undergoes distinct structural changes in PR myoids and pigment granules (melanosomes) migration within RPE cells, which are collectively termed as \u0026ldquo;retinomotor movements\u0026rdquo; and this phenomenon is regulated both by circadian rhythm and light signals. During bright light conditions, the rod myoids elongate and insert their outer segments (OS) into the RPE microvilli processes, while the cone myoids contract and are placed in the front to absorb the bright light. Conversely, under dim light, the rod myoids contract to position their OS proximally for maximal photon absorption and the cone myoids elongate and get distally positioned. Similarly, the melanosome within RPE cells migrate to the apical surface of microvilli structures that surround the cone outer segments (COS) and protect the rod outer segments (ROS) from photobleaching during daytime. Conversely, the melanosome gets sequestered to the base of RPE cells to support maximal light absorption by the rods during night-time \u003cb\u003e(Supp.\u003c/b\u003e Figure\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC\u003cb\u003e)\u003c/b\u003e. These structural changes are predominantly regulated by light-dependent mechanisms in rods and RPE and by the internal circadian rhythm in cones via the dopamine and prostaglandin-mediated signalling pathways that regulates the cytoskeletal dynamics \u003csup\u003e\u003cb\u003e\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e,\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e\u003c/b\u003e\u003c/sup\u003e. Zebrafish iris lacks the pupillary sphincter muscles to control light entry and therefore the retinomotor movements plays a crucial role in maximizing light-capture under dark and in protecting the rod PRs from photobleaching under photopic conditions.\u003c/p\u003e\u003cp\u003eWe evaluated the retinomotor responses of PR and RPE cells of wildtype and mutants, maintained under controlled photopic and scotopic conditions. This was done to examine the outer-retinal changes and light sensitivity-dependent responses. Upon light-adaptation, the rod myoids elongated while cone myoids contracted in both wildtype and mutant retinas, reflecting normal retinomotor behaviour \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA \u003cb\u003ei-ii)\u003c/b\u003e. Likewise, the melanosomes in RPE cells migrated to the apical side, surrounding the COS \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA-p\u003cb\u003e)\u003c/b\u003e. In contrast, the \u003cem\u003eabca4b\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e mutant retinas exhibited increased pigmentation, with melanosomes dispersed throughout the RPE cell bodies \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA-q\u003cb\u003e)\u003c/b\u003e. This suggested an increased stress response in RPE cells, possibly an outcome of reduced light sensitivity of COS and excess unabsorbed photons in the outer-retina. Upon dark-adaptation, both wildtype and mutants displayed typical PR retinomotor movements, wherein the rod myoids contracted and cone myoids elongated and positioned the ROS proximally and COS distally \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA \u003cb\u003eiii-iv)\u003c/b\u003e. However, the RPE cells in mutants appeared abnormal, with reduced or absent arborizations in their apical microvilli structures \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA-r\u003cb\u003e\u0026amp;s)\u003c/b\u003e.\u003c/p\u003e\u003cp\u003eMorphometric analysis of the outer-retina confirmed a significant decrease in the (i) thickness of pigment free zone in RPE, (ii) length of cone inner and OS (iii) length of rod inner and OS and (iv) thickness of the rod nuclear layer (RNL) \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC \u003cb\u003ei-iv)\u003c/b\u003e. These findings collectively demonstrate progressive degeneration of the outer-retinal layers in mutants, confirming defects both in photoreceptors and RPE cells.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e\u003ch2\u003eMorphology and spatial organization of photoreceptor cells in zebrafish retina\u003c/h2\u003e\u003cp\u003eTo visualize the spatial arrangement of rod and cone PRs in zebrafish eyes, the retinal sections of the wildtype fish were stained with Alexa Fluor\u0026trade; 488-conjugated Peanut Agglutinin (PNA). The PNA lectin binds to specific glycosylated protein and lipids in the membranes of all cone and rod PR inner segments (IS) and outer segments (OS) \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA-i\u003cb\u003e)\u003c/b\u003e.\u003c/p\u003e\u003cp\u003eBased on the OS staining, the four distinct cone sub-types could be clearly identified such as, the ultraviolet sensitive cones (white arrowhead; UVS or UV cones), short wavelength sensitive cones (yellow arrowhead, SWS or blue cones), long and middle wavelength sensitive cones (square bracket, LWS/MWS or R/G cones or double cones) \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA-i\u003cb\u003e)\u003c/b\u003e. PNA staining also revealed the distally positioned ROS (magenta arrowhead), which were interspersed among the microvilli projections of the RPE cells along the distal retinal margins \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA \u003cb\u003ei-ii)\u003c/b\u003e. Counterstaining with DAPI highlighted two distinct PR nuclear layers, which are spatially separated by the outer limiting membrane (OLM). The rod nuclear layer (RNL) is composed of 2\u0026ndash;3 layers of circular nuclei of rod cells and the cone nuclear layer (CNL) consists of a single row of elongated cone nuclei, positioned apical to the OLM \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA \u003cb\u003eii-iii)\u003c/b\u003e. The nuclei of UVS-cones are of inverted triangle or V-shaped \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA-i\u003cb\u003eii, white asterisk)\u003c/b\u003e and are located along the distal margins of the RNL and their OS are positioned in between the elongated nuclei of the SWS/MWS/LWS cones in the CNL \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA-i\u003cb\u003e)\u003c/b\u003e. The SWS COS are positioned medially between the UVS and MWS/LWS cones. The MWS and LWS cones exist as doublets and their OS are distally positioned. Unlike the rodents with inverted chromatin architecture of rod nucleus, the zebrafish rod nuclei display uniformly distributed, homogeneous chromatin. However, the nuclei of all cones show a granular chromatin architecture, like that of the human retina \u003csup\u003e\u003cb\u003e\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e\u003c/b\u003e\u003c/sup\u003e \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA-i\u003cb\u003eii)\u003c/b\u003e.\u003c/p\u003e\u003cp\u003e\u003cb\u003eDegeneration of UVS and SWS cones in\u003c/b\u003e \u003cb\u003eabca4b\u003c/b\u003e\u003csup\u003e\u003cb\u003e\u0026minus;/\u0026minus;\u003c/b\u003e\u003c/sup\u003e \u003cb\u003enull mutants\u003c/b\u003e\u003c/p\u003e\u003cp\u003eTo assess for the status of PR cells and their degeneration in \u003cem\u003eabca4b\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e null mutants, the retinal sections of wildtype and mutant fishes were stained with FITC-labelled PNA at 3, 6, 12 months of adulthood. Wildtype retinas displayed the characteristic mosaic pattern of COS, with typical conical morphology, alongside the well-formed cylindrical ROS \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB \u003cb\u003ei-iii \u0026amp; vii-ix)\u003c/b\u003e. However, mutant retinas at 3M displayed shortened and shrunken UVS and SWS-COS, which suggested the onset of retinal degeneration (RD) (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB \u003cb\u003ex).\u003c/b\u003e At 6M and 12M, the mutants displayed a marked reduction in PNA staining intensity, and accelerated COS degeneration of UVS and SWS cones, followed by double cones \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB \u003cb\u003exi)\u003c/b\u003e. Further, a significant degeneration of ROS was also observed at advanced ages \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB \u003cb\u003eii)\u003c/b\u003e.\u003c/p\u003e\u003cp\u003eQuantification of cone nuclei in wildtype and mutants at different stages has revealed no significant changes at 3M, indicating that the OS undergo degeneration initially \u003cb\u003e(Supp.\u003c/b\u003e Figure\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA \u003cb\u003ei-iii)\u003c/b\u003e. However, at 6M and 12M, there was a rapid and significant decline in all cone PR types, which confirmed the cone-rod pattern of progressive degeneration \u003cb\u003e(Supp\u003c/b\u003e Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA \u003cb\u003eiv-ix)\u003c/b\u003e. These results demonstrate that \u003cem\u003eabca4b\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e zebrafish undergo a slow but progressive RD, starting with early structural defects in COS and culminating in widespread loss of cones and rods with advancing age.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eProgressive degeneration of all cones in\u003c/b\u003e \u003cb\u003eabca4b\u003c/b\u003e\u003csup\u003e\u003cb\u003e\u0026minus;/\u0026minus;\u003c/b\u003e\u003c/sup\u003e \u003cb\u003enull mutants\u003c/b\u003e\u003c/p\u003e\u003cp\u003eABCA4 protein is localized to PR disc membranes, where the photon sensing opsins are localized and together they play a crucial role in visual cycle. To assess the structural integrity of POS in \u003cem\u003eabca4b\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e mutants, retinal sections were stained with antibodies specific to each of the UVS, SWS, LWS and MWS-COS.\u003c/p\u003e\u003cp\u003eThe anti-RHO (MAB5356, clone 1D4), labels the rod PR in rodents and humans. However, it is known to specifically label the LWS-COS in zebrafish (LWS opsin, \u003cb\u003eSupp.\u003c/b\u003e Figure\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB \u003cb\u003ei\u003c/b\u003e) \u003csup\u003e\u003cb\u003e\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u003c/b\u003e\u003c/sup\u003e. Similarly, the anti-RHO (ab232934, clone EPR21876) labels ROS in rodents and humans but, selectively labels the MWS-COS in zebrafish \u003cb\u003e(Supp.\u003c/b\u003e Figure\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB \u003cb\u003ei)\u003c/b\u003e. The anti-RPE65 antibody, (ab23178) labels all COS in zebrafish \u003cb\u003e(Supp.\u003c/b\u003e Figure\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB \u003cb\u003eii)\u003c/b\u003e. Finally, the anti-R/G-opsin (AB5405) marks the LWS/MWS opsins in mouse and human retinas, but we observed that it labels all PR-OS in zebrafish \u003cb\u003e(Supp.\u003c/b\u003e Figure\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB \u003cb\u003eiii)\u003c/b\u003e.\u003c/p\u003e\u003cp\u003eImmunohistochemistry of LWS and MWS-COS in 3M and 12M wildtype retinas, displayed their adjacent placement and appeared as doublets at regular intervals (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA \u003cb\u003e\u0026amp; B i-iii)\u003c/b\u003e. However, the 3M-old mutants showed early degeneration of double COS, predominantly affecting the MWS-COS \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA \u003cb\u003ev-vii)\u003c/b\u003e. By 12M, MWS-COS were significantly lost, while the LWS-COS remained, but with distorted morphology (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB \u003cb\u003ev-vii\u003c/b\u003e). In addition to the OS loss in mutants, the cone nuclei morphology was also altered. In wildtype retina, the nuclei of UVS cones appeared as inverted triangle shape and are located along the distal margins of RNL, while the SWS, MWS and LWS cone nuclei in the CNL are elongated and oblong shaped \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA\u003cb\u003e\u0026amp;B-iv)\u003c/b\u003e. In 3M-old mutants, the UV cone nuclei lost their inverted triangular morphology and appeared irregular and at 12M they became rounded and lost their structural integrity. The other cone nuclei also lost their elongated shape and became shorter and disorganized \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA\u003cb\u003e\u0026amp;B-viii)\u003c/b\u003e. Further, the immunostaining of all COS displayed degeneration in 3M mutant retinas and the residual OS were found to be mislocalized (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC \u003cb\u003ei-ii\u003c/b\u003e).\u003c/p\u003e\u003cp\u003eTo evaluate cone integrity, the retinal sections were stained with anti-arr3b, which labels Cone arrestin expressed in double cone cell bodies. Bright-field images of wildtype retinas at 6M and 12M showed specific labelling of the inner segments and cell bodies of double cones \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD \u003cb\u003ei-ii)\u003c/b\u003e. However, the mutants displayed significantly reduced PR layer thickness (ROS, CNL, RNL) and abnormal double cone IS at 6M \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD\u003cb\u003e-iii)\u003c/b\u003e, which got severely degenerated further at 12M \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD\u003cb\u003e-iv)\u003c/b\u003e. Additionally, the mutant RPE cells showed increased pigmentation, with melanosomes dispersed throughout the cell body under photopic conditions, which indicates potential diminished light sensitivity of the retina \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD \u003cb\u003ei-iii)\u003c/b\u003e.\u003c/p\u003e\u003cp\u003eUnder bright light conditions, the double COS of 12M wildtype retina were positioned proximal to the OLM for maximal light capture \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eE-i\u003cb\u003e)\u003c/b\u003e. However, in mutants, the double COS have undergone degeneration, and the residual LWS-COS appear dispersed and are positioned distal to the OLM and are deeply buried within the RPE layer \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eE-i\u003cb\u003ei)\u003c/b\u003e. This confirmed that the degenerated outer-retinal architecture of mutants have adapted to low light responses and assumed a permanent dark-adapted state, likely due to cone degeneration and diminished sensitivity to bright light.\u003c/p\u003e\u003cp\u003eTogether these findings revealed progressive degeneration of IS and OS, altered nuclear structure and cell loss of all cones in \u003cem\u003eabca4b\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e mutants. Prolonged exposure to unabsorbed light photons seemed to trigger chronic stress in RPE cells, leading to persistent dark-adapted responses under photopic conditions such as, the myoid elongation in LWS/MWS cones and melanosome accumulation in RPE cells.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e\u003ch2\u003eRod photoreceptor degeneration in null homozygous mutants\u003c/h2\u003e\u003cp\u003eTo further assess the rod degeneration in mutants, the retinal sections of 24-month-old, dark-adapted animals were immunostained with FITC-labelled PNA, which labelled all POS. Under dark-adapted conditions, the ROS are proximally positioned close to OLM to support maximal light absorption \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA-i\u003cb\u003e)\u003c/b\u003e. However, in mutant retinal sections, considerable loss of both ROS and COS were observed and the residual OS appeared shorter in size \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA-i\u003cb\u003ei)\u003c/b\u003e. Further, to specifically assess ROS degeneration, light-adapted retinas at 12M were stained with anti-R/G-opsin (AB5405) that detects all PR-OS \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB-i\u003cb\u003e)\u003c/b\u003e. The wildtypes displayed tubular ROS structures at the distal end of the retina \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB-p\u003cb\u003e)\u003c/b\u003e. Whereas the mutants showed shorter ROS with signs of degeneration, in addition to an extensive loss of all COS \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB-q\u003cb\u003e)\u003c/b\u003e. Unlike the tubular ROS structures seen in wildtype retinas \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB-r\u003cb\u003e)\u003c/b\u003e, the mutants ROS showed structural deformities such as atypical bulges with hollow lumen \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB-s\u003cb\u003e)\u003c/b\u003e. It is interesting to note that these structural abnormalities are clearly observed with anti-R/G-opsin, which specifically marked all PR-OS, while the membrane glycoprotein labelling with FITC-PNA only helped to examine the POS integrity. These results confirmed that the ROS are also undergoing degeneration at advanced stages of the disease, with structural deformities, leading to an overall reduction in the thickness of the outer nuclear layer (ONL).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eLipofuscin deposits in the retina of\u003c/b\u003e \u003cb\u003eabca4b\u003c/b\u003e\u003csup\u003e\u003cb\u003e\u0026minus;/\u0026minus;\u003c/b\u003e\u003c/sup\u003e \u003cb\u003emutants\u003c/b\u003e\u003c/p\u003e\u003cp\u003eIn STGD1/ARRD patients, the loss of ABCA4 leads to the accumulation of the A2E, a bisretinoid complex that remain undigested by the lysosomal enzymes within RPE cells and appear as autofluorescent lipofuscin deposits \u003csup\u003e\u003cb\u003e\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e\u003c/b\u003e\u003c/sup\u003e. This causes RPE cell stress and gradual atrophy, followed by secondary loss of PRs and vision impairment. We therefore checked for the presence of autofluorescent lipofuscin accumulation in unstained cryosections of both wildtype and \u003cem\u003eabca4b\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e mutant retinas of 12M-old fish. The unstained retinal sections were excited at 488 nm and the autofluorescent emissions were collected from 500\u0026ndash;700 nm \u003csup\u003e\u003cb\u003e\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u003c/b\u003e\u003c/sup\u003e. While the wildtype retinal sections had a few autofluorescent lipofuscin deposits in the choroidal regions \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA \u003cb\u003ei-ii \u0026amp; p)\u003c/b\u003e, the mutants displayed an increased accumulation, which are evident both in the choroidal region and within RPE cells \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA \u003cb\u003eiii-iv \u0026amp; q)\u003c/b\u003e. Since oxidized lipids are the primary component of lipofuscin deposits, we evaluated for intracellular lipid peroxide accumulation using a lipophilic probe (BODIPY 665/676), which exhibits a shift in its absorption and emission spectra from 665/676 nm to 580/605 nm upon binding to oxidized lipids. To detect the toxic lipid peroxides, BODIPY stained retinal sections were excited with 561 nm laser and the emission spectra from oxidized lipids were collected from 580\u0026ndash;660 nm. The confocal microscopic images confirmed the absence of BODIPY stained oxidized lipids in wildtype retinas \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eB \u003cb\u003ei-ii \u0026amp; r)\u003c/b\u003e, while an increased accumulation of toxic lipid intermediates was noted within POS, beneath RPE cells and in choroidal regions of mutant retinal sections \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eB \u003cb\u003eiii-iv \u0026amp; s)\u003c/b\u003e, which further confirmed the RPE cell stress.\u003c/p\u003e\u003cp\u003eDespite the accumulation of toxic lipids, the RPE cells in mutant retina remained viable, even at 12M, but developed hyperpigmentation and their melanosomes exhibited slightly altered retinomotor responses under light-adapted conditions. However, the progressive PR degeneration was evident, as marked by significant changes in nuclear and outer segment structures and cell loss at advanced stages \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB \u003cb\u003e\u0026amp; Supp.\u003c/b\u003e Figure\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA\u003cb\u003e)\u003c/b\u003e. This observation contrasts with the human STGD1 physiology, wherein the RPE degeneration typically precedes the PR cell loss. Taken together, it suggests that the PR degeneration in \u003cem\u003eabca4b\u003c/em\u003e null mutants is a primary effect, due to the accumulation of toxic A2E in PR disc membranes and not a secondary effect of lipofuscin deposits and lysosomal stress leading to RPE cell death.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eEarly loss of retinal stem cells in\u003c/b\u003e \u003cb\u003eabca4b\u003c/b\u003e\u003csup\u003e\u003cb\u003e\u0026minus;/\u0026minus;\u003c/b\u003e\u003c/sup\u003e \u003cb\u003emutants\u003c/b\u003e\u003c/p\u003e\u003cp\u003eAdult zebrafish retina has immense regenerative potential unlike that of humans. During zebrafish retinogenesis, the newly formed retinal neurons originate from the ciliary margin zone (CMZ) that contains mitotically active retina stem cells (RSCs) along the retinal periphery. The RSCs present in CMZ contributes to the retinal growth and formation of different retinal cell types during eye development \u003csup\u003e\u003cb\u003e\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e\u003c/b\u003e\u003c/sup\u003e. We therefore asked if the RSCs participates in adult retinal regeneration and attempts to maintain the tissue integrity, in response to the ongoing cell loss in \u003cem\u003eabca4b\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e mutants. To investigate this, the retinal sections of the wildtype and mutant fish were immunostained for PCNA at early developmental stages (2, 3, 4, 15 dpf) and during adulthood (3, 6 and 12M).\u003c/p\u003e\u003cp\u003eImmunohistochemistry of wildtype and mutant retinas to detect nuclear PCNA expression at 2 dpf displayed proliferating retinal progenitors that are distributed throughout the developing retina. However, from 3 dpf, the pcna\u003csup\u003e+\u003c/sup\u003e cells were confined to the peripheral retina (CMZ) and its expression was lost in the fully differentiated cells in the central retina. Between 4\u0026ndash;15 dpf, a gradual decline in the pcna\u003csup\u003e+\u003c/sup\u003e cells was observed in the CMZ region \u003cb\u003e(Supp.\u003c/b\u003e Figure\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA\u003cb\u003e)\u003c/b\u003e, which confirmed that the early retinal development, RSC proliferation and differentiation are normal in mutants, as compared to the wildtype. It is well known that the proliferative pool of CMZ stem cells declines with age and are totally extinguished in wildtype by 3\u0026ndash;4 years \u003csup\u003e\u003cb\u003e\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e\u003c/b\u003e\u003c/sup\u003e. In wildtype fish retinas, a compact cluster of PCNA positive proliferating cells were present at the CMZ (13\u0026thinsp;\u0026plusmn;\u0026thinsp;4.6) at 3M \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eA \u003cb\u003ei)\u003c/b\u003e which gradually decreased at 6M (9.6\u0026thinsp;\u0026plusmn;\u0026thinsp;0.57) and 12M (2\u0026thinsp;\u0026plusmn;\u0026thinsp;1) (n\u0026thinsp;=\u0026thinsp;3), with rare PCNA positive cells being retained at the CMZ \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eA \u003cb\u003eii, iii)\u003c/b\u003e. However, in age-matched mutant retinas, we observed an early depletion in the number of PCNA positive cells in 3M (6.6\u0026thinsp;\u0026plusmn;\u0026thinsp;1.1) and 6M (4.33\u0026thinsp;\u0026plusmn;\u0026thinsp;1.1) (n\u0026thinsp;=\u0026thinsp;3) \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eA \u003cb\u003eiv, v)\u003c/b\u003e, and we observed a complete loss of pcna\u003csup\u003e+\u003c/sup\u003e cells at 12M \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eA \u003cb\u003evi)\u003c/b\u003e. Similarly, the immunostaining for Phospho Histone H3 (phh3) also confirmed a decrease in phh3\u003csup\u003e+\u003c/sup\u003e mitotic cells in 3M mutants \u003cb\u003e(Supp. Figure B i-ii)\u003c/b\u003e. Further, a notable reduction in the sox2\u003csup\u003e+\u003c/sup\u003e M\u0026uuml;ller glial cells at the CMZ and inner nuclear layer (INL) was observed in 3M mutants, which indicated an early exhaustion of RSCs \u003cb\u003e(Supp. Figure C i-iv).\u003c/b\u003e\u003c/p\u003e\u003cp\u003eWe could also detect a few pcna\u003csup\u003e+\u003c/sup\u003e cells in the ONL of wildtype retinas, which are likely to be M\u0026uuml;ller-derived rod progenitors (RPs) \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eB \u003cb\u003ei)\u003c/b\u003e and were found to be reduced in mutant retinas \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eB \u003cb\u003eii)\u003c/b\u003e. These observations together suggests that the ongoing degeneration in mutant retinas might be subjecting the RSCs to chronic activation, expansion and differentiation to replace the lost PR cells, thus resulting in an accelerated loss of reserve stem cell pool during early adulthood.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec15\" class=\"Section2\"\u003e\u003ch2\u003eProgenitor and mature cell marker expression in developing and adult zebrafish\u003c/h2\u003e\u003cp\u003eTo understand the temporal expression of \u003cem\u003eabca4b\u003c/em\u003e and other retina-specific genes, we evaluated the transcripts in wildtype and \u003cem\u003eabca4b\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u0026minus;/\u0026minus;\u003c/em\u003e\u003c/sup\u003e mutant retinas during early larval development and in adulthood by semi-quantitative RT-PCR. The expression of \u003cem\u003eabca4b\u003c/em\u003e mRNA started at around 72 hours post fertilization (hpf) and peaked at 7 dpf in wt. However, the expression could be detected only from 7 dpf and at lower levels in mutant retinas (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eC-i), which suggested that the mutant transcripts may be rendered unstable due to frame shift and pre-mature stop codons \u003cb\u003e(Supp.\u003c/b\u003e Figure\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA \u003cb\u003ei-iv)\u003c/b\u003e.\u003c/p\u003e\u003cp\u003eThe RT-PCR analysis of early progenitor retinal markers such as \u003cem\u003echx10\u003c/em\u003e and \u003cem\u003epax6\u003c/em\u003e displayed an increased expression in both wildtype and mutants starting from 24 hpf and peaked at 72 hpf, when the retina is fully formed. As the progenitor cells start differentiating and committing to mature retinal cell types, a decline in \u003cem\u003epax6\u003c/em\u003e and \u003cem\u003echx10\u003c/em\u003e expression was observed from 7 dpf onwards and was only expressed at base levels in adults at 12M, which confirmed that their expression is retained only in a small fraction of mature retinal cells. In \u003cem\u003eabca4b\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u0026minus;/\u0026minus;\u003c/em\u003e\u003c/sup\u003e mutants, the temporal expression pattern of \u003cem\u003echx10\u003c/em\u003e and \u003cem\u003epax6\u003c/em\u003e was identical to wildtype during early development. However, at 12M, we observed a significant upregulation in \u003cem\u003epax6\u003c/em\u003e and \u003cem\u003echx10\u003c/em\u003e expression, which suggested possible activation of progenitors in mutant retinas and triggered likely by the degeneration in ONL. Similarly, an elevated expression of \u003cem\u003ecrx\u003c/em\u003e, a PR precursor marker was also observed at 12M in \u003cem\u003eabca4b\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u0026minus;/\u0026minus;\u003c/em\u003e\u003c/sup\u003e mutants, which suggested the activation of molecular pathways that induce the formation of multipotent retinal progenitors (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eC \u003cb\u003eii\u003c/b\u003e).\u003c/p\u003e\u003cp\u003eWe further evaluated the retinal tissues for the expression of different mature photoreceptor and RPE-specific transcripts. The wildtypes showed the expression of all mature cell transcripts starting from 12 hpf, which peaked at 72 hpf and remained constant until 12M. In abca4b\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e retinas, we observed a delayed onset of expression of \u003cem\u003euvs\u003c/em\u003e and \u003cem\u003emws opsin\u003c/em\u003e at 72 hpf, which plateaued at 7 dpf and the levels are further comparable to wt expression till 12M \u003cb\u003e(Supp.\u003c/b\u003e Figure\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB \u003cb\u003ei)\u003c/b\u003e. However, the expression patterns of other mature retinal gene such as \u003cem\u003elws opsin, sws opsin, arr3\u003c/em\u003e and \u003cem\u003erpe65\u003c/em\u003e were comparable between wildtype and mutant retinas \u003cb\u003e(Supp.\u003c/b\u003e Figure\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB \u003cb\u003eii).\u003c/b\u003e\u003c/p\u003e\u003cp\u003eThe upregulation of \u003cem\u003epax6\u003c/em\u003e, \u003cem\u003echx10\u003c/em\u003e and \u003cem\u003ecrx\u003c/em\u003e transcripts in mutant retinas at 12M suggests possible activation of regenerative pathways and could partly explain the early loss of reserve stem cells at the CMZ. These results suggested that the rapid depletion of CMZ-RSCs could further accelerate the retinal ONL degeneration in older \u003cem\u003eabca4b\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u0026minus;/\u0026minus;\u003c/em\u003e\u003c/sup\u003e mutants.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eRetention of wound healing and regenerative response in\u003c/b\u003e \u003cb\u003eabca4b\u003c/b\u003e\u003csup\u003e\u003cb\u003e\u0026minus;/\u0026minus;\u003c/b\u003e\u003c/sup\u003e \u003cb\u003emutant retinas\u003c/b\u003e\u003c/p\u003e\u003cp\u003eApart from the RSCs present in the CMZ, the MGCs can dedifferentiate and generate multipotent, self-renewing RSCs in adult zebrafish retina. As \u003cem\u003eabca4b\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e animals displayed an early loss of proliferating PCNA positive cells at the CMZ and in the ONL layers during adulthood, we assessed if the injury-induced, M\u0026uuml;ller-driven regeneration ability is active in these mutants. To assess for the emergence of proliferative RPCs, the retinal sections of the uninjured and needle prick injured wildtype and mutant retinal sections were stained with anti-PCNA. The uninjured retinas of 24M-old wildtype and the mutants had only rare pcna\u003csup\u003e+\u003c/sup\u003e cells in the ONL and none at the CMZ \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eA \u003cb\u003ei, ii)\u003c/b\u003e. However, upon injury, both the wildtype and mutant retinas showed a massive increase in the numbers of pcna\u003csup\u003e+\u003c/sup\u003e cells across all retinal layers, suggesting that the MGCs-driven, injury response is active and can support the regeneration and repair of damaged retinal tissues \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eB \u003cb\u003ei-ii)\u003c/b\u003e. These results confirmed that although the \u003cem\u003eabca4b\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e mutants displayed a faster depletion of RSCs at CMZ, the M\u0026uuml;ller glia-driven regenerative ability remained active to support retinal injury repair. However, it warrants further evaluations during post injury recovery, to understand if the regenerated retina gets properly laminated and the PR cells in ONL layers undergo morphological maturation to restore normal retinal functions.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eDelayed feed-capture response in\u003c/b\u003e \u003cb\u003eabca4b\u003c/b\u003e\u003csup\u003e\u003cb\u003e\u0026minus;/\u0026minus;\u003c/b\u003e\u003c/sup\u003e \u003cb\u003emutants\u003c/b\u003e\u003c/p\u003e\u003cp\u003eThe UVS cones are important for high resolution prey-capture behaviour in zebrafish. Since we observed an early loss of UVS cones in \u003cem\u003eabca4b\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e mutant retinas, we asked if the cellular defects could affect retinal functions and gross visual behaviours. To assess the feed-capture responses, we custom-designed a rectangular and Y-maze for age-matched wildtype \u003cb\u003e(Supp. video file 1A, 2A, 3A, 4A)\u003c/b\u003e and mutant fish \u003cb\u003e(Supp. video file 1B, 2B, 3B, 4B)\u003c/b\u003e, using both the dry and live feeds. The results revealed that the wildtypes displayed a directed approach towards the feed and remained hovering around the spot, for a focussed feeding. In contrast, the \u003cem\u003eabca4b\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e mutants exhibited random movements throughout the maze. The fish movements were video recorded, and the representative videos are shown here. The videos were deidentified and examined by two independent assessors (naive to the study) to record the time duration at which the animals have first identified and consumed the feed. The results confirmed that the wildtype could rapidly recognize the feed, whereas the mutants demonstrated a significant delay in feed-capture \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003eA \u003cb\u003ei-ii)\u003c/b\u003e.\u003c/p\u003e\u003cp\u003eSpatial-navigation and learned decision making abilities were also evaluated using Y-maze, where the ability of the animals to identify the correct arm where the feed was dropped was assessed. In live feed test, wildtypes chose the correct arm in 60% of the attempts (12/20), thus demonstrating normal visual and spatial perception in detecting the actively moving prey. However, the mutants were able to choose the correct arm in 25% of the attempts (5/20), possibly due to random chance (50%) or aided by other sensory stimuli such as olfaction and nociception. This suggests that the loss of UVS cones affects the ability of mutants in detecting and responding to smaller and dynamic live prey. In case of dry feed test, wildtypes chose the correct arm in 70% of the attempts (14/20) and the mutants chose the correct arm in 50% of the attempts (10/20), which suggested that the relatively less dynamic and floating larger pellets of dry feeds are easier to detect even by the mutants with severe UVS cone loss \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003eA \u003cb\u003eiii-iv)\u003c/b\u003e.\u003c/p\u003e\u003cp\u003eFurther, the fish movements along the maze were tracked using a threshold-based video tracking algorithm created using Python, resulting in the generation of locational trajectory plots. The trajectory plots of both the mazes have confirmed that the wildtypes have predominantly remained around the feed drop area, as indicated by the densely populated regions in the representative heat maps and histogram plots \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003eB \u003cb\u003ei-iv)\u003c/b\u003e. Whereas, the mutants demonstrated random movements throughout the tank, with minimal mobility around the feed drop area, as shown in the representative heat maps and histogram plots \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003eB \u003cb\u003ev-viii)\u003c/b\u003e.\u003c/p\u003e\u003cp\u003eTaken together, the mutants displayed an increased latency in feed recognition, abnormal response in focussed feeding and spatial navigation. Despite these defects, the mutants survived and displayed normal growth, development and fertility, possibly because the other sensory functions such as mechanosensation and olfaction were intact, which enabled them to feed and mate effectively under the controlled laboratory conditions, with unlimited food supply and absence of competitive predators. Additionally, both sexes of mutants were fertile and when interbred, they produced progenies that developed normally and helped in successful expansion of mutant colonies. This confirmed that the visual perception and visuomotor responses play a primary role in immediate feed-capture behaviour in teleost, while the other sensory systems, although important, are likely to play a secondary role in supporting the feeding and mating behaviour.\u003c/p\u003e\u003cp\u003e\u003cb\u003eDefective optokinetic response (OKR) in\u003c/b\u003e \u003cb\u003eabca4b\u003c/b\u003e\u003csup\u003e\u003cb\u003e\u0026minus;/\u0026minus;\u003c/b\u003e\u003c/sup\u003e \u003cb\u003emutants\u003c/b\u003e\u003c/p\u003e\u003cp\u003eUpon visual function quantification, adult wildtype zebrafish (1-year old) displayed a typical OKR, with a slow-phase in the direction of grating motion and a fast-resetting phase in the opposite direction \u003cb\u003e(Supp. video file 5A\u003c/b\u003e, Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003eC \u003cb\u003ei-iii white arrows)\u003c/b\u003e. In contrast, 7 out of 10 age-matched mutants displayed no detectable eye movements in response to the moving drum \u003cb\u003e(Supp. video file 5B)\u003c/b\u003e while the remaining 3 animals displayed a few erratic and random eye movements \u003cb\u003e(Supp. video file 5C)\u003c/b\u003e. Quantitatively, the wildtypes showed a fast-phase count of 25.3\u0026thinsp;\u0026plusmn;\u0026thinsp;4.84 (mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD), while the mutants showed only 13.1\u0026thinsp;\u0026plusmn;\u0026thinsp;2.54 fast-phases over a period of 11 seconds (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05) \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003eD\u003cb\u003e)\u003c/b\u003e, which confirmed a significantly impaired OKR response in mutants. The 5 dpf larval \u003cem\u003eabca4b\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e mutants also displayed incomplete saccades in comparison to age-matched wildtype larvae, despite their normal retinal histology at early larval stages \u003cb\u003e(Supp. video file 6A-C)\u003c/b\u003e.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eThe cone-enriched retina of zebrafish (\u003cem\u003eDanio rerio\u003c/em\u003e) resembles the human macula and are therefore better models than rodents for studying various macular and cone-rod dystrophies, including STGD1 caused by mutations in ABCA4. A recent report has shown that the knockout of \u003cem\u003eabca4a\u003c/em\u003e had no effects on retinal PRs and RPE cells and most of the abca4 protein in zebrafish is encoded by \u003cem\u003eabca4b\u003c/em\u003e \u003csup\u003e\u003cb\u003e\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e\u003c/b\u003e\u003c/sup\u003e. Therefore, we targeted the zebrafish \u003cem\u003eabca4b\u003c/em\u003e gene using isoform-specific CRISPR-gRNAs to create a knockout model of STGD1. The adult mutants displayed gross structural and morphological abnormalities in outer retinal layers, with reduced OS thickness and increased pigmentation in RPE cells.\u003c/p\u003e\u003cp\u003eThe retinomotor associated changes in myoid lengths of PR cells and pigment granule migration (melanosome) within RPE cells are known to be jointly regulated by the circadian rhythm and incident light in teleost. This mechanism can serve as an indirect measure of retinal light sensitivity response. The PR myoids of adult mutants exhibited near normal retinomotor behaviour. This may be because the zebrafish retina is cone-enriched and the cone responses are predominantly regulated by the circadian rhythm, while the rod and RPE cell responses are mainly controlled by the light \u003csup\u003e\u003cb\u003e\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e,\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e,\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e\u003c/b\u003e\u003c/sup\u003e. Nevertheless, the significant OS reduction, both under photopic and scotopic conditions indicated PR degeneration. These outer retinal defects could result in reduced light absorption by the PRs and the excess (unabsorbed) photons may induce chronic photo-oxidative stress and could trigger increased melanin production, as an immediate cytoprotective response in RPE cells. However, the involvement of circadian rhythm in retinal regulation and cone responses has made it difficult to isolate the light-mediated responses in \u003cem\u003eabca4b\u003c/em\u003e null mutants. The dark-adapted \u003cem\u003eabca4b\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e RPE cells appeared atypical, with loss of apical microvilli structures, which are critical for phagocytosis and recycling of shed POS. Also, the light-adapted mutant RPE displayed increased pigmentation, with melanosomes dispersed from the basal cytoplasm to apical microvilli structures. Thus, the reduced light sensitivity of the mutant retinas seems to adopt the RPE cells to a dark-adapted retinomotor responses, even under photopic conditions. A similar \u0026ldquo;expanded melanophores\u0026rdquo; phenomenon was reported in blind zebrafish, where the pigment cells (melanophores) of the skin are larger and distributed, leading to their darker appearance. This is because, the vision impaired animals lack the ability to adapt their skin pigmentation in response to ambient light levels. Higher the pigmentation, greater is the visual impairment and \u003cem\u003evice versa\u003c/em\u003e and this has been used as a simple screening tool to identify vision mutants in large library screens \u003csup\u003e\u003cb\u003e\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e\u003c/b\u003e\u003c/sup\u003e. A study on rhodopsin P23H mutants has reported an increase in oxidative stress response and altered circadian gene expression in both cone and RPE cells \u003csup\u003e\u003cb\u003e\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e\u003c/b\u003e\u003c/sup\u003e.\u003c/p\u003e\u003cp\u003eFITC-labelled PNA staining of \u003cem\u003eabca4b\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e mutants displayed early outer-retinal degeneration, starting from 3-months. They exhibited shortened OS with progressive thinning, culminating in total loss of all cone and rod OS at advanced adulthood. Detailed analysis of mutant retinas at different timepoints revealed structural deformities in cone cell nuclei and outer segments. Under bright light, the COS of wildtype are aligned proximal to the OLM for maximal light absorption. However, in mutants, the degenerating COS are seen buried deeper within the RPE, thus confirming the reduced light sensitivity of cones, which led to increased pigmentation and persistent dark-adapted retinomotor responses in RPE cells. A recent report also displayed COS dysmorphology in \u003cem\u003eabca4b\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e mutants, with elongation, thinning, disrupted disk-packing, reduced COS shedding and \u0026lsquo;eat-me\u0026rsquo; signals on POS (externalized phosphatidylserine), affecting their phagocytosis and clearance by RPE cells \u003csup\u003e\u003cb\u003e\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e\u003c/b\u003e\u003c/sup\u003e. The abca4 protein was also shown to localize in a stripe pattern along the COS length, predicting a structural role, apart from the well-known retinal transport function in POS during phototransduction \u003csup\u003e\u003cb\u003e\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e\u003c/b\u003e\u003c/sup\u003e and in processing the shed POS and lipids inside RPE lysosomes \u003csup\u003e\u003cb\u003e\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u003c/b\u003e\u003c/sup\u003e.\u003c/p\u003e\u003cp\u003e\u003cem\u003eThe Abca4\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e mice model have demonstrated progressive PR degeneration, with delayed onset at 6M and an extensive ONL loss at 12M \u003csup\u003e\u003cb\u003e\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e\u003c/b\u003e\u003c/sup\u003e. Mice are nocturnal with rod-enriched retinas. This required the development of \u003cem\u003eAbca4\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u0026minus;/\u0026minus;\u003c/em\u003e\u003c/sup\u003e \u003cem\u003eNrl\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u0026minus;/\u0026minus;\u003c/em\u003e\u003c/sup\u003e mice models to engineer cone-dominant retinas, to understand the effects of Abca4 loss on cone cell functions \u003csup\u003e\u003cb\u003e\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e\u003c/b\u003e\u003c/sup\u003e. The \u003cem\u003eabca4b\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u0026minus;/\u0026minus;\u003c/em\u003e\u003c/sup\u003e zebrafish model revealed that the cones are more sensitive to photooxidative stress than rods, with degeneration starting as early as 1M, unlike the delayed onset in \u003cem\u003eAbca4\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e mice. We further confirm that the cones are the first cell type to be affected in \u003cem\u003eabca4b\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e mutants, while rod degeneration is apparent only at advanced adulthood.\u003c/p\u003e\u003cp\u003eThe key pathological features in STGD1 patients and \u003cem\u003eAbca4\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e mice are delayed dark-adaptation, drusen deposits or lipofuscin accumulation in RPE cells, increased oxidative stress leading to RPE cell death; followed by secondary PR layer degeneration and vision loss \u003csup\u003e\u003cb\u003e\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e,\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u003c/b\u003e\u003c/sup\u003e. Similarly, the \u003cem\u003eabca4b\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e zebrafish retinas accumulate autofluorescent lipid peroxides within the choroid, RPE and POS. Interestingly, despite these toxic deposits, the mutant RPE cells remained viable and highly pigmented for up to 24M. However, the effects of \u003cem\u003eabca4b\u003c/em\u003e loss on PRs, particularly the COS degeneration was evident as early as 3M. This suggests that the early degenerative changes in the PRs are a direct and primary effect of intracellular A2E toxicity and excess \u003cem\u003eall-trans\u003c/em\u003e retinal accumulation in POS and not due to RPE cell loss dependant secondary effects. The \u003cem\u003eAbca4\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u0026minus;/\u0026minus;\u003c/em\u003e\u003c/sup\u003e \u003cem\u003eNrl\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u0026minus;/\u0026minus;\u003c/em\u003e\u003c/sup\u003e mice retina also displayed accelerated A2E production, inefficient clearance and impaired transport to RPE, resulting in A2E accumulation and cone toxicity \u003csup\u003e\u003cb\u003e\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e\u003c/b\u003e\u003c/sup\u003e.\u003c/p\u003e\u003cp\u003eMost teleost retina has immense regenerative capacity supported by two distinct stem cell niches: 1) the RSCs at the CMZ and 2) the MGCs in the INL \u003csup\u003e\u003cb\u003e\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e\u003c/b\u003e\u003c/sup\u003e. Additionally, the RPE cells can regenerate from the peripheral cells upon injury \u003csup\u003e\u003cb\u003e\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e\u003c/b\u003e\u003c/sup\u003e. RSCs in the CMZ are competent to generate all retinal neurons except the rods. However, a few rod progenitors reside in the ONL and are derived from the slow-dividing MGCs and contribute to rod maintenance and homeostasis \u003csup\u003e\u003cb\u003e\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e\u003c/b\u003e\u003c/sup\u003e. ScRNA-seq experiments in rhodopsin P23H mutant, (rod degeneration model) reported a gradual increase of cell clusters expressing progenitor and rod cell-markers, indicating rod regeneration. This model also reported extensive RPE degeneration \u003csup\u003e\u003cb\u003e\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e\u003c/b\u003e\u003c/sup\u003e. However, we observed that the RPE cells remained viable and the ONL degeneration progressed with age in \u003cem\u003eabca4b\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e mutants, despite the regenerative potential of zebrafish retinas. The activated RSCs undergo asymmetric division, to maintain the stem cell pool and generate transiently amplifying progenitors that differentiate and gives rise to all retinal neurons, except the rods. These RSCs contribute to the retinal growth during development and for retinal tissue repair and maintenance during adult tissue homeostasis \u003csup\u003e\u003cb\u003e\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e,\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e,\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e\u003c/b\u003e\u003c/sup\u003e. In \u003cem\u003eabca4b\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e mutants, we observed that the chronic retinal degeneration has led to the premature depletion of PCNA\u003csup\u003e+\u003c/sup\u003e, pHH3\u003csup\u003e+\u003c/sup\u003e and SOX2\u003csup\u003e+\u003c/sup\u003e stem cell reserve at the CMZ and INL.\u003c/p\u003e\u003cp\u003eIn the uninjured retina, the MGCs generates PAX6\u003csup\u003e+\u003c/sup\u003e late-stage progenitors, which migrate to the ONL and differentiate into rods \u003csup\u003e\u003cb\u003e\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e,\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e,\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e\u003c/b\u003e\u003c/sup\u003e. In adult \u003cem\u003eabca4b\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e zebrafish mutants, we observed a significant reduction in rod progenitors (RPs), with only a few rare PCNA\u003csup\u003e+\u003c/sup\u003e cells identified in the ONL, and none in the INL. Previous studies have shown that the rod degeneration does not induce the MGC proliferation in the INL \u003csup\u003e\u003cb\u003e\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e\u003c/b\u003e\u003c/sup\u003e. This suggests that rod regeneration primarily relies on the RPs in the ONL and gets depleted with age. Thus, the early depletion of RSCs at the CMZ and RPs in the ONL explained the slow but progressive degeneration of the outer-retina in \u003cem\u003eabca4b\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e mutants.\u003c/p\u003e\u003cp\u003eStudies have shown that the MGC-derived progenitors in the INL express an array of genes associated with RPs (\u003cem\u003epax6, rx1, vsx2, crx, notch, delta and N-cadherin)\u003c/em\u003e in response to PR degeneration \u003csup\u003e\u003cb\u003e\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e,\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e\u003c/b\u003e\u003c/sup\u003e. We observed an upregulation of RSC-specific (\u003cem\u003epax6, vsx2\u003c/em\u003e) and PR precursor cell specific (\u003cem\u003ecrx\u003c/em\u003e) transcripts in \u003cem\u003eabca4b\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e mutants, which indicated the presence of regenerative signals in mutant retinas at 12M. It further suggests an attempt to activate MGCs in the INL, but we did not detect any PCNA\u003csup\u003e+\u003c/sup\u003e cells in the INL under uninjured conditions. However, upon retinal injury, we observed a surge in PCNA\u003csup\u003e+\u003c/sup\u003e cells in both INL and ONL. Such Muller-driven regenerative ability was retained in \u003cem\u003ebbs2\u003c/em\u003e mutants upon light ablation \u003csup\u003e\u003cb\u003e\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e\u003c/b\u003e\u003c/sup\u003e. In teleost models where rods were selectively destroyed, they displayed an increased proliferation in ONL, possibly suggesting an expansion of MGC-derived rod progenitors \u003csup\u003e\u003cb\u003e\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e,\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e\u003c/b\u003e\u003c/sup\u003e. In an inducible model of rod toxicity, complete loss of all rod cells has triggered massive MGCs proliferation in the INL, indicating that an extensive rod loss can activate the quiescent MGCs \u003csup\u003e\u003cb\u003e\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e\u003c/b\u003e\u003c/sup\u003e. Similarly, selective cone ablation was shown to activate the MGCs \u003csup\u003e\u003cb\u003e\u003cspan additionalcitationids=\"CR40\" citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e\u003c/b\u003e\u003c/sup\u003e. These findings suggests that a critical threshold of tissue damage or injury is required to trigger the activation of MGC-driven retinal regeneration. In uninjured, aging \u003cem\u003eabca4b\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e mutants, the slow ONL degeneration appear to be insufficient to achieve the critical threshold required for the robust activation of MGCs. We also hypothesize that, additional extrinsic cues such as injury-induced inflammation may be required to activate MGC-driven regenerative responses. Taken together, these findings highlight that the resident RSCs at the CMZ and RPs in the ONL compensate for PR cell loss. However, they get depleted precociously under chronic degenerative conditions. Given that an acute injury is required to trigger activation and reprogramming of MGCs, degeneration continues in the ONL of \u003cem\u003eabca4b\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e mutants, leading to progressive vision loss.\u003c/p\u003e\u003cp\u003eLarval zebrafish under natural environments feed on transparent but UV-bright microorganisms and zooplanktons that are illuminated by sunlight. Thus, the UVS cone-enriched, strike-zone region (area temporalis) of the zebrafish retina is required for their normal prey-capture behaviour and navigation \u003csup\u003e\u003cb\u003e\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e\u003c/b\u003e\u003c/sup\u003e. These cones connect to UV-responsive, ON-sustained RGCs which forms a dedicated achromatic pathway that processes UV signals to guide precise prey-capture behaviour \u003csup\u003e\u003cb\u003e\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e\u003c/b\u003e\u003c/sup\u003e. Therefore, the loss of UVS-cones in mutants has greatly affected their feed-capture behaviour. Using the rectangular and Y-maze, we demonstrate that the mutants displayed greater difficulty in feeding live artemia larvae, which requires UVS-cone dependent vision for prey detection and a directed chase-response for successful capture. However, with dry feeds, the visual performance of the mutants has relatively improved, which suggests that the mutants are moderately competent to detect larger feed pellets and stationary objects, despite severe UVS-cone loss. It is also possible that the blind fish can rely on other sensory inputs such as olfaction and mechanosensation. The lack of competition for feed under laboratory conditions has supported sufficient feeding and survival to late adulthood. This confirms that the visual perception and visuomotor responses play a primary role in feed-capture behaviour, while the other sensory systems are likely to play a secondary role to support zebrafish feeding and mating behaviour.\u003c/p\u003e\u003cp\u003eThe OKR test in \u003cem\u003eabca4b\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e mutants displayed severe visual defects, with no detectable eye movements, while a few animals with partial vision had shown random and irregular eye movements. It is important to note that the OKR setup was illuminated by white light and the photopic responses reflect the functions of residual LWS/MWS-COS that are sensitive to visible wavelengths of light \u003csup\u003e\u003cb\u003e\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e\u003c/b\u003e\u003c/sup\u003e. Since the \u003cem\u003eabca4b\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e mutants show an early loss of UVS and SWS cones, it may be feasible to isolate and quantify the visual responses of different cones using lights of different wavelengths such as 360 nm (for UVS cones), 415\u0026ndash;420 nm, (for SWS cones) 480\u0026ndash;490 nm (for MWS cones), 560\u0026ndash;590 nm (for LWS cones) and 730 nm (for scotopic) conditions. Also, the gradual changes in the visual acuity and contrast sensitivity of mutants at different stages of degeneration may require assessments using a range of spatial frequency gratings (0.3, 0.15, 0.075, 0.03 cpd) and a range of contrast settings (30%, 50%, 70%, 100%).\u003c/p\u003e\u003cp\u003eIn summary, we highlight that the \u003cem\u003eabca4b\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e mutants display extensive cone degeneration followed by rod, a hallmark of STGD1. The RPE cells remain viable but accumulate drusen deposits, which causes cellular stress and persistent dark-adapted retinomotor responses. The resident stem cells at the CMZ and ONL are precociously lost in mutants, leading to continued degeneration in the outer-retina, resulting in severe vision loss, despite retaining the MGC-dependant regenerative potential. Finally, we conclude that the \u003cem\u003eabca4b\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e zebrafish reported here can serve as valuable \u003cem\u003ein vivo\u003c/em\u003e model for evaluating newer drugs for the treatment of lipofuscin-induced retinal degenerative conditions such as SMD and AMD.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eDeclaration of competing interests:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll authors declare no conflict of interest.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor Contributions:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eDP, DS, PJS, IM conceived the project, designed, and carried out the experiments related to the generation of transgenic zebrafish models; DP, DS, PJS, GK, PS participated in the methods standardization and protocol development; DP and DS carried out the visual behaviour and function tests; DP, SNSHC and SB participated in the custom design of feed-capture maze and OKR set up; DP, MM carried out the image and video analysis for quantification of zebrafish visual responses; RM and IM managed the project and acquired the funding; DP, IM compiled the data and drafted the manuscript. All authors participated in the review and approval of the contents of the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors thank Sreedhar Rao Boyinpally and Tirupathi Rao Mocherla for technical support with IHC; Udayachandrika Kamepalli for confocal imaging. Manasa Kalivemula, Manogna Vangipuram, Rojalin Das, Devaraju and Ayush Kumar for the custom-design of feed capture maze and OKR imaging setup.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study was supported by R\u0026amp;D grants to RM and IM from the Department of Biotechnology (DBT)- (BT/PR13644/GET/119/32/2015), Government of India; Intramural grant from the Hyderabad Eye Research Foundation (HERF) and Senior Research Fellowship to DP from the Indian Council of Medical Research (ICMR), Government of India.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll data generated and analysed during this study are included in this manuscript and in supplementary information files. Raw data are available upon request from the corresponding author, Dr. Indumathi Mariappan ([email protected]). The zebrafish mutant line used in this study has been deposited in the Zebrafish Information Network (ZFIN) database (https://zfin.org/). The exon 2 gene sequence of the abca4b mutant have been deposited in the GenBank (https://www.ncbi.nlm.nih.gov/WebSub/?form=history\u0026amp;tool=genbank) \u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eChen, T. C.\u003cem\u003e et al.\u003c/em\u003e Genetic characteristics and epidemiology of inherited retinal degeneration in Taiwan. \u003cem\u003eNPJ Genom Med\u003c/em\u003e \u003cstrong\u003e6\u003c/strong\u003e, 16, doi:10.1038/s41525-021-00180-1 (2021).\u003c/li\u003e\n\u003cli\u003eCornelis, S. S.\u003cem\u003e et al.\u003c/em\u003e Compendium of Clinical Variant Classification for 2,246 Unique ABCA4 Variants to Clarify Variant Pathogenicity in Stargardt Disease Using a Modified ACMG/AMP Framework. \u003cem\u003eHum Mutat\u003c/em\u003e \u003cstrong\u003e2023\u003c/strong\u003e, 6815504, doi:10.1155/2023/6815504 (2023).\u003c/li\u003e\n\u003cli\u003eQuazi, F., Lenevich, S. \u0026amp; Molday, R. S. ABCA4 is an N-retinylidene-phosphatidylethanolamine and phosphatidylethanolamine importer. \u003cem\u003eNat Commun\u003c/em\u003e \u003cstrong\u003e3\u003c/strong\u003e, 925, doi:10.1038/ncomms1927 (2012).\u003c/li\u003e\n\u003cli\u003eLenis, T. L.\u003cem\u003e et al.\u003c/em\u003e Expression of ABCA4 in the retinal pigment epithelium and its implications for Stargardt macular degeneration. \u003cem\u003eProc Natl Acad Sci U S A\u003c/em\u003e \u003cstrong\u003e115\u003c/strong\u003e, E11120-e11127, doi:10.1073/pnas.1802519115 (2018).\u003c/li\u003e\n\u003cli\u003eFarnoodian, M.\u003cem\u003e et al.\u003c/em\u003e Cell-autonomous lipid-handling defects in Stargardt iPSC-derived retinal pigment epithelium cells. \u003cem\u003eStem Cell Reports\u003c/em\u003e \u003cstrong\u003e17\u003c/strong\u003e, 2438-2450, doi:10.1016/j.stemcr.2022.10.001 (2022).\u003c/li\u003e\n\u003cli\u003eWeng, J.\u003cem\u003e et al.\u003c/em\u003e Insights into the function of Rim protein in photoreceptors and etiology of Stargardt\u0026apos;s disease from the phenotype in abcr knockout mice. \u003cem\u003eCell\u003c/em\u003e \u003cstrong\u003e98\u003c/strong\u003e, 13-23, doi:10.1016/s0092-8674(00)80602-9 (1999).\u003c/li\u003e\n\u003cli\u003eRadu, R. A.\u003cem\u003e et al.\u003c/em\u003e Accelerated accumulation of lipofuscin pigments in the RPE of a mouse model for ABCA4-mediated retinal dystrophies following Vitamin A supplementation. \u003cem\u003eInvest Ophthalmol Vis Sci\u003c/em\u003e \u003cstrong\u003e49\u003c/strong\u003e, 3821-3829, doi:10.1167/iovs.07-1470 (2008).\u003c/li\u003e\n\u003cli\u003eCharbel Issa, P.\u003cem\u003e et al.\u003c/em\u003e Fundus autofluorescence in the Abca4(-/-) mouse model of Stargardt disease--correlation with accumulation of A2E, retinal function, and histology. \u003cem\u003eInvest Ophthalmol Vis Sci\u003c/em\u003e \u003cstrong\u003e54\u003c/strong\u003e, 5602-5612, doi:10.1167/iovs.13-11688 (2013).\u003c/li\u003e\n\u003cli\u003eBibliowicz, J., Tittle, R. K. \u0026amp; Gross, J. M. Toward a better understanding of human eye disease insights from the zebrafish, Danio rerio. \u003cem\u003eProg Mol Biol Transl Sci\u003c/em\u003e \u003cstrong\u003e100\u003c/strong\u003e, 287-330, doi:10.1016/b978-0-12-384878-9.00007-8 (2011).\u003c/li\u003e\n\u003cli\u003eM\u0026auml;kel\u0026auml;inen, S.\u003cem\u003e et al.\u003c/em\u003e An ABCA4 loss-of-function mutation causes a canine form of Stargardt disease. \u003cem\u003ePLoS Genet\u003c/em\u003e \u003cstrong\u003e15\u003c/strong\u003e, e1007873, doi:10.1371/journal.pgen.1007873 (2019).\u003c/li\u003e\n\u003cli\u003eBellingrath, J. S.\u003cem\u003e et al.\u003c/em\u003e Large animal model species in pluripotent stem cell therapy research and development for retinal diseases: a systematic review. \u003cem\u003eFrontiers in ophthalmology\u003c/em\u003e \u003cstrong\u003e4\u003c/strong\u003e, 1377098, doi:10.3389/fopht.2024.1377098 (2024).\u003c/li\u003e\n\u003cli\u003eNoel, N. C. L., MacDonald, I. M. \u0026amp; Allison, W. T. Zebrafish Models of Photoreceptor Dysfunction and Degeneration. \u003cem\u003eBiomolecules\u003c/em\u003e \u003cstrong\u003e11\u003c/strong\u003e, doi:10.3390/biom11010078 (2021).\u003c/li\u003e\n\u003cli\u003eHuckenpahler, A. L.\u003cem\u003e et al.\u003c/em\u003e Noninvasive Imaging of Cone Ablation and Regeneration in Zebrafish. \u003cem\u003eTranslational vision science \u0026amp; technology\u003c/em\u003e \u003cstrong\u003e9\u003c/strong\u003e, 18, doi:10.1167/tvst.9.10.18 (2020).\u003c/li\u003e\n\u003cli\u003eFishman, G. A., Farbman, J. S. \u0026amp; Alexander, K. R. Delayed rod dark adaptation in patients with Stargardt\u0026apos;s disease. \u003cem\u003eOphthalmology\u003c/em\u003e \u003cstrong\u003e98\u003c/strong\u003e, 957-962, doi:10.1016/s0161-6420(91)32196-1 (1991).\u003c/li\u003e\n\u003cli\u003eBurnside, B., Adler, R. \u0026amp; O\u0026apos;Connor, P. Retinomotor pigment migration in the teleost retinal pigment epithelium. I. Roles for actin and microtubules in pigment granule transport and cone movement. \u003cem\u003eInvest Ophthalmol Vis Sci\u003c/em\u003e \u003cstrong\u003e24\u003c/strong\u003e, 1-15 (1983).\u003c/li\u003e\n\u003cli\u003eBurnside, B. \u0026amp; Basinger, S. Retinomotor pigment migration in the teleost retinal pigment epithelium. II. Cyclic-3\u0026apos;,5\u0026apos;-adenosine monophosphate induction of dark-adaptive movement in vitro. \u003cem\u003eInvest Ophthalmol Vis Sci\u003c/em\u003e \u003cstrong\u003e24\u003c/strong\u003e, 16-23 (1983).\u003c/li\u003e\n\u003cli\u003eSolovei, I.\u003cem\u003e et al.\u003c/em\u003e Nuclear architecture of rod photoreceptor cells adapts to vision in mammalian evolution. \u003cem\u003eCell\u003c/em\u003e \u003cstrong\u003e137\u003c/strong\u003e, 356-368, doi:10.1016/j.cell.2009.01.052 (2009).\u003c/li\u003e\n\u003cli\u003eYin, J.\u003cem\u003e et al.\u003c/em\u003e The 1D4 antibody labels outer segments of long double cone but not rod photoreceptors in zebrafish. \u003cem\u003eInvest Ophthalmol Vis Sci\u003c/em\u003e \u003cstrong\u003e53\u003c/strong\u003e, 4943-4951, doi:10.1167/iovs.12-9511 (2012).\u003c/li\u003e\n\u003cli\u003eCideciyan, A. V.\u003cem\u003e et al.\u003c/em\u003e Mutations in ABCA4 result in accumulation of lipofuscin before slowing of the retinoid cycle: a reappraisal of the human disease sequence. \u003cem\u003eHum Mol Genet\u003c/em\u003e \u003cstrong\u003e13\u003c/strong\u003e, 525-534, doi:10.1093/hmg/ddh048 (2004).\u003c/li\u003e\n\u003cli\u003eRaymond, P. A., Barthel, L. K., Bernardos, R. L. \u0026amp; Perkowski, J. J. Molecular characterization of retinal stem cells and their niches in adult zebrafish. \u003cem\u003eBMC Dev Biol\u003c/em\u003e \u003cstrong\u003e6\u003c/strong\u003e, 36, doi:10.1186/1471-213x-6-36 (2006).\u003c/li\u003e\n\u003cli\u003eHernandez-Nunez, I.\u003cem\u003e et al.\u003c/em\u003e Decline in Constitutive Proliferative Activity in the Zebrafish Retina with Ageing. \u003cem\u003eInt J Mol Sci\u003c/em\u003e \u003cstrong\u003e22\u003c/strong\u003e, doi:10.3390/ijms222111715 (2021).\u003c/li\u003e\n\u003cli\u003eWilloughby, J. J. \u0026amp; Jensen, A. M. Abca4, mutated in Stargardt disease, is required for structural integrity of cone outer segments. \u003cem\u003eDis Model Mech\u003c/em\u003e \u003cstrong\u003e18\u003c/strong\u003e, doi:10.1242/dmm.052052 (2025).\u003c/li\u003e\n\u003cli\u003eMenger, G. J., Koke, J. R. \u0026amp; Cahill, G. M. Diurnal and circadian retinomotor movements in zebrafish. \u003cem\u003eVisual neuroscience\u003c/em\u003e \u003cstrong\u003e22\u003c/strong\u003e, 203-209, doi:10.1017/s0952523805222083 (2005).\u003c/li\u003e\n\u003cli\u003eNeuhauss, S. C.\u003cem\u003e et al.\u003c/em\u003e Genetic disorders of vision revealed by a behavioral screen of 400 essential loci in zebrafish. \u003cem\u003eJ Neurosci\u003c/em\u003e \u003cstrong\u003e19\u003c/strong\u003e, 8603-8615, doi:10.1523/jneurosci.19-19-08603.1999 (1999).\u003c/li\u003e\n\u003cli\u003eSanthanam, A., Shihabeddin, E., Wei, H., Wu, J. \u0026amp; O\u0026apos;Brien, J. Molecular basis of retinal remodeling in a zebrafish model of retinitis pigmentosa. \u003cem\u003eCell Mol Life Sci\u003c/em\u003e \u003cstrong\u003e80\u003c/strong\u003e, 362, doi:10.1007/s00018-023-05021-1 (2023).\u003c/li\u003e\n\u003cli\u003eMolday, R. S. ATP-binding cassette transporter ABCA4: molecular properties and role in vision and macular degeneration. \u003cem\u003eJ Bioenerg Biomembr\u003c/em\u003e \u003cstrong\u003e39\u003c/strong\u003e, 507-517, doi:10.1007/s10863-007-9118-6 (2007).\u003c/li\u003e\n\u003cli\u003eWu, L., Nagasaki, T. \u0026amp; Sparrow, J. R. Photoreceptor cell degeneration in Abcr (-/-) mice. \u003cem\u003eAdv Exp Med Biol\u003c/em\u003e \u003cstrong\u003e664\u003c/strong\u003e, 533-539, doi:10.1007/978-1-4419-1399-9_61 (2010).\u003c/li\u003e\n\u003cli\u003eConley, S. M.\u003cem\u003e et al.\u003c/em\u003e Increased cone sensitivity to ABCA4 deficiency provides insight into macular vision loss in Stargardt\u0026apos;s dystrophy. \u003cem\u003eBiochim Biophys Acta\u003c/em\u003e \u003cstrong\u003e1822\u003c/strong\u003e, 1169-1179, doi:10.1016/j.bbadis.2011.10.007 (2012).\u003c/li\u003e\n\u003cli\u003eHanovice, N. J.\u003cem\u003e et al.\u003c/em\u003e Regeneration of the zebrafish retinal pigment epithelium after widespread genetic ablation. \u003cem\u003ePLoS Genet\u003c/em\u003e \u003cstrong\u003e15\u003c/strong\u003e, e1007939, doi:10.1371/journal.pgen.1007939 (2019).\u003c/li\u003e\n\u003cli\u003eBernardos, R. L., Barthel, L. K., Meyers, J. R. \u0026amp; Raymond, P. A. Late-stage neuronal progenitors in the retina are radial M\u0026uuml;ller glia that function as retinal stem cells. \u003cem\u003eJ Neurosci\u003c/em\u003e \u003cstrong\u003e27\u003c/strong\u003e, 7028-7040, doi:10.1523/jneurosci.1624-07.2007 (2007).\u003c/li\u003e\n\u003cli\u003eRaymond, P. A. \u0026amp; Rivlin, P. K. Germinal cells in the goldfish retina that produce rod photoreceptors. \u003cem\u003eDev Biol\u003c/em\u003e \u003cstrong\u003e122\u003c/strong\u003e, 120-138, doi:10.1016/0012-1606(87)90338-1 (1987).\u003c/li\u003e\n\u003cli\u003eMeyer, R. L. Evidence from thymidine labeling for continuing growth of retina and tectum in juvenile goldfish. \u003cem\u003eExperimental neurology\u003c/em\u003e \u003cstrong\u003e59\u003c/strong\u003e, 99-111, doi:10.1016/0014-4886(78)90204-2 (1978).\u003c/li\u003e\n\u003cli\u003eOtteson, D. C., D\u0026apos;Costa, A. R. \u0026amp; Hitchcock, P. F. Putative stem cells and the lineage of rod photoreceptors in the mature retina of the goldfish. \u003cem\u003eDev Biol\u003c/em\u003e \u003cstrong\u003e232\u003c/strong\u003e, 62-76, doi:10.1006/dbio.2001.0163 (2001).\u003c/li\u003e\n\u003cli\u003eMontgomery, J. E., Parsons, M. J. \u0026amp; Hyde, D. R. A novel model of retinal ablation demonstrates that the extent of rod cell death regulates the origin of the regenerated zebrafish rod photoreceptors. \u003cem\u003eJ Comp Neurol\u003c/em\u003e \u003cstrong\u003e518\u003c/strong\u003e, 800-814, doi:10.1002/cne.22243 (2010).\u003c/li\u003e\n\u003cli\u003eWu, D. M.\u003cem\u003e et al.\u003c/em\u003e Cones regenerate from retinal stem cells sequestered in the inner nuclear layer of adult goldfish retina. \u003cem\u003eInvest Ophthalmol Vis Sci\u003c/em\u003e \u003cstrong\u003e42\u003c/strong\u003e, 2115-2124 (2001).\u003c/li\u003e\n\u003cli\u003eSong, P., Fogerty, J., Cianciolo, L. T., Stupay, R. \u0026amp; Perkins, B. D. Cone Photoreceptor Degeneration and Neuroinflammation in the Zebrafish Bardet-Biedl Syndrome 2 (bbs2) Mutant Does Not Lead to Retinal Regeneration. \u003cem\u003eFront Cell Dev Biol\u003c/em\u003e \u003cstrong\u003e8\u003c/strong\u003e, 578528, doi:10.3389/fcell.2020.578528 (2020).\u003c/li\u003e\n\u003cli\u003eBraisted, J. E., Essman, T. F. \u0026amp; Raymond, P. A. Selective regeneration of photoreceptors in goldfish retina. \u003cem\u003eDevelopment\u003c/em\u003e \u003cstrong\u003e120\u003c/strong\u003e, 2409-2419, doi:10.1242/dev.120.9.2409 (1994).\u003c/li\u003e\n\u003cli\u003eMorris, A. C., Scholz, T. L., Brockerhoff, S. E. \u0026amp; Fadool, J. M. Genetic dissection reveals two separate pathways for rod and cone regeneration in the teleost retina. \u003cem\u003eDevelopmental neurobiology\u003c/em\u003e \u003cstrong\u003e68\u003c/strong\u003e, 605-619, doi:10.1002/dneu.20610 (2008).\u003c/li\u003e\n\u003cli\u003eFraser, B., DuVal, M. G., Wang, H. \u0026amp; Allison, W. T. Regeneration of cone photoreceptors when cell ablation is primarily restricted to a particular cone subtype. \u003cem\u003ePLoS One\u003c/em\u003e \u003cstrong\u003e8\u003c/strong\u003e, e55410, doi:10.1371/journal.pone.0055410 (2013).\u003c/li\u003e\n\u003cli\u003eHagerman, G. F.\u003cem\u003e et al.\u003c/em\u003e Rapid Recovery of Visual Function Associated with Blue Cone Ablation in Zebrafish. \u003cem\u003ePLoS One\u003c/em\u003e \u003cstrong\u003e11\u003c/strong\u003e, e0166932, doi:10.1371/journal.pone.0166932 (2016).\u003c/li\u003e\n\u003cli\u003eD\u0026apos;Orazi, F. D., Suzuki, S. C., Darling, N., Wong, R. O. \u0026amp; Yoshimatsu, T. Conditional and biased regeneration of cone photoreceptor types in the zebrafish retina. \u003cem\u003eJ Comp Neurol\u003c/em\u003e \u003cstrong\u003e528\u003c/strong\u003e, 2816-2830, doi:10.1002/cne.24933 (2020).\u003c/li\u003e\n\u003cli\u003eYoshimatsu, T., Schr\u0026ouml;der, C., Nevala, N. E., Berens, P. \u0026amp; Baden, T. Fovea-like Photoreceptor Specializations Underlie Single UV Cone Driven Prey-Capture Behavior in Zebrafish. \u003cem\u003eNeuron\u003c/em\u003e \u003cstrong\u003e107\u003c/strong\u003e, 320-337.e326, doi:10.1016/j.neuron.2020.04.021 (2020).\u003c/li\u003e\n\u003cli\u003eZhou, M.\u003cem\u003e et al.\u003c/em\u003e Zebrafish Retinal Ganglion Cells Asymmetrically Encode Spectral and Temporal Information across Visual Space. \u003cem\u003eCurr Biol\u003c/em\u003e \u003cstrong\u003e30\u003c/strong\u003e, 2927-2942.e2927, doi:10.1016/j.cub.2020.05.055 (2020).\u003c/li\u003e\n\u003cli\u003eHaug, M. F., Biehlmaier, O., Mueller, K. P. \u0026amp; Neuhauss, S. C. Visual acuity in larval zebrafish: behavior and histology. \u003cem\u003eFrontiers in zoology\u003c/em\u003e \u003cstrong\u003e7\u003c/strong\u003e, 8, doi:10.1186/1742-9994-7-8 (2010).\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Retinal Degeneration, Zebrafish, abca4b, CRISPR editing, Stargardt Macular Degeneration, Retinal Stem Cells","lastPublishedDoi":"10.21203/rs.3.rs-7346082/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7346082/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eMutations in \u003cem\u003eABCA4\u003c/em\u003e gene causes Stargardt macular degeneration, which manifests with toxic lipofuscin deposits in the outer retina, gradual atrophy of RPE cells, followed by photoreceptor cell loss. The cone-enriched retina, with macula-like \u0026lsquo;area-temporalis\u0026rsquo; of zebrafish are better models than rodents for studying human macular dystrophies. Here, we generated \u003cem\u003eabca4b\u003c/em\u003e knockout zebrafish model using CRISPR/Cas9 editing and evaluated the early and late-stage retinal changes. In adult \u003cem\u003eabca4b\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u0026minus;/\u0026minus;\u003c/em\u003e\u003c/sup\u003e mutants, the RPE cells exhibited hyperpigmentation, altered retinomotor behaviour and lipofuscin accumulation, but they remained viable. However, the photoreceptors underwent progressive degeneration, with a sequential loss of blue and UV cones, followed by red and green cones and finally the rod cells. This triggered the chronic activation and early depletion of retinal stem cells at the ciliary marginal zone of mutants and resulted in accelerated outer-retinal degeneration and severe visual defects, despite them retaining the M\u0026uuml;ller glia-dependant retinal repair potential.\u003c/p\u003e","manuscriptTitle":"Loss of retinal stem cell reserve and lipofuscin accumulation accelerates cone-rod degeneration and replicates Stargardt disease in abca4b null zebrafish","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-08-27 11:59:41","doi":"10.21203/rs.3.rs-7346082/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2025-10-06T16:13:18+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-10-02T03:10:56+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"68190864872188124684465223224942334888","date":"2025-09-27T06:06:11+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-09-16T08:37:06+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"288232194069429716838269072671626923143","date":"2025-09-06T22:20:24+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-08-19T14:06:27+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-08-19T13:45:02+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2025-08-19T07:24:15+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-08-18T04:07:49+00:00","index":"","fulltext":""},{"type":"submitted","content":"Scientific Reports","date":"2025-08-18T04:03:26+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"33cafee0-8f62-4302-8170-20f0d32e3757","owner":[],"postedDate":"August 27th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[{"id":53676068,"name":"Biological sciences/Cell biology"},{"id":53676069,"name":"Biological sciences/Developmental biology"},{"id":53676070,"name":"Health sciences/Diseases"},{"id":53676071,"name":"Biological sciences/Neuroscience"},{"id":53676072,"name":"Biological sciences/Stem cells"}],"tags":[],"updatedAt":"2025-11-24T16:06:15+00:00","versionOfRecord":{"articleIdentity":"rs-7346082","link":"https://doi.org/10.1038/s41598-025-28951-1","journal":{"identity":"scientific-reports","isVorOnly":false,"title":"Scientific Reports"},"publishedOn":"2025-11-21 15:58:02","publishedOnDateReadable":"November 21st, 2025"},"versionCreatedAt":"2025-08-27 11:59:41","video":"","vorDoi":"10.1038/s41598-025-28951-1","vorDoiUrl":"https://doi.org/10.1038/s41598-025-28951-1","workflowStages":[]},"version":"v1","identity":"rs-7346082","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7346082","identity":"rs-7346082","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2025) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00
unpaywall
last seen: 2026-05-23T02:00:01.238055+00:00
License: CC-BY-4.0