LRP2 is a potential molecular target for pathological myopia

High myopia (HM) and posterior staphyloma (PS) are major causes of vision loss worldwide. Genetic and environmental factors, especially light exposure, contribute to myopia. Mutations in low -density lipoprotein -related receptor type 2, LRP2 cause syndromic myopia, and the Foxg1-Cre-Lrp2lox/lox mouse is a model for myopia and PS but the involvement of LRP2 in non-syndromic HM (NSHM) was unknown . We showed that LRP2 levels were decreased in the vitreous of 25 patients with NSHM and PS, and that in human donor eyes affected by PS, LRP2 expression was reduced in the neural retina and retinal pigment epithelium (RPE). The morphologic changes of these RPE wer e similar to those observed in the RPE of the Foxg1 - Cre-Lrp2lox/lox mouse. In iPSc -derived human RPE cells (iRPE), LRP2 was expressed at a functional location, and LRP2 silencing by a specific siRNA regulated genes belonging to pathways involved in eye and ne uronal development, visual perception, tissue remodeling, hormone metabolism and RPE structure, demonstrating that LRP2 orchestrates in RPE, functions that are essential for eye growth. Exposure of iRPE to light with LEDs of different wavelengths upregulated LRP2 expression, with higher efficacy for red light. Conversely, LRP2 expression was downregulated after cortisol exposure. Our findings link LRP2 to myopization and environmental factors and highlight its role in NSHM and PS in humans. LRP2 appears to be a viable target for interventional strategies in the treatment of NSHM. (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted March 10, 2025. ; https://doi.org/10.1101/2025.03.04.641381doi: bioRxiv preprint 4

The prevalence of myopia, a refractive error commonly caused by abnormal elongation of the eyeball, is increasing rapidly worldwide, with the global prevalence expected to exceed 50% by 2050 1. The refractive error can be corrected by optical or surgical means, but high myopia (HM), greater than 6 diopters, is often associated with sight -threatening retinal complications, including retinal detachment and maculopathy secondary to posterior staphyloma (PS), a focal protrusion of the ocular globe with an extreme thinning of the retinal pigment epithelium (RPE), the choroid, the neural retina, and the sclera 2,3. Intensive research has led to the development of intervention strategies to reduce myopia progression, including atropine drops, defocus lenses or light therapy, which have significant but moderate effects4. To date, there is no method to prevent HM and its blinding complications, which is a major public health problem5. Myopia results from a complex interplay between genetic and environmental factors6,7, the most widely accepted of which is exposure to daylight, to the point where light therapy has been proposed as a preventive strategy. However, the respective effects of different light components (such as luminance, spectral composition, temporal modulation) and of circadian regulations8–10 remain incompletely understood. Several hundreds of genes most of which are involved in TGF -beta signaling, collagen synthesis and retinal signal transduction have been associated with myopia 11 and the study of monogenic syndromic myopia can help understanding of the mechanisms involved in multifactorial myopia. Variants in LRP2 (low- density lipoprotein receptor -related protein 2), which encodes megalin/LRP2 causes the rare Donnai-Barrow syndrome, which combines syndromic myopia and PS, hypertelorism, sensory neuronal loss, partial agenesis of the corpus callosum and proteinuria 12–14. The mouse model conditionally knockout for Lrp2 in ocular tissues (Foxg1-Cre-Lrp2lox/lox) developed postnatal myopia and a posterior protrusion of the globe very similar to myopic staphyloma 15. (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted March 10, 2025. ; https://doi.org/10.1101/2025.03.04.641381doi: bioRxiv preprint 5 Furthermore, conditional mutants in which Lrp2 has been knocked out only in the retinal pigment epithelium (RPE) also developed myopia and staphyloma 16. In addition, the transcriptional downregulation of Lrp2 in the RPE during the first three postnatal weeks promoted rapid eye growth and, high Lrp2 expression in RPE of adult mice ensured that eye growth stopped at the correct size 17. Taken together, these previous findings highlight the key role played by LRP2 in RPE -driven regulation of eye growth and in staphyloma formation. However, the mechanisms involved are still unclear. LRP2 is a large transmembrane glycoprotein detected at the apical membrane of various epithelial cells where it participates in clathrin -mediated endocytosis, capturing and releasing ligands that either undergo degradation in lysosomes or are transported via a transcytosis route and secreted at the basal pole of the cell 18. It regulates the extracellular concentrations of molecules, including vitamins and hormones 19,20 and modulates the activity of morphogens such as sonic hedgehog (SHH) or bone morphogenetic protein 4 (BMP4) during development21,22. Via endosomes recycling, LRP2 also controls cell shape and planar cell polarity 23,24. The availability of LRP2 at the cell surface is subjected to regulatory mechanisms, including the phosphorylation of its cytoplasmic domain, a PKC -regulated metallo-protease ectodomain shedding followed by the processing of the membrane bound C -terminal by gamma-secretase that produces a soluble intracellular domain and, exosome secretion 25. In murine RPE, LRP2 is predominantly located at the apical plasma membrane, where it facilitates the uptake of albumin or transferrin 19. But the mechanisms by which LRP2 expressed in the RPE controls eye growth are poorly understood. Whether LRP2 is also involved in NSHM is unknown. We set out to investigate the involvement of LRP2 in NSHM in humans. We used human RPE derived from iPSc to study the transcriptional consequences of LRP2 silencing and the effect of environmental factors, including light and cortisol exposure, on LRP2 expression. (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted March 10, 2025. ; https://doi.org/10.1101/2025.03.04.641381doi: bioRxiv preprint 6

Levels of LRP2 are decreased in the vitreous of NSHM eyes with PS LRP2 levels was evaluated in vitreous samples of high myopic patients with PS who underwent pars plana vitrectomy for myopic tractional maculopathy, macular hole or epiretinal membrane and compared to vitreous from emmetropic patients operated for epiretinal membrane or for intraocular lens luxation. These measurements were carried out on a Japanese population and on a European Caucasian population by two independent research groups and two different analysis methods. A proteomic analysis was performed on the vitreous from 15 NSHM Japanese patients compared to 10 controls . Table 1 recapitulates the demographic characteristics and surgical indications. Axial length in the HM group was 29.33±1.94mm and all patients had posterior staphyloma. Proteomic analysis of the vitreous performed by label -free quantitative liquid chromatography-tandem mass spectrometry identified 332 proteins (Data File S1) of which were 73 differentially expressed proteins (DEPs), including LRP2 (fold change = 0.5; p = 0.016) (Fig. 1A; Table 2). The top up-regulated DEPs included apolipoprotein D, transforming growth factor-beta-induced ig-H3 (TGFBI), complement factor D and thrombospondin-4. On the other hand, versican core protein, S -arrestin, collagen IX alpha-2 chain, LRP2, and retinol-binding protein 3 (IRBP) were reduced. The most significant biological processes associated with downregulated proteins were linked to nervous system development and negative regulation of proteolysis (fig. S1). Molecular functions related to the significantly regulated proteins included reduced low-density lipoprotein binding, calcium ion binding, and chaperone binding, whereas serine-type endopeptidase inhibitor activity and integrin binding were elevated (fig. S1). The down-regulated proteins were predominantly located in the extracellular region and extracellular space, while up-regulated proteins were mostly linked to extracellular matrix (fig. S1). Abnormal retinal morphology, myopia, and retinal detachment were the most significant (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted March 10, 2025. ; https://doi.org/10.1101/2025.03.04.641381doi: bioRxiv preprint 7 phenotypes associated with the differentially expressed proteins (Fig. 1B). The most significant connected protein cluster contained 14 proteins, including LRP2 and its ligands clusterin (CLU) and APOE (Fig. 1C and fig. S2A), which were enriched in neurodegenerative disorders (Gene Ontology Disease, fig. S2B). In the European Caucasian group of patients, 10 HM patients and 13 emmetropic patients were included. Table 1 recapitulates the demographic characteristics and surgical indication. In the HM group, axial length was 29.67±2 mm and all eyes had posterior staphyloma. LRP2 was measured by enzyme -linked immunosorbent assay (ELISA) analysis on vitreous samples . LRP2 levels and LRP2/protein were significantly lower in HM eyes (0.8 ± 0.36 ng/ml and 0.41±0.21) than in emmetropic eyes (1.7 ± 1.1 ng/ml and 0.75±0.49) (p=0.01 and 0.02 respectively) (ig. 1D). Pathological features of high myopic human eyes with posterior staphyloma Two highly myopic post-mortem eyes, with axial lengths of 32 mm and 31 mm for the right and left eye, and a posterior staphyloma, were studied. The pre-mortem spectral domain optical coherence tomography (SD-OCT) images of the right pseudophakic HM eye revealed posterior incurvation of the PS with thinning of the retina and the choroid (Fig. 2, A andB, black arrows), complicated by myopic tractional maculopathy (MTM) with foveoschisis ( Fig. 2, A and B; stars and white stars). The SD -OCT images of the left eye were of low quality due to c orneal opacification. On the post-mortem enucleated donor eyeball, the PS with scleral thinning was clearly visible (Fig. 2C). Peripapillary atrophy was visible on macroscopic pictures of the open eyeball (Fig. 2, D and E), and the PS was located temporal to the fovea (Fig. 2, D and E; black arrow). A cross-section at the level of the PS ( Fig. 2G) showed disorganization of the retinal layers and cysts (arrows) and extreme retinal thinning at the bottom of the PS (Fig. 2G; double arrow) compared to emmetropic retina ( Fig. 2F). RPE cells outside the PS showed clear (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted March 10, 2025. ; https://doi.org/10.1101/2025.03.04.641381doi: bioRxiv preprint 8 disorganization (Fig. 2, H to J), with mislocalization of melanosomes and aggregations of pigments. More precise cellular disorders were characterized using markers of different cell types on immunohistochemistry of emmetropic and HM human retina cryosections (Fig. 3). In the control retina, glial Müller cells (RMG) identified by glutamine synthetase expression (GS) extended their processes from the inner limiting membrane (ILM) to the outer limiting membrane (OLM) (Fig. 3, A and B). In the HM retina, RMG processes were disorganized and lost their alignments within the thinned layers (Fig. 3C). The RMG processes organized around cysts (Fig. 3D) and invaded the bottom of the PS that was covered by RMG cells ( Fig. 3E). The neuronal-specific marker, tubulin beta 3, labeled the nerv e fiber layer, the ganglion cells (RGC) and their extensions, and amacrine cells ( Fig. 3, F and G). In the HM retina, a severe thinning of the nerve fiber layer (Fig. 3H) was observed together with a reduction of RGC (Fig. 3, H and I). Blue and green cones (Fig. 3, J and K), labeled by opsins, showed significant disorganization in HM retina with greater loss of blue cones ( Fig. 3, L and M). Finally, the astrocytic-specific marker GFAP, which stains astrocytes and the end feet of RMG cells in the emmetropic retina (Fig. 3, N and O), showed a dense layer at the surface of HM retina, which could correspond to the vitreoretinal traction al membrane seen on SD-OCT (Fig. 2, A and B) but the RMG invading the posterior staphyloma did not express GFAP. The retina of the HM eye exhibited loss of ganglion cells and cones, as well as thinning of all retinal layers, and cystic degeneration accompanied by glial Müller cells disorganization . Extreme degeneration was present in the PS area which was filled by glial Müller cells. Decreased LRP2 in human HM with PS retina is associated with severe RPE disorganization similar to Foxg1-Cre-Lrp2lox/lox mouse RPE In emmetropic human neural retina, LRP2 was expressed in RMG cells, co -localized with GS (Fig. 4, A and B). In the HM neural retina, significant disorganization of the retinal layers was (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted March 10, 2025. ; https://doi.org/10.1101/2025.03.04.641381doi: bioRxiv preprint 9 evident at the margin of the staphyloma, where glial Müller cells spanning through layers and the subretinal space expressed low levels of LRP2 ( Fig. 4, C and D). In the RPE cells, LRP2 expression was decreased in the HM compared to the emmetropic eye, as seen in both transversal sections from left eye ( Fig.e 4E) and flat-mounts of the right eye ( Fig. 4, F to H). In emmetropic RPE, LRP2 was located at the apical membrane and in vesicles ( Fig. 4E; arrowhead), but also showed diffuse labeling underneath the Bruch membrane (BM), in the most inner part of the choroid where it stained the pillars of the chor iocapillaris (Fig. 4E). In RPE flat -mounts of the emmetropic control eye, LRP2 was localized in punctiform sub - membrane clusters at the apical and lateral borders of the RPE cells ( Fig. 4, F and G), at the cell membrane (Fig. 4G), and in clathrin-positive vesicles (Fig. 4H). On transversal sections of HM RPE cells (Fig. 4I), LRP2 was faintly detected (Fig. 4, J to L), at the cell membrane (Fig. 4K) and in very few clathrin -positive vesicles ( Fig. 4L) with staining of LRP2 aggregated at the apical side ( Fig. 4I; arrowhead) without any signal underneath BM ( Fig. 4I). Along with LRP2 reduction, a parallel reduction in clathrin -positive vesicles ( Fig. 4L) was observed. In HM eyes with PS, LRP2 was thus decreased not only in the vitreous but also in retina and RPE. RPE morphology was characterized by phalloidin staining that labels actin cytoskeleton . As opposed to the regular arrangement of RPE cells in emmetropic human eye ( Fig. 5A), in HM eye, RPE displayed irregular organization, cell size dispersity (Fig. 5B) and doubling or breaks of the cell junctions (Fig. 5, C and D). At the bottom of the staphyloma, the extreme thinning and eye incurvation did not allow for RPE flat mounting. The RPE from Foxg1-Cre-Lrp2lox/lox mouse was studied to explore the impact of suppressed LRP2 expression on the RPE morphology. As opposed to control WT mice ( Fig. 5, E to F), that showed the regular octagonal RPE cell surrounded by eight regular hexagonal cells, the transgenic mouse displayed irregularly arranged RPE with dramatic changes in cellular size and shape mostly posterior to the equator (Fig. 5, H and I). Membrane ZO-1 staining tight junction (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted March 10, 2025. ; https://doi.org/10.1101/2025.03.04.641381doi: bioRxiv preprint 10 was lost and replaced by diffuse cytoplasmic staining ( Fig. 5J) . At the periphery, areas with normal-sized RPE cells showed actin stress fibers (Fig. 5J). Automatic quantification (Fig. 5K) revealed that RPE cell size increased in the middle and peripheral retina (Fig. 5, L and M) and that cell density decreased mostly posterior to the equator (Fig. 5N). The RPE from individuals with HM and PS, which exhibit a marked decrease in LRP2 expression, displayed morphological changes analogous to those observed in Lrp2 invalidated mice. Transcriptional consequences of LRP2 silencing in iRPE cells. To decipher the consequence of LRP2 downregulation in RPE cells and its potential link with myopia and PS, we used RNA interference to silence LRP2 mRNA in iRPE cells (shLRP2 iRPE). We first evaluated the ability of differentiated iRPE to express LRP2 and other endocytosis markers. LRP2 was localized at the cell membrane from the apical to the basolateral side and in subapical vesicles ( Fig. 6A), co-localizing at the apical pole with the receptor-mediated endocytic protein clathrin ( Fig. 6B), partially with the early endocytic marker EEA1, ( Fig. 6C) and with LAMP1, a membrane protein principally located in lysosomes (Fig. 6D). LRP2 being expressed in an appropriate spatial and functional location, iRPE cells were used to study the molecular consequences of LRP2 down-regulation. Bulk transcriptomes showed that shLRP2 specifically and efficiently reduced LRP2 mRNA expression by 40% after 48 hours, which was confirmed by quantitative PCR (Fig. 7A) and by western blot ( Fig. 7B). Principal component analysis (PCA) showed the overall variation among samples, with a clear separation in the first three components between shLRP2 and scramble iRPE (fig. S3). We identified 118 differentially expressed transcripts between shLRP2 iRPE and scramble iRPE, including 75 down -regulated and 42 up -regulated transcripts, as shown in V olcano maps (Fig. 7, C and D; Data File S2). A list of differentially expressed genes (DEGs) along with their fold change and additional information about their roles in eye (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted March 10, 2025. ; https://doi.org/10.1101/2025.03.04.641381doi: bioRxiv preprint 11 physiology, is provided in Table 3 and Table 4. As expected, LRP2 was one of the most down- regulated genes by adjusted p -value. Along with LRP2, we identified several other RPE - specific apical membrane DEGs that were downregulated in shLRP2 iRPE, whilst upregulated DEGs were involved in the control of the circadian clock, cell cycle and in the regulation of TGF beta activity. The results of the KEGG enrichment analysis demonstrated that DEGs were mainly enriched in "retinol metabolism" (downregulation) and in "ECM receptor interaction" (upregulation) ( fig. S4A and Data File S3). The GO -based enrichment analysis performed under the three categories: Biological Processes (BP), Cellular Components (CC), and Molecular Functions (MF) (fig. S4, B to D show the topmost enriched GO terms; Table S3 has the complete list) identified the downregulation of genes related to molecular transmembrane transporter activity, fat soluble vitamin metabolic process (related to retinoic acid and vitamin D), ion homeostasis (Fig. 7E; fig. S4, B and D) and apical and basal plasma membranes ( fig. S4C and fig. S5A). The upregulated DEGs were enriched in GO terms related to extracellular matrix and cytoskeleton arrangement ( fig. S4, C and D). Using reactome pathways analysis (Table S3); the top downregulated proteins included the canonical retinoid cycle in vision and solute carrier-mediated transmembrane transport ( fig. S4E), while the top upregulated DEGs included kinesins, collagen biosynthesis and modifying enzymes (fig. S4C). Human phenotype ontology (HPO) enrichment analysis ( Data File S3) identified chorioretinal atrophy, RPE atrophy, and progressive night blindness ( fig. S4F). When performing an enrichment analysis with LRP2 as a common factor ( Data File S4), enriched GO terms were related to the apical plasma membrane, solute transmembrane transporters, fat soluble vitamin metabolic processes, sensory perception, and steroid metabolic processes (Fig. 7F). Upregulated enriched GO terms were related to the cytoskeleton and collagen -containing extracellular matrix ( Data File S4). Reactome pathway analysis identified three downregulated pathways: visual phototransduction, metabolism of steroids, and sensory perception (Fig. 7G). Table 5 recapitulates selected gene (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted March 10, 2025. ; https://doi.org/10.1101/2025.03.04.641381doi: bioRxiv preprint 12 sets associated with LRP2 reduction in iRPE cells and their potential link with myopia and PS development. Light and cortisol regulate LRP2 expression in human iRPE cells Light and circadian rhythms are major environmental factors associated with the incidence and the progression of myopia 26 and cortisol secretion which is under circadian regulation is modulated by light exposure 27. We assessed the exposure of iRPE cells to an LED lighting system emitting red [631nm], blue [454nm], and hot white [3300°K] light at a dose of 0.3 J/cm², which was previously shown to be safe for the iRPE28. After 0.5 and 2 hours of exposure to any of these LEDs, the expression of LRP2 mRNA increased significantly (2.00 ± 0.16, p = 0.0059 and 1.70 ± 0.08, p = 0.0132) and transiently, returning to baseline at 10 hours (1.02 ± 0.18, p = 0.9791) (Fig. 8A). Exposure to red light was the most effective at increasing LRP2 mRNA at 0.5 and 2 hours (2.08 ± 0.14, p = 0.0286 and 1.83 ± 0.06, p = 0.0286) ( Fig. 8A). On immunohistochemistry, two hours after illumination, we observed a parallel increase in LRP2 and the early endosome-associated protein 1 (EEA1) in iRPE cells (Fig. 8B). Having previously demonstrated that the glucocorticoid receptors NR3C1 (GR) and the mineralocorticoid receptor NR3C2 (MR) are both expressed and functional in the iRPE cells used in this study29, we evaluated the effect of cortisol on LRP2 expression. Exposure of iRPE cells to 100nM cortisol led to a significant decrease in LRP2 mRNA expression after 24 hours (1.00 ± 0.04 vs. 0.67 ± 0.07; p = 0.0152*<0.05) (Fig. 8C). Both light exposure and cortisol regulate the expression of LRP2 in iRPE cells but in opposite manner, suggesting that LRP2 could be one of the molecular links between environmental factors and HM development. (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted March 10, 2025. ; https://doi.org/10.1101/2025.03.04.641381doi: bioRxiv preprint 13

Convergent results from various experimental models have previously identified LRP2 as an important player in eye growth and in staphyloma. Both the Lrp2-cKO mouse and the conditional mouse with specific knock out of Lrp2 in RPE developed myopia and staphyloma 15,16. Of note, the latter models are the only myopia models that develop staphyloma, showing the important role of LRP2 expressed in the RPE in its development. In humans, biallelic pathogenic variants in LRP2 cause the Donnai-Barrow syndrome characterized among others signs by high grade syndromic myopia and PS 14. In these patients LRP2 is either absent or nonfunctional30,31 indicating that LRP2 is important in human eye pathophysiology. We here show that reduced levels of LRP2 in the vitreous, retina and RPE cells are associated with NSHM, supporting the hypothesis that LRP2 is also involved in NSHM associated with PS in humans. The exact roles of LRP2 in human retina physiology and its mechanisms of action on eye growth are not fully elucidated. Nevertheless, it is likely that any changes in LRP2 synthesis, recycling and/or subcellular distribution could alter its functions. Indeed, studies in the renal proximal convoluted tubule, the major site of LRP2 expression in the adult, show that in its membrane bound form LRP2 acts as major endocytic receptor whereas processed by regulated intramembrane cleavage, the LRP2 C -terminal fragment would enter the nucleus to regulate gene expression 32. Extracellular cleaved LRP2 fragment is thought to act as a soluble decoy receptor that may bind ligands and alter their bioavailability 18,33. The present data suggest that both the membrane bound and the extracellular form of LRP2 are decreased in the myopic eyes. The reduction of soluble LRP2 in the vitreous, shown by two different biochemical methods, performed by two independent groups in two different populations together with reduced LRP2 observed in the retina and RPE suggests that the reduction of LRP2 result s from a decrease in transcription and / or (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted March 10, 2025. ; https://doi.org/10.1101/2025.03.04.641381doi: bioRxiv preprint 14 translation. Although s oluble LRP2 has been previously measured in human vitreous proteome 34 its origin is unknown. In renal cells, a soluble form of LRP2 has been detected, resulting either from the secretion of an isoform lacking the cytoplasmic domain or from a two steps cleavage by -secretase for intramembrane cleavage and by metalloproteases for the extracellular cleavage 35. The detection of LRP2 in the vitreous and the plasma membrane/endocytic apparatus of retinal cells in both control and myopic subjects may suggest that extracellular LRP2 cleavage commonly occurs in the ocular tissues. Interestingly, transthyretin , that indirectly influences the cleavage of LRP2 by γ- secretase by modulating its interaction with the receptor , was shown to be misfolded and dyfunctional in case of myopic macular pathologies 36. The exact functions of the soluble form of LRP2 still remain to be understood . It could act as a ligand trap, masking or enhancing signaling pathway such as that of SHH37 or BMP422 that was associated with HM genetic studies 38. Indeed, excessive levels of soluble LRP2 induced by a CRISPR/Cas9 approach were associated with buphthalmia in the zebrafish 39. The authors suggested that defective ligand endocytosis resulting from a lack or excess of LRP2 resulted in the same eye enlargement, but further studies are necessary to identify the underlying mechanism. At the cellular level , LRP2 was expressed mostly in the apical and basal extremities of glial Müller cells in the human retina . Recently, LRP2 was shown to be expressed in brain atsrocytes and microgli a, differentially regulated by inflammatory signals and involved in amyloid beta endocytosis activity 40. In the RPE, LRP2 was located at the apical membrane and in vesicles following a decreasing gradient along the apico -basal axis, ensuring transport between the subretinal space and the choroid as previously suggested 17. We also identified LRP2 signal at the basal side underneath RPE in the normal human retina, where it could bind to clusterin and apolipoproteins and metalloproteases, abundant in the Bruch membrane in humans 41. LRP2 expressed at the (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted March 10, 2025. ; https://doi.org/10.1101/2025.03.04.641381doi: bioRxiv preprint 15 baso-lateral could contribute to the regulation of nutrient diffusion and waste disposal between the RPE and blood 41, eye homeostasis and eye growth 17,42. In NSHM RPE LRP2 expression was reduced along the endocytic apparatus suggesting defective LRP2 - dependent endocytosis. LRP2 is considered as a suppressor of the eye size; the exact mechanism is not clear but reduced endocytosis and recycling of LRP2 and LRP2-ligand complexes is likely to cause a less -efficient LRP2 -mediated regulation of eye growth. Reduced LRP2 -ligand endocytosis by RPE cells would eventually result in an excess of these ligands in the milieu. We did not observe any upregulation of trans thyretin, LRP2 ligand previously involved in HM 36,43, although the levels of clusterin were slightly increased . On the contrary RBP4, another LRP2 ligand was upregulated (>1.5 fold) suggesting a dynamic regulat ion of these proteins in the vitreous. To further investigate the relationship between myopia, SP, and LRP2 expression in RPE cells, we analyzed the transcriptomic changes induced by partial knockdown of LRP2. Our study also shows that LRP2 depletion in the RPE may lead to a coordinated modulat ion of sensory perception and phototransduction with that of hormone and steroid metabolism and with tissue remodeling. T he decrease in transcripts of enzymes related to retinoid homeostasis (RPE65, retinal dehydrogenase 5 or 11) may explain the decrease in visual cycle integrity and the retinal degeneration , observed in humans and in animal models null for Lrp244. In addition to the differentially apically expressed solute transporters, we found numerous genes involved in maintaining the epithelial apical scaffold, such as occluding (OCLN) or myosin VIIA (MYO7A). Both in the Foxg1-Cre-Lrp2lox/lox mouse eye and in human eyes with PS, RPE cell structure and polarity were severely altered, which could be a consequence of ocular elongation, but also an early and possibly LRP2 -driven event, as shown in form -deprived myopia in chicks. In the latter, an increa se in the su rface area of individual RPE cells compensated (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted March 10, 2025. ; https://doi.org/10.1101/2025.03.04.641381doi: bioRxiv preprint 16 for the expanded vitreous chamber 45. Similarly, in the Foxg1-Cre-Lrp2lox/lox mouse, we showed in previous studies that the total surface area of the RPE layer was expanded without RPE proliferation or cell death 15,46. We observed that LRP2 deficiency leads to a severe reduction in clathrin -mediated endocytosis vesicles in humans and in iRPE cells , together with a reduction in EEA1 and LAMP1 vesicles. We could thus speculate that the loss of LRP2 in RPE cells could induce cell surface enlargement through failure of apical membrane removal. As a result of surface expansion, especially posterior to the equator, the RPE would then produce more Bruch's membrane, which is consistent with morphometric changes of Bruch's memb rane in the development of myopia in humans 47. However, further studies are required to better understand the mechanisms linking LRP2 expression in RPE cells and Müller glial cells to the development of myopia and PS . The causes of LRP2 downregulation in myopic eyes is most probably multifactorial and could result from tissue scale mechanical stresses 48 occurring during excessive eye growth, from genetic or epigenetic predispositions, from local inflammatory microenvironment 49,50, from hormonal factors and, from environmental stimuli such as lighting conditions. LRP2 expression is tightly regulated and its reduction in epithelial cells has been associated in different fibrosis pathologies. Further, this inhibition of transcription is caused by the canonical TGF -beta1/SMAD2 -SMAD3 pathway 51. Among the factors that positively control LRP2 are retinoic acid 52, vitamin D 52, and alpha and gamma peroxisome proliferator -activated receptors 53. Interestingly, our results show that LRP2 expression is upregulated in iRPE by light exposure, which can be explained by the presence of melanopsin (Opn4) 54,55 and other non -visual opsins like neuropsin (Opn5) 56 or peropsin 57 in RPE cells. LRP2 up-regulation by light, is in line with epidemiological data showing that light exposure is a robust environmental stimulus in the prevention of myopia 58. Our experiments indicated that exposure to red light seemed (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted March 10, 2025. ; https://doi.org/10.1101/2025.03.04.641381doi: bioRxiv preprint 17 to up -regulate LRP2 more efficiently than blue or white light, in line with intervention studies in children showing reduced myopia progression by red light therapy 59. An indirect mechanism of action of light could be the circadian regulation of cortisol that is sensitive to the wavelength composition of environmental lighting 27. Interestingly, cortisol downregulated the expression of LRP2 in iRPE cells an d in a Chinese population, higher levels of cortisone, corticosterone and aldosterone were recently measured in aqueous humor of myopic eyes 60, suggesting a link between myopia and ocular metabolism of corticoids. In a model of negative lens induced myopia in guinea pigs, hydrocortisone enhanced the axial elongation, the myopic shift and scleral thinning but had the reverse effect during physiol ogic emetropization 61, demonstrating the potential differential effects of corticoids in emmetropization process and in pathologic myopia. The complex links between light, circadian rhythm, corticoids , LRP2 myopia require further investigations but our results tend to indicate that LRP2 could be a molecular link between light, circadian regulations and NSHM. This study is subject to certain limitations, including the relatively small number of human eyes with PS that were available for analysis due to the rarity of such fresh mortem eyes in biobanks. However, the observation that LRP2 was not only reduced in the retina but also in the vitreous lends further support to our findings. The number of vitreous samples is also limited; however, this study has examined a substantial number of vitreous samples from HM patients with PS, and the findings have been validat ed by the reproducibility of the results by two independent groups in two distinct patient populations. Subsequent studies should aim to specifically analyze the relationship between LRP2 in the vitreous, axial length, and PS, and to characterize the solub le LRP2 form. (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted March 10, 2025. ; https://doi.org/10.1101/2025.03.04.641381doi: bioRxiv preprint 18 In conclusion , our study demonstrates that in human eyes with NSHM associated with PS, which is the more severe form of myopia, LRP2 is decreased both in the vitreous and in the RPE. In human RPE cells, LRP2 expression is regulated by light, which is the environmental factor the most associated with myopia. Finally, the silencing of LRP2 in human RPE cells regulated the expression genes involved in myopia development. LRP2 appears as a potential interventional target in the prevention of NSHM and its blinding complication s. (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted March 10, 2025. ; https://doi.org/10.1101/2025.03.04.641381doi: bioRxiv preprint 19

Ethics - Patients recruitment A total of 25 patients with NSHM and 23 patients with emmetropic eyes, for which vitrectomy was scheduled for macular surgery or for intraocular lens luxation were recruited in the study. There were 25 Asian Japanese patients and 23 Caucasian European patients. Undiluted vitreous humor samples from eyes with NSHM complicated by staphyloma (n=15) and from emmetropic control eyes (n=10) were obtained for mass spectrometry analysis at Kyoto Prefectural University of Medicine, Japan (Table 1). The study was con ducted in compliance with the Institutional Review Board of Kyoto Prefectural University of Medicine which approved the study (permission RBMR-C-864-6). Informed written consent was obtained from all patients. Undiluted vitreous humor samples from eyes with NSHM and PS (n=10) and from emmetropic control eyes (n=10) were collected for ELISA analysis at Ophtalmopole, Paris, France and at Hospital Puerta de Hierro, Albacete, Spain ( Table 1). In France and Spain, vitreous samples are considered as surgical wast e and can be used for research purposes if patients have expressed no opposition according to French and Spanish law. Agreement was obtained for all patients. Storage and analysis were. authorized in France by CPP Ile de France 1 (N°2016 -14390) and the use of patient’s information got the authorization number CNIL 2233436. All samples were stored at -80°C until preparation was initiated. Sample Preparation for Mass Spectrometry Protein concentrations were measured on undiluted vitreous samples with an infrared spectrometer (Direct Detect, Darmstadt, Germany) and samples were prepared for analysis using the S-Trap Micro spin column digestion protocol from ProtiFi (Huntington, NY , USA) as described in detail62 . Analysis was performed on an Orbitrap Fusion Tribrid mass spectrometer coupled to a Dionex UltiMate 3000 RSLC nano system (Thermo Fisher Scientific Instruments, (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted March 10, 2025. ; https://doi.org/10.1101/2025.03.04.641381doi: bioRxiv preprint 20 Waltham, MA, USA). All details are described in the Supplemental section of materials and methods. Enzyme-Linked Immunosorbent Assay (ELISA) protein quantification of LRP2 LRP2 concentration was determined by ELISA (Creative Diagnostics, DEIA -FN834, NY). Briefly, microtiter plates were coated with 1μg polyclonal antibody specific for human LRP2. Undiluted 100 µl of aqueous or vitreous humor sample was added to the plates. Th e presence of LRP2 was revealed by incubation with the same antibody labeled with biotin. The intensity of this colored product is directly proportional to the concentration of LRP2 present in the samples and was measured immediately by absorbance at 450 nm. The Student's t-test was used for statistical analysis of the ELISA data. Differences and correlations were considered statistically significant if P <0.05. Two-way scatter plots based on ELISA data with prediction from a linear regression were created in STATA 16.0. Eye samples Four donor eyes were obtained by Lion's Gift of Sight (Saint Paul, Minnesota, USA), which operates under the rules of the Food and Drug US Administration and the Eye Bank Association of America. Donor consent was obtained, and the next of kin received no compensation or financial gain from the donation. Samples were collected less than 10 hours after death and fixed in 4% paraformaldehyde (PFA) in PBS for 24 hours. Importation into France was carried out in accordance with regulations applicable to the transfer of human tissues with authorization N° IE-2022-2285 from the French ministry of research. Two male donor eyes with moderate cataract and refraction of -0.75 (+0.75)5° in the right eye and -0.50 (+1) 170° in the left eye were used as emmetropic control eye. The donor aged 88 male no remarkable medical history and no known ocular diseases and died due to small bowel obstruction. The postmortem time before enucleation and fixation was 6 hours. (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted March 10, 2025. ; https://doi.org/10.1101/2025.03.04.641381doi: bioRxiv preprint 21 Both HM eyes from a 89 male donor were analyzed. Medical history reported hypertension and arthritis, the cause of death was pulmonary edema and postmortem time was 8 hours. Both eyes were pseudophakic and showed macular staphyloma, vitreomacular traction and degenerative macular schisis. Pre mortem examination of the left eye was impaired by corneal opacification secondary to corneal surgery for keratoconus. Eyes were fixed in 4% paraformaldehyde overnight, rinsed and preserved in 1% paraformaldehyde at 4° c. Eyes were then dissected to remove the cornea and the anterior segment. The posterior segment was included in Optimal cutting temperature compound and 10µm cryosections were prepared. For flat-mounting, after removing the cornea and lens, the remaining posterior segment of the eye was flat-mounted and dissected to remove the neural retina. The posterior segment was cut into 4 quarters and the RPE/choroid was separated from the sclera after section of the vortex veins. Immunostaining of human tissues Sclera-choroidal-RPE complexes were incubated for 1 hour in a solution (phosphate -buffered saline (PBS) 0.1M, 10% Normal goat serum, 0.01% triton X100) at room temperature. Then, tissues were incubated with the primary antibodies at appropriate dilution (Ta ble 6) and phalloidin-rhodamine (1:200, Thermo Fisher Scientific, France) in a buffer solution (PBS 0.1M, 5% Normal donkey serum, 0.01% triton X100) during 5 days at 4°C under gentle agitation. After 6 X 30 min consecutive washings with 0.1M PBS / 0.01% tr iton X100, tissues were incubated for 3 hours at room temperature with the adequate secondary antibodies diluted at 1:1000. After 4 X 30min successive washings, tissues were flat mounted using Dako Omnis Fluorescence Mounting Medium (Agilent, Les Ulis, France). Similar protocol was applied for immunostaining on transversal cryosections, with overnight (4°C) incubation for the primary antibody and 1 hour (at room temperature) for secondary antibody incubation. Images were acquired using a fluorescence microscope (model Olympus BX51, Olympus, Rungis, France) or a confocal microscope (model Zeiss LSM710, Zeiss, Rueil Malmaison, France). iRPE cell culture and differentiation A human-induced pluripotent stem cells (hiPSC) cell line, obtained from fibroblasts of a healthy donor was used as previously described 29. The hiPSC were expanded and differentiated in to (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted March 10, 2025. ; https://doi.org/10.1101/2025.03.04.641381doi: bioRxiv preprint 22 hiPSC-derived RPE (iRPE) cells using a differentiation protocol 29. All details of cell culture and maintenance are described in the Supplemental section of materials and methods. At passage 3, iRPE cells were seeded in Transwells (0.4 μm pore polyester membrane inserts, Corning, CLS3450 and CLS3460) coated with Matrigel® red phenol -free matrix (Corning, 356231) in a serum- and antibiotic-free retinal Retinal Differentiation Medium (Supplemental section of materials and methods). All cultures were maintained in an incubator at 37 °C, 5% CO2. The trans-epithelial resistance (TER) was measured (Supplemental section of materials and methods), and cells were used between the sixth and th e tenth week of culture, once the trans-epithelial resistance reached physiological levels (> 100 Ω/cm2). RNA silencing Briefly, for each transfection, 6µl of triplex siRNA, a pool of 3 target-specific 19-25 nucleotides siLRP2 (Santa Cruz, sc -40103) or scrambled siRNA (Santa Cruz, sc -37007) or fluorescein - conjugated control siRNA (Santa Cruz, sc-36869) were diluted in 100µl of siRNA transfection medium (Santa Cruz, sc-36868,). This solution was mixed v/v with a diluted solution of siRNA transfection reagent (Santa Cruz, sc-29528). The siRNA mixture was added to the apical surface of Transwell -coated iRPEs for 6 hours. Withou t removing the siRNA mixture, serum - concentrated medium (2X) was added for 18 h incubation. After incubation, the cells were placed in fresh medium for 24 hours. The cells were then collected for protein and RNA extraction. RNA sequencing Raw data quality was assessed using FastQC. Low-quality sequences and adapters were pruned or removed using Dragen with default settings to retain high-quality matched reads. Illumina's DRAGEN Bio-IT platform (v3.10.4) was used for mapping to the hg38 reference genome and quantification using the Gencode v37 annotation GTF file. Library orientation, composition and transcript coverage were checked using Picard tools. Subsequent analyses were performed (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted March 10, 2025. ; https://doi.org/10.1101/2025.03.04.641381doi: bioRxiv preprint 23 using R software. Data normalization was performed using the DESeq2 (v1.26.0) Bioconductor software package, followed by differential expression analysis using the DESeq2 workflow. Adjusted p -values for multiple hypotheses were calculated using the Benjami ni-Hochberg procedure to control the false discovery rate (FDR). Finally, an enrichment analysis was performed using the R clusterProfiler (v3.14.3) package for Gene Set Enrichment Analysis (GSEA) on gene sets from the C5 ontology, comprising GO (Gene Onto logy) grouping biological processes, cellular components and molecular functions and HPO (Human Phenotype Ontology), and the KEGG and REACTOME databases. Light exposure Cells were exposed to red (630 nm, Qasim1xQA -SL0001-EU), blue (454 nm, Joyland, D50SWD-B), or white (3300 K, Lepro4100067-WW-EU-NF-a) LEDs in a 37°C incubator with 5% CO2. The specificities of each light source (CT, peak of emission, integrated irradiance) were measured using a spectroradiometer (Kanonica Minolta CL70 F CR I). Cells were exposed to a white, blue and red LED for 820s, 1000s and 900s respectively, to match ambient light exposure. These exposure times correspond to a dose of 0.3J/cm2 (calculat ed as the energy of the integrated spectrum multiplied by the exposure time). Cells were illuminated for 5 days, and mRNA collected at 3 post -illumination times: 30 minutes, 2 hours and 10 hours. TER measurements were taken during the blue -light illumination protocol to assess cell integrity during the experiment. Corticosteroid treatment of iRPE cells Cells were seeded at P3 in cell culture plastic dishes. On day 35, one week prior to corticosteroid treatment, retinal differentiation medium was removed and iRPE cells were incubated in experimental corticosteroid -free medium (DMEM, high glucose, HEPES, no phenol red (Thermo Fisher Scie ntific,); 10% fetal bovine serum, charcoal stripped (Thermo Fisher (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted March 10, 2025. ; https://doi.org/10.1101/2025.03.04.641381doi: bioRxiv preprint 24 Scientific)). On day 42, iRPE cells were treated for 24 h with cortisol 10−7 M. As cortisol was dissolved in ethanol (EtOH), control cells were treated with 0.1% EtOH in medium Quantitative RT-qPCR Total RNA was isolated using commercially available kits according to the manufacturer's instructions (RNeasy Mini, Qiagen) and measured (Nanodrop, Peqlab). One g was used in a reverse transcription reaction (SuperScript First strand synthesis, ThermoFisher). Quantitative PCR was performed using Master Mix PCR Power SYBR ™ Green (4367659, Applied Biosystems). Quantitative polymerase chain reaction (PCR) was performed on a 7500 real-time PCR system (Applied Biosystems). Transcripts levels were calculated using the standard curves generated using serial dilutions of cDNA obta ined from samples, then normalized to HPRT. Primers sequences were listed in Table 6. Each plo tted value corresponds to the mean of 3 independent experiments in duplicates Datas represent a mean gene expression per fold ± s.d. Data were analyzed using the non -parametric Kruskal Wallis test and Mann Witney post -test (*p<0.05, **p<0.01, ***p<0.001), using GraphPad Prism 8 software (GraphPad Software, San Diego, CA). Immunocytochemistry on iRPE cells iRPE cells were fixed with 4% PFA. Primary antibodies were incubated in blocking buffer (1% BSA, 0.1% triton X-100 in PBS) for three hours. Secondary antibodies were incubated for one hour. Nuclei were counterstained with DAPI for 5 minutes. Antibodies and reagents listed in Table 6 . No cellular autofluorescence or non -specific labeling was detected under these conditions. Images were collected by confocal microscopy and processed using ZEN (Zeiss) and ImageJ softwares. Immunofluorescence (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted March 10, 2025. ; https://doi.org/10.1101/2025.03.04.641381doi: bioRxiv preprint 25 Eyes were enucleated (n = 7 WT, n = 7 Lrp2 -cKO; age = 20 weeks) and fixed for 30 minutes in 4% PFA. The RPE was dissected and laid flat, then post -fixed with acetone for 10 minutes at -20°C.. Tissues were incubated with phalloidin for 3 h, rinsed, and th en incubated with rabbit anti -ZO1in blocking buffer (1% BSA, 0.3% Triton X -100 in PBS) for 24 h at 4°C. Secondary antibody was incubated 2 h at room temperature. After mounting, RPE was cut at four spots yielding four quadrants corresponding to the naso -temporal and dorso -ventral directions. Images were acquired using an inverted confocal microscope (Zeiss LSM 710). Flatmount was imaged with a 20x objective lens. Typically, 3 to 4 images were obtained of each of the four quadrants to cover studied regions (intermediate or peripheral retina). Using ImageJ software, a macro was developed to calculate the RPE cell areas for each sample. . The macro is divided into three main stages: the first stage involves segmentation, including image binarization and skeletonization; the second stage involves manual ROI correction; and the final stage involves skeleton analysis, requiring the following plugins: tubeness, morphology, and analyze skeleton. To calculate the RPE cell density, the total area of RPE cells cells per region of interest (intermediate or periphery) was divided by the total number of RPE cells per region of interest. Data were analyzed using the non -parametric Mann Witney post -test using GraphPad Prism 8 software (GraphPad Software, San Diego, CA). (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted March 10, 2025. ; https://doi.org/10.1101/2025.03.04.641381doi: bioRxiv preprint 26 Table 1. Summary of human vitreous samples Characteristics Mass spectrometry analysis ELISA myopia (n=15) Controls (n=10) myopia(n=10) Controls (n=13) Gender (male/female) 3/12 4/6 5/5 8/5 Age (year) 71±8.6 71.6±8.5 63±4 67.3±18 Axial length (mm) 29.33±1.94 24.11±1.57 29.67±2 22.6±0.7 Posterior Staphyloma 15 0 10 0 Indications for surgery Epiretinal membrane 4 10 2 10 Myopic Tractional maculopathy 11 8 Macular hole 1 1 Intraocular lens luxation 2 (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted March 10, 2025. ; https://doi.org/10.1101/2025.03.04.641381doi: bioRxiv preprint 27 Table 2. Significantly Differentially Expressed Proteins in High Myopia compared to Controls Protein ID Protein names Gene names p-value Fold change Myopia/control P05090 Apolipoprotein D APOD 0.012 2.91 Q15582 Transforming growth factor-beta- induced protein ig-h3 TGFBI 0.014 2.48 P00746 Complement factor D CFD 3E-04 2.43 P06312 Ig kappa chain V-IV region IGKV4-1 0.011 2.32 P62937 Peptidyl-prolyl cis-trans isomerase A PPIA 0.014 2.28 P35443 Thrombospondin-4 THBS4 0.035 2.26 P61626 Lysozyme C LYZ 1E-03 1.94 P01619 Ig kappa chain V-III region B6 IGKV3-20 0.008 1.80 P06681-3 Complement C2 C2 0.001 1.73 P01344 Insulin-like growth factor II IGF2 0.009 1.72 P02753 Retinol-binding protein 4 RBP4 0.037 1.69 P01008 Antithrombin-III SERPINC1 0.003 1.66 P51884 Lumican LUM 9E-04 1.62 P01009 Alpha-1-antitrypsin SERPINA1 0.004 1.60 P0DOX7 Immunoglobulin kappa light chain 0.013 1.53 Q96IY4 Carboxypeptidase B2 CPB2 0.019 1.53 Q16610 Extracellular matrix protein 1 ECM1 0.048 1.48 P0DOY3 Ig lambda-6 chain C region IGLC6 0.037 1.45 P01019 Angiotensinogen AGT 0.019 1.41 P01011 Alpha-1-antichymotrypsin SERPINA3 0.015 1.33 Q9Y4L1 Hypoxia up-regulated protein 1 HYOU1 0.033 0.74 Q9HCB6 Spondin-1 SPON1 0.025 0.74 Q96KN2 Beta-Ala-His dipeptidase CNDP1 0.047 0.74 Q9NQ79-3 Cartilage acidic protein 1 CRTAC1 0.021 0.73 Q9UNW1 Multiple inositol polyphosphate phosphatase 1 MINPP1 0.027 0.73 Q9BRK5 45 kDa calcium-binding protein SDF4 0.023 0.70 Q9BY67-2 Cell adhesion molecule 1 CADM1 0.047 0.68 Q14118 Dystroglycan DAG1 0.031 0.67 P23471-3 Receptor-type tyrosine-protein phosphatase zeta PTPRZ1 0.041 0.67 Q99519 Sialidase-1 NEU1 0.041 0.67 Q5IS74 Tripeptidyl-peptidase 1 TPP1 0.047 0.66 P10909-6 Clusterin CLU 0.048 0.66 O75882-3 Attractin ATRN 0.011 0.66 Q92520 Protein FAM3C FAM3C 0.032 0.66 O43505 Beta-1,4-glucuronyltransferase 1 B4GAT1 0.039 0.65 P19022 Cadherin-2 CDH2 0.024 0.65 P02649 Apolipoprotein E APOE 0.004 0.63 O15031 Plexin-B2 PLXNB2 0.039 0.62 Q7Z3B1 Neuronal growth regulator 1 NEGR1 0.006 0.62 P15586 N-acetylglucosamine-6-sulfatase GNS 0.034 0.62 Q08629 Testican-1 SPOCK1 0.035 0.61 (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted March 10, 2025. ; https://doi.org/10.1101/2025.03.04.641381doi: bioRxiv preprint 28 P15291-2 Beta-1,4-galactosyltransferase 1 B4GALT1 0.021 0.61 O15240 Neurosecretory protein VGF VGF 0.006 0.60 P13591-5 Neural cell adhesion molecule 1 NCAM1 0.013 0.6 P27797 Calreticulin CALR 0.019 0.59 Q9BSG5-2 Retbindin RTBDN 0.018 0.59 Q9UBP4 Dickkopf-related protein 3 DKK3 0.004 0.59 P48723 Heat shock 70 kDa protein 13 HSPA13 0.012 0.57 Q9P2V4 Leucine-rich repeat LRIT1 0.006 0.57 P10619-2 Lysosomal protective protein CTSA 0.029 0.57 Q6UXD5-6 Seizure 6-like protein 2 SEZ6L2 0.016 0.56 Q9P121-3 Neurotrimin NTM 0.006 0.55 Q8WXD2 Secretogranin-3 SCG3 0.023 0.55 P10645 Chromogranin-A CHGA 0.029 0.54 Q6MZW2 Follistatin-related protein 4 FSTL4 0.029 0.54 P08138-2 Tumor necrosis factor receptor superfamily member 16 NGFR 0.011 0.54 P10745 Retinol-binding protein 3 RBP3 0.006 0.53 P98160 Basement membrane-specific heparan sulfate proteoglycan core protein HSPG2 0.038 0.52 O0053 Neural cell adhesion molecule L1-like protein CHL1 0.021 0.52 P98164 Low-density lipoprotein receptor-related protein 2 LRP2 0.016 0.50 Q5IS80 Amyloid beta A4 protein APP 0.017 0.50 Q13510 Acid ceramidase ASAH1 0.024 0.48 Q14055 Collagen alpha-2(IX) chain COL9A2 0.006 0.47 P51693 Amyloid-like protein 1 APLP1 0.017 0.47 P10523 S-arrestin SAG 5E-04 0.46 Q9Y4C0-4 Neurexin-3 NRXN3 0.012 0.46 Q92823-3 Neuronal cell adhesion molecule NRCAM 0.004 0.45 Q7Z7G0 Target of Nesh-SH3 ABI3BP 0.032 0.45 Q06481 Amyloid-like protein 2 APLP2 0.008 0.45 O75326 Semaphorin-7A SEMA7A 0.012 0.44 Q14515-2 SPARC-like protein 1 SPARCL1 0.004 0.42 P13611-2 Versican core protein VCAN 0.005 0.15 (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted March 10, 2025. ; https://doi.org/10.1101/2025.03.04.641381doi: bioRxiv preprint 29 Table 3: List of differentially expressed genes (DEGs) down regulated in shLRP2 iRPE cells. Gene ID Gene Name Fold Additional informations DPYS dihydropyrimidinase -3.00 Second step of reductive pyrimidine degradation - Dihydropyrimidinase deficiency (DPYSD) associated with congenital microvillous atrophy SLC4A10 solute carrier family 4 member 10 -2.31 Sodium-driven chloride bicarbonate exchanger – NEDHBA syndrome ATP13A5 ATPase 13A5 -2.30 ATPase ATP2B2 ATPase plasma membrane Ca2+ transporting 2 -1.82 ATP-driven Ca2+ ion pump PDE2A phosphodiesterase 2A -1.68 cGMP-activated cyclic nucleotide phosphodiesterase – IDDPADS syndrome LRP2 LDL receptor related protein 2 -1.66 Multiligand endocytosis receptor – Apical membrane RPE SLCO1A2 solute carrier organic anion transporter family member 1A2 -1.57 Na+-independent transporter – Mediates apical uptake of all -trans-retinol across human RPE ACSS1 acyl-CoA synthetase short chain family 1 -1.56 Catalyzes the synthesis of acetyl-CoA from short-chain fatty acids PLXNC1 plexin C1 -1.56 Receptor for SEMA7A SPON1 spondin 1 -1.54 Cell Adhesion Molecule P2RY1 purinergic receptor P2Y1 -1.53 Receptor for extracellular adenine nucleotides – Degradation of ATP by RPE NECAB1 N-terminal EF-hand calcium binding protein 1 - 1.51 Calcium binding protein CRYBA1 crystallin beta A1 -1.50 Heat shock protein – Apical membrane RPE, endocytosis UGT8 UDP glycosyltransferase 8 -1.48 Catalyzes the transfer of galactose to ceramide FAM167A family with sequence similarity 167 member A -1.48 N.D. CRYBG1 Beta-gamma crystallin domain-containing 1 -1.48 Cytoskeleton RPE65 retinoid isomerohydrolase RPE65 -1.46 Isomerohydrolase in the retinoid cycle involved in regeneration of 11-cis-retinal – Leber Congenital Amaurosis 2 (LCA2) SNED1 sushi, nidogen and EGF like domains 1 -1.45 Extracellular matrix molecule SLC16A12 solute carrier family 16 member 12 -1.45 Creatine transporter – Cataract 47 (CTRCT47) CDKN1C cyclin dependent kinase inhibitor 1C -1.43 Potent tight-binding inhibitor of several G1 cyclin/CDK complexes CRYBB1 crystallin beta B1 -1.43 Interaction CRYBA1 - Cataract 17, multiple types (CTRCT17) NDRG1 N-myc downstream regulated 1 -1.42 Stress-responsive protein – Charcot-Marie-Tooth Diseases 4D SLC39A12 solute carrier family 39 member 12 -1.42 Uniporter that promotes Zn2+ import from the extracellular space to the cytoplasm. Identified as causing non-syndromic high myopia NTNG1 netrin G1 -1.41 Guidance Molecule LINGO2 leucine rich repeat and Ig domain containing 2 -1.40 N.D. DUSP26 dual specificity phosphatase 26 -1.40 Inactivation of MAPK1 and MAPK3 ARRDC3 arrestin domain containing 3 -1.40 Endosome adaptator PTGR3 prostaglandin reductase 3 -1.40 Functions as15-oxo-prostaglandin 13-reductase TMEM255A transmembrane protein 255A -1.39 N.D. SLC16A4 solute carrier family 16 member 4 -1.39 Proton-linked monocarboxylate plasma membrane transporter SELENOP selenoprotein P -1.39 Antioxidant defense properties of selenium LRP8 LDL receptor related protein 8 -1.38 Cell surface receptor for Reelin – Myocardial Infarction 1 (MCI1) MAN2A1 mannosidase alpha class 2A member 1 -1.38 Biosynthesis of N-glycans FLVCR2 FLVCR heme transporter 2 -1.37 Heme importer/sensor – Proliferative Vasculopathy and Hydranencephaly - Hydrocephaly syndrome (PVHH) Vasculopathy of the retina RDH5 retinol dehydrogenase 5 -1.37 11-cis retinol oxidation in the RPE – Fundus Abipunctatus (FALBI) – Flecked retina, night blindness CYP4V2 cytochrome P450 family 4 subfamily V member 2 -1.36 Cytochrome P450 monooxygenase involved in fatty acif metabolism – Bietti Crystalline corneoretinal distrophy (BCD) – Degeneration of the retina and sclerosis of choroidal vessels SOSTDC1 sclerostin domain containing 1 -1.36 Directly antagonizes activity of BMP2, BMP4, and BMP7 – RPE expression MEST mesoderm specific transcript -1.36 N.D. NOG noggin -1.36 Inhibitor of BMP – decreased in the guinea-pig myopic model BCO1 beta-carotene oxygenase 1 -1.35 Cleavage of beta -carotene in 2 retinal – Hypercarotenemia and Vitamine A Deficiency (HCV AD) increased beta-carotene and decreased vitamine A levels HSD17B11 hydroxysteroid 17-beta dehydrogenase 11 -1.34 Androgen metabolism during steroidogenesis RHOU ras homolog family member U -1.32 Control of cell shape S1PR1 sphingosine-1-phosphate receptor 1 -1.30 G-protein coupled receptor for the bioactive lysosphingolipid shingosine-1- phosphate HNMT histamine N-methyltransferase -1.29 Inactivation of histamine – Intellectual Developmental Disorder (MRT51) RDH11 retinol dehydrogenase 11 -1.29 Retinol deshydrogenase with higher activity towards 9 -cis, 11-cis and all -trans- retinol – Retinal Distrophy Juvenile Cataracts, and Short Stature syndrome (RDJCSS) – Retinal distrophy, RPE and choroid atrophy. DNAJC3 DnaJ heat shock protein family (Hsp40) member C3 -1.28 Endoplasmic reticulum stress – Ataxia, combined Cerebellar and Peripheral, with Hearing loss and Diabetes mellitus (ACPHD) LEPROTL1 leptin receptor overlapping transcript like 1 -1.28 N.D. CTNNAL1 catenin alpha like 1 -1.27 Modulation of the Rho pathway MAB21L2 mab-21 like 2 -1.26 Embryonic development including eye – Microphtalmia/Coloboma and Skeletal (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted March 10, 2025. ; https://doi.org/10.1101/2025.03.04.641381doi: bioRxiv preprint 30 Dysplasia syndrome (MCSKS) - ANKRD46 ankyrin repeat domain 46 -1.25 N.D. FAXDC2 fatty acid hydroxylase domain containing 2 -1.23 Megakariocyte differentiation LETMD1 LETM1 domain containing 1 -1.22 Mitochondrial structure TOB1 transducer of ERBB2, 1 -1.21 Anti-proliferative protein LIPG lipase G, endothelial type -1.21 Hydrolysis of HDL ST3GAL5 ST3 beta-galactoside alpha-2,3-sialyltransferase 5 -1.21 Formation of gangliosides – Salt and Pepper Developmental Regression syndrome (SPDRS) STMP1 short transmembrane mitochondrial protein 1 -1.20 Mitochondrial microprotein EIF4A2 eukaryotic translation initiation factor 4A2 -1.19 Translation initiation factor SARAF store-operated calcium entry associated regulatory factor -1.18 Negative regulator of store-operated calcium entry FAM13A family with sequence similarity 13 member A -1.18 N.D. SLC20A1 solute carrier family 20 member 1 -1.17 Sodium-phosphate symporter RHOB ras homolog family member B -1.14 Apoptosis CPE carboxypeptidase E -1.14 Sorting receptor that directs prohormones to the secretory pathway – BDV syndrome BMF Bcl2 modifying factor -1.13 Apoptosis (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted March 10, 2025. ; https://doi.org/10.1101/2025.03.04.641381doi: bioRxiv preprint 31 Table 4. List of DEGs up regulated in in shLRP2 iRPE cells with a fold change cut off of 1.1<. Gene ID Gene Name Fold Additional informations ID1 inhibitor of DNA binding 1, HLH protein 2.05 Transcriptional regulator - Regulates the circadian clock by repressing the transcriptional activator activity of the CLOCK-BMAL1 heterodimer MYBL2 MYB proto-oncogene like 2 1.99 DNA binding E2F motifs FIBCD1 fibrinogen C domain containing 1 1.8 Acetyl group-binding receptor facilitating endocytosis AMTN Amelotin 1.74 Promoter of calcium phosphate mineralization – Amelogenesis imperfecta 3B (AI3B) ZBED1 zinc finger BED-type containing 1 1.69 E3-type small ubiquitin-like modifier (SUMO) ligase TP73 tumor protein p73 1.69 Apoptotic response to DNA damage – Ciliary dyskinesia, primary, 47, and lissencephaly (CILD47) RRM2 ribonucleotide reductase regulatory subunit M2 1.67 Biosynthesis of deoxyribonucleotides from the corresponding ribonucleotides ASF1B anti-silencing function 1B histone chaperone 1.66 Histone chaperone ID3 inhibitor of DNA binding 3, HLH protein 1.65 Transcriptional regulator - Regulates the circadian clock by repressing the transcriptional activator activity of the CLOCK-BMAL1 heterodimer. Differentially expressed in RPE in a guinea pig model of myopia DTL denticleless E3 ubiquitin protein ligase homolog 1.63 Substrate-specific adapter of a DCX (DDB1 -CUL4-X-box) E3 ubiquitin -protein ligase complex - regulates the circadian clock function by mediating the ubiquitination and degradation of CRY1 MKI67 marker of proliferation Ki-67 1.6 Binds DNA, with a preference for supercoiled DNA and AT-rich DNA CDC6 cell division cycle 6 1.58 Initiation of DNA replication – Meier Gorlin syndrome 5 (MGORS5) MCAM melanoma cell adhesion molecule 1.51 Cell adhesion molecule E2F1 E2F transcription factor 1 1.51 Transcription factor GPD1 glycerol-3-phosphate dehydrogenase 1 1.46 Glycerol-3-phosphate dehydrogenase activity – Hypertriglyceridemia, transient infantile (HTGTI) TPX2 TPX2 microtubule nucleation factor 1.44 Microtubule nucleator NEURL1B neuralized E3 ubiquitin protein ligase 1B 1,43 E3 ubiquitin-protein ligase involved in regulation of the Notch pathway LRRC32 leucine rich repeat containing 32 1.4 Key regulator of TGF beta signaling CHST2 carbohydrate sulfotransferase 2 1.38 Inflammation COL11A1 collagen type XI alpha 1 chain 1.35 Fibrillogenesis. Sticler syndrome 2 (STL2)– Marshall syndrome (MRSHS) – ocular abnormalities consisting of large eyes with ocular hypertelorism- high myopia SCARA3 scavenger receptor class A member 3 1.34 Protection against oxidative molecules TPM4 tropomyosin 4 1.34 Binds to actin filaments – Bleeding disorder (BDPLT25) BSN bassoon presynaptic cytomatrix protein 1.33 Scaffolf protein in the presynaptic compartment GRIK3 glutamate ionotropic receptor kainate type 3 1.32 Ionotropic glutamate receptor NFASC neurofascin 1.31 Cell adhesion molecule – Neurdevelopmental disorder (NEDCPMD) ADAM28 ADAM metallopeptidase domain 28 1.28 Adhesion and protolytic events in lymphocyte PCSK7 proprotein convertase subtilisin/kexin type 7 1.27 Serine endoprotase FHOD3 formin homology 2 domain containing 3 1.26 Actin-organizing protein ADAMTS7 ADAM metallopeptidase with thrombospondin type 1 motif 7 1.24 Metalloprotease TCOF1 treacle ribosome biogenesis factor 1 1.24 Nucleolar protein – Treacher Collins syndrome (TCS1) PALM paralemmin 1.21 Plasma membrane dynamics LEFTY2 left-right determination factor 2 1.21 Left-right asymmetry determination of organs – Left-right axis malformations (LRAM) MMP14 matrix metallopeptidase 14 1.21 Endopeptidase of the ECM produced by RPE – Winchester syndrome (WNCHS) ADAMTS12 ADAM metallopeptidase with thrombospondin type 1 motif 12 1.18 Metalloprotease NDST1 N-deacetylase and N-sulfotransferase 1 1,15 Heparan sulfate biogenesis – Intellectual Developmental disorder (MRT46) HNRNPL heterogeneous nuclear ribonucleoprotein L 1,15 Splicing factor (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted March 10, 2025. ; https://doi.org/10.1101/2025.03.04.641381doi: bioRxiv preprint 32 Table 5. Selected gene sets associated with LRP2 reduction in iRPE cells. Normalized Enrichment Scores. ID Description NES Light processing M11434 GOBP RETINOL METABOLIC PROCESS -2,291 M13006 GOBP SENSORY PERCEPTION OF LIGHT STIMULUS -2,269 M34809 HP SCOTOMA -1,966 M38378 HP ABNORMAL FULL FIELD ELECTRORETINOGRAM -1,952 M37110 HP PROGRESSIVE NIGHT BLINDNESS -1,919 M14699 GOBP SENSORY PERCEPTION -1,910 M41363 HP ABNORMAL LIGHT AND DARK ADAPTED ELECTRORETINOGRAM -1,893 M37157 HP PERIPHERAL VISUAL FIELD LOSS -1,855 Hormonal processes M12960 GOBP RESPONSE TO STEROL -2,220 M12703 GOBP CELLULAR HORMONE METABOLIC PROCESS -2,075 M14197 GOBP CELLULAR RESPONSE TO STEROL -2,032 M3753 GOBP HORMONE METABOLIC PROCESS -1,873 M11178 GOBP REGULATION OF HORMONE LEVELS -1,681 M16758 GOBP STEROID METABOLIC PROCESS -1,631 M13381 GOBP STEROID BIOSYNTHETIC PROCESS -1,592 Epithelial transport M37121 HP RETINAL PIGMENT EPITHELIAL ATROPHY -2,029 M13303 GOBP TRANSEPITHELIAL TRANSPORT -2,017 M24808 GOBP IMPORT ACROSS PLASMA MEMBRANE -1,921 M15727 GOBP IMPORT INTO CELL -1,748 M18079 GOMF METAL ION TRANSMEMBRANE TRANSPORTER ACTIVITY -1,702 M10755 GOBP TRANSITION METAL ION TRANSPORT -1,668 Apico-basal polarity M1446 GOCC APICAL PLASMA MEMBRANE -1,699 M17164 GOCC APICAL PART OF CELL -1,698 M3406 GOCC BASOLATERAL PLASMA MEMBRANE -1,689 M17798 GOCC BASAL PART OF CELL -1,686 Choroid support M34087 GOBP VASCULAR TRANSPORT -2,088 M34782 HP CHORIORETINAL ATROPHY -2,039 M38919 HP CHORIORETINAL DEGENERATION -1,904 M16767 GOBP VASCULAR PROCESS IN CIRCULATORY SYSTEM -1,843 Extracellular matrix remodeling M12927 GOMF EXTRACELLULAR MATRIX STRUCTURAL CONSTITUENT 2,155 M10742 GOCC COLLAGEN TRIMER 2,154 M25882 GOCC COLLAGEN CONTAINING EXTRACELLULAR MATRIX 2,060 M10505 GOBP COLLAGEN FIBRIL ORGANIZATION 1,995 M23167 GOBP COLLAGEN METABOLIC PROCESS 1,983 M17310 GOCC COMPLEX OF COLLAGEN TRIMERS 1,949 M22974 GOBP COLLAGEN CATABOLIC PROCESS 1,869 M880 GOBP PROTEOGLYCAN METABOLIC PROCESS 1,835 Cytoskeleton assembly M6458 GOCC ACTIN FILAMENT 2,351 M17227 GOCC ACTIN FILAMENT BUNDLE 2,125 M17139 GOCC MYOFILAMENT 2,059 M17284 GOCC ACTOMYOSIN 2,032 M5272 GOCC ACTIN CYTOSKELETON 2,011 M18964 GOMF MICROTUBULE MOTOR ACTIVITY 2,010 M9766 GOMF ACTIN FILAMENT BINDING 1,915 M14799 GOMF ACTIN BINDING 1,895 M9078 GOMF MICROTUBULE BINDING 1,888 M2926 GOCC CORTICAL CYTOSKELETON 1,865 M4679 GOCC MICROTUBULE ASSOCIATED COMPLEX 1,864 M12616 GOBP MICROTUBULE DEPOLYMERIZATION 1,862 M14007 GOBP MICROTUBULE BUNDLE FORMATION 1,830 (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted March 10, 2025. ; https://doi.org/10.1101/2025.03.04.641381doi: bioRxiv preprint 33 Table 6 . Antibodies and reagents for immunohistochemical staining. Primary Antibodies Species, Label, Method Source, number Dilution Glutamine synthetase Mouse, IF Merck Millipore, MAB2-302 1:300 Tubulin-beta3 Mouse, IF BioLegend, 801202 1:300 OPN1LW/OPN1MW (Red/green-sensitive opsin) Rabbit, IF Merck Millipore, AB5405 1:100 OPN1SW (Blue-sensitive opsin) Goat, IF Santa Cruz, sc-14363 1:200 Glial fibrillary acidic protein Rabbit, IF Dako Cytomation, Z0334 1:300 LRP2 Rabbit, IF Abcam, Ab76969 1:300 ZO-1 Rabbit, IF Invitrogen, 40-2200 1:200 Clathrin Mouse, IF Santa Cruz, sc-12735 1:200 EEA1 Mouse, IF BD Transduction, 610457 1:250 LAMP1 Mouse, IF DSHB, H4A3 1:100 Secondary Antibodies Anti-Rabbit Donkey, alexa-488, IF ThermoFisher, A21206 1:300 Anti-Rabbit Donkey, alexa-594, IF ThermoFisher, A21207 1:300 Anti-Mouse Donkey, alexa-594, IF ThermoFisher, A32766 1:300 Anti-Mouse Goat, alexa-594, IF ThermoFisher, A11005 1:300 Reagents Phalloidin (Aminata Phalloidin) Rhodamine, IF ThermoFisher, R415 1:300 4',6-diamidino-2-phenylindole (DAPI) Fluorescent counterstain Roche, 10236276001 1:2500 (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted March 10, 2025. ; https://doi.org/10.1101/2025.03.04.641381doi: bioRxiv preprint 34 List of supplementary materials Supplemental Material and methods 5 Supplemental Figures Figure S1: GO analysis of DEPs Figure S2: The most significant cluster obtained from the PPI and its disease enrichment Figure S3: Principal component analysis. Figure S4: KEEG, Gene Ontology, Reactome and Human Phenotype Ontology based gene enrichments. Figure S5: Category net plot enrichment analysis. 4 Supplemental Data Files in attached Excel Format files Data File S1: filtered results of the LC/MS MS Data File S2: List of DEGs Data File S3: Enrichment-p adjust Data File S4: Enrichment LRP2-p adjust (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted March 10, 2025. ; https://doi.org/10.1101/2025.03.04.641381doi: bioRxiv preprint 35

1. Wolffsohn JS, Whayeb Y, Logan NS, Weng R, International Myopia Institute Ambassador Group*. IMI-Global Trends in Myopia Management Attitudes and Strategies in Clinical Practice-2022 Update. Invest Ophthalmol Vis Sci. 2023;64(6):6. doi:10.1167/iovs.64.6.6 2. Ohno-Matsui K, Jonas JB. Posterior staphyloma in pathologic myopia. Prog Retin Eye Res. Published online December 8, 2018. doi:10.1016/j.preteyeres.2018.12.001 3. Ruiz-Medrano J, Montero JA, Flores-Moreno I, Arias L, García-Layana A, Ruiz- Moreno JM. Myopic maculopathy: Current status and proposal for a new classification and grading system (ATN). Prog Retin Eye Res. 2019;69:80-115. doi:10.1016/j.preteyeres.2018.10.005 4. Zaabaar E, Asiamah R, Kyei S, Ankamah S. Myopia control strategies: A systematic review and meta-meta-analysis. Ophthalmic Physiol Opt J Br Coll Ophthalmic Opt Optom. 2025;45(1):160-176. doi:10.1111/opo.13417 5. Shi H, Guo N, Zhao Z, He X, Li J, Duan J. Global prevalence of myopic macular degeneration in general population and patients with high myopia: A systematic review and meta-analysis. Eur J Ophthalmol. 2024;34(3):631-640. doi:10.1177/11206721231185816 6. Tedja MS, Haarman AEG, Meester-Smoor MA, et al. IMI - Myopia Genetics Report. Invest Ophthalmol Vis Sci. 2019;60(3):M89-M105. doi:10.1167/iovs.18-25965 7. Biswas S, El Kareh A, Qureshi M, et al. The influence of the environment and lifestyle on myopia. J Physiol Anthropol. 2024;43(1):7. doi:10.1186/s40101-024-00354-7 8. Liu XN, Naduvilath TJ, Sankaridurg PR. Myopia and sleep in children-a systematic review. Sleep. 2023;46(11):zsad162. doi:10.1093/sleep/zsad162 9. Ho CL, Wu WF, Liou YM. Dose-Response Relationship of Outdoor Exposure and Myopia Indicators: A Systematic Review and Meta-Analysis of Various Research Methods. Int J Environ Res Public Health. 2019;16(14). doi:10.3390/ijerph16142595 10. Lingham G, Mackey DA, Lucas R, Yazar S. How does spending time outdoors protect against myopia? A review. Br J Ophthalmol. 2020;104(5):593-599. doi:10.1136/bjophthalmol-2019-314675 11. Haarman AEG, Klaver CCW, Tedja MS, et al. Identification of Rare Variants Involved in High Myopia Unraveled by Whole Genome Sequencing. Ophthalmol Sci. 2023;3(4):100303. doi:10.1016/j.xops.2023.100303 12. Yuan S, Huang X, Zhang S, et al. Two novel variations in LRP2 cause Donnai-Barrow syndrome in a Chinese family with severe early-onset high myopia. Front Genet. 2023;14:1107347. doi:10.3389/fgene.2023.1107347 13. Khan AO, Ghazi NG. The distinct optic disk and peripapillary appearance in Donnai- Barrow syndrome. Ophthalmic Genet. 2018;39(3):321-324. doi:10.1080/13816810.2018.1430245 14. Longoni M, Kantarci S, Donnai D, Pober BR. Donnai-Barrow Syndrome. In: Adam MP, Feldman J, Mirzaa GM, et al., eds. GeneReviews®. University of Washington, Seattle; 1993. Accessed September 8, 2024. http://www.ncbi.nlm.nih.gov/books/NBK1878/ 15. Cases O, Joseph A, Obry A, et al. Foxg1-Cre Mediated Lrp2 Inactivation in the Developing Mouse Neural Retina, Ciliary and Retinal Pigment Epithelia Models Congenital High Myopia. PloS One. 2015;10(6):e0129518. doi:10.1371/journal.pone.0129518 16. Storm T, Heegaard S, Christensen EI, Nielsen R. Megalin-deficiency causes high myopia, retinal pigment epithelium-macromelanosomes and abnormal development of the ciliary body in mice. Cell Tissue Res. 2014;358(1):99-107. doi:10.1007/s00441-014-1919-4 17. Mai S, Zhu X, Wan EYC, et al. Postnatal eye size in mice is controlled by SREBP2- (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted March 10, 2025. ; https://doi.org/10.1101/2025.03.04.641381doi: bioRxiv preprint 36 mediated transcriptional repression of Lrp2 and Bmp2. Dev Camb Engl. 2022;149(14):dev200633. doi:10.1242/dev.200633 18. Goto S, Hosojima M, Kabasawa H, Saito A. The endocytosis receptor megalin: From bench to bedside. Int J Biochem Cell Biol. 2023;157:106393. doi:10.1016/j.biocel.2023.106393 19. Christensen EI, Birn H. Megalin and cubilin: multifunctional endocytic receptors. Nat Rev Mol Cell Biol. 2002;3(4):256-266. doi:10.1038/nrm778 20. Beenken A, Cerutti G, Brasch J, et al. Structures of LRP2 reveal a molecular machine for endocytosis. Cell. 2023;186(4):821-836.e13. doi:10.1016/j.cell.2023.01.016 21. Christ A, Herzog K, Willnow TE. LRP2, an auxiliary receptor that controls sonic hedgehog signaling in development and disease. Dev Dyn Off Publ Am Assoc Anat. 2016;245(5):569-579. doi:10.1002/dvdy.24394 22. Gajera CR, Emich H, Lioubinski O, et al. LRP2 in ependymal cells regulates BMP signaling in the adult neurogenic niche. J Cell Sci. 2010;123(Pt 11):1922-1930. doi:10.1242/jcs.065912 23. Kowalczyk I, Lee C, Schuster E, et al. Neural tube closure requires the endocytic receptor Lrp2 and its functional interaction with intracellular scaffolds. Dev Camb Engl. 2021;148(2):dev195008. doi:10.1242/dev.195008 24. Bunatyan L, Margineanu A, Boutin C, et al. LRP2 contributes to planar cell polarity- dependent coordination of motile cilia function. Cell Tissue Res. 2023;392(2):535-551. doi:10.1007/s00441-023-03757-7 25. Marzolo MP, Farfán P. New insights into the roles of megalin/LRP2 and the regulation of its functional expression. Biol Res. 2011;44(1):89-105. doi:10.4067/S0716- 97602011000100012 26. Chen YY, Tsai TH, Liu YL, Lin HJ, Wang IJ. The impact of light properties on ocular growth and myopia development. Taiwan J Ophthalmol. 2024;14(2):143-150. doi:10.4103/tjo.TJO-D-24-00031 27. Robertson-Dixon I, Murphy MJ, Crewther SG, Riddell N. The Influence of Light Wavelength on Human HPA Axis Rhythms: A Systematic Review. Life Basel Switz. 2023;13(10):1968. doi:10.3390/life13101968 28. Françon A, Delaunay K, Jaworski T, et al. Phototoxicity of low doses of light and influence of the spectral composition on human RPE cells. Sci Rep. 2024;14(1):6839. doi:10.1038/s41598-024-56980-9 29. Canonica J, Zhao M, Favez T, et al. Pathogenic Effects of Mineralocorticoid Pathway Activation in Retinal Pigment Epithelium. Int J Mol Sci. 2021;22(17):9618. doi:10.3390/ijms22179618 30. Storm T, Tranebjærg L, Frykholm C, et al. Renal phenotypic investigations of megalin-deficient patients: novel insights into tubular proteinuria and albumin filtration. Nephrol Dial Transplant Off Publ Eur Dial Transpl Assoc - Eur Ren Assoc. 2013;28(3):585- 591. doi:10.1093/ndt/gfs462 31. Dachy A, Paquot F, Debray G, et al. In-depth phenotyping of a Donnai-Barrow patient helps clarify proximal tubule dysfunction. Pediatr Nephrol Berl Ger. 2015;30(6):1027-1031. doi:10.1007/s00467-014-3037-7 32. Li Y, Cong R, Biemesderfer D. The COOH terminus of megalin regulates gene expression in opossum kidney proximal tubule cells. Am J Physiol Cell Physiol. 2008;295(2):C529-537. doi:10.1152/ajpcell.00037.2008 33. Wicher G, Larsson M, Fex Svenningsen A, Gyllencreutz E, Rask L, Aldskogius H. Low density lipoprotein receptor-related protein-2/megalin is expressed in oligodendrocytes in the mouse spinal cord white matter. J Neurosci Res. 2006;83(5):864-873. doi:10.1002/jnr.20774 (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted March 10, 2025. ; https://doi.org/10.1101/2025.03.04.641381doi: bioRxiv preprint 37 34. Aretz S, Krohne TU, Kammerer K, et al. In-depth mass spectrometric mapping of the human vitreous proteome. Proteome Sci. 2013;11(1):22. doi:10.1186/1477-5956-11-22 35. Jung FF, Bachinsky DR, Tang SS, et al. Immortalized rat proximal tubule cells produce membrane bound and soluble megalin. Kidney Int. 1998;53(2):358-366. doi:10.1046/j.1523-1755.1998.00766.x 36. Shao J, Xin Y, Yao Y. Correlation of misfolded transthyretin in abnormal vitreous and high myopia related ocular pathologies. Clin Chim Acta Int J Clin Chem. 2011;412(23- 24):2117-2121. doi:10.1016/j.cca.2011.07.021 37. Christ A, Christa A, Klippert J, et al. LRP2 Acts as SHH Clearance Receptor to Protect the Retinal Margin from Mitogenic Stimuli. Dev Cell. 2015;35(1):36-48. doi:10.1016/j.devcel.2015.09.001 38. Jiang Y, Ouyang J, Li X, et al. Novel BMP4 Truncations Resulted in Opposite Ocular Anomalies: Pathologic Myopia Rather Than Microphthalmia. Front Cell Dev Biol. 2021;9:769636. doi:10.3389/fcell.2021.769636 39. Collery RF, Link BA. Precise Short Sequence Insertion in Zebrafish Using a CRISPR/Cas9 Approach to Generate a Constitutively Soluble Lrp2 Protein. Front Cell Dev Biol. 2019;7:167. doi:10.3389/fcell.2019.00167 40. Takano-Kawabe K, Matoba K, Nakamura Y, Moriyama M. Low Density Lipoprotein Receptor-related Protein 2 Expression and Function in Cultured Astrocytes and Microglia. Neurochem Res. 2024;49(1):199-211. doi:10.1007/s11064-023-04022-7 41. Yuan X, Gu X, Crabb JS, et al. Quantitative proteomics: comparison of the macular Bruch membrane/choroid complex from age-related macular degeneration and normal eyes. Mol Cell Proteomics MCP. 2010;9(6):1031-1046. doi:10.1074/mcp.M900523-MCP200 42. Storm T, Burgoyne T, Dunaief JL, Christensen EI, Futter C, Nielsen R. Selective Ablation of Megalin in the Retinal Pigment Epithelium Results in Megaophthalmos, Macromelanosome Formation and Severe Retina Degeneration. Invest Ophthalmol Vis Sci. 2019;60(1):322-330. doi:10.1167/iovs.18-25667 43. Shao J, Xin Y, Li R, Fan Y. Vitreous and serum levels of transthyretin (TTR) in high myopia patients are correlated with ocular pathologies. Clin Biochem. 2011;44(8-9):681-685. doi:10.1016/j.clinbiochem.2011.03.032 44. Faridi R, Yousaf R, Gu S, et al. Variants of LRP2, encoding a multifunctional cell- surface endocytic receptor, associated with hearing loss and retinal dystrophy. Clin Genet. 2023;103(6):699-703. doi:10.1111/cge.14312 45. Lin T, Grimes PA, Stone RA. Expansion of the retinal pigment epithelium in experimental myopia. Vision Res. 1993;33(14):1881-1885. doi:10.1016/0042-6989(93)90015- o 46. Cases O, Obry A, Ben-Yacoub S, et al. Impaired vitreous composition and retinal pigment epithelium function in the FoxG1::LRP2 myopic mice. Biochim Biophys Acta. 2017;1863(6):1242-1254. doi:10.1016/j.bbadis.2017.03.022 47. Jonas JB, Bikbov MM, Wang YX, Jonas RA, Panda-Jonas S. Anatomic Peculiarities Associated with Axial Elongation of the Myopic Eye. J Clin Med. 2023;12(4):1317. doi:10.3390/jcm12041317 48. Salbreux G, Barthel LK, Raymond PA, Lubensky DK. Coupling mechanical deformations and planar cell polarity to create regular patterns in the zebrafish retina. PLoS Comput Biol. 2012;8(8):e1002618. doi:10.1371/journal.pcbi.1002618 49. Che D, Lv L, Cao Y, et al. Lipid profile in the aqueous humor of patients with myopia. Exp Eye Res. 2024;247:110023. doi:10.1016/j.exer.2024.110023 50. Pan S, Yuan J, Jin Y, et al. Innate immune responsive inflammation in development of progressive myopia. Eye Lond Engl. 2024;38(8):1542-1548. doi:10.1038/s41433-024-02947-z 51. Cabezas F, Farfán P, Marzolo MP. Participation of the SMAD2/3 signalling pathway (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted March 10, 2025. ; https://doi.org/10.1101/2025.03.04.641381doi: bioRxiv preprint 38 in the down regulation of megalin/LRP2 by transforming growth factor beta (TGF-ß1). PloS One. 2019;14(5):e0213127. doi:10.1371/journal.pone.0213127 52. Liu W, Yu WR, Carling T, et al. Regulation of gp330/megalin expression by vitamins A and D. Eur J Clin Invest. 1998;28(2):100-107. doi:10.1046/j.1365-2362.1998.00253.x 53. Cabezas F, Lagos J, Céspedes C, Vio CP, Bronfman M, Marzolo MP. Megalin/LRP2 expression is induced by peroxisome proliferator-activated receptor -alpha and -gamma: implications for PPARs’ roles in renal function. PloS One. 2011;6(2):e16794. doi:10.1371/journal.pone.0016794 54. Provencio I, Jiang G, De Grip WJ, Hayes WP, Rollag MD. Melanopsin: An opsin in melanophores, brain, and eye. Proc Natl Acad Sci U S A. 1998;95(1):340-345. doi:10.1073/pnas.95.1.340 55. Peirson SN, Bovee-Geurts PHM, Lupi D, Jeffery G, DeGrip WJ, Foster RG. Expression of the candidate circadian photopigment melanopsin (Opn4) in the mouse retinal pigment epithelium. Brain Res Mol Brain Res. 2004;123(1-2):132-135. doi:10.1016/j.molbrainres.2004.01.007 56. Tarttelin EE, Bellingham J, Hankins MW, Foster RG, Lucas RJ. Neuropsin (Opn5): a novel opsin identified in mammalian neural tissue. FEBS Lett. 2003;554(3):410-416. doi:10.1016/s0014-5793(03)01212-2 57. Cook JD, Ng SY, Lloyd M, et al. Peropsin modulates transit of vitamin A from retina to retinal pigment epithelium. J Biol Chem. 2017;292(52):21407-21416. doi:10.1074/jbc.M117.812701 58. He M, Xiang F, Zeng Y, et al. Effect of Time Spent Outdoors at School on the Development of Myopia Among Children in China: A Randomized Clinical Trial. JAMA. 2015;314(11):1142-1148. doi:10.1001/jama.2015.10803 59. Jiang Y, Zhu Z, Tan X, et al. Effect of Repeated Low-Level Red-Light Therapy for Myopia Control in Children: A Multicenter Randomized Controlled Trial. Ophthalmology. 2022;129(5):509-519. doi:10.1016/j.ophtha.2021.11.023 60. Chou T, Huang X, Liu J, et al. First Evidence Indicates the Physiology- and Axial- Myopia-Dependent Profiles of Steroid Hormones in Aqueous Humor. Metabolites. 2022;12(12):1220. doi:10.3390/metabo12121220 61. Ding M, Guo D, Wu J, et al. Effects of glucocorticoid on the eye development in guinea pigs. Steroids. 2018;139:1-9. doi:10.1016/j.steroids.2018.09.008 62. Cehofski LJ, Kojima K, Terao N, et al. Aqueous Fibronectin Correlates With Severity of Macular Edema and Visual Acuity in Patients With Branch Retinal Vein Occlusion: A Proteome Study. Invest Ophthalmol Vis Sci. 2020;61(14):6. doi:10.1167/iovs.61.14.6 Author Contributions: KD, AT, OC and FBC: study conception and design - writing original draft. KD, E Picard, PL, LJ and E Pussard: performing experiments. RK: providing Lrp2 -cKo. JMRM and JRM: providing vitreous samples. KK collected vitreou s samples for mass spectrometry and contributed to the analysis of proteomics data. HV , BH, and LJC performed mass spectrometry and data analysis of the proteomics data. All authors contributed to review and editing of the article and approved the submitted version. (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted March 10, 2025. ; https://doi.org/10.1101/2025.03.04.641381doi: bioRxiv preprint 39 Funding: This study was supported by Fondation de France (KD) and GIF-NC Région Nomandie (RK). Institutional review Board Statement: At Kyoto Prefectural University of Medicine , Japan, the study was conducted in compliance with the Institutional Review Board of Kyoto Prefectural University of Medicine which approved the study (permission RBMR-C-864-6). Informed written consent was obtained from all patients. At Ophtalmopole, Paris, France, vitreous samples are considered as surgical waste and can be used for research purposes if patients have expressed no opposition according to French law. Agreement was obtained for all patients. Storage and analysis w ere authorized in France by CPP Ile de France 1 (N°2016 -14390) and the use of patient’s information got the authorization number CNIL 2233436. At Hospital Puerta de Hierro, Albacete, Spain, vitreous samples are considered as surgical waste and can be used for research purposes if patients have expressed no opposition according to Spanish law. The study involving human iRPE cultures were reviewed and approved by CODECOH DC- INSERM. Importation of human eyes was approved by the French ministry of research (N° IE-2022-2285) Informed Consent Statement: Informed consent to participate in this study was obtained from all the participants. Conflict of interest: The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted March 10, 2025. ; https://doi.org/10.1101/2025.03.04.641381doi: bioRxiv preprint 40 Acknowledgments: We gratefully acknowledge the support of the Data Analysis Core (DAC) platform at the Institut du Cerveau de Paris in carrying out RNA sequencing. Special thanks also go to Emeline Cherchame for her invaluable help with RNAseq data analysis. The services p rovided by the DAC platform (https://dac.institutducerveau-icm.org) were crucial to the success of this study. The mass spectrometer used for the proteomics study was funded by A.P. Møller og Hustru Chastine Mc-Kinney Møllers Fond til almene Formaal. (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted March 10, 2025. ; https://doi.org/10.1101/2025.03.04.641381doi: bioRxiv preprint 41 Figure Captions Fig. 1 . Analysis of proteins in the vitreous of myopic and emmetropic patients. (A) V olcano plot of differentially expressed proteins. The rightmost part of the plot (blue circles) showed the 20 up-regulated proteins and the leftmost (red circles) the 53 down regulated proteins. (B) Monarch analysis enrichment of down regulated proteins , only the top 5 terms were displayed. Gene count associated with a particular Monarch term is indicated. (C) Protein- Protein Interactions (PPI) using STRING analysis displayed the signaling network between the differentially expressed proteins. Nodes in blue circles refer to upregulated proteins , nodes in grey circles refer to down regulated proteins. Markov cluster algorithm analysis indicated the main interactomes. The nine top interactomes are indicated at the right. Protein names are provided in Table 1. (D) Concentrations of LRP2 protein in ng/ml in undiluted vitreous from control (n = 13) and NSHM myopic (n = 10) eyes quantified with ELISA. The graph on the right showed the ration of LRP2 compared to the total protein content. Statistical analysis was performed using the Mann-Whitney test, *p<0.05. Fig. 2. Ophthalmologic imaging and histological analysis of the right eye of a HM donor. (A-B) Pre mortem SD-OCT scans of the right eye with inferior cross -section (A) and macular cross-section (B), showing the PS (white arrows) and tractional maculopathy (yellow stars). The myopic eye displayed an atrophy of the macula delineated by small arrows and the posterior incurvation indicated the uncomplicated PS. (C) Gross morphology of a the high myopic right enucleated post mortem eye with a posterior staphyloma (PS). ( D) Macroscopic image of the posterior chamber after dissection showing the posterior staphyloma (ps). (E) Insert box of (D) focusing on fovea and ps (black arrow). (F) DAPI-stained section of a normal human retina near the macula. (G) DAPI-stained section of the high myopic retina with a PS (double headed arrow) shows a severe reduction of thickness of all retinal layers, adjacent to the PS. Schisis (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted March 10, 2025. ; https://doi.org/10.1101/2025.03.04.641381doi: bioRxiv preprint 42 (white arrow) is observed between the inner nuclear layer (inl) and the outer nuclear layer (onl). A cyst is observed between the RPE and the outer segments layer (asterisk). bv: blood vessel. (H) RPE cells in human retina form a single layer of pigmented cells as observed on light transmission microscopy. Melanosomes (m) have an elongated shape and nuclei (n) are spaced at regular intervals. (I, J) In the HM donor eye, RPE cells are still forming a single layer. RPE cells are abnormally large, their apical domain is reduced, and melanosomes aggregate in macromelanosomes (mm) or macrostructures (ag). Scale bars: F,G = 120 m; H = 75 m; H-J = 5 m. Fig 3. Immunolabelling of retinal cells in the emmetropic and HM retina. (A, B) Glutamine synthetase (GS) labels Müller glial cells in the emmetropic retina, extending radially from the nerve fiber layer (nfl) to the onl (C, D) In HM retina, GS-positive cells extend in all directions and thicken at the retinal surface. At higher magnification, GS -positive cells surround a cyst in the ganglion cell layer (gcl) (C) and fill the bottom of the staphyloma where almost no retina remains (E). (F, G) Tubulin beta-3 (Tubb3) is a neuronal marker of retinal ganglion (RGC) and amacrine cells in the emmetropic retina. (H) In HM retina, the number of Tubb3-amacrine cells and RGCs is reduced. Higher magnification shows Tubb3-positive axons browsing at the surface of the staphyloma. (J, K) Blue (red staining) and green (green staining) opsin markers reveal the distribution of blue and green cones in the emmetropic retina. (L, M) In HM retina, the number of blue cones is reduced ( L) and high magnification shows the accumulation of green opsin in abnormally shaped outer segments. (N, O) Glial fibrillary acidic protein (GFAP) labels astrocytes and glial Müller cells endfeet in the emmetropic retina. (P, Q) In the HM retina, the GFAP-positive endfeet are reduced. (Q) At higher magnification, a GFAP- positive membrane lays on the retinal surface but no positive cells are observed in the retina . Scale bars: A,F,J,N = 200 m; B,G,O = 80 m; K = 20 m; C,H,L,P = 250 m; D,E,I,M,Q = 60 m. (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted March 10, 2025. ; https://doi.org/10.1101/2025.03.04.641381doi: bioRxiv preprint 43 Fig. 4. LRP2 immunolabelling in the emmetropic and HM retina. (A,B) In the emmetropic neural retina, LRP2 is expressed around RGCs and along GS positive glial Müller cells. (C, D) In the HM neural retina, LRP2 expression is greatly reduced in GS - positive cells, that surround cysts (stars). (E) In transversal sections of RPE cells, LRP2 is located at the apical pole (white arrowheads), in intracellular vesicles and at the basal pole of the RPE, and in the pillars of the choriocapillaris. (F, G) In RPE flat mounted preparation from the left emmetropic eye, LRP2 is distributed in cytoplasmic vesicles (F) along apical and lateral membranes (G) and most LRP2-positive vesicles are also positive for clathrin. (I) In transversal section of the HM RPE, LRP2 expression is greatly diminished and absent in the choriocapillaris. (J to L) In RPE flat mounted from the HM eye , LRP2 distribution is sparse and diffuse, and does not colocalize with clathrin ( L) that is also diminished. Scale bars: A-D 200 m; G-I, K,L 50 m. Fig 5. Organization of the RPE is altered in HM eye and in Lrp2cKO mouse. (A) Phalloidin staining reveals the geometric paving pattern of RPE in the emmetropic eye. (B to D ) In HM eye, RPE geometric paving pattern is lost as most cells increase in size. Bicellular junctions display secondary actin arcs (C, arrows) and cell junctions are disorganized (D arrows). ( E, F ) Phalloidin staining on RPE flat -mount of WT control mouse shows the regular pattern of RPE cells. ( G) Zonula Occludens 1 (ZO1) follows in the apical pole the distribution of phalloidin. (H, I) In Lrp2cKO RPE, the pseudo-geometric paving pattern is lost and is replaced by a tangle of cells whose surface has increased. (J) ZO1 is redistributed in the cytoplasm of abnormally shaped RPE cell. ( K) Digital overlay reconstruction of control and, Lrp2cKO RPE indicates the increase size of RPE cells both at the periphery and at the intermediate level of the retina in Lrp2cKO. ( L) Cell area in m2, (M) cell density in number of cells/mm2, and (N) distribution of cells by sizes in the intermediate and peripheral retina of (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted March 10, 2025. ; https://doi.org/10.1101/2025.03.04.641381doi: bioRxiv preprint 44 control compared to Lrp2cKO mice. Values represent the mean of cell size average of each sample (n=7) per genotype ± SEM. Mann-Whitney U test. *** p <0.001. Scale bars: A-D,E,H = 50 m; F,I = 25 m; G,J = 75 m. Fig. 6. LRP2 localization in healthy human iRPE. (A) Consecutives confocal images from an apical to basal stack showing LRP2 accumulation in large vesicular structures in the apical pole (arrows), faintl localization at lateral membranes and in small cytoplasmic vesicles and in larger perinuclear vesicles (arrowheads). (B) Consecutives confocal images from an apical to basal stack show that LRP2 colocalized with the major protein of coated pits and apical endocytic vesicles, clathrin (yellow arrow). In the basal part of the cell, LRP2 (green arrow) did not colocalize with clathrin (red arrow). (C) Confocal image showing that LRP2 (green) partially colocalized with the endocytic marker, early endocytose antigen-1 (EEA1; red) (yellow arrow). (D) In the basal compartment, LRP2 (green) colocalize with LAMP1 (red) a specific lysosomal marker (yellow arrows). Scale bars: A,C,D = 10 m; B = m; C = 30 m. Fig. 7. Differentially expressed genes (DEGs) between shLRP2 and scrambled iRPE cells. (A) Lrp2 mRNA quantification between scrambled (n = 4) and shLRP2 (n = 4) iRPE (*p<0.05). (B) LRP2 levels as expressed by the ratio LRP2/GAPDH between scrambled (n = 4) and shLRP2 (n = 4) iRPE (**p<0.01). (C) V olcano plot of DEGs between shLRP2 and scrambled iRPE cells with –Log10 of the adjusted p value on the Y -axis and Log2 of the fold change expression on the X-axis. Some genes including LRP2 are indicated. (D) Graph bars show the number of downregulated (75), upregulated (42) and unchanged (15678) genes (E). The top 30 most enriched GO terms (selected based on the p-values) of regulated genes . Analysis was performed using Metascape.Category netplot gene enrichment analysis considering only LRP2 as a common factor with 3 GO terms, sensory perception, import across plasma membrane and steroid metabolic processes ( F) and with 2 Reactome terms, sensory perception, visual (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted March 10, 2025. ; https://doi.org/10.1101/2025.03.04.641381doi: bioRxiv preprint 45 transduction and metabolism (G). Fold change (color codes on each graph) for each gene of the selected GO term is indicated. Analysis was performed using Metascape. Absolute normalized enrichment allowed to identify terms that were upregulated or downregulated using all differentially expressed genes. Fig. 8. LRP2 expression and environmental factors . (A) Quantification of LRP2 mRNA by Q-PCR in iRPE non -exposed (ne) or exposed to light (left panel) after 0.5, 2 or 10 hrs post illumination. Left panel showing quantification of LRP2 mRNA in iRPE non-exposed (ne) or exposed to light. Right panel showing quantification of LRP2 mRNA in iRPE non-exposed (ne) or exposed to red, blue, or white light. Values correspond to the mean of 4 independent experiments in duplicates for each condition. Each independent experiment represents the mean of three wells. Datas were expressed in fold gene expression ± SD. Data were analyzed using the non-parametric Kruskal Wallis test and Mann Witney post -test, *p<0.05; **p<0.01, # not significant. (B) LRP2 and EEA1 expressions in iRPE non-exposed or exposed to red light. (C) LRP2 mRNA expression in iRPE cultures treated without (ethanol) or cortisol. Values correspond to the mean of 6 experiments in triplicates. Datas represent mean fold gene expression ± SEM. Mann-Whitney test, *p<0.05. Scale bars: 20 m for LRP2 and 40 m for EAA1. (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted March 10, 2025. ; https://doi.org/10.1101/2025.03.04.641381doi: bioRxiv preprint 46 Figure 1 (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted March 10, 2025. ; https://doi.org/10.1101/2025.03.04.641381doi: bioRxiv preprint 47 Figure 2 (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted March 10, 2025. ; https://doi.org/10.1101/2025.03.04.641381doi: bioRxiv preprint 48 Emmetropic eye High Myopic eye Figure 3 (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted March 10, 2025. ; https://doi.org/10.1101/2025.03.04.641381doi: bioRxiv preprint 49 Figure 4 Emmetropic eye Emmetropic eye High myopic eye High myopic eye A B C D (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted March 10, 2025. ; https://doi.org/10.1101/2025.03.04.641381doi: bioRxiv preprint 50 Figure 5 HUMAN Emmetropic eye High myopic eye Intermediate . peripheral (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted March 10, 2025. ; https://doi.org/10.1101/2025.03.04.641381doi: bioRxiv preprint 51 Figure 6 (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted March 10, 2025. ; https://doi.org/10.1101/2025.03.04.641381doi: bioRxiv preprint 52 (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted March 10, 2025. ; https://doi.org/10.1101/2025.03.04.641381doi: bioRxiv preprint 53 Figure 8 (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted March 10, 2025. ; https://doi.org/10.1101/2025.03.04.641381doi: bioRxiv preprint Supplementary Materials LRP2 is a potential molecular target for pathological myopia Kimberley Delaunay1, Emilie Picard 1, Patricia Lassiaz 1, Laurent Jonet 1, Vidjea Cannaya 1, José Maria Ruiz Moreno 2, Kentaro Kojima 3, Henrick Vorum 4,5, Bent Honoré 5,6, Jorge R Medrano2, Lasse Jorgensen Cehofski 4,5, Eric Pussard7, Renata Kozyraki#8, Alicia Torriglia #1, Olivier Cases 1#, Francine Behar-Cohen#1,9. Supplementary Material and methods 5 Supplementary Figures Figure S1: GO analysis of DEPs Figure S2: The most significant cluster obtained from the PPI and its disease enrichment Figure S3: Principal component analysis. Figure S4: KEEG, Gene Ontology, Reactome and Human Phenotype Ontology based gene enrichments. Figure S5: Category net plot enrichment analysis. 4 Supplementary Data Files in attached Excel Format files Data File S1: filtered results of the LC/MS MS Data File S2: List of DEGs Data File S3: Enrichment-p adjust Data File S4: Enrichment LRP2-p adjust (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted March 10, 2025. ; https://doi.org/10.1101/2025.03.04.641381doi: bioRxiv preprint

Quantitative Mass Spectrometry by Label -Free Quantification Nano Liquid Chromatography – Tandem Mass Spectrometry (LFQ nLC-MS/MS) Samples were resuspended in 0.1% formic acid and analyzed with LFQ nLC -MS/MS. Of each sample, 0.7 to 1.0 µg was analyzed in triplicates. Mass spectrometry was performed on an Orbitrap Fusion Tribrid mass spectrometer (Thermo Fisher Scientific Instruments, Waltham, MA, USA) coupled to a Dionex UltiMate 3000 RSLC nano system (Thermo Fisher Scientific Instruments, Waltham, MA, USA). The mass spectrometer was equipped with an EasySpray ion source (Thermo Fisher Scientific Instruments). Liquid chromatography and label-free quantification (LFQ) were performed as described in a recent article (1) with few modifications. The orbitrap scan range (m/z) was 375 to 1500. The elution gradient was 3h, established by mixing buffer A (99.9% water and 0.1% formic acid) and buffer B (99.9% acetonitrile and 1% formic acid). Using the MaxQuant software version 1.6.6.0 (Max Planck Institute of Biochemistry, Martinsried, Germany; https://maxquant.net/maxquant/) for LFQ analysis (2), raw data files were searched against the UniProt Homo sapiens database (www.uniprot.org). Settings for the database search were published in a previous work (1). Unfiltered results of the database search are available in Supplementary File S1. Mass spectrometry data were further processed with Perseus software version 1.6.2.3 (Max Planck Institute of Biochemistry, Martinsried, Germany; https://maxquant.net/perseus/) to remove poorly identified proteins as described in a previous article (3, 4). LFQ values were log2 transformed, and mean LFQ values were calculated. At least two unique peptides were required for successful (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted March 10, 2025. ; https://doi.org/10.1101/2025.03.04.641381doi: bioRxiv preprint protein identification. Proteins were required to be successfully identified and quantified in at least 50% of the samples in each group. The median technical coefficient of variation was calculated for each of the proteins in each sample. The mean value for the samples was 11.3% (range, 6.49%– 16.1%). Statistics Statistical analysis was performed on proteins that were successfully identified and quantified in at least 50% of the samples in the HM group and 50% of the samples in the control group. No imputation of missing values was performed prior to statistical analysis. Statistical analysis by the Student's t-test was conducted in Perseus to compare HM with controls. Correction for multiple hypothesis testing was performed using the permutation -based method (5) in Perseus with the number of randomizations set to 250 and an S0 parameter of 0.1. The false discovery rate was set to 0.05. CRT values were log10 transformed prior to calculation of correlations to make the CRT values normally distributed. Correlations were calculated in STATA 16.0 (StataCorp, College Station, TX, USA) using Pearson's correlation coefficient (r). Correlations were considered statistically significant if P <0.05. Two-way scatter plots with prediction from a linear regression were created with STATA 16.0. Bioinformatic analysis of statistically significantly changed proteins was performed with STRING 11.0. Cluster analysis of statistically significantly regulated proteins was performed with STRING 11.0 (string-db.org) (6–8). If more than one protein was listed in the IDs, the first listed UniProt ID was used for STRING analysis. If an isoform was not recognized by STRING, the regular UniProt ID without isoform was used. Cluster analysis was performed with the Markov Cluster Algorithm set to 2. (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted March 10, 2025. ; https://doi.org/10.1101/2025.03.04.641381doi: bioRxiv preprint iRPE cell culture and differentiation Subconfluent hiPSC cultured on Matrigel® hESC -Qualified Matrix (Corning, France) with mTeSR™1 medium (Stemcell Technologies, Germany) were detached with Collagenase, Type IV (Thermo Fisher Scientific). hiPSC colonies within 50-300 µm diameter range were transferred and cultured into flasks of 25 cm² with Embryoid Body Medium (DMEM/F-12, HEPES medium; 1% N-2; 1% B -27™; 1% L -Glutamine; 0.1 mM 2 -Mercaptoethanol; 5 μM RHO/ROCK pathway inhibitor Y-27632 (Stemcell Technologies)), to form three-dimensional embryoid body-like (EB) aggregates. On day 1, EB were plated on cell culture dishes (P60) coated with Matrigel® Mat rix Basement Membrane Growth Factor Reduced (Corning) and cultured for 10 days in neural induction medium (NIM) (DMEM/F-12, HEPES medium; 1% N -2; 1% L-Glutamine; 1% MEM Non-Essential Amino Acids Solution; Heparin (Merck Millipore)). On day 10, NIM was replaced and Ebs were cultured during three days in Retinal Differentiation Medium (RDM) (DMEM-high glucose-GlutaMAX™; HEPES medium /Ham's F-12 Nutrient Mix medium [3:1]; 2% B-27™ with vitamin A (all products from Thermo Fisher Scientific). On day 13, Ebs were cultured in RDM. When satisfactory level of pigmentation was reached (by day 30 -40), iRPE pigmented foci were manually microdissected under a microscope using a surgical blade, collected, seeded on Matrigel® Matrix Basement Membranec and grown for an additional 30 days in RDM until deeply pigmented monolayers re -formed. On day 60 -70, mature iRPE cells were resuspended in RDM containing 5 μM of RHO/ROCK pathway inhibitor Y -27632 and then reseeded on Matrigel® Matrix Basement Growth Factor Reduced coated 24 -well plates for further expansion and (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted March 10, 2025. ; https://doi.org/10.1101/2025.03.04.641381doi: bioRxiv preprint maturation. At this stage, iRPE cells were at passage 1 (P1) and cultured in the serum - and antibiotic-free RDM. Trans-Epithelial Resistance The trans -epithelial resistance (in Ω/cm 2) was measured using the EVOM2 Epithelial Voltohmmeter and an STX2 electrode (World Precision Instruments, Sarasota, Florida). Each value corresponds to the average of several independent wells and was corrected for background resistance using a blank well with culture medium. Quantitative RT-qPCR The following target genes were analyzed: LRP2 sense 5'-GCCGATGCATTTATCAAAAC- 3'antisense 5'-TCACATCCATCTATCTCC-3', MR sense 5′-GGCTACCACAGTCTCCGA-3′, antisense 5'-ACGTTGACAATCTCCATGTAG -3', GR sense 5' - GGAATAGGTGCCAAGGATCTGG-3', antisense 5'-GCTTACATCTGGTCATGCTGG-3'. Expression levels of individual genes were normalized with hprt1 sense 5'- CATTGCTGAGGATTTGGAAAGG -3', antisense 5′-CTTGAGCACACAGGGCTACA-3' or 18S sense 5′-TGCAATTCCATGAACG-3', antisense 5′-GCTTATGACCCGCACTTACTGG-3', in the same sample by calculation of the ΔCt value, and relative quantification was performed using the ΔΔCt method with unilluminated iRPEs serving as controls. Western Blot Cells from 6 wells (N=6) of iRPE were lysed in RIPA extraction buffer (50 mM Tris HCl pH 8 ; 150 mM NaCl; 1% NP -40; 0.5% sodium deoxycholate; 0.1% sodium dodecyl sulfate) (Thermo Fisher Scientific) for the extraction of membrane, nuclear, and cytoplasmic proteins in the presence (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted March 10, 2025. ; https://doi.org/10.1101/2025.03.04.641381doi: bioRxiv preprint of protease inhibitors. Protein concentration was measured using the bicinchoninic acid (BCA)

(Pierce BCA Protein Assay Kit, Thermo Fisher Scientific) following the manufacturer's instructions. Equal amounts of reduced proteins (15 μg) were separate d on a 2-8% TRIS-acetate gel (Invitrogen) for large protein separation. Proteins were separated according to their size under an electric current of 100 volts for 1 hour and 30 minutes, and then transferred to a nitrocellulose membrane (Protan®, Whatman®, GE Healthcare, Versailles, France) for 1 hour and 20 minutes at 10 volts under liquid conditions. The transfer quality was systematically checked using Ponceau S staining. Membranes were incubated in a blocking buffer composed of 1X PBS and 5% milk for 1 hour with agitation. The primary antibodies rabbit anti -LRP2 (1:1000, Abcam, ab76969), was diluted in the working buffer (1X PBS - 0.5% milk - 0.1% Tween-20) and applied to the membrane, then incubated overnight at 4°C with agitation. After washing, the membranes were incubated with HRP-conjugated secondary antibody goat anti-rabbit, 1:5000, Vector Ref. PI-1000, London, UK) diluted in the same working buffer for 1 hour at room temperature. ECL Plus Western Blotting Detection Reagents (GE Healthcare, Orsay, F rance) were used for visualization. Mouse anti - GAPDH antibody (1:5000, Invitrogen Ref. AM4300) was used as an internal control. Bands were visualized using iBright Imaging Systems (Thermo Fisher Scientific, France) and quantified using ImageJ software (Nat ional Institutes of Health, University of Wisconsin, WI, USA). Statistical

were obtained using the non -parametric Mann -Whitney test (*p<0.05, **p<0.01, ***p<0.001) to evaluate significant differences. Statistical analysis was performed using GraphPad Prism 8 software (GraphPad Software, San Diego, CA). (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted March 10, 2025. ; https://doi.org/10.1101/2025.03.04.641381doi: bioRxiv preprint Fig. S1: GO analysis of the DEPs. (A) GO analysis of the down regulated proteins; ( B) GO analysis of up regulated proteins. According to the order of FDR, only the top 5 terms were displayed. Gene count associated to a particular GO is indicated. (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted March 10, 2025. ; https://doi.org/10.1101/2025.03.04.641381doi: bioRxiv preprint Fig. S2: (A) The most significant cluster was obtained from PPI network . LRP2 and its ligands CLU and APOE were enriched as hub proteins in this cluster. ( B) Disease -gene associations enrichment indicated an enrichment in neurodegenerative diseases. (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted March 10, 2025. ; https://doi.org/10.1101/2025.03.04.641381doi: bioRxiv preprint Fig. S3: Principal component (PC) analysis, X-axis, Y-axis, and Z-axis show PC1, PC2 and PC3, respectively. (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted March 10, 2025. ; https://doi.org/10.1101/2025.03.04.641381doi: bioRxiv preprint Fig. S4: (A) The top 6 most enriched KEGG of downregulated DEGs and upregulated DEGs. ( B to D) The top 30 most enriched GO terms (selected based on the p -values), (B) GO biological processes, (C) GO cellular processes, ( D) GO molecular functions, ( E) reactome and (F) human phenotype ontology. The terms were selected based on the lowest LogP values (color codes on each graph). Analysis was performed using metascape. Absolute normalized enrichment allowed to identify terms that were upregulated or downregulated using all DEGs. (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted March 10, 2025. ; https://doi.org/10.1101/2025.03.04.641381doi: bioRxiv preprint Fig. S5: Category netplot enrichment analysis with (A) the top 2 most enriched GO terms (selected based on the p-values) of down-regulated DEGs and (B) the top 2 most enriched Hallmark of up- regulated DEGs. Analysis was performed using metascape. (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted March 10, 2025. ; https://doi.org/10.1101/2025.03.04.641381doi: bioRxiv preprint

1. C. Christakopoulos, L. J. Cehofski, S. R. Christensen, H. Vorum, B. Honoré, Proteomics reveals a set of highly enriched proteins in epiretinal membrane compared with inner limiting membrane. Exp. Eye Res. 186, 107722 (2019). 2. S. Tyanova, T. Temu, J. Cox, The MaxQuant computational platform for mass spectrometry- based shotgun proteomics. Nat. Protoc. 11, 2301–2319 (2016). 3. L. J. Cehofski, A. Kruse, S. Kirkeby, A. N. Alsing, J. Ellegaard Nielsen, K. Kojima, B. Honoré, H. Vorum, IL-18 and S100A12 Are Upregulated in Experimental Central Retinal Vein Occlusion. Int. J. Mol. Sci. 19, 3328 (2018). 4. L. J. Cehofski, A. Kruse, B. Kjærgaard, A. Stensballe, B. Honoré, H. Vorum, Proteins involved in focal adhesion signaling pathways are differentially regulated in experimental branch retinal vein occlusion. Exp. Eye Res. 138, 87–95 (2015). 5. V. G. Tusher, R. Tibshirani, G. Chu, Significance analysis of microarrays applied to the ionizing radiation response. Proc. Natl. Acad. Sci. U. S. A. 98, 5116–5121 (2001). 6. D. Szklarczyk, J. H. Morris, H. Cook, M. Kuhn, S. Wyder, M. Simonovic, A. Santos, N. T. Doncheva, A. Roth, P. Bork, L. J. Jensen, C. von Mering, The STRING database in 2017: quality-controlled protein-protein association networks, made broadly accessible. Nucleic Acids Res. 45, D362–D368 (2017). 7. D. Szklarczyk, A. Franceschini, S. Wyder, K. Forslund, D. Heller, J. Huerta-Cepas, M. Simonovic, A. Roth, A. Santos, K. P. Tsafou, M. Kuhn, P. Bork, L. J. Jensen, C. von Mering, STRING v10: protein-protein interaction networks, integrated over the tree of life. Nucleic Acids Res. 43, D447-452 (2015). 8. D. Szklarczyk, A. L. Gable, D. Lyon, A. Junge, S. Wyder, J. Huerta-Cepas, M. Simonovic, N. T. Doncheva, J. H. Morris, P. Bork, L. J. Jensen, C. von Mering, STRING v11: protein-protein association networks with increased coverage, supporting functional discovery in genome-wide experimental datasets. Nucleic Acids Res. 47, D607–D613 (2019). (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted March 10, 2025. ; https://doi.org/10.1101/2025.03.04.641381doi: bioRxiv preprint