Red Light-Activated Reversible Inhibition of Protein Functions by Assembled Trap

29 Red light offers strong tissue penetration and low phototoxicity, making it an attractive 30 option for optogenetic applications. However, the available red light -inducible 31 optogenetic tools are rather limited. Here, we present a novel red light-induced protein 32 clustering system, namely R -LARIAT (Red Light-Activated Reversible Inhibition by 33 Assembled Trap), that controls protein functions in a spatiotemporal manner. Our 34 system capitalizes on the rapid and reversible binding of LDBs (nanobodies-based 35 dimerization binders) to a bacterial phytochrome DrBphP, which uses a mammalian 36 endogenous biliverdin chromophore to absorb red light. An anti -GFP nanobody fused 37 with LDBs allows this method to quickly trap a wide variety of GFP -tagged proteins 38 into light-induced protein clusters. Strikingly, our system exhibits an excellent 39 performance in clustering efficiency with high light sensitivity and stability, it can 40 function even when shielded by multiple glass plates. By utilizing the R -LARIAT 41 system to tr ap and sequester tubulin, cell cycle progression can be blocked in HeLa 42 cells. Therefore, the R-LARIAT system takes advantage of red light with greater tissue 43 penetration and holds the potential to precisely control protein functions in living 44 organisms. 45 46

Optogenetics, Red light, DrBphP, Nanobody, LARIAT, LDB 47 48

49 Nature has evolved diverse organisms, including plants, algae, bacteria, fungi, and 50 corals, that serve as rich sources of photoreceptors 1, 2. These photoreceptors usually 51 absorb light from 300 nm (ultraviolet; UV) to 800 nm (near-infrared light; NIR) range, 52 triggering photochemical reactions that may induce conformational changes of 53 photosensitive domains. Such light-induced conformational changes can be relayed to 54 an attached effector domain to control various functions of proteins of interest (POIs) 55 in optogenetics3-5. Optogenetic technology has been widely used to modulate protein 56 activity with high spatiotemporal resolution, such as CRY2 -CIB16 , iLID -sspB27 , 57 (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted March 13, 2025. ; https://doi.org/10.1101/2025.03.10.642306doi: bioRxiv preprint 3 LOV28, 9 and the Magnet system4. These photosensitive modules have been engineered 58 into proteins of interest or anchored to the plasma membrane to manipulate cellular 59 functions, including cell dynamics 4, signal transduction 10, and gene expression 11, 12. 60 Additionally, optogenetic switches can also be applied t o the split-protein reassembly 61 system, allowing light control of various bioactive proteins including nucleases 13, 14, 62 recombinases15, 16, proteases 17, polymerases 18, antibodies 19, and neurotoxins 20. 63 However, most optogenetic strategies focus o n protein activation, those strategies for 64 precise and effective inhibition of target proteins in a spatiotemporal specific manner 65 are very limited. 66 Traditional genetic perturbation methods, including gene mutation or deletion and 67 RNA interference, have been widely used to study protein function, but such genetic 68 strategies are typically irreversible and require a relatively long time to exert their 69 effects, and tend to induce side effects, such as lethality early in development 21-23. 70 Optogenetic tools provide a promising opportunity for inhibiting the activities and 71 functions of proteins with rapid reversibility and high spatiotemporal resolution. UV-B 72 photoreceptor from Arabidopsis, UVR8 exits as homodimers in the dark and dissociates 73 into monomers in response to UV-B light (280–310 nm)24. Two copies of UVR8 were 74 fused to an endoplasmic reticulum (ER) -processed protein, which led to sequestration 75 of the fusion protein in the ER in darkness 25. UV-B light induced the release of the 76 fusion protein from the ER by disassembly of the dimers. Another versatile optogenetic 77 strategy call ed LARIAT (Light -Activated Reversible Inhibition by Assembled Trap) 78 can also inhibit protein function by reversibly sequestering target proteins into large 79 clusters in living mammalian cells21. 80 The LARIAT system based on blue light (450 –500 nm) is comprised of a 81 photoreceptor cryptochrome 2 (CRY2) -fused the anti -GFP nanobody and a 82 cryptochrome-interacting basic -helix-loop-helix1 (CIB1) -fused multimeric protein 83 (MP; CIB1-MP). Upon blue light stimulation, the CRY2 proteins form simultaneously 84 homo-oligomers and heterodimers with CIB1-MP, which drives the formation of large 85 clusters through interconnections among CIB1-MP to trap and inactivate GFP-labeled 86 (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted March 13, 2025. ; https://doi.org/10.1101/2025.03.10.642306doi: bioRxiv preprint 4 proteins captured by anti -GFP nanobody26, 27. However, the limited tissue penetration 87 capability of blue light greatly hampers LARIAT’s in vivo application. Since t he 88 majority of optogenetic tools based on short-wavelength lights such as violet (380–440 89 nm), blue (440–485 nm), or green (510–565 nm), only have limited tissue penetration 90 capability8, 28, 29. As an alternative, red and near-infrared light (650–900 nm) offer better 91 tissue penetration and exhibit lower phototoxicity than other visible and UV light 30, 31, 92 which make them a promising and ideal candidate for optogenetic tools. 93 Phytochromes are a class of bilin -binding photoreceptors found in plants, 94 cyanobacteria or algae, bacteria and fungi, that response to red and far -red light32, 33. 95 Phytochromes can typically switch between the red light-absorbing Pr state and the far-96 red light-responsive Pfr state34. Phytochrome B (PhyB), derived from Arabidopsis, uses 97 the phytochromobilin (PΦB) chromophore to absorb red light (660 nm), switching to 98 an activated state where it can bind to phytochrome-interacting factors (PIFs). And this 99 binding is reversible upon exposure to infrared light (720 nm) 5, 35. The PhyB/PIFs 100 system enables reversible nuclear localization of proteins, allowing light -regulated 101 control of protein positioning in mammalian cells and zebrafish 36. The cyanobacterial 102 phytochrome 1 (Cph1) uses phycocyanobilin (PCB) as the chromophore and exhibits 103 reversible dimer-to-monomer transition when light switches from 660 nm to 740 nm37. 104 Cph1 was fused to neurotrophin receptor TrkB and FGFR1 to enable red light-inducible 105 activation of RTK -mediated signaling 37. Although these red l ight-activatable 106 photoswitches have been developed and applied to regulate vary biological activities, 107 they require addition of exogenous chromophores in mammalian cells, thereby limiting 108 their application. 109 The bacteriophytochrome photoreceptor 1 (BphP1) derived from 110 Rhodopseudomonas palustris uses biliverdin (BV), a metabolite abundantly present in 111 mammals, as the chromophore38, 39, and can form a heterodimer with its natural binding 112 partner RpsR2 upon 760-nm NIR light. And the heterodimer dissociates in darkness or 113 under 660-nm red light irradiation 32. However, PpsR2 can bind to the apoprotein of 114 BphP1 irrespective of red light illumination, indicating high dark activity in 115 (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted March 13, 2025. ; https://doi.org/10.1101/2025.03.10.642306doi: bioRxiv preprint 5 BphP1/PpsR2 system40, 41, which greatly hinders its future utilization. Recently, several 116 nanobodies were successfully selected to specifically bind to another BphP derived 117 from Deinococcus radiodurans phytochrome (DrBphP) with low dark activity and high 118 specificity under 654 -nm red light illumination 40-42. The DrBphP-nanobody 119 heterodimers dissociate from Pfr state to fr state under 780 nm irradiation or in the 120 darkness. Photoswitches based on DrBphP and its nanobody-based binders have been 121 used to reversibly regulate gene expression and signal pathway in living cells and 122 mammalian animals 40, 41. However, the red light -controlled reversible inactivation 123 system by trapping or sequestering POIs is currently unavailable. 124 Here, we developed a versatile optogenetic strategy controlled by red light (660 125 nm) for reversibly inhibiting target proteins, by engineering the photosensor DrBphP 126 fused with multimeric proteins and the nanobody -based binders LDBs (Light 127 Dependent Binders) fused with nanobodies of tagged proteins, namely R-LARIAT (Red 128 Light-Activated Rev ersible Inhibition by Assembled Trap). The R -LARIAT allows 129 rapid and reversible control of protein function by sequestering tagged proteins 130 captured by nanobodies of tagged proteins into large clusters with red light illumination. 131 We demonstrated that 2× L DBs connected by two copies of GGGGS -linker 132 dramatically increase clustering efficiency for effective GFP-tagged proteins inhibition 133 by sequestration. We also showed that the R-LARIAT has been tested for disrupting 134 mitotic progression by trapping Tubulins. Our R-LARIAT system take advantage of red 135 light with deeper penetration ability, and photochemical properties of DrBphP that use 136 the mammalian endogenous metabolite as chromophores, offering new applicat ion 137 prospects for deep tissue even living animals in the future. 138 139

AND DISCUSSION 140 Red light irradiation did not cause significant DNA damage 141 LARIAT is an effective strategy to reversibly inactivate proteins of interest by 142 sequestering them into clusters with blue light21, 26. However, long-term exposure to 143 blue light might cause DNA damage to mammalian cells , which limits the application 144 (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted March 13, 2025. ; https://doi.org/10.1101/2025.03.10.642306doi: bioRxiv preprint 6 of this technology in vivo43, 44. To evaluate whether red light is more advantageous in 145 phototoxicity, we compared the effects of red light (450 nm) versus blue light (660 nm) 146 using phosphorylated H2A.X ( -H2A.X) staining as an indication of DNA damage in 147 human U2OS cells (Figure 1A). After exposing the cells to either red or blue light for 148 2 hours, we observed a significantly increased percentage of -H2A.X positive nuclei 149 under blue light exposure, but not red light (Figure 1B). The results indicate that red 150 light may be a safer choice for optogenetically manipulating the activity of target 151 proteins in living cells. Thus, considering that red light is capable of penetrating deeper 152 tissues than shorter -wavelength blue light 38, 45, we hypothesized that a red light -153 dependent LARIAT system could be more suitable for in vivo applications (illustrated 154 in Figure 1C). 155 156 Figure 1. Prolonged exposure to blue light can cause DNA damage. 157 (A) Fluorescence imaging of red light (660 nm) or blue light (450 nm) -induced γ-H2A.X 158 expression in U2OS cells. Nuclei were labeled by DAPI. Scale bar: 10 µm. (B) Statistical data 159 showing the percentage of γ-H2A.X foci positive cells among total DAPI -stained cells (n = 5 160 per group). Data are presented as mean ± SEM. Statistical analysis was performed using one -161 way ANOV A with Tukey’s multiple comparisons test. n.s., not significant; ***P < 0.001. (C) 162 Cartoon diagram showing the red light-induced LARIAT system to arrest proteins of interest 163 (POIs). 164 165 Creating a red light-induced protein clustering system 166 In the original LARIAT system21, 26, the photosensitive protein CRY2 senses blue light, 167 triggering its oligomerization and binding to CIB1, which subsequently forms clusters 168 to trap GFP -tagged proteins (Figure S1). Therefore, we sought to replace the CRY2 169 (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted March 13, 2025. ; https://doi.org/10.1101/2025.03.10.642306doi: bioRxiv preprint 7 with a red light-responsive protein. A truncated bacterial photoreceptor DrBphP derived 170 from Deinococcus radiodurans, whose photoswitching efficiency closely matches that 171 of the full-length DrBphP46, 47, fits our needs perfectly. First, DrBphP responds to a 660 172 nm-red light excitation wavelength that causes almost no DNA damage t o cells even 173 after prolonged exposure (Figure 1A). Second, DrBphP relies on biliverdin (BV) as a 174 chromophore, which is a natural metabolite in most eukaryotes. Third, nanobodies (i.e. 175 LDB-3 and LDB-14) specifically recognizing and binding the red light-activated form 176 of DrBphP are readily available41. 177 Therefore, we cloned the DrBphP and DrBphP-binding nanobodies, LDBs (light-178 induced dimerization binders) into a single plasmid by 2A linker system to ensure 179 constant relative amounts of DrBphP and LDBs in transfected ovarian somatic cells 180 (OSCs) of Drosophila. We investigated three scenarios corresponding to different 181 designs for fusion proteins ( Figure 2A and Figure S2). In scenario (I), DrBphP was 182 fused with the VHH(GFP) (anti-GFP nanobody) that binds specifically to GFP fusion 183 proteins while one copy of LDB was fused with a CaMKII α multimerization domain 184 (MP)-mCherrry (MP-mCherry) (Figure 2A-Ⅰ and Figure S2A), analogous to the blue 185 light-dependent LARIAT (Figure S1). In scenario (II), like (I) except two copies of LDB 186 (2× LDBs, LDB-3 and LDB-14) connected by a GGGGS linker were used (Figure 2A-187 Ⅱ and Figure S2B). In scenario (III), 2× LDBs were fused with the anti-GFP nanobody 188 while DrBphP was fused with the MP-mCherry (Figure 2A-Ⅲ and Figure S2C). 189 To test the ability of these constructs to form clusters with GFP fusion protein s 190 under red light activation, we engineered a GFP knock-in tag to the C-terminus of the 191 Panoramix (Panx) open reading frame in OSC s using CRISPR/Cas9 (Figure S3A–C). 192 As a positive control, we tested the original LARIAT system based on CRY2/CIBN (an 193 N-terminal fragment of the CIB1) using the Panx-GFP as a target. Consistent with the 194 published results21, the protein clustering capability depends on wildtype CRY2 as well 195 as the presence of both CIBN and blue light induction (Figure S4A–D). Then we tested 196 the three constructs based on DrBphP/LDBs using the same Panx-GFP cell lines with 197 660-nm red light illumination (Figure 2B–D). The construct (III) demonstrated the most 198 (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted March 13, 2025. ; https://doi.org/10.1101/2025.03.10.642306doi: bioRxiv preprint 8 efficient clustering ability like the blue light-dependent LARIAT (Figure S4A), with the 199 mCherry spots (DrBphP-mCherry-MP) almost completely co-clustering the GFP spots 200 (Panx-GFP) in a red light-dependent manner (Figure 2D). 201 202 Figure 2. Design and validation of a novel protein clustering system induced by red 203 light. 204 (A) Schematic diagrams of three different scenarios for construction of fusion proteins. 205 (B–D) Representative fluorescence images (left) and intensity profile (right) for Panx-206 GFP and LDB-MP (B), LDBs -MP (2× LDBs) (C), or DrBphP-MP (D) in Panx-GFP 207 cells expressing the indicated constructs as Figure 2A-I, II or III in Drosophila after 30 208 min of 660-nm illumination. Scale bar: 2 µm. 209 210 Optimization of the red light-induced protein clustering system 211 Since significant clusters of Panx-GFP were observed only when LDB-3 and LDB-14 212 connected by a GGGGS linker peptide were fused to the C -terminus of V HH(GFP) 213 (Figure 2A-III and Figure 2D). And the photosensory module (PSM) of DrBphP exists 214 (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted March 13, 2025. ; https://doi.org/10.1101/2025.03.10.642306doi: bioRxiv preprint 9 as a head-to-head parallel dimer48, 49. We suspected that each nanobody module of the 215 2× LDBs may bind one copy of DrBphP in the dimer respectively. Therefore, t he 216 distance between the two LDBs could be critical for its binding the DrBphP dimer. For 217 this, we first tested the ability of 2 × LDBs with different GGGGS-linker lengths (1×, 218 2×, 3×, 4×) to bind DrBphP by a yeast two -hybrid (Y2H) assay. Upon red light 219 treatment, the yeast expressing DrBphP and 2× LDBs with different linker lengths 220 could grow on selective plates supplemented with 3 -AT up to 10 mM (Figure S5A). 221 Conversely, only relatively weak interactions can be detected under dark conditions 222 (Figure S5B), indicating the interactions induced by red light between DrBphP and 2× 223 LDBs are much stronger. 224 Since no significant differences in strength of the interaction s between DrBphP 225 and 2× LDBs with different linker lengths by the Y2H assay, we directly tested the 226 cluster-forming ability of these different 2× LDBs in Panx-GFP cells (Figure 3A, left 227 panel). By counting the percentage of cluster -containing cells upon red light 228 illumination, we found that two copies of the GGGGS -linker were the most efficient 229 constructs, in which about 70% cells with LARIAT expression could form clusters 230 perfectly (Figure 3A, right panel and Figure 3B–3D). 231 Therefore, the optimal clustering efficiency induced by red light was achieved 232 when LDB-3 and LDB-14 were connected by two copies of GGGGS -linker and fused 233 with the GFP nanobody (VHH(GFP)), while DrBphP was fused with the MP-mCherry. 234 Here, we present a novel red light-induced protein clustering system called R-LARIAT 235 (red Light-Activated Reversible Inhibition by Assembled Trap) (Figure 4A-Ⅰ). Similar 236 to the original blue -light LARIAT, DrBphP undergoes a conformational change upon 237 exposure to the 660-nm red light and binds to the LDBs -(VHH(GFP)) fusion proteins, 238 thereby sequestering the GFP fusion proteins into large protein clusters formed by the 239 multimerization action of MP (Figure 4A-Ⅱ). 240 (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted March 13, 2025. ; https://doi.org/10.1101/2025.03.10.642306doi: bioRxiv preprint 10 241 Figure 3. Optimization of the linker lengths in red light -induced protein clustering 242 system. 243 (A) Left: The sequence and length of linkers between LDB-3 and LDB-14 for red light-244 induced protein clustering system. Right: Statistical data of the percentage of cluster-245 containing cells among total mCherry positive cells after 30 minutes of 660 -nm 246 illumination (n = 5 per group). Data are presented as mean ± SEM. Statistical analysis 247 was performed using one -way ANOV A with Tukey’s multiple comparisons test. *P < 248 0.05, **P < 0.01. (B–E) Representative fluorescence images (left) and intensity profile 249 (right) for mCherry -MP and Panx -GFP in Panx-GFP cells transfected with the R -250 LARIAT plasmid containing the 1× linker (B), 2× linkers (C), 3× linkers (D), or 4× 251 (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted March 13, 2025. ; https://doi.org/10.1101/2025.03.10.642306doi: bioRxiv preprint 11 linkers (E) between LDB-3 and LDB-14 after 30 minutes of 660-nm illumination. Scale 252 bar: 2 µm. 253 254 Characterization of R-LARIAT 255 To assess the characterization of R-LARIAT, we firstly explored the time-dependence 256 of protein clustering upon the red light exposure. We found that protein clusters could 257 be detected in around 40% of cells expressing R-LARIAT as early as after 5-minute red 258 light stimulation, and the percentage would reach up to approximately 70% under 40-259 minute of red light illumination (Figure 4B). Next, we examined the half-life of cluster 260 dissociation by moving cells into a dark environment following a 40-minute red-light 261 illumination. The clusters maintained at similar levels up to 4-hour darkness and then 262 dropped significantly at 8 hours (Figure 4 C). These results indicate our R -LARIAT 263 system has considerable advantages in the aspect of cluster formation and dissociation. 264 Since red light is known to be able to penetrate deep tissues38, 45, we tested whether 265 our R-LARIAT system could function well through glass plates (1 mm thickness). We 266 placed 0, 1, 2, 3, or 4 glass plates on the top of cells and illuminated cell through the 267 glass plates with 660 nm-red light for 20 minutes. Strikingly, even with four glass plates 268 covering the cells, the efficiency of protein clustering remained at approximately 60% 269 as if the glass plates were never there (Figure 4D). 270 To further test the ability of R -LARIAT to sequester other GFP -tagged proteins, 271 we engineered a GFP knock-in tag at the N-terminus of the Eggless (Egg) open reading 272 frame in OSCs (Figure S6A). We found that GFP -Egg spots almost completely co -273 clustered the MP-mCherry spots under red light illumination (Figure S6B), indicating 274 our R-LARIAT system can be used to sequester diverse GFP-labeled proteins. Similarly, 275 dramatic cluster formation could be observed in OSCs expressing another mCherry 276 knock-in tag at Mael locus upon red light stimulation (Figure S6C and S6D). These 277

indicate the potential of our R -LARIAT system for sequestering a wide variety 278 of proteins captured by different tag proteins. 279 (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted March 13, 2025. ; https://doi.org/10.1101/2025.03.10.642306doi: bioRxiv preprint 12 280 Figure 4. Characterization of R-LARIAT. 281 (A) Schematic diagrams illustrating the modules (I) and working model (II) of the R-282 LARIAT system. The DrBphP fused mCherry-MP undergoes a conformational change 283 upon exposure to 660-nm red light and binds to the LDBs -VHH(GFP) fusion proteins 284 to capture and sequester GFP-tagged proteins into large protein clusters. (B) Statistical 285 data of the percentage of cluster -containing cells induced by red light with different 286 irradiation time. (C) Statistical data showing the percentage of cluster-containing cells 287 when kept in the dark at different time point s after 40-min red light irradiation. (D) 288 Statistical data showing the percentage of cluster -containing cells when illuminated 289 through different numbers of the 1 -mm thick glass plate with 660-nm red light for 20 290 minutes. 291 292 R-LARIAT successfully sequesters Tubulin to inhibit mitosis. 293 To demonstrate our newly developed R-LARIAT c an indeed manipulate protein 294 function, we constructed stable HeLa cell lines expressing GFP-Tubulin as a target. The 295 DrBphP-MP fusion was expressed to sense the red light and the VHH(GFP)-LDBs 296 fusion was used to capture the light -activated DrBphP aggregates in the GFP-Tubulin 297 (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted March 13, 2025. ; https://doi.org/10.1101/2025.03.10.642306doi: bioRxiv preprint 13 cells. As a negative control, MP alone with no DrBphP module was used. Upon red 298 light illumination, the DrBphP-MP signals (stained with V5 tag antibody) could 299 colocalize GFP-Tubulin signals (Figure 5A , bottom panel), indicating that the 300 VHH(GFP)-LDBs fusion suc cessfully sequestered GFP -Tubulin proteins into the 301 DrBphP-MP clusters. In contrast, MP alone remained diffusely distributed with little or 302 no colocalization with GFP-Tubulin (Figure 5A, top panel). 303 To examine the functional consequences of GFP -Tubulin sequestration, we 304 synchronized the HeLa cells with the CDK1 inhibitor (RO-3306) by arresting most of 305 the cells at the G2/M transition. Then the cells were illuminated with 660 nm-red light 306 for 10 min to sequester GFP -Tubulin. Then RO-3306 was washed away to allow the 307 cell cycle to proceed. We collected cells for statistical analysis of cell cycle distribution 308 at different time points (0.5, 1, and 1.5 hours) follow ing the cell cycle progression 309 (illustrated in Figure 5B). M phase cells could be classified into three categories, 310 metaphase (highlighted with triangles) ; anaphase/telophase (highlighted with circles ) 311 and others, based on GFP-Tubulin and DNA morphologies (labeled with RFP-H2B)50. 312 Consistent with the published results21, sequestering GFP-Tubulin by R-LARIAT led to 313 a significantly increase in the percentage of metaphase cells, accompanied by a decrease 314 in the anaphase/telophase phase after withdrawal of RO-3306 for 1 and 1.5 hours, but 315 this phenomenon was not observed when using R-LARIAT without DrBphP (Figure 316 5C and 5D).These results i ndicated that the cell cycle was significantly slowed down 317 by the R-LARIAT trapping the GFP -Tubulin. Therefore, our newly developed R-318 LARIAT can be used to efficiently manipulate protein functions with high 319 spatiotemporal resolution through light-induced clustering in living cells. 320 (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted March 13, 2025. ; https://doi.org/10.1101/2025.03.10.642306doi: bioRxiv preprint 14 321 (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted March 13, 2025. ; https://doi.org/10.1101/2025.03.10.642306doi: bioRxiv preprint 15 Figure 5. R-LARIAT can inhibit mitotic progression by trapping Tubulin. 322 (A) Representative fluorescence images showing the colocalization of GFP -Tubulin 323 and DrBphP-MP in HeLa cells expressi ng R-LARIAT upon red light illumination. 324 Scale bar: 1 µm. (B) A schematic depicting workflow of blockage of cell cycle. (C and 325 D) The percentage of cells in different phases (C) and the expression of RFP-H2B and 326 GFP-Tubulin (D) after withdrawal of RO -3306 for 0.5, 1 and 1.5 hours in HeLa cells 327 expressing R-LARIAT with (DrBphP +) or without DrBphP (DrBphP −) upon red light 328 illumination. M phase cells were classified according to the morphologies of GFP -329 Tubulin and chromosomes (RFP-H2B labelled). White circles denote cells in telophase 330 while triangles denote cells in metaphase. Scale bar: 15 µm. 331 332

333 Red light, with its high tissue penetration ability and low photodamage characteristics, 334 has become one of the preferred choices in optogenetics31. However, the development 335 of red light optogenetic tools is rather limited, restricting their application at the tissue 336 level. To bridge this gap, we developed a novel red light-induced protein clustering 337 system designed to overcome the limitations of existing technologies with the hope of 338 broadening the applications of optogenetics. 339 Our R-LARIAT system relies on the rapid and specific interaction between the red 340 light-sensitive DrBphP and its binder nanobody LDB 41. This interaction ultimately 341 forms large protein clusters through promoting interconnection among DrBphP-342 conjugated multimeric proteins (MPs), enabling the trapping of GFP-tagged proteins 343 captured by a GFP -specific nanobody (VHH(GFP)) to eliminate their functions. 344 Through this mechanism, we successfully constructed a red light -induced protein 345 clustering system capable of precisely controlling the aggregation state of target 346 proteins, thereby disturbing their functions (Figure 4A). Consequently, our system 347 demonstrates a high light sensitivity and stability, as clusters could be induced in about 348 of the 40% cells with only 5 -min red -light illumination and were maintained for 349 approximately 4 hours after the withdrawal of light. 350 Compared to the original blue light version of LARIAT, R- LARIAT based on red 351 light almost does not cause significant DNA damage in living cells. Perhaps most 352 importantly, R-LARIAT can penetrate through multiple glass plates (4-mm thickness), 353 which holds the potential to be applied in live transparent animals such as C. elegans 354 (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted March 13, 2025. ; https://doi.org/10.1101/2025.03.10.642306doi: bioRxiv preprint 16 or Zebrafish. And our R-LARIAT system should be useful for controlling many cellular 355 processes by trapping diverse target proteins into clusters to sequester their functions, 356 such as gene expression, signaling pathway , cell metabolism, immune responses , 357 neuronal activity, etc. Alternatively, the R -LARIAT can be coupled with the 358 E3/ubiquitin/proteasome pathway to simultaneously cluster and degrade target proteins, 359 potentially further increasing the robustness of this optogenetic tool. Our newly 360 developed R-LARIAT provides researchers with powerful and flexible tools for 361 modulating protein activity with high spatiotemporal resolution and reversibility , 362 further expanding the versatility of this technique. 363 364

365 Plasmid construction. 366 The core modules of R -LARIAT, a truncated version DrBphP without the histidine kinase 367 domain, and the nobody-based binders for DrBphP, LDB-3/LDB-14 were amplified from the 368 NanoReD system 41, then were cloned into the pENTR4 vector (Thermo Fisher Scientific, 369 A10465). Subsequently, they were recombined into the pUbiquitin gateway vector for 370 expression in flies and the pCAGG gateway vector fo r expression in mammals through LR 371 Clonase II (Invitrogen) -mediated recombination. The sequence of CIBN (an N -terminal 372 fragment of the CIB1 ) and CRY2PHR (the photolyase homology region of CRY2) or 373 CRY2PHR (D387A) (a mutant of CRY2 ) in blue light-mediated LARIA T system were 374 amplified from those vectors in published paper 27. The anti-GFP nanobody (VHH(GFP)) and 375 anti-mCherry nanobody sequences were cloned from a PHR -VHH(GFP) vector 27 and a 376 pGEX6P1-mCherry-Nanobody vector (Addgene, 70696) respectively. All primers used in this 377 study were listed in Supplementary Table 1. 378 The gRNAs targeting Panoramix (Panx), Maelstrom (Mael), and Eggless (Egg) of Drosophila 379 were designed using the website: http://crispor.tefor.net/, then were cloned into the CFD4 vector 380 (Addgene, 49411), following previously described methods51. The sequence of gRNAs utilized 381 in this research were listed in Supplementary Table 2. Gene fragments of Tubulin and H2B were 382 amplified from the cDNA of HEK293T cells using PCR, then were cloned into the pENTR4 383 (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted March 13, 2025. ; https://doi.org/10.1101/2025.03.10.642306doi: bioRxiv preprint 17 vector. Subsequently, pENTR4-Tubulin was recombined into the MSCV-GFP-Gateway vector 384 through LR reaction, and pENTR4-H2B was recombined into pCW-λn-2×flag-RFP-Gateway. 385 The plasmids information and genes sequence utilized in this research were listed in 386 Supplementary Table 3 and Supplementary Table 4. 387 388 Cell culture and generation of stable cell lines. 389 The Ovarian somatic cells (OSCs) from Drosophila, HeLa cell line and U2OS cells used in this 390 study originated from the Cold Spring Harbor Laboratory in the United States. The OSC cells 391 were typically cultured in the Shields and Sang M3 Insect Media (Sigma) supplemented with 392 10% FBS (Fetal Bovine Serum), 5% fly extract, 0.6 mg/ml glutathione, and 10 mg/ml insulin 393 in a constant temperature (25°C) and humidity incubator. The HeLa cells and U2OS cells were 394 generally cultured in a DMEM media supplemented with 10% FBS and 1% 395 Penicillin/Streptomycin in a constant temperature (37°C) and humidity (60%) incubator wit h 396 5% CO2. 397 Cells were seeded in 6-well plates to reach approximately 80% confluency for transfection. The 398 Panx-GFP, GFP-egg and mCherry-Mael cell lines were established using CRISPR/Cas952. The 399 OSC cells were co-transfected with the CFD4 plasmids expressing sgRNA targeted Panx, Egg 400 or Mael (1.5 µg/well), the homologous arm (1.5 µg/well) containing selective markers and 401 inserted tags (GFP or mCherry), and the plasmid encoding wild-type spCas9 (1.5 µg/well) using 402 FuGENE HD (Promega, E2312). The stable cell lines were generated by antibiotic selection 403 according t o the relative resistance genes at 48 hours post -transfection. The Panx-GFP and 404 GFP-egg cell line were selected by the blasticidin (10 µg/mL), while mCherry-Mael cell line 405 were selected by hygromycin (50 µg/mL) in OSCs. HeLa cells were co-transfected with the 406 MSCV-GFP-Tubulin plasmid (2 µg/well) and the pCW -λn-2×flag-RFP-H2B plasmid (2 407 µg/well) using Lipofectamine 2000 (Invitrogen, 11668030). The stable GFP-Tubulin/RFP-H2B 408 cell line were selected by the puromycin (1 µg/mL) and Neromycin (400 µg/mL) in HeLa cells. 409 Then GFP-Tubulin/RFP-H2B cell line was transfected with the R-LARIA T plasmids by using 410 Lipofectamine 2000 and selected by blasticidin (10 µg/mL) for establishment of GFP-411 Tubulin/RFP-H2B/R-LARIAT cell line. All the cell lines were validated via genomic PCR, RT-412 (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted March 13, 2025. ; https://doi.org/10.1101/2025.03.10.642306doi: bioRxiv preprint 18 PCR, and Western blotting. 413 414 Photoexcitation experiment. 415 Panx-GFP cells were transfected with LARIAT plasmids by using FuGENE HD. Next, the cells 416 expressing LARIA T constructs were dissociated and seeded on the glass coverslip in a 6-well 417 plate (Corning) at 48 hours post -transfection and allowed them to adhere for at last 6 hours 418 before imaging. Then cells adhered to the surface were either exposed to 660-nm red light (20 419 mW/cm²) or kept in the dark for 30 min. While the cells expressing the original LARIAT were 420 subjected to 450-nm blue light (20 mW/cm²) for 10 min. Subsequently, the cells were fixed and 421 subjected to immunofluorescence or imaging directly. 422 423 Y2H assay. 424 The Y2H assays were performed using Y187 strain. The fragments of DrBphP were cloned into 425 the pGBKT7 DNA -BD vector (Takara, Cat.#630443), while LDB -3 and LDB -14 fragments 426 connected by 1× linker, 2× linkers, 3× linkers, or 4× linkers were cloned into the pGADT7 AD 427 vector (Takara, Cat.#630442). The colonies containing double plasmids were selected on -Leu-428 Trp YSD plates and confirmed by colony PCR. To detect the protein-protein interactions under 429 red light illumination, single colonies in serial dilutions were plated onto -Leu-Trp-His plates 430 with varying concentrations of 3 -AT. The empty BD vectors without DrBphP were used as a 431 negative control. 432 433 Western blot 434 The cells were digested by trypsin and collected into a centrifuge tube, then were washed twice 435 with PBS, and lysed in RIPA buffer (50 mM Tris-HCl, pH 8.0, 150 mM NaCl, 1% NP-40, 1% 436 sodium deoxycholate, 0.1% SDS, 0.1 mM DTT, PMSF and protease inhibitor cocktail). The 437 lysates were clarified by centrifugation a t 15,000g for 15 minutes and the supernatants were 438 subjected to boil at 95°C for 5 min with Laemmli sample buffer. Then proteins were transferred 439 to PVDF membranes after SDS-PAGE electrophoresis for immunoblotting. The antibodies used 440 in this study include rabbit anti-EGFP (ZENBIO, 300943), mouse anti-Flag (Sigma, clone M2, 441 (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted March 13, 2025. ; https://doi.org/10.1101/2025.03.10.642306doi: bioRxiv preprint 19 F3165), mouse anti-Tubulin (invitrogen, MA5-31466), HRP-conjugated secondary antibodies 442 (anti-rabbit, invitrogen 31460; anti-mouse, invitrogen 31430). Signals were acquired using an 443 automatic chemiluminescence imaging system (Tanon 5200). 444 445 Cell cycle synchronization and photoexcitation. 446 The Cdk1 inhibitor RO-3306 was used to enable cycle synchronization of HeLa cell expressing 447 GFP-Tubulin and RFP-H2B at M phase as described previously 53, 54. The GFP-Tubulin/RFP-448 H2B/R-LARIAT cells were pre-arrested at the G2/M border by treatment with 6 µM RO-3306 449 (Selleck, S7747) for 20 h. To determine the effect of trapped Tubulin on the cell cycle, these 450 cells were exposed to 660 -nm red light (20 mW/cm²) for 10 min, and then wer e washed with 451 pre-warmed PBS (37℃) containing Ca 2+ and Mg 2+ (PBS +) to prevent detachment of cells. 452 After being incubated in pre-warmed medium for 0 hr,1 hr or 1.5 hr, cells were fixed with 4% 453 formaldehyde at room temperature for 20 min. Imaging of cells w as performed using a Zeiss 454 LSM700 to distinguish mitotic sub-phases. The percentage of cells in each category among M 455 phase was calculated according to their morphological characteristics. 456 457 Immunofluorescence and imaging 458 The cells were digested and seeded on a sterilized cover slip (22 mm × 22 mm) in a six -well 459 plate at 60% confluency to allow cells to settle and adhere onto the cover slip. Then culture 460 medium was removed, and the cells were washed twice with PBS and fixed with 4% 461 paraformaldehyde at room temperature for 15–20 minutes prior to immunostaining. Then the 462 cells were incubated with 0.5% PBST (PBS containing 0.1% Triton X-100) at room temperature 463 for 20 minutes and were blocked with blocking buffer (0.1% PBST containing 1% BSA) at 464 room temperature for 1 hour. Then the cells were incubated with the primary antibody against 465 EGFP (ZENBIO, 300943), mCherry (abcam, ab125096), γ-H2A.X (CST, 9718S) or V5 466 (Abclone, AE089) diluted in primary antibody dilution buffer (Abclone, P0103 ) at room 467 temperature for 1 hour. The cells were then incubated with the secondary antibody at room 468 temperature in the dark for 1 hour. The secondary antibodies used in this study include goat 469 anti-rabbit-Alexa Fluor 488 (Beyotime, A0423), goat anti -mouse-ABflo® 555 (ABclona l, 470 (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted March 13, 2025. ; https://doi.org/10.1101/2025.03.10.642306doi: bioRxiv preprint 20 AS057) and goat anti -rabbit-ABflo® 647 (ABclonal, AS060). Images were captured using 471 laser-scanning confocal microscopy (ZIESS-LSM700) and processed with ImageJ. 472 473 ASSOCIATED CONTECT 474 Supporting Information 475 The Supporting Information including Figures S1–S6 and Tables S1–S4 is provided as 476 separated PDF file. 477 Figure S1. Schematic representation of blue light-induced optogenetic clustering system by 478 LARIAT 479 Figure S2. Schematic diagrams of three different constructs for protein clustering system 480 induced by red light. 481 Figure S3. Construction of Panx-GFP cell line. 482 Figure S4. Design and validation of LARIAT modules for blue light-induced cluster 483 formation. 484 Figure S5. Interactions between DrBphP and 2× LDBs. 485 Figure S6. Red light-induced cluster formation in GFP-Egg and mCherry-Mael cells. 486 Table S1. Primers used in this study. 487 Table S2. gRNA sequences for knock-in in OSCs. 488 Table S3. Plasmids information used in this study. 489 Table S4. The gene sequence of LARIAT and R-LARIAT modules. 490 491 AUTHOR INFORMATION 492 Corresponding Author: 493 Yang Yu - Institute of Biophysics, Chinese Academy of Sciences, Beijing 100101, China; 494 Guangzhou Women and Children's Medical Center, Guangzhou Medical University, 495 Guangzhou 510623, China. 496 Xiaohua Lu - Institute of Biophysics, Chinese Academy of Sciences, Beijing 100101, China. 497 Peng Zhou - Division of Life Sciences and Medicine, University of Science and Technology 498 of China, Hefei 230026, China; Guangzhou Women and Children's Medical Center, Guangzhou 499 Medical University, Guangzhou 510623, China; Institute of Bioph ysics, Chinese Academy of 500 (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted March 13, 2025. ; https://doi.org/10.1101/2025.03.10.642306doi: bioRxiv preprint 21 Sciences, Beijing 100101, China. 501 502 Author Contributions: 503 Y .Y ., X.L. and P.Z. designed this study. P.Z. carried out the experiments and analyzed the data. 504 Y .J., T.Z., X.H. assisted in experiments. C.L., W.L., Z.L, L.S contributed materials. P.Z., S.G., 505 Z.Z., Z.Y ., X.L, Y.Y. discussed the results and drafted the manuscript. All authors have read and 506 approved the final manuscript. 507 508 ACKNOWLEDGMENTS 509 We would like to thank the Xiaobo Wang Laboratory for generously providing the original blue 510 light-mediated LARIA T plasmids as gifts. We extend our sincere gratitude to Dr. Changmao 511 Chen for helpful discussions and comments on this work . This work was supported in part by 512 grants from the Ministry of Science and Technology of China (2019YFA0508903 and 513 2017YFA0504200 to Y .Y .), the National Natural Science Foundation of China (81921003 and 514 32170605 to Y .Y .). Y .Y . was additionally supported by the start-up fund from Guangzhou 515 Women and Children’s Medical Center. 516 517

518 [1] Rockwell, N. C., and Lagarias, J. C. (2010) A Brief History of Phytochromes, Chemphyschem 11, 519 1172-1180. 520 [2] Burgie, E. S., and Vierstra, R. D. (2014) Phytochromes: An Atomic Perspective on Photoactivation 521 and Signaling, The Plant Cell 26, 4568-4583. 522 [3] Tan, P., He, L., Huang, Y., and Zhou, Y. (2022) Optophysiology: Illuminating cell physiology with 523 optogenetics, Physiol Rev 102, 1263-1325. 524 [4] Kawano, F., Suzuki, H., Furuya, A., and Sato, M. (2015) Engineered pairs of distinct photoswitches 525 for optogenetic control of cellular proteins, Nat Commun 6, 6256. 526 [5] Uda, Y., Goto, Y., Oda, S., Kohchi, T., Matsuda, M., and Aoki, K. (2017) Efficient synthesis of 527 phycocyanobilin in mammalian cells for optogenetic control of cell signaling, Proc Natl 528 Acad Sci U S A 114, 11962-11967. 529 [6] Kennedy, M. J., Hughes, R. M., Peteya, L. A., Schwartz, J. W., Ehlers, M. D., and Tucker, C. L. (2010) 530 Rapid blue-light–mediated induction of protein interactions in living cells, Nat Methods 531 7, 973-975. 532 [7] Guntas, G., Hallett, R. A., Zimmerman, S. P., Williams, T., Yumerefendi, H., Be ar, J. E., and 533 Kuhlman, B. (2014) Engineering an improved light-induced dimer (iLID) for controlling the 534 localization and activity of signaling proteins, Proc Natl Acad Sci U S A 112, 112-117. 535 [8] Kögler, A. C., Kherdjemil, Y., Bender, K., Rabinowitz, A., Marco-Ferreres, R., and Furlong, E. E. M. 536 (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted March 13, 2025. ; https://doi.org/10.1101/2025.03.10.642306doi: bioRxiv preprint 22 (2021) Extremely rapid and reversible optogenetic perturbation of nuclear proteins in 537 living embryos, Dev Cell 56, 2348-2363.e2348. 538 [9] Glantz, S. T., Carpenter, E. J., Melkonian, M., Gardner, K. H., Boyden, E. S., Wong, G. K., and 539 Chow, B. Y. (2016) Functional and topological diversity of LOV domain photoreceptors, 540 Proc Natl Acad Sci U S A 113, E1442-1451. 541 [10] Aoki, K., Kumagai, Y., Sakurai, A., Komats u, N., Fujita, Y., Shionyu, C., and Matsuda, M. (2013) 542 Stochastic ERK Activation Induced by Noise and Cell -to-Cell Propagation Regulates Cell 543 Density-Dependent Proliferation, Mol Cell 52, 529-540. 544 [11] Nihongaki, Y., Yamamoto, S., Kawano, F., Suzuki, H., and Sato, M. (2015) CRISPR-Cas9-based 545 Photoactivatable Transcription System, Chem Biol 22, 169-174. 546 [12] Nihongaki, Y., Furuhata, Y., Otabe, T., Hasegawa, S., Yoshimoto, K., and Sato, M. (2017) 547 CRISPR–Cas9-based photoactivatable transcription systems to ind uce neuronal 548 differentiation, Nat Methods 14, 963-966. 549 [13] Nihongaki, Y., Kawano, F., Nakajima, T., and Sato, M. (2015) Photoactivatable CRISPR-Cas9 for 550 optogenetic genome editing, Nat Biotechnol 33, 755-760. 551 [14] Nihongaki, Y., Otabe, T., Ueda, Y., and S ato, M. (2019) A split CRISPR –Cpf1 platform for 552 inducible genome editing and gene activation, Nat Chem Biol 15, 882-888. 553 [15] Kawano, F., Okazaki, R., Yazawa, M., and Sato, M. (2016) A photoactivatable Cre –loxP 554 recombination system for optogenetic genome e ngineering, Nat Chem Biol 12, 1059-555 1064. 556 [16] Jung, H., Kim, S.-W., Kim, M., Hong, J., Yu, D., Kim, J. H., Lee, Y., Kim, S., Woo, D., Shin, H. -S., 557 Park, B. O., and Heo, W. D. (2019) Noninvasive optical activation of Flp recombinase for 558 genetic manipulation in deep mouse brain regions, Nat Commun 10, 314. 559 [17] Lee, D., Creed, M., Jung, K., Stefanelli, T., Wendler, D. J., Oh, W. C., Mignocchi, N. L., Lüscher, 560 C., and Kwon, H. -B. (2017) Temporally precise labeling and control of neuromodulatory 561 circuits in the mammalian brain, Nat Methods 14, 495-503. 562 [18] Pu, J., Zinkus -Boltz, J., and Dickinson, B. C. (2017) Evolution of a split RNA polymerase as a 563 versatile biosensor platform, Nat Chem Biol 13, 432-438. 564 [19] Yu, D., Lee, H., Hong, J., Jung, H., Jo, Y., Oh, B. -H., Park, B. O., and Heo, W. D. (2019) 565 Optogenetic activation of intracellular antibodies for direct modulation of endogenous 566 proteins, Nat Methods 16, 1095-1100. 567 [20] Liu, Q., Sinnen, B. L., Boxer, E. E., Schneider, M. W., Grybko, M. J., Buchta, W. C., G ibson, E. S., 568 Wysoczynski, C. L., Ford, C. P., Gottschalk, A., Aoto, J., Tucker, C. L., and Kennedy, M. J. 569 (2019) A Photoactivatable Botulinum Neurotoxin for Inducible Control of 570 Neurotransmission, Neuron 101, 863-875.e866. 571 [21] Lee, S., Park, H., Kyung, T., Kim, N. Y., Kim, S., Kim, J., and Heo, W. D. (2014) Reversible protein 572 inactivation by optogenetic trapping in cells, Nat Methods 11, 633-636. 573 [22] Doupé, D. P., and Perrimon, N. (2014) Visualizing and Manipulating Temporal Signaling 574 Dynamics with Fluorescence-Based Tools, Sci Signal 7, re1. 575 [23] Turgeon, B., and Meloche, S. (2009) Interpreting Neonatal Lethal Phenotypes in Mouse 576 Mutants: Insights Into Gene Function and Human Diseases, Physiological Reviews 89, 1-577 26. 578 [24] Wargent, J. J., Gegas, V. C., Je nkins, G. I., Doonan, J. H., and Paul, N. D. (2009) UVR8 in 579 Arabidopsis thaliana regulates multiple aspects of cellular differentiation during leaf 580 (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted March 13, 2025. ; https://doi.org/10.1101/2025.03.10.642306doi: bioRxiv preprint 23 development in response to ultraviolet B radiation, New Phytol 183, 315-326. 581 [25] Chen, D., Gibson, E. S., a nd Kennedy, M. J. (2013) A light -triggered protein secretion system, 582 J Cell Biol 201, 631-640. 583 [26] Osswald, M., Santos, A. F., and Morais -de-Sá, E. (2019) Light-Induced Protein Clustering for 584 Optogenetic Interference and Protein Interaction Analysis in Dr osophila S2 Cells, 585 Biomolecules 9. 586 [27] Qin, X., Park, B. O., Liu, J., Chen, B., Choesmel -Cadamuro, V., Belguise, K., Heo, W. D., and 587 Wang, X. (2017) Cell -matrix adhesion and cell -cell adhesion differentially control basal 588 myosin oscillation and Drosophila egg chamber elongation, Nat Commun 8, 14708. 589 [28] Lu, X., Wen, Y., Zhang, S., Zhang, W., Chen, Y., Shen, Y., Lemieux, M. J., and Campbell, R. E. 590 (2021) Photocleavable proteins that undergo fast and efficient dissociation, Chem Sci 12, 591 9658-9672. 592 [29] Kainrath, S., Stadler, M., Reichhart, E., Distel, M., and Janovjak, H. (2017) Green‐Light‐Induced 593 Inactivation of Receptor Signaling Using Cobalamin ‐Binding Domains, Angew Chem Int 594 Ed Engl 56, 4608-4611. 595 [30] Lehtinen, K., Nokia, M. S., and Takala, H. (2022) Red Light Optogenetics in Neuroscience, Front 596 Cell Neurosci 15. 597 [31] Tang, K., Beyer, H. M., Zurbriggen, M. D., and Gärtner, W. (2021) The Red Edge: Bilin -Binding 598 Photoreceptors as Optogenetic Tools and Fluorescence Reporters, Chem Rev 121, 14906-599 14956. 600 [32] Kaberniuk, A. A., Shemetov, A. A., and Verkhusha, V. V. (2016) A bacterial phytochrome-based 601 optogenetic system controllable with near-infrared light, Nat Methods 13, 591-597. 602 [33] Zhou, Y., Kong, D., Wang, X., Yu, G., Wu, X., Guan, N., Weber, W., and Ye, H. (2021) A small 603 and highly sensitive red/far -red optogenetic switch for applications in mammals, Nat 604 Biotechnol 40, 262-272. 605 [34] Bellini, D., and Papiz, Miroslav Z. (2012) S tructure of a Bacteriophytochrome and Light -606 Stimulated Protomer Swapping with a Gene Repressor, Structure 20, 1436-1446. 607 [35] Levskaya, A., Weiner, O. D., Lim, W. A., and Voigt, C. A. (2009) Spatiotemporal control of cell 608 signalling using a light-switchable protein interaction, Nature 461, 997-1001. 609 [36] Beyer, H. M., Juillot, S., Herbst, K., Samodelov, S. L., Müller, K., Schamel, W. W., Römer, W., 610 Schäfer, E., Nagy, F., Strähle, U., Weber, W., and Zurbriggen, M. D. (2015) Red Light -611 Regulated Reversible Nuclear Localization of Proteins in Mammalian Cells and Zebrafish, 612 ACS Synth Biol 4, 951-958. 613 [37] Reichhart, E., Ingles ‐ Prieto, A., Tichy, A. M., McKenzie, C., and Janovjak, H. (2016) A 614 Phytochrome Sensory Domain Permits Receptor Activation by Red Light, Angew Chem 615 Int Ed Engl 55, 6339-6342. 616 [38] Redchuk, T. A., Omelina, E. S., Chernov, K. G., and Verkhusha, V. V. (2017) Near -infrared 617 optogenetic pair for protein regulation and spectral multiplexing, Nat Chem Biol 13, 633-618 639. 619 [39] Bhoo, S.-H., Davis, S. J., Walker, J., Karniol, B., and Vierstra, R. D. (2001) Bacteriophytochromes 620 are photochromic histidine kinases using a biliverdin chromophore, Nature 414, 776-779. 621 [40] Kuwasaki, Y., Suzuki, K., Yu, G., Yamamoto, S., Otabe, T., Kakihara, Y., Nishiwaki, M., Miyake, K., 622 Fushimi, K., Bekdash, R., Shimizu, Y., Narikawa, R., Nakajima, T., Yazawa, M., and Sato, M. 623 (2022) A red light –responsive photoswitch for deep tissue optogenetics, Nat Biotechnol 624 (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted March 13, 2025. ; https://doi.org/10.1101/2025.03.10.642306doi: bioRxiv preprint 24 40, 1672-1679. 625 [41] Huang, Z., Li, Z., Zhang, X., Kang, S., Dong, R., Sun, L., Fu, X., Vaisar, D., Watanabe, K., and Gu, 626 L. (2020) Creating Red Light -Switchable Protein Dimerization Systems as Genetically 627 Encoded Actuators with High Specificity, ACS Synth Biol 9, 3322-3333. 628 [42] Davis, S. J., Vener, A. V., and Vierstra, R . D. (1999) Bacteriophytochromes: Phytochrome -Like 629 Photoreceptors from Nonphotosynthetic Eubacteria, Science 286, 2517-2520. 630 [43] Cao, Y., Zhou, S., Yamada, R., and Sakamoto, K. (2023) Low energy multiple blue light-emitting 631 diode light Irradiation promote s melanin synthesis and induces DNA damage in B16F10 632 melanoma cells, PLoS One 18. 633 [44] Chamayou‐Robert, C., DiGiorgio, C., Brack, O., and Doucet, O. (2021) Blue light induces DNA 634 damage in normal human skin keratinocytes, Photodermatology, Photoimmunology & 635 Photomedicine 38, 69-75. 636 [45] Ruggiero, E., Alonso -de Castro, S., Habtemariam, A., and Salassa, L. (2016) Upconverting 637 nanoparticles for the near infrared photoactivation of transition metal complexes: new 638 opportunities and challenges in medicinal inorga nic photochemistry, Dalton Trans 45, 639 13012-13020. 640 [46] Wagner, J. R., Zhang, J., von Stetten, D., Günther, M., Murgida, D. H., Mroginski, M. A., Walker, 641 J. M., Forest, K. T., Hildebrandt, P., and Vierstra, R. D. (2008) Mutational Analysis of 642 Deinococcus radiodurans Bacteriophytochrome Reveals Key Amino Acids Necessary for 643 the Photochromicity and Proton Exchange Cycle of Phytochromes, J Biol Chem 283, 644 12212-12226. 645 [47] Takala, H., Björling, A., Berntsson, O., Lehtivuori, H., Niebling, S., Hoernke, M., Koshel eva, I., 646 Henning, R., Menzel, A., Ihalainen, J. A., and Westenhoff, S. (2014) Signal amplification and 647 transduction in phytochrome photosensors, Nature 509, 245-248. 648 [48] Leopold, A. V., Chernov, K. G., Shemetov, A. A., and Verkhusha, V. V. (2019) Neurotro phin 649 receptor tyrosine kinases regulated with near-infrared light, Nat Commun 10, 1129. 650 [49] Chernov, K., Redchuk, T., Omelina, E., and Verkhushaa, V. (2017) Near -Infrared Fluorescent 651 Proteins, Biosensors, and Optogenetic Tools Engineered from Phytochromes , Chem Rev 652 117, 6423-6446. 653 [50] Okumura, D., Hagino, M., Yamagishi, A., Kaibori, Y., Munira, S., Saito, Y., and Nakayama, Y. 654 (2018) Inhibitors of the VEGF Receptor Suppress HeLa S3 Cell Proliferation via 655 Misalignment of Chromosomes and Rotation of the Mito tic Spindle, Causing a Delay in 656 M-Phase Progression, Int J Mol Sci 19. 657 [51] Port, F., Chen, H.-M., Lee, T., and Bullock, S. L. (2014) Optimized CRISPR/Cas tools for efficient 658 germline and somatic genome engineering in Drosophila, Proc Natl Acad Sci U S A 111, 659 E2967-2976. 660 [52] Ran, F. A., Hsu, P. D., Wright, J., Agarwala, V., Scott, D. A., and Zhang, F. (2013) Genome 661 engineering using the CRISPR-Cas9 system, Nat Protoc 8, 2281-2308. 662 [53] Nakayama, Y., Saito, Y., Soeda, S., Iwamoto, E., Ogawa, S., Yamagishi, N., Kuga, T., and 663 Yamaguchi, N. (2014) Genistein Induces Cytokinesis Failure Through RhoA Delocalization 664 and Anaphase Chromosome Bridging, J Cell Biochem 115, 763-771. 665 [54] Nakayama, Y., Matsui, Y., Takeda, Y., Okamoto, M., Abe, K., Fukumoto, Y., and Yamaguchi, N. 666 (2012) c-Src but Not Fyn Promotes Proper Spindle Orientation i n Early Prometaphase, J 667 Biol Chem 287, 24905-24915. 668 (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted March 13, 2025. ; https://doi.org/10.1101/2025.03.10.642306doi: bioRxiv preprint S1 Supplementary Information for Red Light-Activated Reversible Inhibition of Protein Functions by Assembled Trap Peng Zhou 1,2,3*, Yongkang Jia 4, Xuan He 2, Tianyu Zhang 2,3, Chao Liu 2, Wei Li2, Zengpeng Li 5, Ling Sun 6, Shouhong Guang 1, Zhongcheng Zhou 2, Zhiheng Yuan 2,3, Xiaohua Lu3*, Yang Yu2,3* 1Division of Life Sciences and Medicine, University of Science and Technology of China, Hefei 230026, China. 2Guangzhou Women and Children's Medical Center, Guangzhou Medical University, Guangzhou, 510623, China. 3Institute of Biophysics, Chinese Academy of Sciences, Beijing 100101, China. 4School of Life and Health Sciences, Hubei University of Technology, Wuhan 430068, China. 5Key Laboratory of Marine Genetic Resources, State Key Laboratory Breeding Base of Marine Genetic Resources, Fujian Key Laboratory of Marine Genetic Resources, Fujian Collaborative Innovation Centre for Exploitation and Utilization of Marine Biological Resources, Third Institute of Oceanography Ministry of Natural Resources, Xiamen 361005, China. 6Center for Reproductive Medicine, Guangzhou Women and Children’s Medical Center, Guangzhou Medical University, Guangzhou 510623, China. *Corresponding Author: Yang Yu; Xiaohua Lu; Peng Zhou Email: [email protected] or [email protected] ( Y. Y. ); [email protected] (X.L.); [email protected] (P.Z.) Table of Contents Supplementary Figures…………………………………………………………...S2 Supplementary Tables…………………………………………………………….S8 References………………………………………………………………………….S16 (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted March 13, 2025. ; https://doi.org/10.1101/2025.03.10.642306doi: bioRxiv preprint S2 SUPPLEMENTARY FIGURES Figure S1. Schematic representation of blue light -induced optogenetic clustering system by LARIAT. The cryptochrome 2 (CRY2) was fused with an anti-GFP nanobody that can specifically bind to GFP-tagged proteins. The cryptochrome-interacting bHLH 1 (CIB1) was fused with the multimerization domain from CaMKII α ( MP) to form dodecamers in the cytoplasm. Blue light can trigger CRY2 oligomerization and CRY2–CIB1 dimerization, and consequently the formation of clusters to trap GFP -tagged proteins. In the dark, CRY2 reverts spontaneously to its ground state and the clusters disassemble. (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted March 13, 2025. ; https://doi.org/10.1101/2025.03.10.642306doi: bioRxiv preprint S3 Figure S2. Schematic diagrams of three different constructs for protein clustering system induced by red light. (A−C) Schematic diagram s depicting construction of plasmid and protein clustering according to scenario I (A), scenario II (B) and scenario III (C). In scenario (I), The DrBphP was fused with the anti -GFP nanobody (VHH(GFP)) while one copy of LDB (LDB3) was fused with a CaMKII α multimerization domain (MP) -mCherrry (mCherry-MP). In scenario (II), The DrBphP was fused with the VHH(GFP) while two copies of LDB (2× LDBs, LDB -3 and LDB-14) connected by a GGGGS linker were fused with mCherry- MP. In scenario (III), 2× LDBs connected by a GGGGS linker were fused with the VHH(GFP) while DrBphP was fused with the mCherry-MP. (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted March 13, 2025. ; https://doi.org/10.1101/2025.03.10.642306doi: bioRxiv preprint S4 Figure S3. Construction of Panx-GFP cell line. (A) A schematic of showing the knock- in strategy to construct Panx- GFP cell line in OSCs using CRISPR/Cas9. Agarose gel showing PCR results confirming a correct integration of GFP-tag (3× Flag, V5 and EGFP) to the C-terminus of the Panx locus in OSCs of Drosophila. PCR primers amplifying the indicated regions are shown on the top while two gRNAs targeting near the stop codon of Panx are indicated at the bottom. (B) Western blots showing the expression of GFP and 3× Flag in Panx- GFP cells or OSCs. Tubulin was employed as a loading control. (C) Immunofluorescence showing the GFP fluorescence signal in Panx-GFP cells and OSCs. Scale bar: 20 µm. (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted March 13, 2025. ; https://doi.org/10.1101/2025.03.10.642306doi: bioRxiv preprint S5 Figure S4. Design and validation of LARIAT modules for blue light- induced cluster formation. (A–D) Schematic diagram s of plasmid construction (top) and corresponding representative fluorescence images (left) and intensity profiles (right) for CIBN -MP and Panx-GFP in Panx- GFP cells expressing the indicated LARIAT module after 10 minutes of 450-nm blue light illumination. In Figure (A), The cryptochrome photolyase homology region ( CRY2PHR) was fused with the anti -GFP nanobody (V HH(GFP)) while an N -terminal fragment of the CIB1 ( CIBN) was fused with a CaMKII α multimerization domain (MP)-mCherrry (mCherry-MP). In Figure (B), The VHH(GFP) without CRY2PHR, and CIBN fused with mCherry- MP, were cloned into a single plasmid by 2A linker system. In Figure (C), A mutant of CRY2, CRY2PHR (D387A) was fused with the VHH(GFP) while CIBN was fused with the mCherry-MP. In Figure (D), The CRY2PHR fused with V HH(GFP), and mCherry -MP without CIBN , were cloned into a single plasmid by 2A linker system. Scale bar: 2 µm. (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted March 13, 2025. ; https://doi.org/10.1101/2025.03.10.642306doi: bioRxiv preprint S6 Figure S5. Interactions between DrBphP and 2× LDBs. (A and B) Yeast two-hybrid assays showing interactions between DrBphP and 2× LDBs (LDB-3 and LDB-14) with different linker lengths under red light illumination (A) or dark conditions (B). The empty BD vector without Dr BphP was used as a negative control. The colonies expressing DrBphP and 2× LDBs were grown on YSD/ –Leu/– Trp/–His medium supplemented with 0–10 mM of the 3-AT. (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted March 13, 2025. ; https://doi.org/10.1101/2025.03.10.642306doi: bioRxiv preprint S7 Figure S6. Red light-induced cluster formation in GFP-Egg and mCherry-Mael cells. (A) Schematic showing the knock- in strategy to construct Egg- GFP cell line in OSCs using CRISPR/Cas9. Agarose gel showing PCR results confirming a correct integration of GFP-tag to the N -terminus of the Egg locus in OSCs of Drosophila. Western blots showing the expression of 3× Flag in GFP -Egg cells or OSCs. (B) Representative fluorescence images and intensity profiles of Dr BphP-MP and GFP-Egg in GFP -Egg cells expressing the R -LARIAT plasmid under red light illumination or in darkness. Scale bar: 2 µm. (C) Schematic showing the knock- in strategy to construct mCherry - Mael cell line. The agarose gel and western blots showing the integration of mCherry- tag to the Mael locus in OSCs and the expression of 3× Flag in mCherry -Mael cells respectively. (D) Representative fluorescence images and intensity profiles of GFP-MP and mCherry-Mael in mCherry-Mael cells expressing the R -LARIAT plasmid. Scale bar: 2 µm. (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted March 13, 2025. ; https://doi.org/10.1101/2025.03.10.642306doi: bioRxiv preprint S8 SUPPLEMENTARY TABLES Table S1. Primers used in this study. Primers Sequences (5’ to 3’) Source pENTR4-F1 TCGAGATATCTAGACCCAGCTTTC This work pENTR4-R1 GGTGGAGCCTGCTTTTTTGT This work pENTR4-F2 CTACAAACTCTTCCTGTTAGTTAG This work pENTR4-R2 ATGGCTCATAACACCCCTTG This work Ubi-F CCAGCCAGGAAGTTAGTTTC This work Hsp-R ATCGTACGGATCTGGGGG This work VHH(GFP)-F ATGGATCAAGTCCAACTGGTG This work VHH(GFP)-R CTTGCCTGCAGCTGAACTTCGCCGCTGCCG CTGGAG This work LDB-3-F CCGTCTCCAGCGGCAGCGGCGAAGTTCAG CTGCAGGCAAG This work LDB-3-linker-R AGATCCTCCTCCTCCAGATCCTCCTCCTCC GCTGCTAACGGTAACCTGGG This work LDB-14-F GATCTGGAGGAGGAGGATCTGAAGTTCAG CTGCAGGCAAG This work LDB-14-R GCTGCTAACGGTAACCTGGG This work LDB-14-T2A-F CCCAGGTTACCGTTAGCAGCGGCAGCGGC GAAGGACGGGGATCGTTGC This work P2A-T2A-R AGGACCGGGGTTTTCTTCCACGTCTCCTGC TTGCTTTAACAGAGAGAAGTTCGTGGCAG GTCCGGGATTCTCCTC This work P2A-BphP1-F TGGAAGAAAACCCCGGTCCTATGAGTCGT GACCCTTTGC This work BphP-R ATGGTGGCGACCGGTACATGTAATGCGCCA GTAAGAGTGTCGC This work HVPV AT-F CATGTACCGGTCGCCACC This work MP-R GCTGGGTCTAGATATCTCGATCAATGGGGC AGGACGGA This work VHH (mCherry)-F ACAAAAAAGCAGGCTCCACCATGGCACAG GTTCAGCTGG This work VHH (mCherry)- R GCCGCTGCCTGTAAACGGGCTGCTAACGG This work VHH (mCherry)- LDB-3-F GCCCGTTTACAGGCAGCGGCGAAGTTCAG CTGCAGGCAAG This work EGFP-F ATGGTGAGCAAGGGCGAGG This work EGFP-R CTTGTACAGCTCGTCCATGCC This work EGFP-MP-F GCATGGACGAGCTGTACAAGTCCGGACTC AGATCTCGAGC This work Panx-LA-F TCGAAACGTGAGAACTTGGACG This work Panx-RA-R CTTGCATTTTATTGAGCTTTATATCTGTG This work (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted March 13, 2025. ; https://doi.org/10.1101/2025.03.10.642306doi: bioRxiv preprint S9 Egg-LA-F GAGCGAAATTTTATACAATGTTATCGCTTGT CTCGCAAATTTGCATTAATGTGTAAAGTT This work Egg-RA-R TCCCTCGACGCCGGTGTTTCTTGGACATCC TCCACTGTGCTTCCACTGCTCTCTAAGCAG This work Meal-LA-F GCTCGCACACGCGCTCAACACCTACCCTTA CCCGTCAAAAATACCGACCTTCTTCTTGC This work Mael-RA-R GTCGGCCCTCGGCGTTTCGGTTTCTCCACT CGTTTACGAACATCATAAACCCACTATGC This work hTUBA1B-F ACAAAAAAGCAGGCTCCACCATGCGTGAG TGCATCTCCATCC This work hTUBA1B-R GCTGGGTCTAGATATCTCGATTAGTATTCCT CTCCTTCTTCCTCACCC This work hH2BC21-F ACAAAAAAGCAGGCTCCACCATGCCTGAA CCGGCAAAATCC This work hH2BC21-R GCTGGGTCTAGATATCTCGATCACTTGGAG CTGGTGTACTTGGT This work (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted March 13, 2025. ; https://doi.org/10.1101/2025.03.10.642306doi: bioRxiv preprint S10 Table S2. gRNA sequences for knock-in in OSCs. gRNA Sequences (5’ to 3’) Panx gRNA1 CCTTTATTATTGCCAGAGC Panx gRNA2 GTTGCTCTCCAAGCGAACCT Maelstrom gRNA1 AGGAGCCATCTTTACGGGCG Maelstrom gRNA2 TCGTAAACGAGTGGAGAAAC Eggless gRNA1 GACTCATTAAAACTATGTCT Eggless gRNA2 GCTGCTCTCTAAGCAGTCCA (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted March 13, 2025. ; https://doi.org/10.1101/2025.03.10.642306doi: bioRxiv preprint S11 Table S3. Plasmids information used in this study. Plasmids Description Source or literature pENTR4 Gateway entry vector Thermo Fisher Scientific, A10465 CFD4 Expressing two gRNAs from Drosophila U6:1 and U6:3 Addgene, #49411 pGEX6P1-mcherry- nanobody Expressing GST-tagged anti- mCherry nanobody in E. coli cells. Addgene, #70696 pBOBI-BD-DrBphP Expressing DrBphP Huang et al. 1 LDB-3-p65 Expressing LDB-3 LDB-14-p65 Expressing LDB-14 pC1s-VHH (GFP)-SNAP- PHR-P2A-CIBN-mCherry- MP Expressing LARIAT modules Qin et al. 2 pGBKT7 DNA-BD For Y2H assay Takara, #630443 pGADT7 AD For Y2H assay Takara, #630442 pUbiquitin gateway Gateway destination vector for expression in Drosophila This work pCAGG gateway Gateway destination vector for expression in mammalian This work pUbi-SpCas9 Expressing SpCas9 in Drosophila This work MSCV-GFP-Gateway Gateway destination vector for expression in mammalian This work pCW-λn-2×flag-RFP- Gateway Gateway destination vector for doxycycline-inducible lentiviral expression in mammalian This work (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted March 13, 2025. ; https://doi.org/10.1101/2025.03.10.642306doi: bioRxiv preprint S12 Table S4. The gene sequence of LARIAT and R-LARIAT modules. Name CDS or vector sequence VHH(GFP) ATGGATCAAGTCCAACTGGTGGAGTCTGGTGGCGCTTTGGT GCAGCCAGGTGGCTCTCTGCGTTTGTCCTGTGCCGCTTCTG GCTTCCCAGTGAACCGCTATTCCATGCGCTGGTATCGCCAGG CTCCAGGCAAAGAGCGTGAGTGGGTAGCCGGTATGTCCAGC GCGGGTGATCGTAGCTCCTATGAAGACTCCGTGAAGGGCCG TTTCACCATCAGCCGTGACGATGCCCGTAACACGGTGTATCT GCAAATGAACAGCTTGAAACCTGAAGATACGGCCGTGTATT ACTGTAATGTGAACGTGGGCTTCGAGTATTGGGGCCAAGGC ACCCAGGTCACCGTCTCCAGCGGCAGCGGC LDB3-2× linkers- LDB14- SV40NLS GAAGTTCAGCTGCAGGCAAGCGGTGGTGGTTTTGTTCAGCC TGGTGGTAGCCTGCGTCTGAGCTGTGCAGCCAGCGGTTTTA CCTGGGATCATTACATCATGGGCTGGTTTCGCCAGGCACCGG GTAAAGAACGTGAATTTGTTAGCGCAATCAGCGAAAATGGT GATGCATGGAATTATTATGCCGATAGCGTGAAAGGTCGCTTT ACCATTAGCCGTGATAATAGCAAAAATACCGTTTACCTGCAG ATGAATAGTCTGCGTGCAGAAGATACCGCAACCTATTATTGT GCAATCGGTTTTGATGTTCCATCTGGTCGTTCTTGGCAGGGT TCTCATTTTTGGATGTATTGGGGTCAGGGCACCCAGGTTACC GTTAGCAGCGGAGGAGGAGGATCTGGAGGAGGAGGATCTG AAGTTCAGCTGCAGGCAAGCGGTGGTGGTTTTGTTCAGCCT GGTGGTAGCCTGCGTCTGAGCTGTGCAGCCAGCGGTACCAC CTCTCGTTGGGAATCTATGGGCTGGTTTCGCCAGGCACCGG GTAAAGAACGTGAATTTGTTAGCGCAATCAGCTGGCAGAAT AATTCTGTTCCATATTATGCCGATAGCGTGAAAGGTCGCTTT ACCATTAGCCGTGATAATAGCAAAAATACCGTTTACCTGCAG ATGAATAGTCTGCGTGCAGAAGATACCGCAACCTATTATTGT GCAGCACAGCATAACTTTCTGGGTCATCGTTATTGGGGTCAG GGCACCCAGGTTACCGTTAGCAGCCCAAAAAAGAAGAGAA AGGTAGGCAGCGGC T2A-P2A- SV40NLS- DrBphP GAAGGACGGGGATCGTTGCTCACATGCGGCGATGTCGAGG AGAATCCCGGACCTGCCACGAACTTCTCTCTGTTAAAGCAA GCAGGAGACGTGGAAGAAAACCCCGGTCCTCCAAAAAAGA AGAGAAAGGTAGGCAGCGGCATGAGTCGTGACCCTTTGCC ATTCTTTCCTCCTCTTTATCTGGGTGGACCCGAGATTACAAC AGAAAACTGCGAACGCGAACCAATTCACATCCCGGGATCTA TTCAACCACACGGTGCATTGCTGACGGCAGACGGACATTCC GGAGAGGTTTTACAGATGTCGCTTAACGCAGCAACGTTTCT GGGACAAGAGCCTACGGTTTTGCGCGGCCAGACGTTAGCG GCTCTGTTGCCAGAGCAATGGCCGGCCTTACAGGCGGCATT GCCTCCAGGGTGCCCCGATGCATTGCAATACCGCGCGACAC TGGATTGGCCGGCGGCAGGACATCTTTCTCTGACAGTCCAC CGCGTGGGCGAGCTGTTGATCCTGGAGTTTGAACCTACGGA (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted March 13, 2025. ; https://doi.org/10.1101/2025.03.10.642306doi: bioRxiv preprint S13 GGCCTGGGACTCGACTGGCCCGCACGCGTTACGCAATGCGA TGTTCGCTCTTGAATCAGCGCCAAACTTGCGCGCGTTAGCT GAAGTGGCCACACAAACCGTACGCGAGCTTACAGGCTTTG ACCGCGTGATGTTATACAAATTCGCACCCGATGCGACAGGC GAGGTAATCGCCGAAGCCCGCCGCGAGGGGTTGCATGCCTT TCTTGGCCATCGTTTTCCGGCCTCAGATATTCCCGCCCAAGC GCGCGCCCTTTACACTCGCCATCTGCTTCGTTTGACTGCGGA CACGCGCGCGGCGGCCGTTCCCTTAGACCCAGTACTTAATC CTCAGACTAACGCTCCTACCCCCTTAGGGGGGGCAGTGCTG CGTGCGACGTCGCCTATGCACATGCAGTACCTTCGCAATATG GGCGTCGGCTCCTCTTTAAGTGTATCAGTGGTAGTTGGGGG GCAGTTATGGGGTCTGATTGCGTGCCATCATCAGACCCCCTA TGTTTTGCCACCAGACCTTCGTACTACTCTTGAATACTTGGG GCGTTTATTAAGCCTTCAGGTGCAAGTCAAGGAAGCCGCGG ACGTTGCTGCATTCCGTCAGTCACTTCGCGAACACCATGCG CGCGTCGCCTTAGCGGCAGCGCATTCCCTGTCGCCGCACGA TACTCTTTCCGACCCTGCACTTGATCTTCTGGGTCTGATGCG TGCTGGGGGCTTAATCCTGCGTTTTGAAGGTCGTTGGCAGA CGTTAGGAGAAGTCCCGCCCGCTCCCGCAGTCGATGCACTG CTTGCATGGCTTGAAACCCAACCAGGGGCGCTTGTTCAGAC TGATGCATTGGGGCAGTTGTGGCCGGCGGGGGCTGATTTGG CTCCCTCAGCCGCGGGTCTGCTTGCCATTTCAGTAGGGGAG GGATGGAGTGAGTGCTTGGTTTGGTTACGTCCCGAACTGCG CCTTGAGGTTGCGTGGGGTGGAGCAACTCCAGACCAGGCC AAGGACGACCTGGGCCCTCGTCACAGTTTCGATACTTACTT AGAAGAGAAGCGTGGGTATGCAGAACCCTGGCATCCCGGA GAGATTGAGGAAGCTCAGGATTTGCGCGACACTCTTACTGG CGCATTACATGTACCGGTCGCCACC mCherry- MP ATGGTGAGCAAGGGCGAGGAGGATAACATGGCCATCATCAA GGAGTTCATGCGCTTCAAGGTGCACATGGAGGGCTCCGTGA ACGGCCACGAGTTCGAGATCGAGGGCGAGGGCGAGGGCCG CCCCTACGAGGGCACCCAGACCGCCAAGCTGAAGGTGACC AAGGGTGGCCCCCTGCCCTTCGCCTGGGACATCCTGTCCCC TCAGTTCATGTACGGCTCCAAGGCCTACGTGAAGCACCCCG CCGACATCCCCGACTACTTGAAGCTGTCCTTCCCCGAGGGC TTCAAGTGGGAGCGCGTGATGAACTTCGAGGACGGCGGCG TGGTGACCGTGACCCAGGACTCCTCCCTGCAGGACGGCGA GTTCATCTACAAGGTGAAGCTGCGCGGCACCAACTTCCCCT CCGACGGCCCCGTAA TGCAGAAGAAGACCATGGGCTGGGA GGCCTCCTCCGAGCGGATGTACCCCGAGGACGGCGCCCTGA AGGGCGAGATCAAGCAGAGGCTGAAGCTGAAGGACGGCG GCCACTACGACGCTGAGGTCAAGACCACCTACAAGGCCAA GAAGCCCGTGCAGCTGCCCGGCGCCTACAACGTCAACATCA AGTTGGACATCACCTCCCACAACGAGGACTACACCATCGTG (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted March 13, 2025. ; https://doi.org/10.1101/2025.03.10.642306doi: bioRxiv preprint S14 GAACAGTACGAACGCGCCGAGGGCCGCCACTCCACCGGCG GCATGGACGAGCTGTACAAGTCCGGACTCAGATCTCGAGCT CAAGCTTCGAATTCTGGTGGATCTGGTGGAGGAGGGAAGA GTGGAGGAAACAAGAAGAACGATGGTGTGAAGGAATCTTC TGAGAGCACCAACACCACCATTGAGGACGAAGACACCAAA GTGCGCAAACAGGAAATTATCAAAGTGACAGAGCAGCTGAT CGAAGCCATAAGCAATGGAGACTTTGAGTCCTACACGAAGA TGTGCGACCCTGGAATGACAGCCTTTGAACCAGAGGCCCTG GGGAACCTGGTGGAGGGCCTGGACTTTCATCGATTCTATTTT GAAAACCTGTGGTCCCGGAACAGCAAGCCCGTGCACACCA CCATCCTGAACCCTCACATCCACCTGATGGGTGACGAGTCA GCCTGCATCGCCTATATCCGCATCACTCAGTACCTGGATGCA GGCGGCATACCCCGCACGGCCCAGTCAGAGGAGACCCGCG TCTGGCACCGCAGGGACGGCAAATGGCAGATCGTCCACTTC CACAGATCTGGGGCGCCCTCCGTCCTGCCCCAT Snap tag- CRY2PHR ATGGACAAAGACTGCGAAATGAAGCGCACCACCCTGGATA GCCCTCTGGGCAAGCTGGAACTGTCTGGGTGCGAACAGGG CCTGCACGAGATCAAGCTGCTGGGCAAAGGAACATCTGCC GCCGACGCCGTGGAAGTGCCTGCCCCAGCCGCCGTGCTGG GCGGACCAGAGCCACTGATGCAGGCCACCGCCTGGCTCAA CGCCTACTTTCACCAGCCTGAGGCCATCGAGGAGTTCCCTG TGCCAGCCCTGCACCACCCAGTGTTCCAGCAGGAGAGCTTT ACCCGCCAGGTGCTGTGGAAACTGCTGAAAGTGGTGAAGT TCGGAGAGGTCATCAGCTACCAGCAGCTGGCCGCCCTGGCC GGCAATCCCGCCGCCACCGCCGCCGTGAAAACCGCCCTGA GCGGAAATCCCGTGCCCATTCTGATCCCCTGCCACCGGGTG GTGTCTAGCTCTGGCGCCGTGGGGGGCTACGAGGGCGGGCT CGCCGTGAAAGAGTGGCTGCTGGCCCACGAGGGCCACAGA CTGGGCAAGCCTGGGCTGGGTCCTGTACCGGTCGCCACCAT GAAGATGGACAAAAAGACCATCGTCTGGTTTCGGAGAGATT TGAGAATAGAAGATAATCCCGCGCTCGCCGCCGCGGCCCAC GAGGGTTCCGTCTTCCCCGTTTTCATTTGGTGTCCTGAAGAA GAAGGCCAGTTTTATCCCGGAAGGGCCTCTAGGTGGTGGAT GAAGCAAAGTCTGGCCCATCTTAGCCAGTCACTGAAAGCAC TGGGCAGTGATCTTACCCTGATCAAGACACACAATACCATCT CTGCCATCCTCGACTGCATCAGGGTGACCGGCGCAACGAAA GTCGTGTTTAACCACCTGTACGATCCAGTTAGTCTGGTGCGC GACCACACTGTGAAGGAGAAGCTGGTGGAACGGGGGATCA GTGTGCAGAGCTACAACGGGGACCTTCTGTACGAGCCATGG GAGATCTATTGCGAGAAAGGGAAACCGTTCACCTCCTTCAA CAGTTACTGGAAGAAATGTTTGGATATGTCAATAGAGTCCGT TATGTTGCCCCCTCCCTGGAGACTGATGCCGATTACTGCTGC TGCAGAGGCCATCTGGGCCTGCTCCATCGAGGAACTCGGTC TGGAAAATGAAGCAGAAAAGCCAAGCAATGCACTTCTCAC (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted March 13, 2025. ; https://doi.org/10.1101/2025.03.10.642306doi: bioRxiv preprint S15 TAGAGCCTGGAGCCCCGGCTGGTCTAATGCCGACAAGCTGC TTAACGAGTTCATCGAAAAACAACTGATTGACTACGCGAAG AACTCCAAGAAAGTGGTAGGTAACTCAACTAGCTTGCTCTC TCCATATCTCCATTTTGGCGAGATTTCTGTCCGCCATGTATTT CAGTGCGCTCGGATGAAACAGATTATCTGGGCTCGCGATAA AAACAGCGAAGGCGAAGAAAGCGCCGATCTGTTCCTGCGA GGGATCGGACTTCGGGAATACTCCCGGTATATATGTTTCAAC TTTCCATTCACACACGAGCAGAGTCTGTTGTCCCACCTCAG GTTCTTCCCCTGGGACGCCGATGTCGACAAATTCAAGGCAT GGAGACAGGGAAGGACAGGGTACCCACTCGTGGATGCTGG CATGAGAGAGCTCTGGGCTACAGGCTGGATGCACAACCGCA TCCGGGTAATCGTGTCCTCATTTGCTGTCAAGTTTCTGCTCC TGCCTTGGAAATGGGGAATGAAGTACTTTTGGGATACCCTTC TCGACGCCGACTTGGAGTGTGACATTCTGGGATGGCAATAT ATTAGCGGGTCAATTCCTGACGGCCATGAGTTGGACAGGTT GGACAATCCGGCCTTGCAGGGAGCTAAGTATGATCCCGAAG GAGAGTATATTCGACAGTGGCTCCCCGAGCTGGCCCGACTT CCTACGGAGTGGATTCACCATCCTTGGGACGCACCACTGAC AGTGCTCAAGGCAAGCGGGGTGGAGCTGGGCACCAATTAC GCTAAGCCTATAGTTGATATAGATACAGCACGCGAGCTGCTG GCTAAAGCGATCTCTCGCACTCGGGAGGCGCAGATTATGAT CGGTGCTGCC CIBN ATGAATGGAGCTATAGGAGGTGACCTTTTGCTCAATTTTCCT GACATGTCGGTCCTAGAGCGCCAAAGGGCTCACCTCAAGTA CCTCAATCCCACCTTTGATTCTCCTCTCGCCGGCTTCTTTGC CGATTCTTCAATGATTACCGGCGGCGAGATGGACAGCTATCT TTCGACTGCCGGTTTGAATCTTCCGATGATGTACGGTGAGAC GACGGTGGAAGGTGATTCAAGACTCTCAATTTCGCCGGAAA CGACGCTTGGGACTGGAAATTTCAAGGCAGCGAAGTTTGAT ACAGAGACTAAGGATTGTAATGAGGCGGCGAAGAAGATGA CGATGAACAGAGATGACCTAGTAGAAGAAGGAGAAGAAGA GAAGTCGAAAATAACAGAGCAAAACAATGGGAGCACAAAA AGCATCAAGAAGATGAAACACAAAGCCAAGAAAGAAGAG AACAATTTCTCTAATGATTCATCTAAAGTGACGAAGGAATTG GAGAAAACGGATTATATT (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted March 13, 2025. ; https://doi.org/10.1101/2025.03.10.642306doi: bioRxiv preprint S16

[1] Huang, Z., Li, Z., Zhang, X., Kang, S., Dong, R., Sun, L., Fu, X., Vaisar, D., Watanabe, K., and Gu, L. (2020) Creating Red Light-Switchable Protein Dimerization Systems as Genetically Encoded Actuators with High Specificity, ACS Synth Biol 9, 3322-3333. [2] Qin, X., Park, B. O., Liu, J., Chen, B., Choesmel-Cadamuro, V., Belguise, K., Heo, W. D., and Wang, X. (2017) Cell-matrix adhesion and cell-cell adhesion differentially control basal myosin oscillation and Drosophila egg chamber elongation, Nat Commun 8, 14708. (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted March 13, 2025. ; https://doi.org/10.1101/2025.03.10.642306doi: bioRxiv preprint