Targeting AKAP13 RhoGEF activity ameliorates pro-fibrotic phenotypes driven by the IPF associated AKAP13 risk variant

31 Rationale: Idiopathic pulmonary fibrosis (IPF) is a progressive, incurable scarring disease of 32 the lung. A common genetic variant near AKAP13 , a multifunctional scaffold protein that 33 integrates intracellular signalling through its interactions with RhoA and protein kinase A 34 (PKA), has been associated with IPF susceptibility and elevated AKAP13 mRNA expression in 35 lung tissue from patients. How ever, its contribution to the pathogenesis of IPF remains 36 unclear. 37

This study investigates how an AKAP13 variant alters epithelial signalling and 38 evaluates the therapeutic potential of targeting AKAP13. 39 Findings: rs62025270-bearing iHBECs exhibited selective upregulation of AKAP13 isoforms , 40 accompanied by increased cell adhesion and reduced proliferation. Transcriptomic profiling 41 revealed upregulated fibrosis -related genes in rs62025270-bearing iHBECs, including SAA1, 42 FGF2, MMP1, CTSB, COL4A1, and CDKN1A. rs62025270-bearing iHBECs also displayed 43 increased RhoA activation and SMAD2 phosphorylation following L PA stimulation. 44 Furthermore, cells harbouring the AKAP13 variant showed reduced intracellular cAMP levels. 45 Pharmacological inhibition of AKAP13 with A13 reversed the pro -adhesive phenotype and 46 reduced RhoA activation in iHBECs. Moreover, in IPF-derived PCLS, A13 suppressed SERPINE1, 47 CCN2, and MMP7 expression, reduced SMAD2 nuclear translocation, and decreased 48 hydroxyproline levels. 49

Presence of an AKAP13 variant disrupts epithelial homeostasis and promotes 50 pro-fibrotic signalling. Inhibition of AKAP13's RhoGEF domain with A13 restores epithelial 51 function and attenuates fibrotic activation, supporting AKAP13 as a therapeutic target in IPF. 52 preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for thisthis version posted January 23, 2026. ; https://doi.org/10.64898/2026.01.21.700846doi: bioRxiv preprint 4

53 Idiopathic pulmonary fibrosis (IPF) is a progressive and fatal interstitial lung disease 54 characterised by chronic epithelial injury in a genetically susceptible individual , leading to 55 excessive extracellular matrix (ECM) deposition, and irreversible lung scarring(1-3). IPF has a 56 poor prognosis, with a median survival of only 3–5 years post-diagnosis(4). Current available 57 antifibrotic therapies offer only limited benefit in slowing disease progression, leaving a 58 critical unmet need for more effective treatments. 59 Recent genome-wide association studies (GWAS) have identified 35 signals associated with 60 increased IPF susceptibility, implicating a wide range of potential molecular pathways ; 61 however, the functional consequence of most of these variants remain unknown(5) . We have 62 previously reported that the common variant, rs62025270 is associated with increased risk of 63 IPF(6). This variant lies proximal to the gene encoding A-kinase anchoring protein 13 (AKAP13), 64 and associated with increased expression of the AKAP13 in lung tissue. Consistently, patients 65 with IPF ha ve evidence of increased AKAP13 mRNA and protein expression in th e fibrotic 66 lung(6). 67 AKAP13 is a multifunctional scaffold protein that integrates cyclic AMP –dependent protein 68 kinase A (PKA) signalling with RhoA activation through its guanine nucleotide exchange factor 69 (RhoGEF) domain (7). AKAP13 (AKAP -Lbc) has been shown to coordinate GPCR -induced 70 signalling in cardiac fibrosis (8-10), where it serves as a RhoGEF and PKA -anchoring scaffold 71 downstream of receptors such as AT1R. AKAP13 suppression markedly attenuates 72 Angiotensin II–induced RhoA activation, myofibroblast differentiation, collagen deposition, 73 and cell migration(8). RhoA is a small GTPase that governs a multitude of cellular processes 74 preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for thisthis version posted January 23, 2026. ; https://doi.org/10.64898/2026.01.21.700846doi: bioRxiv preprint 5 including actin cytoskeleton dynamics, focal adhesion formation, and cellular contractility(11, 75 12). In the lung, aberrant RhoA activation promotes fibrosis through avb6 integrin mediated 76 TGFβ activation(13, 14) , epithelial cell apoptosis (15), fibroblast activation (16), and 77 mechanical stiffening of the matrix (17). Conversely, cyclic AMP (cAMP) acts as a critical 78 antifibrotic signal, primarily through activation of PKA, which suppresses RhoA activity and 79 attenuates TGFβ -mediated pro -fibrotic signalling(18). A balance between cAMP/PKA and 80 RhoA pathways is, therefore, essential for maintaining alveolar homeostasis and preventing 81 fibrogenesis. 82 In this study, we investigate d the functional consequences of aberrant expression of the 83 AKAP13 rs62025270 variant in IPF pathogenesis. Using CRISPR -Cas9–engineered human 84 bronchial epithelial cells (iHBECs) carrying the rs62025270 variant, alongside isoform 85 overexpression models and pharmacological inhibition of AKAP13’s RhoGEF activity, we 86 examined how variant -induced AKAP13 dysfunction alters epithelial behaviour, fibrotic 87 signalling, and susceptibility to pro-fibrotic stimuli. Findings were further validated in human 88 IPF precision-cut lung slices (PCLS), evaluating the effect of AKAP13 inhibition on fibrotic gene 89 expression and TGFβ pathway activation. Together, our data reveal a novel mechanism by 90 which AKAP13 contributes to lung fibrosis and highlight its potential as a therapeutic target 91 in genetically predisposed individuals. 92 93 94 95 96 preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for thisthis version posted January 23, 2026. ; https://doi.org/10.64898/2026.01.21.700846doi: bioRxiv preprint 6

97 Cell culture 98 Immortalised human bronchial epithelial cells (iHBEC) were cultured in Kera;nocyte serum -99 free medium (KSFM) supplemented with L-glutamine (Gibco), 250 ng/mL puromycin (Sigma), 100 25 μ g/mL Bovine Pituitary Extract (Gibco, #13028014), 0.2 ng/mL human recombinant 101 Epidermal Growth Factor (rEGF) (Gibco), and 25 μg/mL G418 (Life Technologies, Gibco) at 37°C 102 with 5% CO2 . For cell starva;on, the medium consisted of KSFM with added 250 ng/mL 103 puromycin, and 25 μg/mL G418. 104 CRISPR/Cas9 Precision Base Edi9ng 105 gRNA1 (GGAGACCTGGCTGAGCAGCCGTTTT) and gRNA2 (AGAAATGTCCTTTGAAGGCAGTTTT) 106 targe;ng the rs62025270 locus for knock -in of the IPF -associated minor allele (A) were 107 designed using Benchling (www.benchling.com). CRISPR/Cas9 constructs were generated with 108 the GeneArt® CRISPR Nuclease Vector OFP Reporter Kit (Life Technologies) according to the 109 manufacturer’s protocol. gRNAs were ligated into GeneArt® vectors, transformed into E. coli 110 One Shot® TOP10, selected on ampicillin agar, and cultured in ampicillin LB broth. Plasmid 111 DNA was purified (QIAprep Spin Miniprep Kit, Qiagen) and gRNA inser;on confirmed by 112 Sanger sequencing. 113 iHBECs were seeded at 2 × 10⁵ /well in 24-well and grown to 80% confluency before 114 transfec;on . For precision base edi;ng, CRISPR nuclease vector containing gRNA were co-115 transfected with 10 μM single -stranded oligonucleo;de (ssOligo) repair template using 116 Lipofectamine™ 3000 (Invitrogen). Cells were incubated with transfec;on mixtures for 24 h 117 before being sorted using OFP on a FACSAria III (BD Biosciences). Individual iHBECs were 118 preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for thisthis version posted January 23, 2026. ; https://doi.org/10.64898/2026.01.21.700846doi: bioRxiv preprint 7 seeded into 96-well plates, expanded through successive culture vessels, and genotypes were 119 confirmed using Sanger sequencing. 120 Plasmid transfec9on 121 Cells were seeded at 2 × 10⁵ cells/well and grown in 6-well plates to 80% confluency prior to 122 transfec;on. Plasmids encoding FLAG -tagged proto-Lbc, Δ-Lbc and pSR-neo empty vector 123 were delivered using Lipofectamine™ 3000 (Invitrogen) for 48-hour. Transfec;on efficiency 124 was confirmed at the protein level using immunobloxng as described below. 125 Western Blot 126 Cells were rinsed with ice -cold PBS before being lysed by scraping in buffer containing 127 100μL/mL Cell Lysis Buffer 10X (Cell Signalling), 100μL/mL cOmplete™ Mini Protease Inhibitor 128 (Sigma-Aldrich), 100 μL/mL phosSTOP ™ (Sigma-Aldrich), 20 μL/mL PMSF (Cambridge 129 Bioscience), 50 μL/mL phosphatase inhibitor cocktail (Cambridge Bioscience). Protein 130 concentra;on was determined using a bicinchoninic acid assay (Fisher Scien;fic). Cell lysates 131 (30-50 μg) were electrophoresed on Bolt™ 4–12% Bis-Tris gels (Invitrogen) and transferred to 132 polyvinylidene difluoride membranes using the iBlot ™ 2 Gel Transfer Device at 25V for 10 133 minutes (Invitrogen). Membranes were blocked in 5% milk/PBST for 1 h at room temperature, 134 then incubated overnight at 4 °C with primary an;bodies: p SMAD2 (0.15ug/ml,138D4, CELL 135 Signalling TECHNOLOGY ), SMAD2/3(1:1000, D7G7, CELL Signalling TECHNOLOGY ), and 136 AKAP13 ( 0.375ug/ml, HPA019773, Atlas an;body ). Azer PBST washes, membranes were 137 incubated with HRP-conjugated secondary an;bodies (5% milk/PBST) for 1 h and visualized by 138 chemiluminescence (SuperSignal West Femto, Thermo Scien;fic) using an Odyssey Fc Imager. 139 140 preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for thisthis version posted January 23, 2026. ; https://doi.org/10.64898/2026.01.21.700846doi: bioRxiv preprint 8 RNA Extrac9on and cDNA Synthesis 141 High-quality RNA was extracted from iHBECs using the NucleoSpin™ RNA Mini Kit (Macherey-142 Nagel, #12373368). Cells (2 × 10⁵ /well, 6-well plates) were seeded for RNA extrac;on. Azer 143 PBS wash, 350 μL RNA lysis buffer was added, lysates were collected, and RNA was purified 144 with on-column DNase diges;on per the manufacturer’s protocol. RNA was eluted in 30 μL 145 RNase-free water and quan;fied using a NanoDrop spectrophotometer (Thermo Scien;fic). 146 For cDNA synthesis, 500 ng of RNA was adjusted to 11 μL with nuclease-free water, mixed with 147 1 μL oligo(dT)₍₅₀₎ (Promega) and 1 μL 10 mM dNTPs, heated at 65 °C for 5 min, and chilled at 148 4 °C for 5 min. A master mix containing 1 μL DTT (100 mM), 1 μL SuperScript IV RT (Invitrogen), 149 1 μ L RNase inhibitor, and 4 μL 5× SSIV buffer was added (final volume: 20 μL). Reverse 150 transcrip;on was performed at 55 °C for 10 min, followed by enzyme inac;va;on at 80 °C for 151 10 min. cDNA was diluted 1:5 with nuclease-free water and stored at –20 °C. 152 nCounter® Fibrosis V2 gene profiling 153 RNA from iHBECs were used for gene expression profiling using nCounter® Fibrosis V2 panel 154 following the manufacturer protocol. Briefly, 50ng of RNA was hybridised at 65 °C with Fibrosis 155 V2 reporter CodeSet and Capture probeSet (BRUKER) for 24 hours before loading into 156 nCounter cartridge and profiled using nCounter SPRINT Profiler (BRUKER). RCC file obtained 157 were uploaded into ROSALIND cloud -based pla€orm for normalisa;on and downstream 158 analyses. 159 xCELLigence Real-Time Cell Analysis (RTCA) 160 Cell prolifera;on was monitored using the xCELLigence RTCA system (Agilent) with CIM-Plate 161 16. 50μL per well pre-warmed KSFM CM+ was added for background measurement. Cells were 162 preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for thisthis version posted January 23, 2026. ; https://doi.org/10.64898/2026.01.21.700846doi: bioRxiv preprint 9 then seeded at 1 × 10⁵ cells/mL (100 μL/well) and incubated at room temperature for 30 min 163 before placement into the device. Impedance readings were collected every 15 min for 40 h, 164 and cell adhesion and prolifera;on rates were calculated using RTCA Sozware 2.0. 165 Cell Viability Assay 166 Cell viability was assessed using the PrestoBlue ™ Cell Viability Reagent (Thermo Fisher 167 Scien;fic) according to the manufacturer’s instruc;ons. Briefly, cells were seeded in 96 -well 168 plates at a density of 1 × 10⁴ cells per well in 100 μL of complete growth medium and 169 incubated at 37 °C in a humidified atmosphere containing 5% CO₂ for 24 h to allow cell 170 a„achment. The culture medium was then replaced with 100 μL of the treatment solu;on or 171 complete medium for untreated controls, followed by incuba;on for 4 h under the same 172 condi;ons. Subsequently, 12 μL of PrestoBlue reagent was added directly to each well, and 173 the plates were incubated for an addi;onal 24 h at 37 °C. Absorbance was measured at 570 174 nm with a reference wavelength of 600 nm using a microplate reader. 175 Cytotoxicity Detec9on Assay 176 Cytotoxicity was evaluated using the lactate dehydrogenase (LDH) assay in accordance with 177 the manufacturer’s instruc;ons. Briefly, cells were seeded in 96-well plates at a density of 1 × 178 10⁴ cells/well in 100 μL of complete growth medium and incubated overnight at 37 °C in a 179 humidified 5% CO₂ atmosphere. The medium was then replaced with 100 μL of treatment 180 solu;ons. Cells were treated with 1% DMSO (vehicle control) or 1% Triton X -100 (posi;ve 181 control for maximum LDH release). 100 μL of culture supernatant from each well was 182 transferred to a new 96 -well plate, and 100 μL of reac;on mixture was added. Plates were 183 incubated at room temperature for 30 min protected from light. Absorbance was measured 184 at 490 nm. 185 preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for thisthis version posted January 23, 2026. ; https://doi.org/10.64898/2026.01.21.700846doi: bioRxiv preprint 10 Intracellular cAMP measurement 186 Cells were cultured for 48 hours in the presence of adenovirus vectors encoding an Epac1 187 cAMP sensor, which detects cAMP signalling globally in the cytosol. FRET imaging of epithelial 188 cells was carried out in a FRET buffer solu;on (144 mM NaCl, 10 mM HEPES, 1 mM MgCl2, 5 189 mM KCl) that was equilibrated to pH 7.4. Cyan fluorescence protein and yellow fluorescence 190 protein images were acquired using a digital camera a„ached to the Nikon Eclipse TE2000 -U 191 microscope. Cell loca;ons were saved and excited at 430nm wavelength with a 20 images per 192 minute acquisi;on rate through the Micromanager sozware. The Mul;FRET plugin was used 193 to mark each cell's ROI and background, enabling individual cell tracking of fluorescence signal 194 changes(19). Baseline signal was recorded for 300 seconds, then 50uM LPA in the fret buffer 195 was added to induce ac;va;on of cAMP signalling and recorded for the following 200 seconds. 196 Lastly, 1mL of 10 μM Forskolin and 100 μM 3-isobutyl-1-methylxanthine (IBMX) was added to 197 saturate and measure total cAMP produc;on by fully ac;va;ng adenyl cyclase and inhibi;ng 198 phosphodiesterase enzymes. 199 RhoA G-LISA Ac,va,on Assay 200 RhoA ac(vity was measured using the RhoA G -LISA Ac(va(on Assay Biochem Kit (Cytoskeleton) 201 following the manufacturer protocol. Briefly, iHBECs cultured at 2 × 10⁵ cells per well in 6-well plates 202 were serum-starved for 24 h, then treated with 50 μM lysophospha;dic acid (LPA, Merck) for 2 min. 203 Cells were washed with ice -cold PBS and lysed in 100 μL G -LISA lysis buffer supplemented with 204 protease inhibitors. Lysates were clarified at 10,000 × g for 1 min at 4 °C, protein quan(fied with 205 Precision Red and diluted to 0.5 mg/mL in lysis buffer. Lysate containing equal amount of protein was 206 mixed 1:1 with binding buffer in duplicate before adding to pre-hydrated assay wells and incubated at 207 4 °C for 30 min with shaking. Wells were rinsed then incubated with an( -RhoA primary an(body for 208 preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for thisthis version posted January 23, 2026. ; https://doi.org/10.64898/2026.01.21.700846doi: bioRxiv preprint 11 45 min, followed by HRP-conjugated secondary an(body for 45 min at 4 °C. Signal was developed with 209 HRP substrate for 10 min at 37 °C, and absorbance was read at 490 nm with plate reader (BioTek). 210 TMLC Luciferase Assay 211 Transformed Mink Lung Cells (giz from Dan Ri…in NYU) were seeded in 96-well plates at 1 × 212 10⁵ cells/mL (100 μL/well) and incubated at 37 °C, 5% CO₂ for 3 h to allow adherence. 213 Recombinant TGF-β1 (10 μ g/mL stock) was diluted to 250, 500, and 1000 pg/mL in growth 214 supplement–free DMEM to generate a standard curve. Azer adherence, medium was 215 replaced with 100 μL of condi;oned medium or TGF -β1 standards in triplicate. Plates were 216 incubated for 16 h, then washed with PBS, and 50 μL of reporter lysis buffer (Promega #E4030) 217 was added. Lysates were transferred to a white opaque plate, and 100 μL luciferase substrate 218 (Promega E1501) was injected using a Luminoskan ™ luminometer (Fisher Scien;fic 219 #15883537) to measure ac;vity. TGFβ ac;vity was calculated from the standard curve rela;ng 220 known TGFβ1 concentra;ons to luciferase output . 221 Human precision cut lung slice (hPCLS) genera9on 222 Fresh IPF lung ;ssue was obtained from the Clinical Research Facility Respiratory Biobank, 223 Royal Brompton Hospital, under ethical approval (NRES 20/SC/0142). To prevent agarose 224 leakage, samples were coated with sodium alginate (3% w/v; Sigma) and cross -linked with 225 calcium chloride (3% w/v; BDH Ltd.) to form a gel seal. Lungs were inflated with sterile 2% low-226 mel;ng -point agarose (Sigma) in 1× HBSS/HEPES buffer (Life Technologies) at 37 °C and chilled 227 on ice. Tissue cores (8 mm diameter) were prepared using a metal corer (Alabama Specialty 228 Products Inc.) and sec;oned at 400 μm thickness using a Compresstome VF-300 microtome. 229 Two hPCLS per well were cultured in 24-well plates with 0.5 mL of RPMI (Gibco) containing 1% 230 preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for thisthis version posted January 23, 2026. ; https://doi.org/10.64898/2026.01.21.700846doi: bioRxiv preprint 12 penicillin/streptomycin, 0.5% gentamycin, 1 μL/mL amphotericin-B, 25 μg/mL ascorbic acid 231 (Fujifilm), and non-essen;al amino acids (NEAA, Gibco). 232 Immunofluorescence Staining of hPCLS 233 hPCLS were paraffin-embedded and sec;oned at 3 μm thickness. Sec;ons were dewaxed in 234 Histoclear and rehydrated through graded ethanol. An;gen retrieval was performed in citrate 235 buffer (pH 6.0) for 2 min, followed by 40 min cooling to room temperature. Sec;ons were 236 blocked in 3% bovine serum albumin (BSA) in PBS for 1 h at room temperature and incubated 237 overnight at 4 °C with an; –phospho-Smad2 (0.15ug/ml,138D4, Cell Signalling Technology). 238 The following day, sec;ons were washed and incubated with Alexa Fluor 568 –conjugated 239 secondary an;body (Invitrogen) for 1 h at room temperature. Nuclei were counterstained with 240 DAPI (1 μg/mL, Roche) for 10 min and slides were washed thoroughly before moun;ng. 241 Images were acquired using a Zeiss Axio Observer widefield microscope with a 10× air 242 objec;ve and Zen 2 acquisi;on sozware. Nuclear masks were generated using the Cellpose3 243 algorithm (Python). Phospho -Smad2–posi;ve nuclei were defined as those with a nuclear 244 intensity/(nuclear + 8 μm perimeter) intensity ra;o >1, and percentages were calculated 245 accordingly. 246 RNA extrac9on of hPCLS 247 Total RNA was extracted from human precision-cut lung slices (hPCLS) using TRIzol reagent 248 (Invitrogen) with a Phase -Maker tube (Thermo Fisher Scien;fic) according to the 249 manufacturer’s protocol. Briefly, 2 –3 slices were transferred to a 2 mL Eppendorf tube 250 containing 0.5 mL TRIzol and homogenized using a ;ssue lyser. Homogenates were transferred 251 to Phase-Maker tubes, adjusted to 1 mL TRIzol, inverted twice, and incubated for 5 min at 252 preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for thisthis version posted January 23, 2026. ; https://doi.org/10.64898/2026.01.21.700846doi: bioRxiv preprint 13 room temperature. Chloroform (200 μL per 1 mL TRIzol) was added, samples were shaken for 253 15 s, incubated for 2 –3 min, and centrifuged (12,000 × g, 10 min, 4 °C). The aqueous phase 254 was transferred to a fresh tube, and RNA was precipitated with isopropyl alcohol (500 μL per 255 1 mL TRIzol) and 1 μL glycogen, followed by a 10 min room-temperature incuba;on. Samples 256 were centrifuged (11,000 × g, 10 min, 4 °C), pellets washed with 75% ethanol (1 mL per 1 mL 257 TRIzol), and centrifuged again (7,500 × g, 5 min, 4 °C). Supernatants were removed, and pellets 258 were air-dried for 10–15 min before resuspension in 30 μL DEPC-treated water. 259 Hydroxyproline measurement by high-performance liquid chromatography 260 Human IPF precision-cut lung slices (PCLS) were cultured for 5 days in the presence or absence 261 of A13 . Culture media were collected daily and replaced with fresh medium containing 262 compound. At day 5, supernatants from each slice were pooled per condi;on for analysis as 263 previously described(20). Briefly, proteins were precipitated by adjus;ng pooled supernatants 264 to 66% (v/v) ethanol, vortexed briefly, and incubated overnight at 4 °C. Precipitates were 265 collected by filtra;on through 0.45 μm PVDF filters (MilliporeSigma) and were transferred into 266 glass hydrolysis tubes with 6 M HCl at 110 °C for 16 h to release free amino acids. Following 267 hydrolysis, samples were evaporated to dryness at 100 °C and subsequently deriva;zed with 268 7-chloro-4-nitrobenzo-2-oxa-1,3-diazole (NBD -Cl) and quan;fied by reverse -phase high -269 performance liquid chromatography (RP -HPLC) using acetonitrile as the organic phase on a 270 C18 (RP-18) column. Hydroxyproline content was used as a quan;ta;ve surrogate for secreted 271 collagen. 272 Sta9s9cal analysis 273 All quan;ta;ve data are presented as median from at least three independent biological 274 replicates. Student’s t -tests were performed for comparisons between two groups , as 275 preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for thisthis version posted January 23, 2026. ; https://doi.org/10.64898/2026.01.21.700846doi: bioRxiv preprint 14 specified in the figure legends. For mul;ple condi;ons or repeated measurements within the 276 same samples, one -sample t -tests or non -parametric Friedman tests with mul;ple 277 comparisons were applied as appropriate. Sta;s;cal analyses were performed using 278 GraphPad Prism. Significance thresholds are indicated in the figure s as *p < 0.05 and **p < 279 0.01. 280

281 The rs62025270 variant modulates AKAP13 transcripts in human bronchial epithelial cells 282 The rs62025270 (G>A, 15:85756967) variant was introduced into immortalized human 283 bronchial epithelial cells (iHBECs) using CRISPR –Cas9 and confirmed by Sanger sequencing 284 (Figure 1A). Immunobloxng of protein lysates from variant-bearing cells revealed a prominent 285 protein band of ~100 kDa in size, considerably smaller than the predicted full-length AKAP13 286 protein which was expected to be ~320 kDa (Figure 1B). Region-specific qPCR showed minimal 287 change in the transcript region encoding the including the protein kinase A (PKA) -binding 288 domain compared with wild type (WT) cells, however there was a significant increase in 289 expression of downstream truncated regions, including the Proto-lbc and the RhoGEF 290 domains (Figure 1C). To assess the func;onal consequences of altered AKAP13 expression, 291 transcrip;onal profile s of WT and rs62025270 -containing cells were analysed using the 292 nCounter® Fibrosis V2 panel (Figure 1D). In comparison with WT cells, variant expressing 293 iHBECs significant upregulated the following genes: serum amyloid A1 (SAA1) ; fibroblast 294 growth factor 2 (FGF2); matrix metallopep;dase 1 (MMP1); cathepsin B (CTSB); collagen type 295 IV alpha 1 chain (COL4A1), and cyclin-dependent kinase inhibitor 1A (CDKN1A) (Fig 1E-J). 296 297 preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for thisthis version posted January 23, 2026. ; https://doi.org/10.64898/2026.01.21.700846doi: bioRxiv preprint 15 The rs62025270 variant enhances RhoA/TGFβ ac9va9on and cellular adhesion 298 The level of RhoA ac;va;on was assessed in wild -type and variant-expressing cells by GLISA 299 assay. Basal RhoA ac;vity was unchanged in rs62025270 -bearing cells, however, following 300 s;mula;on with 50 μM LPA, ac;vity increased by approximately 25% compared to WT (Figure 301 2A). Real -;me impedance monitoring with xCELLigence RTCA revealed that rs62025270 302 bearing cells had an enhanced cell adhesion rate during the first 5 h (Figure 2B) but reduced 303 prolifera;on by 40% over 24 h compared with WT cells (Supplemental Figure 1A). Reduced 304 prolifera;on was confirmed by PrestoBlue assay (Supplementary Fig ure 1B). Epithelial cell 305 prolifera;on is inhibited by TG Fβ (21) which in turn can be enhanced by LPA-mediated RhoA 306 ac;va;on (14). Therefore, the effect of the rs62025270 variant on TGF β ac;va;on was 307 measured. Compared with wild type cells, variant -bearing cells showed augmented SMAD2 308 phosphoryla;on following LPA treatment (Fig ure 2C & D). Furthermore, c ondi;oned media 309 from variant expressing cells showed an increase in TGF-β ac;vity measured by TMLC assay 310 (supplemental Figure 2). 311 The rs62025270 variant promotes RhoA ac9va9on via increased expression of the proto-lbc. 312 We showed that the rs62025270 variant preferen;ally induced AKAP13 isoforms lacking the 313 PKA domain (Figure 1C), therefore plasmids encoding the proto-Lbc ( an AKAP13 isoform, 314 lacking the PKA domain) or Δ-Lbc (an inac;ve form lacking RhoGEF domain) (Figure 3A) were 315 selec;vely overexpressed in iHBECs. Overexpression was confirmed by immunobloxng, with 316 proto-Lbc and Δ-Lbc detected at ~102 kDa and ~52 kDa, respec;vely (Fi gure 3B). Proto-Lbc 317 overexpression enhanced LPA-induced RhoA ac;va;on in iHBECs compared with empty vector, 318 whereas overexpression of Δ-Lbc markedly reduced RhoA ac;va;on (Fig ure 3C). Consistent 319 with the rs62025270 results, overexpression of Proto-Lbc accelerated cell adhesion whereas 320 preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for thisthis version posted January 23, 2026. ; https://doi.org/10.64898/2026.01.21.700846doi: bioRxiv preprint 16 over-expression of Δ-Lbc diminished cell adhesion compared with the empty vector control 321 (Figure 3D). 322 The rs62025270 variant reduces cAMP ac9vity 323 AKAP13 is an A-kinase anchoring protein that is involved in the cAMP signalling, therefore the 324 effect of the rs62025270 variant expressing cells on intracellular cAMP levels was measured 325 using a fluorescence resonance energy transfer (FRET)-based sensor. rs62025270-bearing cells 326 exhibited significantly reduced cAMP levels compared with WT (Figure 4A). To determine 327 whether the effect of cAMP was mediated through the RhoGEF domain of AKAP13 the AKAP13 328 inhibitor A13 was used. Whilst A13 was unable to restore cAMP to WT levels sugges;ng that 329 the RhoGEF domain does not contribute to AKAP13 promo;ng cAMP ac;vity, it was 330 interes;ng to note a small reduc;on in cAMP in both wild -type and rs62025270 bearing cells 331 (Figure 4B). 332 The AKAP13 inhibitor reduces pro-adhesive phenotype , R hoA and TGFβ ac9va9on 333 associated with rs62025270 334 A13 a small molecule that targets the RhoGEF domain of AKAP13 (22) was used to understand 335 whether targe;ng th is might ameliorate the profibro;c phenotypes observed in rs62025270 336 bearing cells . A13 inhibited adhesion in a concentra;on -dependent manner, with 10 μM 337 completely blocking adhesion (Supplementary Fig ure 3A, B). Notably, 3 μM A13 normalized 338 the elevated adhesion rate of rs62025270 cells to WT levels (Fig ure 5A). This effect was not 339 due to toxicity as A13 (1 –10 μM) did not increase lactate dehydrogenase (LDH) release 340 (Supplementary Figure 3C & D). In contrast, SB431542, which suppresses TGFβ signalling by 341 selec;vely inhibi;ng the type 1 receptor ALK5, showed minimal effect on rs62025270 342 medicated epithelial cell adhesion (supplemental Figure4). Furthermore, 10 μM A13 reduced 343 preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for thisthis version posted January 23, 2026. ; https://doi.org/10.64898/2026.01.21.700846doi: bioRxiv preprint 17 LPA-induced RhoA ac;va;on, restoring rs62025270 associated RhoA ac;vity to WT levels 344 (Figure 5B) and also reduced LPA-induced SMAD2 phosphoryla;on (Figure 5C & D). 345 An AKAP13 inhibitor has an9fibro9c ac9vity in human precision cut lung slices 346 Finally, we evaluated the an;fibro;c poten;al of A13 in IPF pa;ent –derived precision-cut lung 347 slices (PCLS). 5-day culture of PCLS with A13 significantly reduced the profibro;c gene 348 expression of serpin family E member 1 (SERPINE1), cellular communica;on network factor 2 349 (CCN2), MMP7, and fibronec;n 1 ( FN1) in a concentra;on dependent manner (Figure 6A-D). 350 Consistent with the in vitro findings, A13 -exposed PCLS exhibited reduced TGFβ ac;vity, as 351 measured by decreased nuclear phosphorylated SMAD 2 (pSMAD2) immunofluorescence 352 staining (Figure 6E & F). 5-day A13 exposure also significantly reduced hydroxyproline content 353 in supernatants at both 3 μM and 10 μM while hydroxyproline levels in lung slice homogenates 354 were similarly affected although to a lesser extent (Figure 6G & H). No toxicity in PCLS was 355 observed with A13 exposure (Figure 6I). 356 357

358 In this study, we describe the func;onal consequ ences of the rs62025270 variant that has 359 been associated with elevated AKAP13 expression and is a causal variant for IPF. Using a 360 CRSIPR-Cas9 based approach , introduc;on of the rs62025270 variant into human bronchial 361 epithelial cells led to enhanced RhoA and TGF β ac;va;on , promoted epithelial adhesion, 362 reduced epithelial prolifera;on , and lowered intracellular cAMP ac;vity. We show in vitro 363 that this variant selec;vely enhances expression of AKAP13 isoforms lacking the PKA domain 364 but retaining the RhoGEF domain. This altered profile shizs the intracellular signalling balance 365 preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for thisthis version posted January 23, 2026. ; https://doi.org/10.64898/2026.01.21.700846doi: bioRxiv preprint 18 toward profibro;c RhoA ac;va;on and away from an; -fibro;c cAMP ac;vity . Furthermore, 366 we show that specific inhibi;on of the RhoGEF domain of AKAP13 can suppress profibro;c 367 makers and hydroxyproline produc;on in PCLS from pa;e nts with IPF. 368 Our transcriptomic profiling revealed that the rs62025270 variant elicits a broader shiz 369 toward a pro -fibro;c transcrip;onal state. Specifically, induc;on of SAA1, an acute -phase 370 reactant(23) that has previously been associated with IPF disease severity (24), may suggest 371 variant-bearing cells are undergoing cellular stress. Transcrip;onal upregula;on of the 372 proteoly;c enzymes, MMP1 and CTSB, were also observed in the variant -bearing cells , 373 indica;ng hyperac;ve extracellular-matrix turnover, which aligns with profibro;c phenotypes 374 observed in pulmonary fibrosis(25, 26). In addi;on , upregula;on of COL4A1, a basement -375 membrane component, may reflect a„empts at matrix restora;on or remodelling, although 376 the func;onal consequences of COL4A1 induc;on in epithelial cells remain unclear and 377 warrant further inves;ga;on . Increased CDKN1A together with the prolifera;on suppression 378 supports a shiz toward cell -cycle arrest and senescence in variant-bearing cells, a phenotype 379 documented in IPF pathogenesis (27, 28). The induc;on of FGF2, a growth factor important 380 for lung development (29), further suggests ac;va;on of epithelial repair . W hile FGF2 can 381 support acute epithelial recovery, its chronic ac;va;on may alter epithelial –mesenchymal 382 signalling, moreover the fact that Nintedanib inhibits FGFR kinases (30) raises the possibility 383 that these cells may respon d favourably to exis;ng an;fibro;c therapy . Func;onally, 384 rs62025270 variant-expressing cells did not exhibit higher basal RhoA ac;vity, but RhoA was 385 increased following LPA s;mula;on , illustra; ng the importance of environmental “second hits” 386 in promo;ng fibrosis in people with common variants (31). Variant-expression cells also 387 showed accelerated cell adhesion, a phenotype reproduced by overexpression of proto-Lbc 388 (the AKAP13 isoform lacking the PKA domain) and suppressed by expression of Δ-Lbc (the 389 preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for thisthis version posted January 23, 2026. ; https://doi.org/10.64898/2026.01.21.700846doi: bioRxiv preprint 19 RhoGEF-deficient mutant). These findings indicate that the RhoGEF ac;vity of PKA -deficient 390 AKAP13 isoforms is a cri;cal driver of the rs62025270 variant phenotype. 391 Importantly, the rs62025270 variant not only altered LPA-induced RhoA ac;vity but also 392 amplified LPA -induced TGF β pathway ac;va;on, as shown by increased Smad 2 393 phosphoryla;on and elevated TGF β bioac;vity in condi;oned media. This mechanis;c link is 394 consistent with prior evidence that RhoA –ROCK signalling enhances TGF β ac;va;on by 395 modula;ng cytoskeletal tension and integrin -mediated release of latent TGFβ complexes (14, 396 32). In addi;on, AKAP13 func;ons as a scafford protein for cAMP-dependent protein kinase 397 (PKA) ac;va;on. Previous studies have shown that AKAP13 anchored PKA inhibits AKAP13 398 RhoGEF ac;vity by phosphoryla;ng AKAP13 at the RhoGEF binding site (33). Conversely, 399 recruitment of phosphodiesterase4 (PDE4) to AKAP13 promotes cAMP degrada;on , resul;ng 400 in reduced PKA ac;va;on (33). Consistent with these observa;on s, we observed reduc;on in 401 intracellular cAMP in rs62025270 cells , sugges; ng that loss of PKA -mediated counter -402 regula;on may contribute toward pro-fibro;c signalling. This is par;cularly relevant given that 403 impaired cAMP signalling has been implicated in IPF pathogenesis, where cAMP modulates 404 fibrosis by affec;ng fibroblast ac;va;on, extracellular matrix produc;on (10, 34). 405 Pharmacological inhibi;on of AKAP13 RhoGEF ac;vity using A13 reversed several rs62025270 406 variant-induced phenotypes. A13 at 3uM effec;vely normalised rs620250270 variant 407 media;ng cell adhesion rates and suppressed LPA-induced RhoA ac;va;on to the level of wild 408 type iHBECs. Interes;ngly, direct inhibi;on of TGF β signalling with ALK5 inhibitor showed 409 minimal effects on cell adhesion, sugges;ng addi;onal mechanism s medicated by RhoA 410 ac;va;on that operate independently of TGFβ. Furthermore, 5-day A13 treatment ex vivo 411 reduced pro-fibro;c gene expression and de novo collagen produc;on in precision-cut lung 412 preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for thisthis version posted January 23, 2026. ; https://doi.org/10.64898/2026.01.21.700846doi: bioRxiv preprint 20 slices (PCLS) from IPF pa;ents , sugges;ng that inhibi;ng the RhoGEF ac;vity of AKAP13 might 413 be useful therapeu;c strategy to treat fibro;c lung dise ases. Given the impact of the 414 rs62025270 on cAMP signalling it m ay be possible that targe;ng the RhoGEF ac;vity of 415 AKAP13 could provide enhanced benefits when combined with currently available an;-fibro;c 416 drugs that modulate this pathway, such as Nerandomilast (35) and Trepros;nil (36). Indeed, 417 the finding that the rs62025270 may impair intracellular cAMP ac;vity raises the prospect of 418 stra;fying responses to Nerandomilast and/or Trepros;nil therapy by AKAP13 genotype. We 419 would hypothesis e that pa;ents with the presence of the rs62025270 would exhibit an 420 enhanced therapeu;c response compared with those pa;ents without the variant. 421 A limita;on of this study is that our mechanis;c analyses were performed in bronchial 422 epithelial cells, which, although relevant for modelling airway injury responses, may not fully 423 recapitulate the biology of alveolar epithelial cell in IPF. Future work should extend these 424 findings to alveolar type II cells, where epithelial –mesenchymal crosstalk may play a central 425 role in fibrosis progression. Addi;onally, in vivo studies will be required to evaluate the safety, 426 pharmacokine;cs, and efficacy of AKAP13 RhoGEF inhibi;on in fibro;c lung disease. 427 In summary, we demonstrate that the IPF-associated rs62025270 variant promotes a shiz in 428 AKAP13 isoform expression that favours pro-fibro;c RhoGEF-dependent RhoA ac;va;on and 429 impairs an; -fibro;c cAMP ac;va;on . Pharmacological inhibi;on of this pathway a„enuates 430 fibrosis-related gene expression, matrix deposi;on, and TGFβ signalling in human lung ;ssue. 431 These findings provide func;onal gene;c insight into the rs62025270 risk allele in IPF and 432 establish AKAP13 RhoGEF ac;vity as a promising therapeu;c target in gene;cally suscep;ble 433 individuals. 434 435 preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for thisthis version posted January 23, 2026. ; https://doi.org/10.64898/2026.01.21.700846doi: bioRxiv preprint 21

436 This study was funded by a Medical Research Council Programme Grant (MR/V00235X/1) to 437 R.G.J. RGJ was funded by an NIHR Research Professorship (RP -2017-08-ST2-014). B.L. is a 438 research fellow funded by Ac;on for pulmonary fibrosis. I. D.S. is an advanced research fellow 439 funded by Rayne Founda;on. Infrastructure support for this research was provided by the 440 NIHR Imperial Biomedical Research Centre (BRC). The authors acknowledge Clinical Research 441 Facility (CRF) Respiratory Biobank, Royal Brompton Hospital for their collec;on of ;ssue and 442 facilita;on of sample transfer. 443 Author contribu;ons 444 B.L., J.M., S.G., L.O., E.P ., contributed to in vitro experiments, ;ssue sample collec;on, PCLS 445 genera;on, and data analysis. G.C. performed hydroxyproline measurement. B.L. and I.K. 446 performed intracellular cAMP measurement using FRET sensor. L.Z., R.C.C., cri;cally reviewed 447 and revised the manuscript. B.L. , A.E.J., and R.G.J. conceptualized the study and drazed the 448 manuscript. A.E.J. and R.G.J. supervised the project, coordinated collabora;ons, and finalized 449 the manuscript. All authors reviewed and approved the final version of the manuscript. 450

451 1. Moss BJ, Ryter SW, and Rosas IO. Pathogenic mechanisms underlying idiopathic 452 pulmonary fibrosis. Annual Review of Pathology: Mechanisms of Disease. 453 2022;17(1):515-46. 454 2. Rieder F, Nagy LE, Maher TM, Distler JH, Kramann R, Hinz B, et al. Fibrosis: cross-organ 455 biology and pathways to development of innova;ve drugs. Nature Reviews Drug 456 Discovery. 2025:1-27. 457 3. May J, Mitchell JA, and Jenkins RG. Beyond epithelial damage: vascular and endothelial 458 contribu;ons to idiopathic pulmonary fibrosis. The Journal of clinical invesPgaPon. 459 2023;133(18). 460 4. Maher TM, and Strek ME. An;fibro;c therapy for idiopathic pulmonary fibrosis: ;me 461 to treat. Respir Res. 2019;20(1):205. 462 preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for thisthis version posted January 23, 2026. ; https://doi.org/10.64898/2026.01.21.700846doi: bioRxiv preprint 22 5. Chin D, Hernandez-Beezink T, Donoghue L, Guillen-Uio B, Leavy OC, Adegunsoye A, et 463 al. Genome -wide associa;on study of Idiopathic Pulmonary Fibrosis suscep;bility 464 using clinically-curated European-ancestry datasets. medRxiv. 2025. 465 6. Allen RJ, Porte J, Braybrooke R, Flores C, Fingerlin TE, Oldham JM, et al. Gene;c variants 466 associated with suscep;bility to idiopathic pulmonary fibrosis in people of European 467 ancestry: a genome -wide associa;on study. The Lancet respiratory medicine. 468 2017;5(11):869-80. 469 7. Bucko PJ, and Sco„ JD. Drugs that regulate local cell signaling: AKAP targe;ng as a 470 therapeu;c op;on. Annu Rev Pharmacol Toxicol. 2021;61(1):361-79. 471 8. Cavin S, Maric D, and Diviani D. A-kinase anchoring protein-Lbc promotes pro-fibro;c 472 signaling in cardiac fibroblasts. Biochimica et Biophysica Acta (BBA) -Molecular Cell 473 Research. 2014;1843(2):335-45. 474 9. Diviani D, Osman H, and Reggi E. A-kinase anchoring protein-Lbc: a molecular scaffold 475 involved in cardiac protec;on. Journal of cardiovascular development and disease. 476 2018;5(1):12. 477 10. Delaunay M, Osman H, Kaiser S, and Diviani D. The role of cyclic AMP signaling in 478 cardiac fibrosis. Cells. 2019;9(1):69. 479 11. Lawson CD, and Ridley AJ. Rho GTPase signaling complexes in cell migra;on and 480 invasion. J Cell Biol. 2018;217(2):447-57. 481 12. Bement WM, Goryachev AB, Miller AL, and von Dassow G. Pa„erning of the cell cortex 482 by Rho GTPases. Nature Reviews Molecular Cell Biology. 2024;25(4):290-308. 483 13. Tatler AL, and Jenkins G. TGF -β ac;va;on and lung fibrosis. Proc Am Thorac Soc. 484 2012;9(3):130-6. 485 14. Xu MY , Porte J, Knox AJ, Weinreb PH, Maher TM, Viole„e SM, et al. Lysophospha;dic 486 acid induces αvβ6 integrin-mediated TGF-β ac;va;on via the LPA2 receptor and the 487 small G protein Gαq. The American journal of pathology. 2009;174(4):1264-79. 488 15. Moon C, Lee Y-J, Park H-J, Chong YH, and Kang JL. N -acetylcysteine inhibits RhoA and 489 promotes apopto;c cell clearance during intense lung inflamma;on. Am J Respir Crit 490 Care Med. 2010;181(4):374-87. 491 16. Zhou Y , Huang X, Hecker L, Kurundkar D, Kurundkar A, Liu H, et al. Inhibi;on of 492 mechanosensi;ve signaling in myofibroblasts ameliorates experimental pulmonary 493 fibrosis. The Journal of clinical invesPgaPon. 2013;123(3):1096-108. 494 17. Chi Y , Chen Y , Jiang W, Huang W, Ouyang M, Liu L, et al. Deficiency of Integrin β 4 Results 495 in Increased Lung Tissue S;ffness and Responds to Substrate S;ffness via Modula;ng 496 RhoA Ac;vity. FronPers in Cell and Developmental Biology. 2022;10:845440. 497 18. For;er SM, Penke LR, King D, Pham TX, Ligres; G, and Peters -Golden M. Myofibroblast 498 dedifferen;a;on proceeds via dis;nct transcriptomic and phenotypic transi;ons. JCI 499 insight. 2021;6(6):e144799. 500 19. Ramuz M, Hasan A, Gruscheski L, Diakonov I, Pavlaki N, Nikolaev VO, et al. A sozware 501 tool for high-throughput real-;me measurement of intensity -based ra;o -metric FRET. 502 Cells. 2019;8(12):1541. 503 20. Contento G, Wilson J-AA, Selvarajah B, Platé M, Guillo;n D, Morales V, et al. Pyruvate 504 metabolism dictates fibroblast sensi;vity to GLS1 inhibi;on during fibrogenesis. Jci 505 Insight. 2024;9(18):e178453. 506 21. Zhang Y , Alexander PB, and Wang X-F. TGF-β family signaling in the control of cell 507 prolifera;on and survival. Cold Spring Harb Perspect Biol. 2017;9(4):a022145. 508 preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for thisthis version posted January 23, 2026. ; https://doi.org/10.64898/2026.01.21.700846doi: bioRxiv preprint 23 22. Diviani D, Raimondi F, Del Vescovo CD, Dreyer E, Reggi E, Osman H, et al. Small -509 molecule protein -protein interac;on inhibitor of oncogenic Rho signaling. Cell 510 chemical biology. 2016;23(9):1135-46. 511 23. Uhlar CM, and Whitehead AS. Serum amyloid A, the major vertebrate acute -phase 512 reactant. Eur J Biochem. 1999;265(2):501-23. 513 24. Vietri L, Benne„ D, Cameli P , Bergan;ni L, Cillis G, Ses;ni P , et al. Serum amyloid A in 514 pa;ents with idiopathic pulmonary fibrosis. Respiratory InvesPgaPon. 2019;57(5):430-515 4. 516 25. Kasabova M, Villeret B, Gombault A, Lecaille F, Reinheckel T, Marchand-Adam S, et al. 517 Discordance in cathepsin B and cysta;n C expressions in bronchoalveolar fluids 518 between murine bleomycin-induced fibrosis and human idiopathic fibrosis. Respir Res. 519 2016;17(1):118. 520 26. Rosas IO, Richards TJ, Konishi K, Zhang Y , Gibson K, Lokshin AE, et al. MMP1 and MMP7 521 as poten;al peripheral blood biomarkers in idiopathic pulmonary fibrosis. PLoS Med. 522 2008;5(4):e93. 523 27. Mar;nez FJ, Collard HR, Pardo A, Raghu G, Richeldi L, Selman M, et al. Idiopathic 524 pulmonary fibrosis. Nature reviews Disease primers. 2017;3(1):1-19. 525 28. Schafer MJ, White TA, Iijima K, Haak AJ, Ligres; G, Atkinson EJ, et al. Cellular 526 senescence mediates fibro;c pulmonary disease. Nature communicaPons. 527 2017;8(1):14532. 528 29. Baran K, Skrzynska K, Czyrek AA, Wi„ek A, Krowarsch D, Szlachcic A, et al. Fibroblast 529 Growth Factors in Lung Development and Regenera;on: Mechanisms and Therapeu;c 530 Poten;al. Cells. 2025;14(16):1256. 531 30. Wollin L, Wex E, Pautsch A, Schnapp G, Hoste„ler KE, Stowasser S, et al. Mode of ac;on 532 of nintedanib in the treatment of idiopathic pulmonary fibrosis. Eur Respir J. 533 2015;45(5):1434-45. 534 31. Johannson KA, Adegunsoye A, Behr J, Coxn V, Glanville AR, Glassberg MK, et al. Impact 535 of environmental exposures on the development and progression of fibro;c inters;;al 536 lung disease. Am J Respir Crit Care Med. 2025;211(4):560-8. 537 32. Jenkins RG, Su X, Su G, Sco„on CJ, Camerer E, Laurent GJ, et al. Liga;on of protease -538 ac;vated receptor 1 enhances α v β 6 integrin–dependent TGF -β ac;va;on and 539 promotes acute lung injury. The Journal of clinical invesPgaPon. 2006;116(6):1606-14. 540 33. Diviani D, Abuin L, Cotecchia S, and Pansier L. Anchoring of both PKA and 14 -3-3 541 inhibits the Rho -GEF ac;vity of the AKAP -Lbc signaling complex. The EMBO journal. 542 2004;23(14):2811-20. 543 34. Insel PA, Murray F, Yokoyama U, Romano S, Yun H, Brown L, et al. cAMP and Epac in 544 the regula;on of ;ssue fibrosis. Br J Pharmacol. 2012;166(2):447-56. 545 35. Richeldi L, Azuma A, Coxn V, Kreuter M, Maher TM, Mar;nez FJ, et al. Nerandomilast 546 in pa;ents with idiopathic pulmonary fibrosis. N Engl J Med. 2025;392(22):2193-202. 547 36. Nathan SD, Waxman A, Rajagopal S, Case A, Johri S, DuBrock H, et al. Inhaled 548 trepros;nil and forced vital capacity in pa;ents with inters;;al lung disease and 549 associated pulmonary hypertension: a post -hoc analysis of the INCREASE study. The 550 lancet respiratory medicine. 2021;9(11):1266-74. 551 552 553 preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for thisthis version posted January 23, 2026. ; https://doi.org/10.64898/2026.01.21.700846doi: bioRxiv preprint 24 554 Figure 1 rs62025270 modulates AKAP13 expression in human bronchial epithelial cells (A) 555 Schema;c overview of introducing the rs62025270 (G>A) variant into iHBECs using a CRISPR–556 Cas9–mediated homology-directed repair strategy. Sanger sequencing confirms the single-557 nucleo;de subs;tu;on. (B) Representa;ve immunoblot of AKAP13 and Tubulin protein levels 558 in wild-type (WT) and rs62025270 iHBECs. (C) Region-specific qPCR analysis targe;ng cDNA 559 regions encoding the PKA (primer 1), proto-Lbc (primer 2), and RhoGEF (primer 3) domains, 560 presented as expression rela;ve to B2M and normalised to WT (n = 3). (D) Top differen;ally 561 expressed genes (DEGs) iden;fied using the nCounter Fibrosis V2 panel, with adjusted p-value 562 (FDR) < 0.05. (E–J) qPCR valida;on of selected DEGs: (E) MMP1, (F) SAA1, (G) FGF2, (H) CTSB, 563 (I) COL4A1, and (J) CDKN1A in WT and rs62025270 iHBECs. Data are presented as expression 564 rela;ve to B2M and further normalised to WT (n = 3). Sta;s;cal analysis was performed using 565 a one-sample t-test. * p<0.05, ** p<0.01. 566 Figure1 C Proto-LbcLbcBrx-1 D A A CRISPR-CAS9 rs62025270A WTrs62025270 B WTrs62025270300kD 102kD 52kD55kD AKAP13 Tubulin EFG HIJ SAA1serum amyloid A15.44562334FGF2fibroblast growth factor 24.5MMP1matrix metallopeptidase 14.48888889CTSBCathepsin B1.46139754COL4A1collagen_ type IV_ alpha 11.34153401CDKN1Ap21_ Cip11.3273431 0 1 2 3 WT rs62025270 mRNA expression to B2M PKA Proto-LbcRhoGEF * 0.0 0.5 1.0 1.5 2.0 2.5FGF2 * 0 2 4 6 8 SAA1 WT rs62025270 0.0 0.5 1.0 1.5 2.0 2.5 COL4A1 * WT rs62025270 0.0 0.5 1.0 1.5 2.0 2.5 CDKN1A ** WT rs62025270 0 1 2 3 CTSB mRNA relative to B2M 0 2 4 6mRNA relative to B2M MMP1 * 25 567 Figure 2 rs62025270 promotes RhoA signalling, leading to increased cell adhesion and TGFβ 568 ac9va9on 569 (A) RhoA ac;vity measured by RhoA G-LISA in wild-type (blue) and rs62025270 (red) iHBECs 570 treated with or without 50 µM LPA for 2 minutes. Data are presented as raw OD values at 490 571 nm (n = 3). (B) Real-;me cell impedance analysis of wild-type (blue) and rs62025270 (red) 572 iHBECs using the xCELLigence RTCA system. Data are shown as cell index over a 5-hour period 573 (n = 3). (C) Representa;ve immunoblot images of phospho-SMAD2 and total SMAD2/3 in 574 iHBECs treated with or without 50 µM LPA for 2 hours. (D) Densitometric quan;fica;on of 575 immunoblots shown in (C), presented as phospho-SMAD2 rela;ve to total SMAD2/3 (n = 3). 576 Sta;s;cal analysis was performed using a paired t-test between wild type and rs62025270 577 treated with LPA. * p<0.05, ** p<0.01. 578 579 580 Figure2A B C 0 1 2 3 4 5 0.0 0.2 0.4 0.6 Time (hrs) Cell Index rs62025270 WT rs62025270WT -LPA-LPA 0.0 0.2 0.4 0.6 0.8 OD at 490nm WT rs620225270 * 0.0 0.5 1.0 1.5 phospho-SMAD2 relative to SMAD2/3 WT rs62025270 - LPA ** 26 581 Figure 3 Proto-Lbc overexpression promotes RhoA ac9va9on and cell adhesion in human 582 bronchial epithelial cells 583 (A) Schema;c representa;on of cDNA constructs encoding full-length AKAP13, Proto-Lbc, and 584 △-Lbc. (B) RhoA ac;vity measured by RhoA G-LISA in iHBECs transfected with empty vector, 585 Proto-Lbc, or △-Lbc., followed by treatment with or without 50 µM LPA for 2 min. Data are 586 presented as fold change rela;ve to control (n = 3). (C) Representa;ve immunoblot showing 587 expression of FLAG-tagged Proto-Lbc and Δ-Lbc in iHBECs. (D) Real-;me cell impedance 588 measurement of iHBECs using the xCELLigence RTCA system. Data are shown as normalised 589 cell index over a 5-hour period (n = 3). 590 APKAbindingdomainRhoGEFAKAP13RhoGEFProto-Lbc△-Lbc B C -Proto-Lbc△-Lbc 102kD 52kD Figure3 52kD38kD β-actin anti-FLAG 1 2 3 4 5 1.0 1.5 2.0 Time (hrs) normalised Cell Index Empty vector Proto-Lbc Δ-Lbc D - Proto-Lbc Δ-Lbc - Proto-Lbc Δ-Lbc 0.0 0.5 1.0 1.5 2.0 OD at 490nm relative to control 27 Figure 591 4 rs62025270 caused intracellular cyclic-AMP (cAMP) reduc9on, which cannot be restored 592 by A13 593 (A) Intracellular cAMP levels in iHBECs measured using a FRET-based biosensor. Data are 594 presented as percentage of the FRET signal normalised to the maximum response induced by 595 forskolin (n = 3). Sta;s;cal analysis was performed using Student’s t-test. **p < 0.01 (B) 596 Intracellular cAMP levels in iHBECs treated with or without 10 µM A13, as measured by the 597 FRET sensor. Sta;s;cal analysis was performed using the Friedman test for mul;ple 598 comparisons. *p < 0.05 599 Figure4 A B WT rs62025270 0 10 20 30 40 50% cAMP response ** 10uMA13WT rs62025270 WT rs62025270 0.0 0.5 1.0 1.5% cAMP response * * ns 28 600 Figure 5 Inhibi9on of RhoGEF by A13 reverses rs62025270 mediated pro-adhesive 601 phenotype and TGFβ ac9va9on 602 (A) Real-;me cell impedance analysis of wild-type (blue) and rs62025270 (red) iHBECs treated 603 with 3 µM A13 or DMSO control using the xCELLigence RTCA system. Data are presented as 604 cell index over a 5-hour period (n = 3). (B) RhoA ac;vity measured by RhoA G-LISA in WT (blue) 605 and rs62025270 (red) iHBECs treated with or without 50 µM LPA for 2 minutes. Data are 606 presented as fold change rela;ve to WT (n = 3). Sta;s;cal analysis was performed using the 607 Friedman test for mul;ple comparisons within genotype. *p < 0.05 (C) Representa;ve 608 immunoblot images of phospho-SMAD2 and total SMAD2/3 in iHBECs treated with or without 609 50 µM LPA for 2 hours in the presence or absence of 10 µM A13. (D) Densitometric 610 quan;fica;on of immunoblots shown in (C). Sta;s;cal analysis was performed using the 611 Friedman test for mul;ple comparisons. *p < 0.05 612 Figure5 A B Phospho-SMAD2 SMAD2/3 GAPDH LPAA13-+-+--++C D 0 1 2 3 4 50.0 0.3 0.6 0.9 1.2 DMSO rs62025270 A13 3uM rs62025270DMSO WTA13 3uM WT Cell Index -LPA LPA+A13 3uMLPA+A13 10uM -LPA LPA+A13 3uMLPA+A13 10uM 0.0 0.5 1.0 1.5 2.0 OD at 490nm normalised to WT rs62025270 WT * - LPA- LPA 0 10 20 30 phospho-SMAD2 relative to SMAD2/3 * 29 613 Figure 6. A13 inhibi9on mi9gates fibrosis in IPF precision-cut lung slices. 614 (A–D) mRNA expression of (A) SERPINE1, (B) CCN2, (C) MMP7, and (D) FN1 in PCLS treated 615 with vehicle control or A13 at 1, 3, or 10 µM for 5 days (n = 5). (E) Representa;ve 616 immunofluorescent staining of phospho-SMAD2 (P-SMAD) in IPF PCLS. White arrows indicate 617 cells in which P-SMAD2 (green) colocalises with DAPI (blue). (F) Percentage of nuclear P-618 SMAD–posi;ve cells normalised to vehicle control (n = 5). (G–H) Hydroxyproline content 619 measured by HPLC in (G) supernatant and (H) ;ssue slices. Data are presented as arbitrary 620 units normalised to slice weight (n = 4). (I) LDH levels in supernatant from PCLS treated with 621 or without A13 (n = 3). *p < 0.05, ** p < 0.01, one-sample t-test. 622 Figure6 P-SMADDAPI ABCD E F G HI ve1310 0.00 0.05 0.10 0.15 0.20 0.25 A13 (uM) delta OD ve1310 0.0 0.5 1.0 1.5 A13 (uM) mRNA relative to B2M *** SERPINE1 ve1310 0.0 0.5 1.0 1.5 2.0 2.5 A13 (uM) *** CCN2 ve1310 0.0 0.5 1.0 1.5 A13 (uM) *** FN1 ve1310 0.0 0.5 1.0 1.5 2.0 2.5 A13 (uM) **** MMP7 ve1310 0.0 0.5 1.0 1.5 A13 (uM) Phosp-SMAD2 normalised to Control ** ve1310 0.0 0.5 1.0 1.5 2.0 A13 (uM) Fold Change normalised to Control ve1310 0.0 0.5 1.0 1.5 A13 (uM) Fold Change normalised to Control ** 30 623 Supplemental Figure1 cell prolifera9on measured by xcelligence and Prestoblue 624 (A) Cell prolifera;on measured by xcelligence RTCA and normalised to wild type over 24 hours. 625 (B) Cell prolifera;on measured by Prestoblue over 24 hours and presented as O.D value. 626 Sta;s;cal analysis was performed using a paired t-test between wild type and rs62025270 627 treated with LPA. * p<0.05 628 629 Supplemental Figure2 TGFβ ac9vity measured by TMLC reporter assay 630 TGFβ ac;vity in condi;oned media measured using a TMLC reporter assay. Data are presented 631 as fold change rela;ve to vehicle control and further normalised to WT (n = 5). 632 SupplementalFigure1 xcelligencePrestoblueA B WT rs62025270 0.0 0.5 1.0 1.5 proliferation rate normalised to WT * WT rs62025270 0.0 0.5 1.0 1.5O.D unit relative to WT * - LPA - LPA 0 2 4 6 Fold change normalised to WT WT rs62025270 SupplementalFigure2 31 633 Supplemental Figure3 Real-9me cell impedance and cytotoxicity assessment of A13-treated 634 iHBECs. 635 (A–B) Real-;me cell impedance measurements of (A) rs62025270-bearing and (B) WT iHBECs 636 treated with A13 (1–10 µM) or DMSO control using the xCELLigence RTCA system. Data are 637 presented as cell index over a 5-hour period (n = 3). (C–D) Lactate dehydrogenase (LDH) levels 638 in (C) rs62025270-bearing and (D) WT iHBECs treated with A13 (1–10 µM) or DMSO control (n 639 = 3). 640 rs62025270 WT 1uM 10uMA13 1uM 10uMA13 SupplementalFigure3A B C D DMSO positive control A13_1uMA13i 2uMA13_3uMA13_5uMA13_10uM 0.0 0.2 0.4 0.6 0.8 1.0 delta OD DMSO positive control A13_1uMA13_2uMA13_3uMA13_5uMA13_10uM 0.0 0.5 1.0 1.5delta OD CellindexCellindex 32 641 Supplemental Figure4 Effect of ALK5 inhibi9on on cell adhesion and cytotoxicity in iHBECs 642 (A) Real-;me cell impedance measurements of rs62025270-bearing and WT iHBECs treated 643 with an ALK5 inhibitor (5 or 10 µM) or DMSO control using the xCELLigence RTCA system. Data 644 are presented as cell index over a 5-hour period (n = 3). (B) Lactate dehydrogenase (LDH) levels 645 in rs62025270-bearing and WT iHBECs treated with an ALK5 inhibitor (5 or 10 µM) or DMSO 646 control (n = 3). 647 SupplementalFigure4 A B 1 2 3 4 50.0 0.5 1.0 TIME (hrs) DMSO SNP ALK5i 5uM SNP ALK5i 10uM SNP DMSO WT ALK5i 5uM WT ALK5I 10uM WT Cell Index DMSO positive control ALK5i 5uMALK5i 10uM 0.0 0.2 0.4 0.6 0.8 1.0delta O.D. C DMSO positive control ALK5i 5uMALK5i 10uM 0.0 0.2 0.4 0.6 0.8 1.0delta OD