Detection of Flaviviruses in Mosquitoes from a Livestock Farm in Ibadan, Nigeria

preprint OA: closed CC-BY-4.0
📄 Open PDF Full text JSON View at publisher
Full text 135,226 characters · extracted from preprint-html · click to expand
Detection of Flaviviruses in Mosquitoes from a Livestock Farm in Ibadan, Nigeria | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Detection of Flaviviruses in Mosquitoes from a Livestock Farm in Ibadan, Nigeria Oluwapelumi S. Ogunlusi, Adewale V. Opayele, Babatunde O. Motayo, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-8271914/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 8 You are reading this latest preprint version Abstract Background Flaviviruses represent a diverse genus within the Flaviviridae family, comprising over 70 enveloped, single-stranded positive-sense RNA viruses that pose significant global health threats. Yellow fever virus (YFV) remains a significant public health concern in Nigeria, with suboptimal vaccination coverage and persistent transmission risk. Understanding local flavivirus circulation in mosquito vectors is crucial for disease surveillance and prevention strategies. Methods Adult female mosquitoes were collected from the University of Ibadan’s dairy and teaching farms between June and August 2022 using stationary human-bait catches and miniature light traps. Mosquitoes were morphologically identified, pooled by species and collection site, and screened for flaviviruses using hemi-nested reverse-transcription PCR targeting the NS5 gene. Positive samples were sequenced and phylogenetic analysis carried out. Results A total of 600 mosquitoes, representing six species from three genera were collected, with Aedes aegypti predominating (60.67%). Of 22 mosquito pools tested, three were positive for flaviviruses. Yellow fever virus was detected in one pool of 37 A. aegypti specimens, while insect-specific flaviviruses were identified in two other pools of the same mosquito. Phylogenetic analysis showed that the YFV isolate clustered with recent Nigerian strains (2018–2020), indicating local circulation. Conclusions This study confirms ongoing flavivirus circulation in mosquito populations, underscoring potential transmission risk to humans despite low infection rates. The detection of YFV in A. aegypti and co-circulating insect-specific flaviviruses warrants sustained monitoring to mitigate zoonotic and arboviral threats. Yellow fever virus Mosquito Molecular detection Nigeria Figures Figure 1 Figure 2 Figure 3 INTRODUCTION Flaviviruses, a group of over 70 RNA viruses within the Flaviviridae family known to cause a range of infections and diseases, emphasizing their global health significance. They are responsible for annual mortality rates exceeding 700,000 deaths. Key members of this family include yellow fever, dengue, Zika, and West Nile viruses, with an estimated burden of 59,220,428 individuals infected globally in 2021 [ 1 , 2 ]. Clinically, about 50–80% of flavivirus infections are asymptomatic or mild, often resembling self-limiting flu-like illnesses with symptoms such as fever, headache, muscle and joint pain, rash, and conjunctivitis. The symptomatic spectrum can range from mild febrile episodes to severe manifestations, including hemorrhagic fever, shock syndrome, encephalitis, paralysis, and congenital defects, depending on the specific virus and host factors [ 3 ]. The circulation cycle involves complex virus-vector-host interactions where mosquitoes acquire viruses from viremic mosquitoes and spread to susceptible hosts. This process encompasses systematic viral dissemination from the mosquito midgut to salivary glands, enabling subsequent transmission during blood feeding [ 4 , 5 ]. Transmission occurs through distinct ecological cycles, with sylvatic cycles involving non-human primates and arboreal mosquitoes in forest environments serving as primary maintenance mechanisms. Small-to-medium mammals function as amplifying hosts, while the transition from sylvatic to urban cycles through peridomestic Aedes aegypti populations enables large-scale human outbreaks [ 6 , 7 ]. Livestock environments create critical transmission interfaces through optimal mosquito breeding conditions in shaded, damp microenvironments. These agricultural settings facilitate spillover events where sylvatic and domestic cycles intersect, with humans and domestic animals serving as incidental hosts experiencing severe clinical manifestations due to their dead-end host status [ 8 , 9 ]. Nigeria's tropical climate provides year-round mosquito prevalence with seasonal variations ranging from 14.35 to 55.48 mosquitoes per perso n per night between dry and wet seasons. Temperature ranges of 24.96°C to 29.24°C and relative humidity fluctuations between 31–89% create optimal conditions for multiple vector species, including Aedes aegypti, Aedes albopictus , and Culex quinquefasciatus [ 10 , 11 ]. Contemporary outbreaks demonstrate the critical role of environmental interfaces in disease emergence. Nigeria has reported series of outbreaks of arboviruses in communities across the county recent times [ 12 , 13 ]. Current surveillance systems face significant limitations, including suboptimal geographic coverage and limited capacity for detecting multiple flavivirus species beyond yellow fever. The University of Ibadan livestock farms represent ideal sites due to extensive mosquito breeding proximity and documented presence of insecticide-resistant Aedes populations. Continuous monitoring in livestock farm settings provides essential data for understanding flavivirus ecology, identifying circulating viral strains, and assessing vector competence under natural conditions [ 14 , 15 ]. These surveillance activities are important in Nigeria's disease prevention and control strategies, particularly for vector-borne diseases and the potential for international spread through travel and trade networks. This study aims to determine the circulation and prevalence of flaviviruses in mosquito populations at the University of Ibadan livestock farms, providing crucial data for understanding local transmission dynamics and informing targeted prevention strategies in Nigeria's evolving epidemiological context. MATERIALS AND METHODS Study sites The study was carried out at the dairy farm and the teaching and research farm of the University of Ibadan, Oyo State. Mosquito collection sites were selected based on spatial characteristics associated with increased mosquito activity, such as proximity to extensive mosquito breeding sites (water puddles), easy accessibility by foot, proximity to farm units, and canals with vegetation (Fig. 1 ). Mosquito collection Two sampling techniques were used in the collection of adult mosquitoes. These were the stationary direct human-bait catches and use of miniature light traps and operated between 4:00 pm and 8:00 pm. The sites were sampled twice every week from June 1st to August 31st, 2022. The traps were set at 4:00 pm each day during the sampling period. Using the stationary direct human-bait method, vaccinated human collectors exposed their legs which are favored biting sites for numerous mosquito species. When the mosquito has settled on this exposed area, they were then caught by carefully placing a universal bottle over them before they bit and then carefully capping it to prevent them from escaping. Mosquito identification, sorting and storage Collected mosquitoes were examined and identified to species level using morphological characteristics according to the classification keys [ 16 , 17 ]. The collected mosquitoes were sorted/pooled into vials by collection site, date, and species (10–50 mosquitoes per pool). The pooled mosquitoes were then stored at -20 o c in RNA litter in the laboratory prior to processing. Flavivirus detection by hemi-nested reverse-transcription polymerase chain reaction (RT-PCR) and sequencing Flavivirus detection by hemi-nested reverse-transcription polymerase chain reaction (RT-PCR) and sequencing Each mosquito pool to be tested for the viruses was triturated in a cold mortar with sterile RNA later. Each pool mixture after grinding was poured into separate labelled eppendorf tubes. Total RNA was extracted using the QIAmp viral RNA Mini Kit. (Qiagen Inc., Valencia, CA). To detect flavivirus RNA in the samples, a one-step reverse transcription PCR was initially done using the SCRIPT Reverse Transcriptase mix (Jena Bioscience, Germany). Amplicons from this first step were then used as templates for the hemi-nested PCR protocol. The protocols used for flavivirus detection were those described by [ 18 ]. Yellow fever vaccine (17D strain) was used as positive control. The Primer sequence published by Scaramozzino et al ., 2001 were used for the PCR assay (Table 1 ). The primers used were CFD2/MAMD and CFD2/FS778 with both targeting the NS5 gene of the viral genome. For the first round RT-PCR assay, amplifications were carried out in 20 µl of reaction mixture containing the following components: 2.2 µl PCR grade water (Jena Bioscience, Germany), 10 µl of SCRIPT Reverse Transcriptase mix (Jena Bioscience, Germany), 0.8 µl of enzyme mix (Jena Bioscience, Germany), 1 µl each of both forward (MAMD) and reverse (CFD2) primers, and 5 µl of the template. All reactions were carried out in a thermocycler (Genemate MRC-400 PCR machine) under the following conditions: Reverse transcription was first performed at 50°C for 60 minutes, followed by an initial denaturation step at 95°C for 5 minutes. Subsequently, 25 cycles of amplification were conducted, each consisting of denaturation at 95°C for 10 seconds, annealing at 53°C for 30 seconds, and elongation at 72°C for 1 minute. Finally, a terminal elongation step at 72°C for 5 minutes was included to ensure complete extension of all amplicons. In the hemi-nested protocol, 2.5 µl of the first product was used as template for the next assay. Amplifications were carried out in a similar 20 µl reaction mixture containing the following components: 11.5 µl PCR water (Jena Bioscience, Germany), 4 µl of red load PCR Mix (Jena Bioscience, Germany), 1 µl each of both forward (FS778) and reverse primers (CFD2), and 2.5 µl of the template. The following PCR cycling protocol was used: An initial denaturation step at 94°C for 5 minutes preceded 35 amplification cycles. Each cycle consisted of denaturation at 94°C for 30 seconds, primer annealing at 54°C for 30 seconds, and elongation at 72°C for 1 minute. Upon completion of the cycles, a final elongation step at 72°C for 5 minutes was conducted to ensure full extension of the amplified DNA fragments. All steps were optimized to achieve specificity and efficiency in the nested amplification process. The PCR products were electrophoresed in a 2% agarose gel stained with ethidium bromide (2 µg/ml); and then visualized and photographed under ultraviolet illumination. Positive samples were sequenced using both forward and reverse primers in using sanger sequencing. The resulting sequences were compared with GenBank reference sequences. Nucleotide sequence analysis The sequences were trimmed and cleaned using Bioedit to remove low-quality reads. The cleaned sequence reads were then compared to other flavivirus sequences on the NCBI database using the BLASTN algorithm (blast.ncbi.nlm.gov/Blast.cgi). Sequences exhibiting significant similarity to the query reads, generated by a BLAST search, were retrieved from databases and subjected to sequence alignment, which served as the foundation for phylogenetic tree construction. Multiple sequence alignment was done using the Muscle program on the Mega 11 software and construction of phylogenetic tree using the maximum likelihood analysis with 1000 bootstrap replicates and Kimura 2 parameter as the best model. STATISTICAL ANALYSIS The True Infection Rate (TIR) of the collected mosquitoes was calculated as the proportion of infected mosquito bodies to the total mosquitoes tested using a pool of between 1–50 mosquitoes per pool. Therefore, the formula for TIR is given as TIR = the number of positive pools / mosquitoes tested x100 [ 19 ]. The density of infected mosquitoes DIM of each species was estimated using the formula: DIM = Total number of mosquitoes of same species collected/Total days spent during collection x TIR [ 19 ]. Table 1 Primer sequence for RT-PCR Primer Name Primer Sequence (5’-3’) Region Annealing temp. ( o C) Amplified product (bp) CFD2 GTGTCCCAGCCGGCGGTGTCATCAG NS5 53 250 MAMD AACATGATGGGRAARAGRGARAA NS5 53 CFD2 GTGTCCCAGCCGGCGGTGTCATCAG NS5 53 220 FS 778 AARGGHAGYMCDGCHATHTGGT NS5 54 Single-letter ambiguity code: W, A/T; K, G/T; R, A/G; Y, C/T; N, A/C/G/T RESULTS Presence and abundance of Mosquito species A total of 600 adult female mosquitoes, comprising 6 species in 3 genera ( Aedes , Culex , and Mansonia ), were collected during the sampling period (Table 2 ). There were significantly more Aedes mosquitoes captures compared to the other species represented (Table 2 ). Aedes species collectively dominated the collection, comprising 425 specimens (70.84%) of the total sample. This genus includes three species, with A. aegypti (60.67%) being the primary contributor, while A. albopictus (7.6%) and A. mcintoshi (2.5%) were present in much smaller numbers. Culex species represented 107 specimens (17.83%), with C. pipens (9.83%), being slightly more abundant than C. quinquefasciatus ( 8.00% ). Mansonia uniformis ( 11.33% ) was the sole representative of its genus, accounting for 68 specimens (11.33%). (Table 2 ). Virus detection in mosquitoes A total of 600 mosquitoes were collected and grouped into 22 pools based on sampling/collection site, collection period and species. 3 positive pools (13.6%) were detected from the study (Table 3 ). Yellow fever virus was detected in 1 pool (P11) containing 37 Aedes aegypti species collected from the teaching and research farm in Late August, 2022 (Table 3 ). Insect specific viruses were detected in 2 pools (P1 and P5). P1 contains 63 Aedes aegypti collected from the dairy farm in mid-June while P5 contains 21 Aedes albopictus mosquitoes similarly collected from the dairy farm in June, 2022 (Fig. 2 ). Prevalence of positive mosquito species Two distinct arboviruses were identified in the surveillance: Insect-Specific Flavivirus (ISFV) and Yellow Fever Virus (YFV). Infections were detected solely in Aedes species, representing 33% of tested species but accounting for the majority of specimens examined. Aedes albopictus demonstrated the highest True Infection Rate (TIR) at 2.17%, nearly four times higher than A. aegypti (0.55%). However, A. aegypti exhibited a substantially higher Dissemination Index of Mosquitoes (DIM) at 7.15% compared to A. albopictus (3.57%). The weighted overall TIR across all species was 0.50%, reflecting the concentration of infections within Aedes populations. Aedes genus represented 71% of total specimens (425/600) with infection detected in 67% of Aedes species tested (2/3 species). This genus served as the primary reservoir for both identified arboviruses. Culex genus comprised 18% of specimens (107/600) across two species, with no detectable infections in either C. pipiens or C. quinquefasciatus . Mansonia genus represented 11% of specimens (68/600) with no infections detected in M. uniformis. (Table 4 ). Table 2 Frequency of mosquito species collected at the University of Ibadan Farm (Teaching and Research farm, and Dairy Farm) Mosquito Species Frequency Percentage Aedes aegypti 364 60.67% Aedes albopictus 46 7.67% Aedes mcintoshi 15 2.50% Culex pipens 59 9.83% Culex quinquefasciatus 48 8.00% Mansonia uniformis 68 11.33% Total 600 100.00% 3A 3B Figure 3 A. Phylogenetic tree of Mosquito flaviruses isolated from Mosquitoes on University of Ibadan (UI) farm. Study sequences are represented with red labels. 3B. Maximum likelihood phylogenetic tree of Yellow fever virus isolated from Mosquitoes on UI Farm. Blue box represents the East African genotyupe, green box represents the West African genotype and the yellow box represents the West African genotype. Table 3 Features of Flavivirus positive mosquitoes Pool Code Collection Site Collection period Pool Size Specie Virus detected P1 Dairy Farm June 1st − 21st, 2022 63 Aedes aegypti Insect specific flavivirus P2 Dairy Farm June 23rd, 2022 72 Aedes aegypti Nil P3 Dairy Farm June 28th − 29th, 2022 78 Aedes aegypti Nil P4 Dairy Farm July 5th − 6th 2022 26 Aedes aegypti Nil P5 Dairy Farm June, 2022 21 Aedes albopictus Insect specific flavivirus P6 Dairy Farm July, 2022 20 Aedes albopictus Nil P7 Dairy Farm June, 2022 13 Aedes mcintoshi Nil P8 Dairy Farm July, 2022 2 Aedes mcintoshi Nil P9 Dairy Farm July 14th − 19th, 2022 40 Aedes aegypti Nil P10 Teaching and Research Farm August 2nd − 9th 2022 23 Aedes aegypti Nil P11 Teaching and Research Farm August 16th − 30th 2022 37 Aedes aegypti Yellow Fever Virus P12 Teaching and Research Farm August, 2022 5 Aedes albopictus Nil P13 Teaching and Research Farm August, 2022 3 Culex pipens Nil P14 Teaching and Research Farm August, 2022 2 Culex quinquefasciatus Nil P15 Teaching and Research Farm August, 2022 3 Mansonia uniformis Nil P16 Dairy Farm June, 2022 44 Mansonia uniformis Nil P17 Dairy Farm July, 2022 21 Mansonia uniformis Nil P18 Dairy Farm July 20th − 27th, 2022 25 Aedes aegypti Nil P19 Dairy Farm June, 2022 39 Culex pipens Nil P20 Dairy Farm July, 2022 17 Culex pipens Nil P21 Dairy Farm June, 2022 29 Culex quinquefasciatus Nil P22 Dairy Farm July, 2022 17 Culex quinquefasciatus Nil Table 4 Prevalence of Infected mosquitoes Mosquito Mosquitoes tested Pools tested Arboviruses identified in positive pools TIR (%) DIM (%) Aedes aegypti 364 8 ISFV (1) and YFV (1) 0.55% 7.15% Aedes albopictus 46 3 ISFV (1) 2.17% 3.57% Aedes mcintoshi 15(1) 2 0 0% 0% Culex Pipens 59(1) 3 0 0% 0% Culex quinquefasciatus 48(1) 3 0 0% 0% Mansoni Uniformis 68(1) 3 0 0% 0% TIR = True infection rate (estimated number of positive mosquitoes per 100 mosquitoes tested) [ 17 ]; **DIM = density of infected mosquitoes (total no. of mosquitoes collected / No. of collection nights x TIR (28 collection nights was used for the calculations) [ 18 ] Phylogenetic analysis The YFV sequences were similar to the Yellow Fever − 2018 -Nigeria Strain and the 2020 Nigeria YFV strain (86.49% similarity) Maximum likelihood analysis placed this sequence with the YFV lineage clade strains (Fig. 4) with nucleotide identities of 75–87% to several global isolates. (GenBank accession MN958078.1, and ON323052.1) (Fig. 3 ). For the insect specific virus isolates, maximum likelihood analysis of these sequences revealed their similarity to at least 3 distinct insect specific viruses (i.e. the Phlebotomus associated flavivirus GenBank accession MN294942.1, Aedes aegypti endogenous flavivirus GenBank accession MZ399704.1, and Flaviviridae sp. MT863350.1). Isolate (P1) showed a high identity with the phlebotomus associated viruses detected in mosquitoes collected between 2016 to 2017 at different locations in Saudi Arabia (Fig. 3 ). Also, similar NS5 sequences have been identified in Aedes mosquitoes collected in Cote d’Ivoire in the year 2004. The mosquito pool with the largest divergence from all other flaviviruses is the insect specific flavivirus (P5) with its most related virus being the Flaviviridae sp. isolate collected in Argentina in year 2019 (Fig. 3 ). DISCUSSION This study was undertaken to provide information on and evidence of circulation of Flaviviruses of medical importance in an human-animal interface environment (the University of Ibadan farm, Oyo State, Nigeria) in Ibadan, Nigeria. Findings from this study indicate the predominance of Aedes species, notably Aedes aegypti , Aedes albopictus , and Aedes mcintoshi in this environment. These species are of medical importance with Ae. aegypti and Ae. albopictus implicated in the transmission of Yellow Fever/Dengue virus in Nigeria [ 20 , 21 ] while Ae. mcintoshi has recently been implicated with Rift valley fever virus in Kenya [ 22 ]. As a result, their presence in this study area would signify a potential risk of transmission of YFV and DENV. These findings are comparable or similar to investigations in Bayelsa where a high prevalence of Aedes mosquito species were also reported [ 23 ], and also comparable to studies conducted in Benin republic [ 24 ], South Africa and Central African Republic [ 25 ], all of which had similarly high Aedes spp. The mosquito pools from the teaching and research farm, University of Ibadan identified a Yellow Fever virus from an Aedes albopictus species. This clearly shows that transmission of Yellow Fever may be ongoing but not at a rate that can be assumed of epidemic status as outbreaks have not been recently reported at the University of Ibadan. Given the repeated history of Ae. aegypti and Ae. albopictus in yellow fever transmission [ 26 ], the zoophilic tendency observed for this species in this study mirrors previous similar findings reported in West Africa [ 27 ]. Similarly, Aedes aegypti mosquitoes collected from the dairy farm, University of Ibadan were found to be infected with two insect-specific flaviviruses (Phlebotomus associated flavivirus and Aedes endogenous flavivirus). Aedes integrated flaviviruses have previously been detected in a variety of Aedes species such as Ae. aegypti and Ae. albopictus [ 28 ]. Findings from this study suggest that Aedes endogenous flavivirus and phlebotomus associated viruses can be isolated from some Aedes species which is as seen in previous studies from Saudi Arabia, China and France respectively [ 29 ]. Analysis from the study showed that Aedes aegypti had the highest density of infected mosquitoes in both of the collection sites used while the highest true infection rate was identified in the Aedes albopictus . It is yet to be determined if this level of infection can constitute a risk for YF transmission because reports from other authors have pegged transmission risk at TIR > 4 to Culex species with WNV [ 30 ]. Similarly, studies from Yucatan, Mexico [ 31 ], and Europe [ 32 ] have shown a significantly positive relationship between the TIR of Aedes mosquitoes and transmission risk to the human population. The phylogenetic reconstruction demonstrates the characteristic trichotomous division of African YFV into three major evolutionary lineages, with sequences clustering according to well-established biogeographical patterns (Fig. 4). The Ibadan sequences position within the West African genotypic framework, specifically clustering with West African Genotype I strains, which is consistent with the known geographic distribution extending from eastern Ivory Coast through Nigeria. This genotype has been associated with greater genetic heterogeneity, potentially reflecting regular epidemic cycles in human populations rather than stable enzootic transmission patterns [ 33 , 34 ]. The tree structure reveals distinct geographic clustering across African regions. The upper yellow section represents West African genotypes, while the lower green portion encompasses East/Central African strains from countries including Uganda, Sudan, and the Democratic Republic of Congo. The Angola genotype appears as the most divergent African lineage, reflecting ancient evolutionary separation from other continental strains. This geographic partitioning supports the concept of regionally restricted viral circulation with limited inter-regional exchange [ 35 , 36 ]. The 0.02 substitutions per site scale bar indicates evolutionary distances consistent with YFV's conservative mutation rates of approximately 2.1×10⁻⁴ to 2.8×10⁻⁴ substitutions per site per year. The relatively short branch lengths within genotypic clades reflect recent common ancestry among geographically proximate strains and the slow evolutionary pace characteristic of YFV compared to other flaviviruses [ 37 ]. Recent molecular epidemiological studies have revealed that contemporary Nigerian outbreaks may derive from broader West African circulation patterns rather than exclusively local lineages. The 2018 Edo State outbreak demonstrated that Nigerian sequences clustered more closely with Senegalese strains than historical Nigerian isolates, indicating complex regional dispersal dynamics. This finding emphasizes the importance of regional surveillance approaches rather than country-specific monitoring strategies [ 38 ]. The phylogenetic positioning of Ibadan sequences within the established West African framework confirms indigenous viral circulation and provides essential baseline data for ongoing surveillance efforts. The analysis contributes to understanding viral ecology patterns crucial for predicting outbreak dynamics and informing evidence-based public health responses across the West African epidemiological landscape [ 39 ]. The other two flaviviruses detected were insect-specific viruses (ISVs). Insect-specific viruses are known to infect insect cells, but they do not replicate in vertebrates or vertebrate cells. The viruses isolated form two distinct phylogenetic and antigenic clades. These findings show the possibility of competitive inhibition as an influence on the transmission of arboviruses of medical importance. Similar findings have been published by Vasilakis et al, 2015 [ 40 ]. Just as well, ISVs have been implicated in the reduction of transmission risk of arboviruses because they can alter vector competence in the vector mosquitoes [ 41 ]. In more recent studies, they ISVs have been proposed as possible Biological Control Agents or Vaccine and Diagnostic platforms for arboviruses [ 42 , 43 ]. Overall, this study has been able to provide valuable insights into the presence and circulation of flaviviruses and the implication of the mosquito and viral diversity seen around the University of Ibadan dairy and teaching and research farms, Oyo State, Nigeria. Declarations Ethics approval to participate Not Applicable Consent for publication No applicable Availability of data materials The sequence data generated in this study are freely available on GenBank with accession numbers PX315715-16. Competing interest The authors declare that they have no competing of interests. Funding The authors did not receive any funding or financial support for this project. Author contributions Conceptualization; Oluwapelumi S Ogunlusi and Adewale V Opayele, Data collection and literature search; Oluwapelumi S Ogunlusi and Adewale V Opayele, Formal analysis; Oluwapelumi S Ogunlusi, Babatunde O Motayo and Adewale V Opayele, Manuscript draft; Oluwapelumi S Ogunlusi, Review and editing; Oluwapelumi S Ogunlusi, Babatunde O Motayo, Adewale V Opayele, and Adedayo O Faneye Acknowledgements Not applicable References Liang Y, Dai X (2024) The global incidence and trends of three common flavivirus infections (Dengue, yellow fever, and Zika) from 2011 to 2021. Front Microbiol 15:1458166. 10.3389/fmicb.2024.1458166 PMID: 39206366; PMCID: PMC11349664 Zhao R, Wang M, Cao J, Shen J, Zhou X, Wang D, Cao J, Flavivirus (2021) From Structure to Therapeutics Development. Life (Basel) 11(7):615. 10.3390/life11070615 PMID: 34202239; PMCID: PMC8303334 The Flaviviruses | CEPI (2023) December 13). https://cepi.net/flaviviruses Wang X, Usama A, Huanchun C, Cao S, Ye J (2023) Biological determinants perpetuating the transmission dynamics of mosquito-borne flaviviruses. Emerg Microbes Infect 12(2):2212812 PMID: 37158598; PMCID: PMC10274526 Madere FS, Andrade da Silva AV, Okeze E et al (2025) Flavivirus infections and diagnostic challenges for dengue, West Nile and Zika Viruses. npj Viruses 3:36. https://doi.org/10.1038/s44298-025-00114-z Blahove MR, Carter JR (2021) Flavivirus Persistence in Wildlife Populations. Viruses 13(10):2099. 10.3390/v13102099 PMID: 34696529; PMCID: PMC8541186 Vasilakis N, Weaver SC (2017) Flavivirus transmission focusing on Zika. Curr Opin Virol 22:30–35. 10.1016/j.coviro.2016.11.007 Epub 2016 Dec 6. PMID: 27936448; PMCID: PMC5346038 Transmission of Yellow fever virus (2024), May 15 Yellow Fever Virus. https://www.cdc.gov/yellow-fever/php/transmission/index.html Casades-Martí L, Peralbo‐Moreno A, Delacour‐Estrella S, Ruiz‐Fons F (2024) Environmental determinants of West Nile virus vector abundance at the wildlife–livestock interface. Med Vet Entomol. https://doi.org/10.1111/mve.12774 Victor OA, Adekunle AJ, Tahiru IK, David OO (2017) Influence of Meteorological Variables on Diversity and Abundance of Mosquito Vectors in Two Livestock Farms in Ibadan, Nigeria: Public Health Implications. J Mosq Res 7(9):70–78. 10.5376/jmr.2017.07.0009 Epub 2017 Jun 23. PMID: 28845206; PMCID: PMC5570447 Ezihe EK, Chikezie FM, Egbuche CM, Nwankwo EN, Onyido AE, Aribodor D, Samdi ML (2017) Seasonal distribution and Micro-Climatic factors influencing the abundance of the malaria vectors in South-East Nigeria. J Mosq Res. https://doi.org/10.5376/jmr.2017.07.0003 Olayemi IK, Ande AT (2008) Relative abundance and seasonal distribution of adult mosquito species in Offa, Kwara State, Nigeria. Nigerian J Entomol 25(1). https://doi.org/10.36108/nje/8002/52.0160 Outbreak in Uselu: How Swift Action Saved Lives from Dengue’s Silent Threat | WHO | Regional Office for Africa (2025), July 26 WHO | Regional Office for Africa. https://www.afro.who.int/countries/nigeria/news/outbreak-uselu-how-swift-action-saved-lives-dengues-silent-threat Yellow Fever situation update, July 2024 - Nigeria (2024), September 13 ReliefWeb. https://reliefweb.int/report/nigeria/yellow-fever-situation-update-july-2024 Nigeria Centre for Disease Control and Prevention (n.d.). https://ncdc.gov.ng/news/506/ncdc-on-alert-following-the-confirmation-of-the-dengue-fever-outbreak-in-sokoto-state Becker N, Petric D, Zgomba M, Boase C, Madon M, Dahl C, Kaiser A.2010. Mosquitoes and their control, Springer: Berlin 6th edition Carney R, Mapes C, Low R, Long A, Bowser A, Durieux D, Rivera K, Dekramanjian B, Bartumeus F, Guerrero D, Seltzer C, Azam F, Chellappan S, Palmer J (2022) Integrating global citizen science platforms to enable Next-Generation surveillance of invasive and vector mosquitoes. Insects 13(8):675. https://doi.org/10.3390/insects13080675 Scaramozzino N, Crance JM, Jouan A, DeBriel DA, Stoll F, Garin D (2001) Comparison of Flavivirus universal primer pairs and development of a rapid, highly sensitive heminested reverse transcription-PCR assay for detection of flaviviruses targeted to a conserved region of the NS5 gene sequences. J Clin Microbiol 39:1922–1927 Agwu JE, Isaac C, Igbinosa IG (2019) Detection of yellow fever and dengue viruses in mosquitoes between 2014 and 2015 in Bayelsa and Benue states of Nigeria Acta entomologica serbica 24.1: 59–78 Faneye A, Nioma I, Olanrewaju MB, Adeyinka A, Ebele A (2013) Serological evidence of recent dengue virus infection among febrile children in a semi-arid zone. Am J Infect Dis 9:7–10 Onoja AB, Omatola AC, Maiga M, Gadzama IS (2022) Recurrent Episodes of Some Mosquito-Borne Viral Diseases in Nigeria: A Systematic Review and Meta-Analysis. Pathogens 11:1162 Campbell LP, Reuman DC, Lutomiah J, Petersen AT, Linthicum KJ, Britich SC, Anyamba A, Sang R (2019) Predicting abundances of Aedes mcintoshi, a primary Rift valley fever virus mosquito vector. PLoS ONE 1412:e0226617 Agwu JE, Isaac C, Igbinosa IG (2019) Detection of yellow fever and dengue viruses in mosquitoes between 2014 and 2015 in Bayelsa and Benue states of Nigeria Acta entomologica serbica 24.1: 59–78 Padonou GG, Konkon AK, Salako AS, Zoungbédji DM, Ossè R, Sovi A, Azondekon R, Sidick A, Ahouandjinou JM, Adoha CJ, Sominahouin AA, Tokponnon FT, Akinro B, Sina H, Baba-Moussa L, Akogbéto MC (2023) Distribution and Abundance of Aedes aegypti and Aedes albopictus (Diptera: Culicidae) in Benin, West Africa. Trop Med Infect Disease 8(9):439. https://doi.org/10.3390/tropicalmed8090439 Longbottom J, Walekhwa AW, Mwingira V, Kijanga O, Mramba F, Lord JS (2023) Aedes albopictus invasion across Africa: the time is now for cross-country collaboration and control. Lancet Global Health 11(4):e623–e628. https://doi.org/10.1016/s2214-109x(23)00046-3 Pinhero G, Rocha M, de Oliveira M, Moreira A, Filho JD (2019) Detection of Yellow Fever Virus in sylvatic mosquitoes during disease outbreaks of 2017–2018 in Minas Gerais State, Brazil. Insects 10:136 Diallo D, Sall AA, Buenemann M, Chen R, Faye O (2012) Landscape ecology of sylvatic chikungunya virus and mosquito vectors in southeastern Senegal. Negl Trop Dis 6:1649 Spadar A, Phelan JE, Benavente ED (2021) Flavivirus integrations in Aedes aegypti are limited and highly conserved across samples from different geographical regions unlike integrations in Aedes albopictus. Parasites vector 14:332 Fang Y, Tambo E, Xue JB, Zhang Y, Zhou XN, Khater E (2021) Detection of DENV-2 and insect specific flaviviruses in mosquitoes collected from Jeddah, Saudi Arabia. Frony Cell Infect Microbiol 25:11:626–638 Bashar K, Rahman MS, Nodi IJ, Howlander AJ (2016) Species composition and habitat characterization of mosquito (Dipteria: Culicidae) larvae in semi-urban areas of Dhaka, Bangladesh. Pathog Glob Health 110(2):48–61 Scholle F, Girard Y, Zhao Q, Higgs S, Mason P (2004) trans-packaged West Nile Virus like particles: infectious properties invitro. infected Mosq vectors Jvirol 21:11605 Kirstein OD, Ayora-Talavera G, Koyoc-Cardeña E, Chan Espinoza D, Che-Mendoza A, Cohuo-Rodriguez A, Granja-Pérez P, Puerta-Guardo H, Pavia-Ruz N, Dunbar MW, Manrique-Saide P, Vazquez-Prokopec GM (2021) Natural arbovirus infection rate and detectability of indoor female Aedes aegypti from Mérida, Yucatán, Mexico. PLoS Negl Trop Dis 15(1):e0008972. 10.1371/journal.pntd.0008972 PMID: 33395435; PMCID: PMC7781390 Zardini A, Menegale F, Gobbi A, Manica M, Guzzetta G, D’Andrea V, Marziano V, Trentini F, Montarsi F, Caputo B, Solimini A, Marques-Toledo C, Wilke ABB, Rosà R, Marini G, Arnoldi D, Piontti APY, Pugliese A, Capelli G, Poletti P (2024) Estimating the potential risk of transmission of arboviruses in the Americas and Europe: a modelling study. Lancet Planet Health 8(1):e30–e40. https://doi.org/10.1016/s2542-5196(23)00252-8 Rezende IM, Sacchetto L, Alves PA, Labeaud AD, Drumond BP (2025) Yellow Fever Virus Genotyping Tool Using RT-qPCR Followed by Nucleotide Sequencing and Phylogenetic Analysis. In: Gomes Fernandes A (ed) Yellow Fever Virus. Methods in Molecular Biology, vol 2913. Humana, New York, NY. https://doi.org/10.1007/978-1-0716-4458-4_13 Mutebi JP, Wang H, Li L, Bryant JE, Barrett AD (2001) Phylogenetic and evolutionary relationships among yellow fever virus isolates in Africa. J Virol 75(15):6999–7008. 10.1128/JVI.75.15.6999-7008.2001 PMID: 11435580; PMCID: PMC114428 Mutebi JP, Wang H, Li L, Bryant JE, Barrett AD (2001) Phylogenetic and evolutionary relationships among yellow fever virus isolates in Africa. J Virol 75(15):6999–7008. 10.1128/JVI.75.15.6999-7008.2001 PMID: 11435580; PMCID: PMC114428 Beck A, Guzman H, Li L, Ellis B, Tesh RB, Barrett AD (2013) Phylogeographic reconstruction of African yellow fever virus isolates indicates recent simultaneous dispersal into east and west Africa. PLoS Negl Trop Dis. ;7(3):e1910. 10.1371/journal.pntd.0001910 . Epub 2013 Mar 14. PMID: 23516640; PMCID: PMC3597480 Bryant JE, Holmes EC, Barrett AD (2007) Out of Africa: a molecular perspective on the introduction of yellow fever virus into the Americas. PLoS Pathog 3(5):e75. 10.1371/journal.ppat.0030075 PMID: 17511518; PMCID: PMC1868956 Ajogbasile FV, Oguzie JU, Oluniyi PE et al (2020) Real-time Metagenomic Analysis of Undiagnosed Fever Cases Unveils a Yellow Fever Outbreak in Edo State, Nigeria. Sci Rep 10:3180. https://doi.org/10.1038/s41598-020-59880-w Motayo BO, Opayele A, Akinduti PA, Faneye AO, Omoregie IP (2024) Phylodynamic Investigation of Yellow Fever Virus Sheds New Insight on Geographic Dispersal Across Africa. Evol Bioinform Online 20:11769343241309247 PMID: 39691473; PMCID: PMC11650462 Vasilakis N, Tesh RB Insect-specific viruses and their potential impact on arbovirus transmission. Curr Opin Virol 2015 Dec 15:69–74. 10.1016/j.coviro.2015.08.007 . Epub 2015 Aug 31. PMID: 26322695; PMCID: PMC4688193. De Faria IJS, De Almeida JPP, Marques JT (2024) Impact of symbiotic insect-specific viruses on mosquito vector competence for arboviruses. Curr Opin Insect Sci 63:101194. https://doi.org/10.1016/j.cois.2024.101194 Bolling BG, Weaver SC, Tesh RB, Vasilakis N (2015) Insect-Specific Virus Discovery: Significance for the Arbovirus Community. Viruses 7(9):4911–4928. https://doi.org/10.3390/v7092851 Bonney JHK, Sanders T, Pratt D, Agbodzi B, Laryea D, Agyeman NKF, Kumordjie S, Attiku K, Adams PL, Boateng GA, Ohene SA, Tamal C, Mawuli G, Yeboah C, Dadzie S, Kubio C, Asiedu-Bekoe F, Odoom JK (2023) Molecular Characterization of Circulating Yellow Fever Viruses from Outbreak in Ghana, 2021–2022. Emerg Infect Dis 29(9):1818–1826. 10.3201/eid2909.221671 PMID: 37610174; PMCID: PMC10461649 Additional Declarations No competing interests reported. Cite Share Download PDF Status: Under Review Version 1 posted Editorial decision: Revision requested 25 Jan, 2026 Reviewers agreed at journal 22 Dec, 2025 Reviews received at journal 16 Dec, 2025 Reviewers agreed at journal 16 Dec, 2025 Reviewers invited by journal 16 Dec, 2025 Editor assigned by journal 04 Dec, 2025 Submission checks completed at journal 04 Dec, 2025 First submitted to journal 03 Dec, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-8271914","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":561123401,"identity":"f9477c1a-6b3a-4c6b-a3c9-bbf953dca393","order_by":0,"name":"Oluwapelumi S. Ogunlusi","email":"","orcid":"","institution":"University of Ibadan","correspondingAuthor":false,"prefix":"","firstName":"Oluwapelumi","middleName":"S.","lastName":"Ogunlusi","suffix":""},{"id":561123402,"identity":"e8bc878b-4555-4de9-9699-892e5fbbc49c","order_by":1,"name":"Adewale V. Opayele","email":"","orcid":"","institution":"University of Ibadan","correspondingAuthor":false,"prefix":"","firstName":"Adewale","middleName":"V.","lastName":"Opayele","suffix":""},{"id":561123403,"identity":"dce7c6be-d8e0-4c3b-b9df-3d8e94800f71","order_by":2,"name":"Babatunde O. Motayo","email":"","orcid":"","institution":"University of Ibadan","correspondingAuthor":false,"prefix":"","firstName":"Babatunde","middleName":"O.","lastName":"Motayo","suffix":""},{"id":561123404,"identity":"ab89fa6b-189e-4ddb-bf7b-ddcc12d26442","order_by":3,"name":"Adedayo O. Faneye","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA6UlEQVRIiWNgGAWjYFCCBAYJCONg4wMGhgOkaWk2IFULA5sEUVr425MP3vjZZpPP33i4rZqn5o4cPwPzw0c38GiROPMs2bK3Lc1yxoGDbbd5jj0zlmxgMzbOwWfNjRwzCd62wwYMYC1shxM3HOBhk8anRf5G/jfJv0At8kAtxTz/iNBicCOHTRpkiwFQCzOQQViL4ZlnxtYy59IMDA8cbJac23fYWLKZgF/kjic/vPmmzMZA7sbxhx/efDssx8/e/PAxXu+DACMbkJA4wMDEA+IxE1IOBn+AmL+BgfEHUapHwSgYBaNgpAEAOfFWpVE5TNUAAAAASUVORK5CYII=","orcid":"","institution":"University of Ibadan","correspondingAuthor":true,"prefix":"","firstName":"Adedayo","middleName":"O.","lastName":"Faneye","suffix":""}],"badges":[],"createdAt":"2025-12-03 15:38:20","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-8271914/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-8271914/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":98624942,"identity":"35156c30-9152-44d5-8203-900867c90e1d","added_by":"auto","created_at":"2025-12-19 17:08:50","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":291128,"visible":true,"origin":"","legend":"","description":"","filename":"MaindocYFVirusGenes.docx","url":"https://assets-eu.researchsquare.com/files/rs-8271914/v1/fa275011bd3a1b8e133afb3c.docx"},{"id":98625469,"identity":"5bbeb09c-b339-4cd7-982b-5e48d1b56611","added_by":"auto","created_at":"2025-12-19 17:09:09","extension":"json","order_by":1,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":6085,"visible":true,"origin":"","legend":"","description":"","filename":"161fd4cafa8243cbb10fd13454bb1b33.json","url":"https://assets-eu.researchsquare.com/files/rs-8271914/v1/24dd5658defdb5e1604209e0.json"},{"id":98625146,"identity":"a1dda408-8fd8-4fae-80b5-fbe90ef49410","added_by":"auto","created_at":"2025-12-19 17:08:57","extension":"xml","order_by":2,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":129605,"visible":true,"origin":"","legend":"","description":"","filename":"161fd4cafa8243cbb10fd13454bb1b331enriched.xml","url":"https://assets-eu.researchsquare.com/files/rs-8271914/v1/8818756b00eb523fed4b45f6.xml"},{"id":98625844,"identity":"7af982c7-2097-4ec4-b972-968ae420efad","added_by":"auto","created_at":"2025-12-19 17:09:22","extension":"eps","order_by":4,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":597,"visible":true,"origin":"","legend":"","description":"","filename":"drawingimage2.eps","url":"https://assets-eu.researchsquare.com/files/rs-8271914/v1/3652a924bdf1d8b070a643db.eps"},{"id":98519008,"identity":"5f10a555-d247-4fc8-abdb-1863ae59d549","added_by":"auto","created_at":"2025-12-18 13:11:45","extension":"jpeg","order_by":5,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":499794,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage1.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8271914/v1/f5ba4c768760afa366456baf.jpeg"},{"id":98624465,"identity":"da586b65-7f76-41dc-9aa8-084ce81c1019","added_by":"auto","created_at":"2025-12-19 17:08:26","extension":"png","order_by":6,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":98318,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-8271914/v1/3aa59b7c8b1d608c7966571b.png"},{"id":98624584,"identity":"1f4b2cae-6954-4e78-b067-2ab0254dbbdf","added_by":"auto","created_at":"2025-12-19 17:08:31","extension":"png","order_by":7,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":106647,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-8271914/v1/ac18471d7caa1086d62c433b.png"},{"id":98624968,"identity":"b847fdad-6cc2-4ac2-a51b-16137fafeeff","added_by":"auto","created_at":"2025-12-19 17:08:51","extension":"png","order_by":8,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":96194,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-8271914/v1/ea3ce3607ac76d4489fdf280.png"},{"id":98625697,"identity":"1507fab9-3683-4409-bde4-ad3776779558","added_by":"auto","created_at":"2025-12-19 17:09:16","extension":"png","order_by":9,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":16167,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-8271914/v1/efa65d7132c4f3e2523d4435.png"},{"id":98519007,"identity":"db83ba20-551c-41cc-9692-245999c2aed8","added_by":"auto","created_at":"2025-12-18 13:11:45","extension":"png","order_by":10,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":30369,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-8271914/v1/118194d95a06a96b8f90c189.png"},{"id":98519010,"identity":"0e09372f-6dfe-4602-8c5a-2074983c5763","added_by":"auto","created_at":"2025-12-18 13:11:45","extension":"xml","order_by":11,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":128396,"visible":true,"origin":"","legend":"","description":"","filename":"161fd4cafa8243cbb10fd13454bb1b331structuring.xml","url":"https://assets-eu.researchsquare.com/files/rs-8271914/v1/eed5fb4690ae3e5ef52f09b0.xml"},{"id":98625726,"identity":"9c437058-3ff4-45bb-b757-e3f5da18873e","added_by":"auto","created_at":"2025-12-19 17:09:17","extension":"html","order_by":12,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":140612,"visible":true,"origin":"","legend":"","description":"","filename":"earlyproof.html","url":"https://assets-eu.researchsquare.com/files/rs-8271914/v1/fb7dbfac9f3d5a0f770a97ff.html"},{"id":98624814,"identity":"35b6bce6-76af-45e5-92c7-9e1ca40a9dea","added_by":"auto","created_at":"2025-12-19 17:08:43","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":585723,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eA\u003c/strong\u003e. Map of Nigeria, showing Oyo State in purple, and Ibadan the study site as a red dot within Oyo State. \u003cstrong\u003eB\u003c/strong\u003e, Street map of Southern area of the University of Ibadan, and the adjoining community, major land marks such as UI Farm(Study site) and Faculty of Veterinary Medicine are shown with the street networks in black lines, and water bodies as blues lines.\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-8271914/v1/52a3927617a77542888f9e11.png"},{"id":98518996,"identity":"0e47f691-bed0-4238-99d2-e541de83d88a","added_by":"auto","created_at":"2025-12-18 13:11:43","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":19041,"visible":true,"origin":"","legend":"\u003cp\u003ePattern of distribution of mosquitoes across both collection sites\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-8271914/v1/de3045f2afccc1acf135a7b5.png"},{"id":98625078,"identity":"3d5d5825-e3e8-42e3-881b-7c057c9f0fb8","added_by":"auto","created_at":"2025-12-19 17:08:55","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":669976,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eA. \u003c/strong\u003ePhylogenetic tree of Mosquito flaviruses isolated from Mosquitoes on University of Ibadan (UI) farm. Study sequences are represented with red labels. B. Maximum likelihood phylogenetic tree of Yellow fever virus isolated from Mosquitoes on UI Farm. Blue box represents the East African genotyupe, green box represents the West African genotype and the yellow box represents the West African genotype.\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-8271914/v1/1638a67253bdf7c9e493953a.png"},{"id":98774722,"identity":"f7e982a1-e44e-4a1a-8191-04ab19e46076","added_by":"auto","created_at":"2025-12-22 12:12:07","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2137804,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8271914/v1/59f44c18-73fe-47d9-be1e-d66adf7622a2.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Detection of Flaviviruses in Mosquitoes from a Livestock Farm in Ibadan, Nigeria","fulltext":[{"header":"INTRODUCTION","content":"\u003cp\u003eFlaviviruses, a group of over 70 RNA viruses within the Flaviviridae family known to cause a range of infections and diseases, emphasizing their global health significance. They are responsible for annual mortality rates exceeding 700,000 deaths. Key members of this family include yellow fever, dengue, Zika, and West Nile viruses, with an estimated burden of 59,220,428 individuals infected globally in 2021 [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. Clinically, about 50\u0026ndash;80% of flavivirus infections are asymptomatic or mild, often resembling self-limiting flu-like illnesses with symptoms such as fever, headache, muscle and joint pain, rash, and conjunctivitis. The symptomatic spectrum can range from mild febrile episodes to severe manifestations, including hemorrhagic fever, shock syndrome, encephalitis, paralysis, and congenital defects, depending on the specific virus and host factors [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe circulation cycle involves complex virus-vector-host interactions where mosquitoes acquire viruses from viremic mosquitoes and spread to susceptible hosts. This process encompasses systematic viral dissemination from the mosquito midgut to salivary glands, enabling subsequent transmission during blood feeding [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e, \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. Transmission occurs through distinct ecological cycles, with sylvatic cycles involving non-human primates and arboreal mosquitoes in forest environments serving as primary maintenance mechanisms. Small-to-medium mammals function as amplifying hosts, while the transition from sylvatic to urban cycles through peridomestic \u003cem\u003eAedes aegypti\u003c/em\u003e populations enables large-scale human outbreaks [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e, \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. Livestock environments create critical transmission interfaces through optimal mosquito breeding conditions in shaded, damp microenvironments. These agricultural settings facilitate spillover events where sylvatic and domestic cycles intersect, with humans and domestic animals serving as incidental hosts experiencing severe clinical manifestations due to their dead-end host status [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. Nigeria's tropical climate provides year-round mosquito prevalence with seasonal variations ranging from 14.35 to 55.48 mosquitoes per perso\u003c/p\u003e \u003cp\u003en per night between dry and wet seasons. Temperature ranges of 24.96\u0026deg;C to 29.24\u0026deg;C and relative humidity fluctuations between 31\u0026ndash;89% create optimal conditions for multiple vector species, including \u003cem\u003eAedes aegypti, Aedes albopictus\u003c/em\u003e, and \u003cem\u003eCulex quinquefasciatus\u003c/em\u003e [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eContemporary outbreaks demonstrate the critical role of environmental interfaces in disease emergence. Nigeria has reported series of outbreaks of arboviruses in communities across the county recent times [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. Current surveillance systems face significant limitations, including suboptimal geographic coverage and limited capacity for detecting multiple flavivirus species beyond yellow fever. The University of Ibadan livestock farms represent ideal sites due to extensive mosquito breeding proximity and documented presence of insecticide-resistant Aedes populations. Continuous monitoring in livestock farm settings provides essential data for understanding flavivirus ecology, identifying circulating viral strains, and assessing vector competence under natural conditions [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. These surveillance activities are important in Nigeria's disease prevention and control strategies, particularly for vector-borne diseases and the potential for international spread through travel and trade networks. This study aims to determine the circulation and prevalence of flaviviruses in mosquito populations at the University of Ibadan livestock farms, providing crucial data for understanding local transmission dynamics and informing targeted prevention strategies in Nigeria's evolving epidemiological context.\u003c/p\u003e"},{"header":"MATERIALS AND METHODS","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eStudy sites\u003c/h2\u003e \u003cp\u003eThe study was carried out at the dairy farm and the teaching and research farm of the University of Ibadan, Oyo State. Mosquito collection sites were selected based on spatial characteristics associated with increased mosquito activity, such as proximity to extensive mosquito breeding sites (water puddles), easy accessibility by foot, proximity to farm units, and canals with vegetation (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e1\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eMosquito collection\u003c/h3\u003e\n\u003cp\u003eTwo sampling techniques were used in the collection of adult mosquitoes. These were the stationary direct human-bait catches and use of miniature light traps and operated between 4:00 pm and 8:00 pm. The sites were sampled twice every week from June 1st to August 31st, 2022. The traps were set at 4:00 pm each day during the sampling period. Using the stationary direct human-bait method, vaccinated human collectors exposed their legs which are favored biting sites for numerous mosquito species. When the mosquito has settled on this exposed area, they were then caught by carefully placing a universal bottle over them before they bit and then carefully capping it to prevent them from escaping.\u003c/p\u003e\n\u003ch3\u003eMosquito identification, sorting and storage\u003c/h3\u003e\n\u003cp\u003eCollected mosquitoes were examined and identified to species level using morphological characteristics according to the classification keys [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. The collected mosquitoes were sorted/pooled into vials by collection site, date, and species (10\u0026ndash;50 mosquitoes per pool). The pooled mosquitoes were then stored at -20\u003csup\u003eo\u003c/sup\u003ec in RNA litter in the laboratory prior to processing.\u003c/p\u003e\n\u003ch3\u003eFlavivirus detection by hemi-nested reverse-transcription polymerase chain reaction (RT-PCR) and sequencing\u003c/h3\u003e\n\u003cdiv class=\"Heading\"\u003eFlavivirus detection by hemi-nested reverse-transcription polymerase chain reaction (RT-PCR) and sequencing\u003c/div\u003e \u003cp\u003eEach mosquito pool to be tested for the viruses was triturated in a cold mortar with sterile RNA later. Each pool mixture after grinding was poured into separate labelled eppendorf tubes. Total RNA was extracted using the QIAmp viral RNA Mini Kit. (Qiagen Inc., Valencia, CA). To detect flavivirus RNA in the samples, a one-step reverse transcription PCR was initially done using the SCRIPT Reverse Transcriptase mix (Jena Bioscience, Germany). Amplicons from this first step were then used as templates for the hemi-nested PCR protocol. The protocols used for flavivirus detection were those described by [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. Yellow fever vaccine (17D strain) was used as positive control. The Primer sequence published by Scaramozzino \u003cem\u003eet al\u003c/em\u003e., 2001 were used for the PCR assay (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). The primers used were CFD2/MAMD and CFD2/FS778 with both targeting the NS5 gene of the viral genome. For the first round RT-PCR assay, amplifications were carried out in 20 \u0026micro;l of reaction mixture containing the following components: 2.2 \u0026micro;l PCR grade water (Jena Bioscience, Germany), 10 \u0026micro;l of SCRIPT Reverse Transcriptase mix (Jena Bioscience, Germany), 0.8 \u0026micro;l of enzyme mix (Jena Bioscience, Germany), 1 \u0026micro;l each of both forward (MAMD) and reverse (CFD2) primers, and 5 \u0026micro;l of the template. All reactions were carried out in a thermocycler (Genemate MRC-400 PCR machine) under the following conditions: Reverse transcription was first performed at 50\u0026deg;C for 60 minutes, followed by an initial denaturation step at 95\u0026deg;C for 5 minutes. Subsequently, 25 cycles of amplification were conducted, each consisting of denaturation at 95\u0026deg;C for 10 seconds, annealing at 53\u0026deg;C for 30 seconds, and elongation at 72\u0026deg;C for 1 minute. Finally, a terminal elongation step at 72\u0026deg;C for 5 minutes was included to ensure complete extension of all amplicons. In the hemi-nested protocol, 2.5 \u0026micro;l of the first product was used as template for the next assay. Amplifications were carried out in a similar 20 \u0026micro;l reaction mixture containing the following components: 11.5 \u0026micro;l PCR water (Jena Bioscience, Germany), 4 \u0026micro;l of red load PCR Mix (Jena Bioscience, Germany), 1 \u0026micro;l each of both forward (FS778) and reverse primers (CFD2), and 2.5 \u0026micro;l of the template. The following PCR cycling protocol was used: An initial denaturation step at 94\u0026deg;C for 5 minutes preceded 35 amplification cycles. Each cycle consisted of denaturation at 94\u0026deg;C for 30 seconds, primer annealing at 54\u0026deg;C for 30 seconds, and elongation at 72\u0026deg;C for 1 minute. Upon completion of the cycles, a final elongation step at 72\u0026deg;C for 5 minutes was conducted to ensure full extension of the amplified DNA fragments. All steps were optimized to achieve specificity and efficiency in the nested amplification process. The PCR products were electrophoresed in a 2% agarose gel stained with ethidium bromide (2 \u0026micro;g/ml); and then visualized and photographed under ultraviolet illumination. Positive samples were sequenced using both forward and reverse primers in using sanger sequencing. The resulting sequences were compared with GenBank reference sequences.\u003c/p\u003e\n\u003ch3\u003eNucleotide sequence analysis\u003c/h3\u003e\n\u003cp\u003eThe sequences were trimmed and cleaned using Bioedit to remove low-quality reads. The cleaned sequence reads were then compared to other flavivirus sequences on the NCBI database using the BLASTN algorithm (blast.ncbi.nlm.gov/Blast.cgi). Sequences exhibiting significant similarity to the query reads, generated by a BLAST search, were retrieved from databases and subjected to sequence alignment, which served as the foundation for phylogenetic tree construction. Multiple sequence alignment was done using the Muscle program on the Mega 11 software and construction of phylogenetic tree using the maximum likelihood analysis with 1000 bootstrap replicates and Kimura 2 parameter as the best model.\u003c/p\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eSTATISTICAL ANALYSIS\u003c/h2\u003e \u003cp\u003eThe True Infection Rate (TIR) of the collected mosquitoes was calculated as the proportion of infected mosquito bodies to the total mosquitoes tested using a pool of between 1\u0026ndash;50 mosquitoes per pool. Therefore, the formula for TIR is given as TIR\u0026thinsp;=\u0026thinsp;the number of positive pools / mosquitoes tested x100 [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. The density of infected mosquitoes DIM of each species was estimated using the formula: DIM\u0026thinsp;=\u0026thinsp;Total number of mosquitoes of same species collected/Total days spent during collection x TIR [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e].\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimer sequence for RT-PCR\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"5\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePrimer Name\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePrimer Sequence (5\u0026rsquo;-3\u0026rsquo;)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eRegion\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eAnnealing temp. (\u003csup\u003eo\u003c/sup\u003eC)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eAmplified product (bp)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCFD2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGTGTCCCAGCCGGCGGTGTCATCAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eNS5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e53\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e250\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMAMD\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAACATGATGGGRAARAGRGARAA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eNS5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e53\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCFD2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGTGTCCCAGCCGGCGGTGTCATCAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eNS5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e53\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e220\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eFS 778\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAARGGHAGYMCDGCHATHTGGT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eNS5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e54\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eSingle-letter ambiguity code: W, A/T; K, G/T; R, A/G; Y, C/T; N, A/C/G/T\u003c/h3\u003e\n"},{"header":"RESULTS","content":"\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003ePresence and abundance of Mosquito species\u003c/h2\u003e \u003cp\u003eA total of 600 adult female mosquitoes, comprising 6 species in 3 genera (\u003cem\u003eAedes\u003c/em\u003e, \u003cem\u003eCulex\u003c/em\u003e, and \u003cem\u003eMansonia\u003c/em\u003e), were collected during the sampling period (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). There were significantly more \u003cem\u003eAedes\u003c/em\u003e mosquitoes captures compared to the other species represented (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). \u003cem\u003eAedes\u003c/em\u003e species collectively dominated the collection, comprising 425 specimens (70.84%) of the total sample. This genus includes three species, with \u003cem\u003eA. aegypti\u003c/em\u003e (60.67%) being the primary contributor, while \u003cem\u003eA. albopictus\u003c/em\u003e (7.6%) and \u003cem\u003eA. mcintoshi\u003c/em\u003e (2.5%) were present in much smaller numbers. Culex species represented 107 specimens (17.83%), with \u003cem\u003eC. pipens\u003c/em\u003e (9.83%), being slightly more abundant than \u003cem\u003eC. quinquefasciatus (\u003c/em\u003e8.00%\u003cem\u003e). Mansonia uniformis (\u003c/em\u003e11.33%\u003cem\u003e)\u003c/em\u003e was the sole representative of its genus, accounting for 68 specimens (11.33%). (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eVirus detection in mosquitoes\u003c/h2\u003e \u003cp\u003eA total of 600 mosquitoes were collected and grouped into 22 pools based on sampling/collection site, collection period and species. 3 positive pools (13.6%) were detected from the study (Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). Yellow fever virus was detected in 1 pool (P11) containing 37 Aedes aegypti species collected from the teaching and research farm in Late August, 2022 (Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). Insect specific viruses were detected in 2 pools (P1 and P5). P1 contains 63 \u003cem\u003eAedes aegypti\u003c/em\u003e collected from the dairy farm in mid-June while P5 contains 21 Aedes albopictus mosquitoes similarly collected from the dairy farm in June, 2022 (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003ePrevalence of positive mosquito species\u003c/h2\u003e \u003cp\u003eTwo distinct arboviruses were identified in the surveillance: Insect-Specific Flavivirus (ISFV) and Yellow Fever Virus (YFV). Infections were detected solely in \u003cem\u003eAedes\u003c/em\u003e species, representing 33% of tested species but accounting for the majority of specimens examined. \u003cem\u003eAedes albopictus\u003c/em\u003e demonstrated the highest True Infection Rate (TIR) at 2.17%, nearly four times higher than \u003cem\u003eA. aegypti\u003c/em\u003e (0.55%). However, \u003cem\u003eA. aegypti\u003c/em\u003e exhibited a substantially higher Dissemination Index of Mosquitoes (DIM) at 7.15% compared to \u003cem\u003eA. albopictus\u003c/em\u003e (3.57%). The weighted overall TIR across all species was 0.50%, reflecting the concentration of infections within \u003cem\u003eAedes\u003c/em\u003e populations. \u003cem\u003eAedes\u003c/em\u003e genus represented 71% of total specimens (425/600) with infection detected in 67% of \u003cem\u003eAedes\u003c/em\u003e species tested (2/3 species). This genus served as the primary reservoir for both identified arboviruses. \u003cem\u003eCulex\u003c/em\u003e genus comprised 18% of specimens (107/600) across two species, with no detectable infections in either \u003cem\u003eC. pipiens\u003c/em\u003e or \u003cem\u003eC. quinquefasciatus\u003c/em\u003e. \u003cem\u003eMansonia\u003c/em\u003e genus represented 11% of specimens (68/600) with no infections detected in \u003cem\u003eM. uniformis.\u003c/em\u003e (Table\u0026nbsp;\u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e4\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eFrequency of mosquito species collected at the University of Ibadan Farm (Teaching and Research farm, and Dairy Farm)\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMosquito Species\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFrequency\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003ePercentage\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eAedes aegypti\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e364\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e60.67%\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eAedes albopictus\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e46\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e7.67%\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eAedes mcintoshi\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e2.50%\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eCulex pipens\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e59\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e9.83%\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eCulex quinquefasciatus\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e48\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e8.00%\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eMansonia uniformis\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e68\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e11.33%\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eTotal\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003e600\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e100.00%\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003e3A\u003c/b\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003e3B\u003c/b\u003e \u003c/p\u003e \u003cp\u003eFigure \u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e3\u003c/span\u003eA. Phylogenetic tree of Mosquito flaviruses isolated from Mosquitoes on University of Ibadan (UI) farm. Study sequences are represented with red labels. 3B. Maximum likelihood phylogenetic tree of Yellow fever virus isolated from Mosquitoes on UI Farm. Blue box represents the East African genotyupe, green box represents the West African genotype and the yellow box represents the West African genotype.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eFeatures of Flavivirus positive mosquitoes\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"6\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePool Code\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCollection Site\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCollection period\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003ePool Size\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eSpecie\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eVirus detected\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eP1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eDairy Farm\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eJune 1st \u0026minus;\u0026thinsp;21st, 2022\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e63\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cem\u003eAedes aegypti\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u003cb\u003eInsect specific flavivirus\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eP2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eDairy Farm\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eJune 23rd, 2022\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e72\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cem\u003eAedes aegypti\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eNil\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eP3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eDairy Farm\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eJune 28th \u0026minus;\u0026thinsp;29th, 2022\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e78\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cem\u003eAedes aegypti\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eNil\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eP4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eDairy Farm\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eJuly 5th \u0026minus;\u0026thinsp;6th 2022\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e26\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cem\u003eAedes aegypti\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eNil\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eP5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eDairy Farm\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eJune, 2022\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e21\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cem\u003eAedes albopictus\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u003cb\u003eInsect specific flavivirus\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eP6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eDairy Farm\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eJuly, 2022\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cem\u003eAedes albopictus\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eNil\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eP7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eDairy Farm\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eJune, 2022\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cem\u003eAedes mcintoshi\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eNil\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eP8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eDairy Farm\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eJuly, 2022\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cem\u003eAedes mcintoshi\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eNil\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eP9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eDairy Farm\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eJuly 14th \u0026minus;\u0026thinsp;19th, 2022\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e40\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cem\u003eAedes aegypti\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eNil\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eP10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTeaching and Research Farm\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAugust 2nd \u0026minus;\u0026thinsp;9th 2022\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e23\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cem\u003eAedes aegypti\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eNil\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eP11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTeaching and Research Farm\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAugust 16th \u0026minus;\u0026thinsp;30th 2022\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e37\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cem\u003eAedes aegypti\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u003cb\u003eYellow Fever Virus\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eP12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTeaching and Research Farm\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAugust, 2022\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cem\u003eAedes albopictus\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eNil\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eP13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTeaching and Research Farm\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAugust, 2022\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cem\u003eCulex pipens\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eNil\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eP14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTeaching and Research Farm\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAugust, 2022\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cem\u003eCulex quinquefasciatus\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eNil\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eP15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTeaching and Research Farm\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAugust, 2022\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cem\u003eMansonia uniformis\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eNil\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eP16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eDairy Farm\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eJune, 2022\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e44\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cem\u003eMansonia uniformis\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eNil\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eP17\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eDairy Farm\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eJuly, 2022\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e21\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cem\u003eMansonia uniformis\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eNil\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eP18\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eDairy Farm\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eJuly 20th \u0026minus;\u0026thinsp;27th, 2022\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e25\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cem\u003eAedes aegypti\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eNil\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eP19\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eDairy Farm\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eJune, 2022\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e39\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cem\u003eCulex pipens\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eNil\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eP20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eDairy Farm\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eJuly, 2022\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e17\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cem\u003eCulex pipens\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eNil\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eP21\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eDairy Farm\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eJune, 2022\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e29\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cem\u003eCulex quinquefasciatus\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eNil\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eP22\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eDairy Farm\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eJuly, 2022\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e17\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cem\u003eCulex quinquefasciatus\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eNil\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab4\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 4\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrevalence of Infected mosquitoes\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"6\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMosquito\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMosquitoes tested\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003ePools tested\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eArboviruses identified in positive pools\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eTIR (%)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eDIM (%)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eAedes aegypti\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e364\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eISFV (1) and YFV (1)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.55%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e7.15%\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eAedes albopictus\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e46\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eISFV (1)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e2.17%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e3.57%\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eAedes mcintoshi\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e15(1)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0%\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eCulex Pipens\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e59(1)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0%\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eCulex quinquefasciatus\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e48(1)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0%\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eMansoni Uniformis\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e68(1)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0%\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"6\"\u003eTIR\u0026thinsp;=\u0026thinsp;True infection rate (estimated number of positive mosquitoes per 100 mosquitoes tested) [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]; **DIM\u0026thinsp;=\u0026thinsp;density of infected mosquitoes (total no. of mosquitoes collected / No. of collection nights x TIR (28 collection nights was used for the calculations) [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003ePhylogenetic analysis\u003c/h2\u003e \u003cp\u003eThe YFV sequences were similar to the Yellow Fever \u0026minus;\u0026thinsp;2018 -Nigeria Strain and the 2020 Nigeria YFV strain (86.49% similarity) Maximum likelihood analysis placed this sequence with the YFV lineage clade strains (Fig.\u0026nbsp;4) with nucleotide identities of 75\u0026ndash;87% to several global isolates. (GenBank accession MN958078.1, and ON323052.1) (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e3\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eFor the insect specific virus isolates, maximum likelihood analysis of these sequences revealed their similarity to at least 3 distinct insect specific viruses (i.e. the Phlebotomus associated flavivirus GenBank accession MN294942.1, \u003cem\u003eAedes aegypti\u003c/em\u003e endogenous flavivirus GenBank accession MZ399704.1, and Flaviviridae sp. MT863350.1). Isolate (P1) showed a high identity with the phlebotomus associated viruses detected in mosquitoes collected between 2016 to 2017 at different locations in Saudi Arabia (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e3\u003c/span\u003e). Also, similar NS5 sequences have been identified in \u003cem\u003eAedes\u003c/em\u003e mosquitoes collected in Cote d\u0026rsquo;Ivoire in the year 2004. The mosquito pool with the largest divergence from all other flaviviruses is the insect specific flavivirus (P5) with its most related virus being the Flaviviridae sp. isolate collected in Argentina in year 2019 (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e3\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e"},{"header":"DISCUSSION","content":"\u003cp\u003eThis study was undertaken to provide information on and evidence of circulation of Flaviviruses of medical importance in an human-animal interface environment (the University of Ibadan farm, Oyo State, Nigeria) in Ibadan, Nigeria. Findings from this study indicate the predominance of \u003cem\u003eAedes\u003c/em\u003e species, notably \u003cem\u003eAedes aegypti\u003c/em\u003e, \u003cem\u003eAedes albopictus\u003c/em\u003e, and \u003cem\u003eAedes mcintoshi\u003c/em\u003e in this environment. These species are of medical importance with \u003cem\u003eAe. aegypti\u003c/em\u003e and \u003cem\u003eAe. albopictus\u003c/em\u003e implicated in the transmission of Yellow Fever/Dengue virus in Nigeria [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e, \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e] while \u003cem\u003eAe. mcintoshi\u003c/em\u003e has recently been implicated with Rift valley fever virus in Kenya [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. As a result, their presence in this study area would signify a potential risk of transmission of YFV and DENV. These findings are comparable or similar to investigations in Bayelsa where a high prevalence of \u003cem\u003eAedes\u003c/em\u003e mosquito species were also reported [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e], and also comparable to studies conducted in Benin republic [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e], South Africa and Central African Republic [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e], all of which had similarly high \u003cem\u003eAedes\u003c/em\u003e spp.\u003c/p\u003e \u003cp\u003eThe mosquito pools from the teaching and research farm, University of Ibadan identified a Yellow Fever virus from an \u003cem\u003eAedes albopictus\u003c/em\u003e species. This clearly shows that transmission of Yellow Fever may be ongoing but not at a rate that can be assumed of epidemic status as outbreaks have not been recently reported at the University of Ibadan. Given the repeated history of \u003cem\u003eAe. aegypti\u003c/em\u003e and \u003cem\u003eAe. albopictus\u003c/em\u003e in yellow fever transmission [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e], the zoophilic tendency observed for this species in this study mirrors previous similar findings reported in West Africa [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. Similarly, \u003cem\u003eAedes aegypti\u003c/em\u003e mosquitoes collected from the dairy farm, University of Ibadan were found to be infected with two insect-specific flaviviruses (Phlebotomus associated flavivirus and \u003cem\u003eAedes\u003c/em\u003e endogenous flavivirus). Aedes integrated flaviviruses have previously been detected in a variety of \u003cem\u003eAedes\u003c/em\u003e species such as \u003cem\u003eAe. aegypti\u003c/em\u003e and \u003cem\u003eAe. albopictus\u003c/em\u003e [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. Findings from this study suggest that \u003cem\u003eAedes\u003c/em\u003e endogenous flavivirus and phlebotomus associated viruses can be isolated from some \u003cem\u003eAedes\u003c/em\u003e species which is as seen in previous studies from Saudi Arabia, China and France respectively [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e29\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eAnalysis from the study showed that \u003cem\u003eAedes aegypti\u003c/em\u003e had the highest density of infected mosquitoes in both of the collection sites used while the highest true infection rate was identified in the \u003cem\u003eAedes albopictus\u003c/em\u003e. It is yet to be determined if this level of infection can constitute a risk for YF transmission because reports from other authors have pegged transmission risk at TIR\u0026thinsp;\u0026gt;\u0026thinsp;4 to Culex species with WNV [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. Similarly, studies from Yucatan, Mexico [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e31\u003c/span\u003e], and Europe [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e32\u003c/span\u003e] have shown a significantly positive relationship between the TIR of Aedes mosquitoes and transmission risk to the human population.\u003c/p\u003e \u003cp\u003eThe phylogenetic reconstruction demonstrates the characteristic trichotomous division of African YFV into three major evolutionary lineages, with sequences clustering according to well-established biogeographical patterns (Fig.\u0026nbsp;4). The Ibadan sequences position within the West African genotypic framework, specifically clustering with West African Genotype I strains, which is consistent with the known geographic distribution extending from eastern Ivory Coast through Nigeria. This genotype has been associated with greater genetic heterogeneity, potentially reflecting regular epidemic cycles in human populations rather than stable enzootic transmission patterns [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e33\u003c/span\u003e, \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e34\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe tree structure reveals distinct geographic clustering across African regions. The upper yellow section represents West African genotypes, while the lower green portion encompasses East/Central African strains from countries including Uganda, Sudan, and the Democratic Republic of Congo. The Angola genotype appears as the most divergent African lineage, reflecting ancient evolutionary separation from other continental strains. This geographic partitioning supports the concept of regionally restricted viral circulation with limited inter-regional exchange [\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e35\u003c/span\u003e, \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e36\u003c/span\u003e]. The 0.02 substitutions per site scale bar indicates evolutionary distances consistent with YFV's conservative mutation rates of approximately 2.1\u0026times;10⁻⁴ to 2.8\u0026times;10⁻⁴ substitutions per site per year. The relatively short branch lengths within genotypic clades reflect recent common ancestry among geographically proximate strains and the slow evolutionary pace characteristic of YFV compared to other flaviviruses [\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e37\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eRecent molecular epidemiological studies have revealed that contemporary Nigerian outbreaks may derive from broader West African circulation patterns rather than exclusively local lineages. The 2018 Edo State outbreak demonstrated that Nigerian sequences clustered more closely with Senegalese strains than historical Nigerian isolates, indicating complex regional dispersal dynamics. This finding emphasizes the importance of regional surveillance approaches rather than country-specific monitoring strategies [\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e38\u003c/span\u003e]. The phylogenetic positioning of Ibadan sequences within the established West African framework confirms indigenous viral circulation and provides essential baseline data for ongoing surveillance efforts. The analysis contributes to understanding viral ecology patterns crucial for predicting outbreak dynamics and informing evidence-based public health responses across the West African epidemiological landscape [\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e39\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe other two flaviviruses detected were insect-specific viruses (ISVs). Insect-specific viruses are known to infect insect cells, but they do not replicate in vertebrates or vertebrate cells. The viruses isolated form two distinct phylogenetic and antigenic clades. These findings show the possibility of competitive inhibition as an influence on the transmission of arboviruses of medical importance. Similar findings have been published by Vasilakis et al, 2015 [\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e40\u003c/span\u003e]. Just as well, ISVs have been implicated in the reduction of transmission risk of arboviruses because they can alter vector competence in the vector mosquitoes [\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e41\u003c/span\u003e]. In more recent studies, they ISVs have been proposed as possible Biological Control Agents or Vaccine and Diagnostic platforms for arboviruses [\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e42\u003c/span\u003e, \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e43\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eOverall, this study has been able to provide valuable insights into the presence and circulation of flaviviruses and the implication of the mosquito and viral diversity seen around the University of Ibadan dairy and teaching and research farms, Oyo State, Nigeria.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthics approval to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot Applicable\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNo applicable\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe sequence data generated in this study are freely available on GenBank with accession numbers PX315715-16.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interest\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no competing of interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors did not receive any funding or financial support for this project.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eConceptualization; Oluwapelumi S Ogunlusi and Adewale V Opayele, Data collection and literature search; Oluwapelumi S Ogunlusi and Adewale V Opayele, Formal analysis; Oluwapelumi S Ogunlusi, Babatunde O Motayo and Adewale V Opayele, Manuscript draft; Oluwapelumi S Ogunlusi, Review and editing; Oluwapelumi S Ogunlusi, Babatunde O Motayo, Adewale V Opayele, and Adedayo O Faneye\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eLiang Y, Dai X (2024) The global incidence and trends of three common flavivirus infections (Dengue, yellow fever, and Zika) from 2011 to 2021. Front Microbiol 15:1458166. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/fmicb.2024.1458166\u003c/span\u003e\u003cspan address=\"10.3389/fmicb.2024.1458166\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003ePMID: 39206366; PMCID: PMC11349664\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhao R, Wang M, Cao J, Shen J, Zhou X, Wang D, Cao J, Flavivirus (2021) From Structure to Therapeutics Development. Life (Basel) 11(7):615. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/life11070615\u003c/span\u003e\u003cspan address=\"10.3390/life11070615\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003ePMID: 34202239; PMCID: PMC8303334\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eThe Flaviviruses | CEPI (2023) December 13). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://cepi.net/flaviviruses\u003c/span\u003e\u003cspan address=\"https://cepi.net/flaviviruses\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang X, Usama A, Huanchun C, Cao S, Ye J (2023) Biological determinants perpetuating the transmission dynamics of mosquito-borne flaviviruses. Emerg Microbes Infect 12(2):2212812 PMID: 37158598; PMCID: PMC10274526\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMadere FS, Andrade da Silva AV, Okeze E et al (2025) Flavivirus infections and diagnostic challenges for dengue, West Nile and Zika Viruses. npj Viruses 3:36. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s44298-025-00114-z\u003c/span\u003e\u003cspan address=\"10.1038/s44298-025-00114-z\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBlahove MR, Carter JR (2021) Flavivirus Persistence in Wildlife Populations. Viruses 13(10):2099. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/v13102099\u003c/span\u003e\u003cspan address=\"10.3390/v13102099\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003ePMID: 34696529; PMCID: PMC8541186\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVasilakis N, Weaver SC (2017) Flavivirus transmission focusing on Zika. Curr Opin Virol 22:30\u0026ndash;35. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.coviro.2016.11.007\u003c/span\u003e\u003cspan address=\"10.1016/j.coviro.2016.11.007\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003eEpub 2016 Dec 6. PMID: 27936448; PMCID: PMC5346038\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTransmission of Yellow fever virus (2024), May 15 Yellow Fever Virus. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.cdc.gov/yellow-fever/php/transmission/index.html\u003c/span\u003e\u003cspan address=\"https://www.cdc.gov/yellow-fever/php/transmission/index.html\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCasades-Mart\u0026iacute; L, Peralbo‐Moreno A, Delacour‐Estrella S, Ruiz‐Fons F (2024) Environmental determinants of West Nile virus vector abundance at the wildlife\u0026ndash;livestock interface. Med Vet Entomol. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/mve.12774\u003c/span\u003e\u003cspan address=\"10.1111/mve.12774\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVictor OA, Adekunle AJ, Tahiru IK, David OO (2017) Influence of Meteorological Variables on Diversity and Abundance of Mosquito Vectors in Two Livestock Farms in Ibadan, Nigeria: Public Health Implications. J Mosq Res 7(9):70\u0026ndash;78. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.5376/jmr.2017.07.0009\u003c/span\u003e\u003cspan address=\"10.5376/jmr.2017.07.0009\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003eEpub 2017 Jun 23. PMID: 28845206; PMCID: PMC5570447\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEzihe EK, Chikezie FM, Egbuche CM, Nwankwo EN, Onyido AE, Aribodor D, Samdi ML (2017) Seasonal distribution and Micro-Climatic factors influencing the abundance of the malaria vectors in South-East Nigeria. J Mosq Res. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.5376/jmr.2017.07.0003\u003c/span\u003e\u003cspan address=\"10.5376/jmr.2017.07.0003\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOlayemi IK, Ande AT (2008) Relative abundance and seasonal distribution of adult mosquito species in Offa, Kwara State, Nigeria. Nigerian J Entomol 25(1). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.36108/nje/8002/52.0160\u003c/span\u003e\u003cspan address=\"10.36108/nje/8002/52.0160\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOutbreak in Uselu: How Swift Action Saved Lives from Dengue\u0026rsquo;s Silent Threat | WHO | Regional Office for Africa (2025), July 26 WHO | Regional Office for Africa. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.afro.who.int/countries/nigeria/news/outbreak-uselu-how-swift-action-saved-lives-dengues-silent-threat\u003c/span\u003e\u003cspan address=\"https://www.afro.who.int/countries/nigeria/news/outbreak-uselu-how-swift-action-saved-lives-dengues-silent-threat\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYellow Fever situation update, July 2024 - Nigeria (2024), September 13 ReliefWeb. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://reliefweb.int/report/nigeria/yellow-fever-situation-update-july-2024\u003c/span\u003e\u003cspan address=\"https://reliefweb.int/report/nigeria/yellow-fever-situation-update-july-2024\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNigeria Centre for Disease Control and Prevention (n.d.). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://ncdc.gov.ng/news/506/ncdc-on-alert-following-the-confirmation-of-the-dengue-fever-outbreak-in-sokoto-state\u003c/span\u003e\u003cspan address=\"https://ncdc.gov.ng/news/506/ncdc-on-alert-following-the-confirmation-of-the-dengue-fever-outbreak-in-sokoto-state\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBecker N, Petric D, Zgomba M, Boase C, Madon M, Dahl C, Kaiser A.2010. Mosquitoes and their control, Springer: Berlin 6th edition\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCarney R, Mapes C, Low R, Long A, Bowser A, Durieux D, Rivera K, Dekramanjian B, Bartumeus F, Guerrero D, Seltzer C, Azam F, Chellappan S, Palmer J (2022) Integrating global citizen science platforms to enable Next-Generation surveillance of invasive and vector mosquitoes. Insects 13(8):675. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/insects13080675\u003c/span\u003e\u003cspan address=\"10.3390/insects13080675\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eScaramozzino N, Crance JM, Jouan A, DeBriel DA, Stoll F, Garin D (2001) Comparison of Flavivirus universal primer pairs and development of a rapid, highly sensitive heminested reverse transcription-PCR assay for detection of flaviviruses targeted to a conserved region of the NS5 gene sequences. J Clin Microbiol 39:1922\u0026ndash;1927\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAgwu JE, Isaac C, Igbinosa IG (2019) Detection of yellow fever and dengue viruses in mosquitoes between 2014 and 2015 in Bayelsa and Benue states of Nigeria Acta entomologica serbica 24.1: 59\u0026ndash;78\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFaneye A, Nioma I, Olanrewaju MB, Adeyinka A, Ebele A (2013) Serological evidence of recent dengue virus infection among febrile children in a semi-arid zone. Am J Infect Dis 9:7\u0026ndash;10\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOnoja AB, Omatola AC, Maiga M, Gadzama IS (2022) Recurrent Episodes of Some Mosquito-Borne Viral Diseases in Nigeria: A Systematic Review and Meta-Analysis. Pathogens 11:1162\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCampbell LP, Reuman DC, Lutomiah J, Petersen AT, Linthicum KJ, Britich SC, Anyamba A, Sang R (2019) Predicting abundances of Aedes mcintoshi, a primary Rift valley fever virus mosquito vector. PLoS ONE 1412:e0226617\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAgwu JE, Isaac C, Igbinosa IG (2019) Detection of yellow fever and dengue viruses in mosquitoes between 2014 and 2015 in Bayelsa and Benue states of Nigeria Acta entomologica serbica 24.1: 59\u0026ndash;78\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePadonou GG, Konkon AK, Salako AS, Zoungb\u0026eacute;dji DM, Oss\u0026egrave; R, Sovi A, Azondekon R, Sidick A, Ahouandjinou JM, Adoha CJ, Sominahouin AA, Tokponnon FT, Akinro B, Sina H, Baba-Moussa L, Akogb\u0026eacute;to MC (2023) Distribution and Abundance of Aedes aegypti and Aedes albopictus (Diptera: Culicidae) in Benin, West Africa. Trop Med Infect Disease 8(9):439. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/tropicalmed8090439\u003c/span\u003e\u003cspan address=\"10.3390/tropicalmed8090439\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLongbottom J, Walekhwa AW, Mwingira V, Kijanga O, Mramba F, Lord JS (2023) Aedes albopictus invasion across Africa: the time is now for cross-country collaboration and control. Lancet Global Health 11(4):e623\u0026ndash;e628. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/s2214-109x(23)00046-3\u003c/span\u003e\u003cspan address=\"10.1016/s2214-109x(23)00046-3\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePinhero G, Rocha M, de Oliveira M, Moreira A, Filho JD (2019) Detection of Yellow Fever Virus in sylvatic mosquitoes during disease outbreaks of 2017\u0026ndash;2018 in Minas Gerais State, Brazil. Insects 10:136\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDiallo D, Sall AA, Buenemann M, Chen R, Faye O (2012) Landscape ecology of sylvatic chikungunya virus and mosquito vectors in southeastern Senegal. Negl Trop Dis 6:1649\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSpadar A, Phelan JE, Benavente ED (2021) Flavivirus integrations in Aedes aegypti are limited and highly conserved across samples from different geographical regions unlike integrations in Aedes albopictus. Parasites vector 14:332\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFang Y, Tambo E, Xue JB, Zhang Y, Zhou XN, Khater E (2021) Detection of DENV-2 and insect specific flaviviruses in mosquitoes collected from Jeddah, Saudi Arabia. Frony Cell Infect Microbiol 25:11:626\u0026ndash;638\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBashar K, Rahman MS, Nodi IJ, Howlander AJ (2016) Species composition and habitat characterization of mosquito (Dipteria: Culicidae) larvae in semi-urban areas of Dhaka, Bangladesh. Pathog Glob Health 110(2):48\u0026ndash;61\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eScholle F, Girard Y, Zhao Q, Higgs S, Mason P (2004) trans-packaged West Nile Virus like particles: infectious properties invitro. infected Mosq vectors Jvirol 21:11605\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKirstein OD, Ayora-Talavera G, Koyoc-Carde\u0026ntilde;a E, Chan Espinoza D, Che-Mendoza A, Cohuo-Rodriguez A, Granja-P\u0026eacute;rez P, Puerta-Guardo H, Pavia-Ruz N, Dunbar MW, Manrique-Saide P, Vazquez-Prokopec GM (2021) Natural arbovirus infection rate and detectability of indoor female Aedes aegypti from M\u0026eacute;rida, Yucat\u0026aacute;n, Mexico. PLoS Negl Trop Dis 15(1):e0008972. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1371/journal.pntd.0008972\u003c/span\u003e\u003cspan address=\"10.1371/journal.pntd.0008972\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003ePMID: 33395435; PMCID: PMC7781390\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZardini A, Menegale F, Gobbi A, Manica M, Guzzetta G, D\u0026rsquo;Andrea V, Marziano V, Trentini F, Montarsi F, Caputo B, Solimini A, Marques-Toledo C, Wilke ABB, Ros\u0026agrave; R, Marini G, Arnoldi D, Piontti APY, Pugliese A, Capelli G, Poletti P (2024) Estimating the potential risk of transmission of arboviruses in the Americas and Europe: a modelling study. Lancet Planet Health 8(1):e30\u0026ndash;e40. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/s2542-5196(23)00252-8\u003c/span\u003e\u003cspan address=\"10.1016/s2542-5196(23)00252-8\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRezende IM, Sacchetto L, Alves PA, Labeaud AD, Drumond BP (2025) Yellow Fever Virus Genotyping Tool Using RT-qPCR Followed by Nucleotide Sequencing and Phylogenetic Analysis. In: Gomes Fernandes A (ed) Yellow Fever Virus. Methods in Molecular Biology, vol 2913. Humana, New York, NY. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/978-1-0716-4458-4_13\u003c/span\u003e\u003cspan address=\"10.1007/978-1-0716-4458-4_13\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMutebi JP, Wang H, Li L, Bryant JE, Barrett AD (2001) Phylogenetic and evolutionary relationships among yellow fever virus isolates in Africa. J Virol 75(15):6999\u0026ndash;7008. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1128/JVI.75.15.6999-7008.2001\u003c/span\u003e\u003cspan address=\"10.1128/JVI.75.15.6999-7008.2001\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003ePMID: 11435580; PMCID: PMC114428\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMutebi JP, Wang H, Li L, Bryant JE, Barrett AD (2001) Phylogenetic and evolutionary relationships among yellow fever virus isolates in Africa. J Virol 75(15):6999\u0026ndash;7008. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1128/JVI.75.15.6999-7008.2001\u003c/span\u003e\u003cspan address=\"10.1128/JVI.75.15.6999-7008.2001\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003ePMID: 11435580; PMCID: PMC114428\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBeck A, Guzman H, Li L, Ellis B, Tesh RB, Barrett AD (2013) Phylogeographic reconstruction of African yellow fever virus isolates indicates recent simultaneous dispersal into east and west Africa. PLoS Negl Trop Dis. ;7(3):e1910. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1371/journal.pntd.0001910\u003c/span\u003e\u003cspan address=\"10.1371/journal.pntd.0001910\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Epub 2013 Mar 14. PMID: 23516640; PMCID: PMC3597480\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBryant JE, Holmes EC, Barrett AD (2007) Out of Africa: a molecular perspective on the introduction of yellow fever virus into the Americas. PLoS Pathog 3(5):e75. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1371/journal.ppat.0030075\u003c/span\u003e\u003cspan address=\"10.1371/journal.ppat.0030075\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003ePMID: 17511518; PMCID: PMC1868956\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAjogbasile FV, Oguzie JU, Oluniyi PE et al (2020) Real-time Metagenomic Analysis of Undiagnosed Fever Cases Unveils a Yellow Fever Outbreak in Edo State, Nigeria. Sci Rep 10:3180. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41598-020-59880-w\u003c/span\u003e\u003cspan address=\"10.1038/s41598-020-59880-w\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMotayo BO, Opayele A, Akinduti PA, Faneye AO, Omoregie IP (2024) Phylodynamic Investigation of Yellow Fever Virus Sheds New Insight on Geographic Dispersal Across Africa. Evol Bioinform Online 20:11769343241309247 PMID: 39691473; PMCID: PMC11650462\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVasilakis N, Tesh RB Insect-specific viruses and their potential impact on arbovirus transmission. Curr Opin Virol 2015 Dec 15:69\u0026ndash;74. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.coviro.2015.08.007\u003c/span\u003e\u003cspan address=\"10.1016/j.coviro.2015.08.007\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Epub 2015 Aug 31. PMID: 26322695; PMCID: PMC4688193.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDe Faria IJS, De Almeida JPP, Marques JT (2024) Impact of symbiotic insect-specific viruses on mosquito vector competence for arboviruses. Curr Opin Insect Sci 63:101194. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.cois.2024.101194\u003c/span\u003e\u003cspan address=\"10.1016/j.cois.2024.101194\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBolling BG, Weaver SC, Tesh RB, Vasilakis N (2015) Insect-Specific Virus Discovery: Significance for the Arbovirus Community. Viruses 7(9):4911\u0026ndash;4928. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/v7092851\u003c/span\u003e\u003cspan address=\"10.3390/v7092851\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBonney JHK, Sanders T, Pratt D, Agbodzi B, Laryea D, Agyeman NKF, Kumordjie S, Attiku K, Adams PL, Boateng GA, Ohene SA, Tamal C, Mawuli G, Yeboah C, Dadzie S, Kubio C, Asiedu-Bekoe F, Odoom JK (2023) Molecular Characterization of Circulating Yellow Fever Viruses from Outbreak in Ghana, 2021\u0026ndash;2022. Emerg Infect Dis 29(9):1818\u0026ndash;1826. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3201/eid2909.221671\u003c/span\u003e\u003cspan address=\"10.3201/eid2909.221671\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003ePMID: 37610174; PMCID: PMC10461649\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"virus-genes","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"viru","sideBox":"Learn more about [Virus Genes](http://link.springer.com/journal/11262)","snPcode":"11262","submissionUrl":"https://submission.nature.com/new-submission/11262/3","title":"Virus Genes","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"Yellow fever virus, Mosquito, Molecular detection, Nigeria","lastPublishedDoi":"10.21203/rs.3.rs-8271914/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-8271914/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBackground\u003c/h2\u003e \u003cp\u003eFlaviviruses represent a diverse genus within the Flaviviridae family, comprising over 70 enveloped, single-stranded positive-sense RNA viruses that pose significant global health threats. Yellow fever virus (YFV) remains a significant public health concern in Nigeria, with suboptimal vaccination coverage and persistent transmission risk. Understanding local flavivirus circulation in mosquito vectors is crucial for disease surveillance and prevention strategies.\u003c/p\u003e\u003ch2\u003eMethods\u003c/h2\u003e \u003cp\u003eAdult female mosquitoes were collected from the University of Ibadan\u0026rsquo;s dairy and teaching farms between June and August 2022 using stationary human-bait catches and miniature light traps. Mosquitoes were morphologically identified, pooled by species and collection site, and screened for flaviviruses using hemi-nested reverse-transcription PCR targeting the NS5 gene. Positive samples were sequenced and phylogenetic analysis carried out.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e \u003cp\u003eA total of 600 mosquitoes, representing six species from three genera were collected, with \u003cem\u003eAedes aegypti\u003c/em\u003e predominating (60.67%). Of 22 mosquito pools tested, three were positive for flaviviruses. Yellow fever virus was detected in one pool of 37 \u003cem\u003eA. aegypti\u003c/em\u003e specimens, while insect-specific flaviviruses were identified in two other pools of the same mosquito. Phylogenetic analysis showed that the YFV isolate clustered with recent Nigerian strains (2018\u0026ndash;2020), indicating local circulation.\u003c/p\u003e\u003ch2\u003eConclusions\u003c/h2\u003e \u003cp\u003eThis study confirms ongoing flavivirus circulation in mosquito populations, underscoring potential transmission risk to humans despite low infection rates. The detection of YFV in \u003cem\u003eA. aegypti\u003c/em\u003e and co-circulating insect-specific flaviviruses warrants sustained monitoring to mitigate zoonotic and arboviral threats.\u003c/p\u003e","manuscriptTitle":"Detection of Flaviviruses in Mosquitoes from a Livestock Farm in Ibadan, Nigeria","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-12-18 13:11:39","doi":"10.21203/rs.3.rs-8271914/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2026-01-26T03:14:19+00:00","index":"","fulltext":""},{"type":"reviewerAgreed","content":"84790009414215554635676623253935976787","date":"2025-12-22T07:40:06+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-12-16T10:56:34+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"53753040684940155302384880102760813501","date":"2025-12-16T08:08:11+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-12-16T07:51:52+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-12-04T14:46:36+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-12-04T14:42:49+00:00","index":"","fulltext":""},{"type":"submitted","content":"Virus Genes","date":"2025-12-03T15:21:15+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"virus-genes","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"viru","sideBox":"Learn more about [Virus Genes](http://link.springer.com/journal/11262)","snPcode":"11262","submissionUrl":"https://submission.nature.com/new-submission/11262/3","title":"Virus Genes","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"059addbd-482c-4853-8af7-48e90e546735","owner":[],"postedDate":"December 18th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[],"tags":[],"updatedAt":"2026-05-13T01:53:18+00:00","versionOfRecord":[],"versionCreatedAt":"2025-12-18 13:11:39","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-8271914","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-8271914","identity":"rs-8271914","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2025) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00
unpaywall
last seen: 2026-05-23T02:00:01.238055+00:00
License: CC-BY-4.0