Expression Profiling and Functional Characterization of LoNCED Gene in Pollen Abortion of Lilium spp.

Expression Profiling and Functional Characterization of LoNCED Gene in Pollen Abortion of Lilium spp. | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Expression Profiling and Functional Characterization of LoNCED Gene in Pollen Abortion of Lilium spp. Haiyan Zhou, Xiang Li, Lan Ma, Qing Duan, Wenwen Du, Guangfen Cui, and 3 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6013825/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 02 Oct, 2025 Read the published version in BMC Plant Biology → Version 1 posted 10 You are reading this latest preprint version Abstract Lilium spp. are widely cultivated for their ornamental value, but excessive pollen production poses commercial challenges. Male sterility, especially pollen-free cultivars, offers a promising breeding strategy to improve market appeal. ABA, a key hormone in regulating anther development, is influenced by the NCED gene. To investigate its role in male sterility, we isolated the LoNCED gene from both fertile and sterile lily progenies. After cloning and analyzing its tissue-specific expression, we explored its function through homologous transient overexpression and heterologous expression. Results showed that sterile progenies had significantly higher ABA levels, with LoNCED expression elevated in their anthers compared to fertile progenies. The LoNCED gene, with a 1812 bp open reading frame encoding 603 amino acids, encodes a hydrophilic protein (66.69 kDa) localized in chloroplasts and mitochondria. Sequence analysis revealed high similarity to NCED proteins from other species. Overexpression of LoNCED downregulated key anther development genes ( DYT1 , TDF1 , CYP703A2 , CALS5 , DEX1 ) and caused tapetum degradation, abnormal microspore development, and pollen sterility. Transgenic Arabidopsis plants overexpressing LoNCED exhibited incomplete anther development, premature tapetum degradation, and reduced pollen grain production. These findings highlight the critical role of LoNCED in regulating anther sterility in lilies. Lilium spp. Male sterility LoNCED gene Anther development Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Background Lilium spp., or lilies, are perennial bulbous flowers in the Liliaceae family, valued for their vibrant colors, fragrance, and cultural symbolism of harmony and good fortune [ 1 ]. Despite their prominence as cut flowers, lilies pose challenges due to abundant, lightweight pollen grains that adhere to petals and clothing, causing contamination. Manual emasculation, commonly used to address this issue, increases labor costs and risks mechanical damage, reducing ornamental value [ 2 ]. Therefore, the cultivation of male-sterile, pollen-free lilies represents a pivotal direction for future breeding efforts. Unlike fertile hybrids, the tapetum in male-sterile lilies behaves differently during microspore mother cell development, preventing microspores from progressing to the tetrad stage. The tapetum, located in the innermost layer of the anther, plays a critical role in supplying nutrients and hormones for microspore development [ 3 ]. Disruptions in tapetum degradation can lead to male sterility [ 4 , 5 ]. In tomato, mutations in tapetum cells early in meiosis lead to stamen degeneration and male sterility [ 6 ]. High-throughput RNA sequencing identified significant differences in gene expression between male-sterile (HS) and fertile (HF) lines, with the differentially expressed genes primarily involved in hormone signal transduction, including auxin, cytokinin, gibberellin, and abscisic acid (ABA) metabolism. Notably, the ABA content was elevated during the tetrad stage. The upregulation of genes associated with ABA biosynthesis, such as NCED, SDR, and AAO, suggested that ABA plays a critical role in regulating tapetum degradation and male sterility [ 7 ]. 9-cis-epoxycarotenoid dioxygenase (NCED) is a key enzyme in the biosynthesis of abscisic acid (ABA) through the indirect pathway and plays a crucial role in regulating this process. NCED is part of a multigene family, and studies have shown that it can induce increased ABA levels in response to environmental stress, thereby enhancing plant stress tolerance [ 8 ]. In tobacco, the NCED gene has been linked to ABA synthesis under drought conditions, with findings indicating that NCED can promote ABA production both under normal and drought conditions [ 9 ]. Similarly, research on soybean has revealed a correlation between NCED gene expression, protein levels, and ABA content in leaves and roots under water stress, further confirming the role of NCED in ABA regulation under drought stress [ 10 ].In Brassica napus , the NCED gene family led to the isolation of BnNCED3, which shares significant amino acid sequence similarity with Arabidopsis NCED3 [ 11 ]. Overexpression of BnNCED3 in transgenic Arabidopsis resulted in increased ABA accumulation and enhanced production of nitric oxide (NO) and reactive oxygen species (ROS), contributing to improved tolerance to abiotic stresses. Furthermore, BnNCED3 was shown to regulate plant growth, including inhibiting seed germination, affecting early-stage development, and promoting ABA-related leaf senescence. These findings suggest that BnNCED3, through modulation of ABA biosynthesis, plays a role in both stress adaptation and plant development [ 12 ].These studies highlight the importance of continuous activation of NCED and the coordination between ABA biosynthesis and catabolism in regulating ABA signaling and its various functions [ 13 ]. Pollen development is a crucial stage in plant sexual reproduction, regulated by a complex molecular network involving multiple coordinated processes, such as tapetum function, sporopollenin deposition, callose dynamics, and exine formation [ 14 ]. The tapetum, often referred to as the "nutrient factory" for pollen development, plays a vital role, and its functional abnormalities directly lead to pollen abortion [ 15 ]. The transcription factor DYT1 (Defective in Tapetal Development and Function 1) regulates the timing of tapetal cell programmed cell death (PCD) by activating downstream genes such as TDF1 (Tapetum Development Delay 1) [ 16 ]. TDF1 further controls the expression of genes involved in sporopollenin precursor biosynthesis, and its loss of function results in tapetum retention and defective pollen wall formation. Sporopollenin, the primary component of the pollen exine, is synthesized through the action of cytochrome P450 family genes, particularly CYP703A2 , which catalyzes the hydroxylation of fatty acids to generate sporopollenin precursors [ 17 ]. Mutations in CYP703A2 lead to pollen exine rupture and male sterility, highlighting its indispensable role in pollen wall formation. Callose, synthesized by CALS5 (Callose Synthase 5), forms a protective layer surrounding the tetrads, preventing the leakage of microspore contents [ 18 ]. Abnormal callose degradation can result in microspore adhesion or rupture. Additionally, DEX1 (Defective in Exine Formation 1) mediates the formation of a scaffold for the initial exine layer, guiding the orderly deposition of sporopollenin [ 19 ]. The loss of DEX1 function leads to complete disintegration of the exine structure [ 20 ]. The functional defects of these genes ultimately result in the loss of pollen viability, manifesting as abnormal tapetal PCD ( DYT1 / TDF1 ), sporopollenin deficiency ( CYP703A2 ), disruption of the callose barrier ( CALS5 ), or exine structural collapse ( DEX1 ). In this study, to investigate the role of the LoNCED gene in anther and pollen development in lilies, a male-sterile hybrid population of Oriental Lily, bred over many years by the Institute of Floriculture, Yunnan Academy of Agricultural Sciences, was utilized. Parental individuals, including the maternal (F) and paternal (M) lines, as well as hybrid fertile offspring (HF) and hybrid sterile offspring (HS), were analyzed. Transcriptomic studies of fertile (HF) and sterile (HS) lines identified the LoNCED gene, which was significantly upregulated in the ABA signaling pathway during key stages of pollen development [ 7 ]. The LoNCED gene was cloned, and its encoded protein was further analyzed and functionally predicted using bioinformatics tools. Overexpression of LoNCED in fertile progeny during the pollen mother cell and tetrad stages was performed to observe its impact on anther development, and the gene was introduced into the model plant Arabidopsis thaliana to explore its expression characteristics and functions. We hypothesized that the LoNCED gene contributes to ABA accumulation, which disrupts pollen development and leads to male sterility in lilies. This study provides insights into the regulatory network of ABA-mediated male sterility by linking LoNCED expression to changes in pollen development and ABA content. These findings establish a theoretical foundation for understanding the role of LoNCED in male sterility in lilies and offer insights for developing pollen-free lily germplasm resources. Results Cytological Differences in Anther Development Between Fertile and Sterile Lily Progenies By comparing paraffin sections of pollen mother cells and tetrads between fertile and sterile lily progenies (Fig. 1 ), we found clear differences in the anther development of the two groups. In sterile progenies, the anther cross-sections at the pollen mother cell stage were similar to those of fertile progenies. The pollen sacs were normally shaped, the epidermal cells were regularly arranged, and the sporogenous cells had large nuclei and dense cytoplasm surrounded by tapetum cells. However, the development of both tapetum cells and pollen mother cells was weaker in sterile progenies compared to fertile ones. At the tetrad stage, tapetum cells in sterile progenies stopped developing and began to break down abnormally. The pollen mother cells showed signs of vacuolation. After the tapetum cells broke down, their contents fused to form a periplasmodium, which entered the anther chamber and surrounded the pollen mother cells, blocking normal progression to the tetrad stage. In contrast, fertile progenies showed microspore mother cells in the center of the microsporangia. These cells had large volumes, prominent nuclei, and dense cytoplasm, gradually growing to the tetrad stage. The tapetum cells were larger, quadrilateral-elongate, and arranged in regular concentric circles. Some tapetum cells had two or more nuclei. ABA Hormone Content Changes in Sterile and Fertile Hybrids During Anther Development The ABA hormone content in sterile hybrids (HS) is significantly higher than in fertile hybrids (HF), particularly during the tetrad stage, where it can reach approximately twice the level in HF. ABA content in HF pollen is notably reduced during the pollen mother cell and tetrad stages, while no significant change is observed in HS pollen. This suggests a more active ABA biosynthesis process in sterile hybrids, potentially linked to changes in hormone regulation during anther development. (Fig. 2 ). Lily NCED Gene Cloning The target band corresponding to the NCED gene CDS sequence was cloned and obtained. Electrophoresis detection showed that the amplified fragment was 1812 bp, consistent with the target band (Fig. 3 ). Sequencing results indicated the full length of the gene was 1812 bp, encoding 603 amino acids. Analysis of the conserved domain in the lily NCED amino acid sequence revealed that the LoNCED amino acid sequence contains one conserved NCED domain between positions 4 and 603. Additionally, a comparison of this protein sequence with homologous proteins in Arabidopsis showed that the LoNCED protein is closer to NCED5 and NCED2 based on the clustering results (Fig. 4 ). It was named LoNCED. Expression of the LoNCED gene in different parts of lilies. During the development of lily pollen, at the microspore mother cell stage and the tetrad stage, there are significant differences in gene expression levels in different parts (Fig. 5 ). At the microspore mother cell stage, in the sterile offspring of lilies, the expression level of the Lily LoNCED gene is relatively high in the flower organs, with the highest expression in the anther, reaching an average relative value of 1.35; while the expression in the style is extremely low, with an average relative value of 0.22. In fertile offspring, compared with sterile offspring, the expression level of the Lily LoNCED gene is relatively lower, and the expression in the leaves is also very low. At the tetrad stage, the relative expression trend of the LoNCED gene is roughly the same as that at the microspore mother cell stage, with the expression in sterile offspring of lilies being significantly higher than that in fertile offspring, and the anther also has the highest expression among all flower organs. Bioinformatics prediction analysis of the protein encoded by the LoNCED gene The physicochemical properties and structural characteristics of the amino acid sequence encoded by the LoNCED gene were analyzed using the Prot Param online software in the ExPASy system ( http://web.expasy.org/protparam/ ). Prot Param predicted that the protein molecular mass was approximately 66.69 KD, the theoretical isoelectric point (pl) was 5.87, the molecular formula was C2987H4594N814O884S20, and the total number of atoms was 9299. Its amino acid sequence was composed of 20 kinds of amino acids, among which serine (Ser) was the most abundant, accounting for 8.6% of the total amino acids; cysteine (Cys) had the lowest content, accounting for 1.0% of the total amino acids; the total number of negatively charged residues (Asp + Glu) was 69, the total number of positively charged residues (Arg + Lys) was 56, the instability index of the protein was 47.01, and it belonged to unstable proteins. The number of fat (lipophilic) offspring was 78.96, and the total average hydrophilicity (Grand verage of hydropathicity) was 0.381. The hydrophobicity and hydrophilicity of the protein encoded by the LoNCED gene were analyzed using the Prot Scale online software in the ExPASy system ( http://web.expasy.org/protscale/ ), with positive values representing hydrophobicity and negative values representing hydrophilicity. The largest site of the amino acids encoded by the LoNCED gene was site 431, with a hydrophobic value of 2.178; the smallest site was site 202, with a hydrophilic value of -2.822. This indicated that the number of hydrophilic amino acids was greater than that of hydrophobic amino acids, so it was speculated that the protein was a stable hydrophilic protein (Fig. 6 A). The online software TMHMM Server ( http://www.cbs.dtu.dk/services/TMHMM/ ) and SignalP ( https://services.healthtech.dtu.dk/services/SignalP-6.0/ ) were used to predict the transmembrane region and signal peptide of the protein encoded by the LoNCED gene. The results showed that the protein did not have transmembrane regions and signal peptides (Fig. 6BC). It was predicted that the protein was located in the cytoplasmic matrix or organelle matrix, and did not belong to membrane proteins or secretory proteins. The subcellular localization of the LoNCED protein was predicted using the WoLF PSORT online software ( https://wolfpsort.hgc.jp/ ), and the results showed that the scores of the LoNCED protein located in the subcellular were 7 for chloroplast and 7 for mitochondrion, indicating that the LoNCED gene mainly played a role in the cytoplasm and organelles. The secondary structure of the LoNCED protein was analyzed using PSIPRED V4.0 ( http://bioinf.cs.ucl.ac.uk/psipred ), and the results showed that the protein had three types of secondary structures, including 72 amino acids forming alpha helix, accounting for 11.94%; 187 amino acids forming extended strand, accounting for 31.01%; and 344 amino acids forming random coil, accounting for 57.05%. The main structure of the protein was random coil (Fig. 6 D). By inputting the amino acid sequence into the Swiss-Model program ( https://www.swissmodel.expasy.org/ ), the tertiary structure of the protein encoded by the Lily ATPase3 gene was predicted (Fig. 6 F). The protein was mainly composed of random coils, and the predictions of the two models were consistent with the results of the secondary structure prediction. The protein sequences of LoNCED were compared by multiple sequence alignment method, and the analysis results showed that the amino acid sequence homology with NCED3 was very high, which met the prediction requirements of the STRING database. In order to further analyze the potential functions of LoNCED, we used the STRING website to predict the protein interaction regulatory mechanism of LoNCED. The results showed that there were 10 proteins interacting with it, namely ABA2, PSY1, ZEP, ABI1, RD29A, ABA3, ABI5, ABI2, AAO3 and LTI65 proteins. The straight line (Edge) between the circle and the node corresponded to the interaction between the two proteins connected by the line, and the different colors represented different types of protein-protein interactions (Fig. 6 E). Homology comparison analysis of LoNCED By aligning the LoNCED with the NCED sequences of different species and blasting the Lily ATPase3 protein sequence in the NCBI database, the ATPase protein sequences of other species with the highest consistency in the alignment results were selected for phylogenetic tree analysis (Fig. 7 ). The protein was most closely related to Iris pallida , Gladiolus hybrid cultivar, Narcissus tazetta and clustered together. Moreover, the amino acid sequence of the LoNCED protein had high similarity with that of other species. The impact of transient overexpression of LoNCED on lily pollen development The relative gene expression levels in the control and overexpression groups of lilies were detected by real-time fluorescence quantitative assay (Fig. 8 A). It was found that the expression level of LoNCED in the anthers of fertile offspring after overexpression was significantly higher than that in the control group, indicating that the LoNCED gene was successfully overexpressed in the fertile offspring. In the microspore mother cell stage and tetrad stage of fertile offspring, overexpression of LoNCED was compared with the empty vector control, and there were significant differences in the morphology of anther development in the microspore mother cell stage and tetrad stage (Fig. 8 G). In the microspore mother cell stage, the tapetum cells in the anthers overexpressing LoNCED disintegrated in large numbers, and the microspore mother cells were located in the center of the microspore sac, with large cell volume and large nucleus. At this time, in the empty vector control group, the tapetum developed relatively normally, with large cells, square and slender, regularly arranged in a palisade state, and the microspore mother cells developed relatively normally. In the tetrad stage, due to the abnormal development of tapetum cells in the early stage and large-scale disintegration in the anthers overexpressing LoNCED, they could not provide the nutrients and energy substances needed for microspore development, and the microspores began to develop abnormally and gradually disintegrated. The whole anther developed abnormally towards pollen abortion. In the control group, the tapetum cells began to disintegrate in the tetrad stage, and some microspores developed normally. However, since they were grown in vitro tissue culture environment, compared with the normally grown tetrad anthers, there were many abnormal states in microspore development, and many microspores disintegrated and could not normally develop into the mononuclear pollen stage. In the two stages of microspore mother cell and tetrad period, the expression of genes related to tapetum development, DYT1 and TDF1 , were significantly downregulated in the anthers overexpressing LoNCED(Fig. 8 B-F). In the microspore mother cell stage, the expression of DYT1 in the anthers overexpressing LoNCED was about four times that of the control group, and the expression of TDF1 was reduced by about 30%. In the tetrad stage, the expression of DYT1 in the anthers overexpressing LoNCED was downregulated by about 50%, and the expression of TDF1 was reduced by about 60%. The expression levels of these related genes were all significantly reduced. In the microspore mother cell stage and tetrad stage, the expression of genes related to sporopollenin synthesis ( CYP703A2 ), callose synthase gene ( CALS5 ), and primary exine formation gene ( DEX1 ) were also significantly downregulated in the anthers overexpressing LoNCED. The impact of the LoNCED gene on Arabidopsis pollen development In order to explore the regulatory role of the LoNCED gene in anther development, the gene was transferred into the model plant Arabidopsis thaliana, and the relative expression level of the gene in transgenic plants was measured after positive selection (Fig. 9 A). The results showed that the LoNCED gene was highly expressed in transgenic plants, with the expression level significantly higher than that in wild-type Arabidopsis (WT), reaching up to 1.3 (Fig. 9 B). After harvesting and sowing the Arabidopsis infected by Agrobacterium, resistance selection was carried out again. Seeds were sown on 1/2 MS medium containing 50 mg·L − 1 kanamycin. Positive plants emerged about 10 days later, with about four leaves. After emergence, they were transplanted into a 1:1 mixture of nutrient soil and vermiculite for further cultivation. After 20 days of cultivation, it was observed that transgenic Arabidopsis was smaller and weaker than WT, with earlier bolting and thinner leaf growth, but the stem grew faster than the leaves (Fig. 9 C). Compared with WT, transgenic Arabidopsis was under obvious stress, with a more delayed growth state and thinner growth of all tissues. Detailed observation of Arabidopsis flower buds through a stereomicroscope revealed that the anthers of transgenic Arabidopsis were underdeveloped and the number of pollen grains was significantly reduced (Fig. 9 D). Meanwhile, paraffin sections were made from the flower buds for histological observation (Fig. 9 E). Through cytological observation, it was found that the pollen sac and its contents in wild - type Arabidopsis developed completely and could form normal anthers. In contrast, in transgenic Arabidopsis, the microspore mother cells and contents in the anthers gradually degraded during development, the tapetum disintegrated prematurely, the pollen sac gradually deformed, the sac wall became thinner, the contents inside the sac gradually disintegrated, forming a large cavity or the sac wall cracked, thus failing to form anther with normal function. This further indicates that the LoNCED gene is specifically expressed in anther development and may be involved in its regulatory function. Discussion The issue of lily pollen contamination remains a key factor affecting the commercial value and market expansion of cut lilies. Pollen not only shortens the ornamental period of flowers but also adheres easily to the skin and clothing, making it difficult to remove and reducing consumer satisfaction. To address this issue, breeding techniques such as hybridization have been successfully used to develop lily varieties with degraded anthers, significantly mitigating the problem of pollen contamination [ 2 , 21 ]. The formation of pollen-free lilies is mainly attributed to pollen abortion and degradation or the inability to produce normal pollen grains [ 22 ]. In maize research, abnormalities in the development and degradation of tapetum cells have been identified as key factors leading to pollen abortion. The tapetum is a crucial tissue that provides nutrients and enzymes during pollen development, and its proper differentiation and timely degradation are essential for pollen maturation [ 23 ]. Therefore, utilizing male sterility traits in lilies for targeted breeding of pollen-free varieties is a reasonable research direction. Studies have shown that insufficient energy supply and hormonal metabolism disorders during anther development may lead to fertility abnormalities, with abscisic acid (ABA) playing a central regulatory role in these processes. For instance, in the tomato male-sterile mutant sl2, endogenous ABA levels in stamens are six times higher than in fertile plants, indicating that ABA accumulation may directly impact normal stamen development [ 24 ]. Similarly, in K and T cytoplasmic male-sterile materials, ABA levels significantly increase during the critical period of pollen abortion, suggesting that ABA accumulation may be closely related to the activation of male sterility gene expression [ 25 ]. In the regulation of ABA biosynthesis, 9-cis-epoxycarotenoid dioxygenase (NCED) serves as a key rate-limiting enzyme, with its expression levels positively correlated with ABA accumulation [ 26 ]. The LeNCED1 gene, isolated from tomatoes, exhibits significantly increased transcription levels under drought stress, and its overexpression results in a marked accumulation of ABA, leading to prolonged seed dormancy [ 27 ]. In Arabidopsis, the AtNCED3 gene was cloned, and transgenic plants with sense expression exhibited significantly higher ABA levels and enhanced drought tolerance, whereas antisense transgenic plants were more sensitive to drought stress [ 28 ]. These findings suggest that NCED genes not only regulate ABA accumulation under stress conditions but may also influence plant growth, development, and reproductive processes. Studies in crops such as avocado [ 29 ], cowpea [ 30 ], grape [ 31 ], peanut [ 32 ], and common bean leaves [ 10 ] have also revealed that NCED genes are significantly induced under stress conditions, promoting ABA accumulation and conferring stress resistance. Research on sweet cherry has shown that the PavNCED gene is highly expressed during floral bud dormancy, regulating ABA metabolism and controlling the transition between floral bud growth and dormancy [ 33 ]. More recent studies further indicate that NCED subfamily genes play an important regulatory role in plant pollen development [ 34 , 35 ]. This study conducted the cloning and functional expression analysis of the LoNCED gene in lilies, clarifying its regulatory role in anther abortion and laying a theoretical foundation for further exploration of its specific regulatory functions in lily male sterility. The study demonstrated a positive correlation between LoNCED expression and abscisic acid (ABA) accumulation, a key phytohormone involved in stress responses and reproductive development [ 36 ]. The protein encoded by this gene contains an open reading frame (ORF) of 1,812 bp, encoding 603 amino acids. Bioinformatics analysis of the encoded protein revealed a relative molecular weight of approximately 66.69 kDa and a theoretical isoelectric point of 5.87. It is a hydrophilic protein with no transmembrane domains or signal peptides. The protein is primarily localized in chloroplasts and mitochondria, consistent with its involvement in ABA biosynthesis [ 37 ]. Furthermore, secondary structure predictions revealed a high proportion of random coils, indicating potential structural flexibility and functional stability, in agreement with tertiary structure predictions. The LoNCED gene in sterile lily progeny was found to be significantly upregulated in anthers during the pollen mother cell and tetrad stages, suggesting that its increased expression leads to ABA accumulation, thereby affecting normal pollen development. This study further quantified ABA levels in lily anthers and analyzed the relative expression of LoNCED during key stages of anther development. Gene cloning and bioinformatics analyses revealed that the LoNCED protein lacks transmembrane domains and signal peptides, is hydrophilic, and exhibits high sequence similarity with NCED proteins from other species. The functional characterization of LoNCED as an NCED-family enzyme—known for catalyzing the rate-limiting step in ABA biosynthesis—supports the hypothesis that its misregulation contributes to male sterility in lilies [ 38 ]. Phylogenetic analysis revealed high sequence similarity between LoNCED and NCED homologs from other species, reinforcing its evolutionary conservation and functional importance in reproductive development [ 39 ]. Transient expression experiments in lily anthers revealed that LoNCED overexpression caused abnormal microspore development, accompanied by the significant downregulation of genes critical for microspore formation and maturation [ 40 , 41 ]. Similar effects have been observed in other plant species, where ABA accumulation has been linked to tapetum degeneration, pollen abortion, and defective anther dehiscence, as seen in rice [ 42 ] and wheat [ 43 ]. These findings further reinforce the role of LoNCED as a key regulator of ABA biosynthesis, directly influencing lily anther development and ultimately contributing to male sterility. For functional validation, the LoNCED gene was overexpressed in Arabidopsis, leading to phenotypic changes such as inhibited growth, early bolting, and accelerated flowering. These findings suggest that LoNCED may play a role in plant developmental timing and hormonal regulation. Given that ABA is a key phytohormone regulating both stress responses and floral development, its misregulation due to LoNCED overexpression could severely disrupt anther development and pollen formation, ultimately contributing to male sterility. These findings further support the hypothesis that LoNCED-mediated ABA accumulation plays a crucial role in reproductive abnormalities. Although this study provides an initial understanding of LoNCED expression in lily anthers and its effect on ABA accumulation, its precise regulatory mechanisms require further investigation. Future research should focus on LoNCED signaling pathways, its interactions with ABA biosynthesis and metabolism, and its specific role in lily fertility regulation to provide stronger theoretical support. Notably, previous studies have demonstrated the importance of bioinformatics in NCED functional research, with the cloning and bioinformatics analysis of the AcNCED gene in kiwifruit ( Actinidia chinensis ) and NCED genes in Dendrobium officinale , revealing their high expression patterns under abiotic stress [ 44 , 45 ]. Drawing on these research experiences and integrating genetic transformation with functional validation will further enhance our understanding of LoNCED, providing new technological pathways and theoretical foundations for molecular breeding of pollen-free lilies. Conclusion The LoNCED gene exhibits differential expression in various floral organs and at different developmental stages in lilies, with predominant expression in anthers during the pollen mother cell stage. Overexpression of LoNCED resulted in abnormal anther development in lilies, preventing the formation of normal microspores, with a significant downregulation of microspore development-related genes. In transgenic Arabidopsis plants overexpressing LoNCED, phenotypic abnormalities such as defective anther development, weak growth, and early bolting were observed. Additionally, the contents of anthers gradually degraded, the tapetum disintegrated prematurely, pollen sacs became deformed, and the inner substances of the sacs degraded, leading to the formation of a large cavity or breakdown of the sac walls, ultimately preventing the formation of functional anthers. Methods Plant materials This study examines fertile (HF) and sterile (HS) offspring from the hybridization of pollen-bearing ‘Siberia’ lily (maternal, F) and ‘Marco polo’ lily (paternal, M), grown at the Lily Breeding Base of the Yunnan Academy of Agricultural Sciences (25° 7’33’’ N, 102° 45’48’’ E). Anthers and floral organs at various developmental stages were collected based on bud size [ 46 ]. Arabidopsis thaliana wild-type Col was used for transgenic plants. All plants were cultivated in a growth chamber, under 22 ± 2°C, 16 h light/8 h dark, with a vermiculite-peat substrate (1:1). Fresh anthers were collected and immediately weighed. The samples were rapidly frozen in liquid nitrogen and stored at -80°C for subsequent analysis. Parameters determination Cytological observation Pollen samples were fixed in FAA solution (100 mL containing 5 mL of 38% formaldehyde, 5 mL of acetic acid, and 90 mL of 70% ethanol) for 24 hours, followed by dehydration through ethanol gradients (75%, 85%, 90%, and 95%) for 4, 2, 2, and 1 hours, respectively. The samples were soaked in anhydrous ethanol for 60 minutes, then immersed in a benzene-ethanol mixture for 5–10 minutes, followed by two xylene treatments for 5–10 minutes each. The samples were infiltrated with molten paraffin at 65°C for three 1-hour cycles, then embedded using a paraffin embedding machine. For sectioning, 4 µm thick paraffin sections were cut with a rotary microtome, and dried at 60°C. Then, the slices were classified by safranin O-fast green staining, sections were stained with 1% safranin-O for 1 h, washed with distilled water, discoloured and then counter-stained with 0.5% fast green for 1 min (G1031, Servicebio, Wuhan, China). The sections were finally observed and photographed under an optical microscope (YS100; Nikon, Tokyo, Japan). Examination of the ABA content The ABA content was determined using high-performance liquid chromatography (HPLC). An appropriate amount of plant sample was extracted with 80% methanol using ultrasonic treatment for 30 min, followed by centrifugation at 12,000 rpm for 10 min. The supernatant was collected, filtered through a 0.22 µm membrane, and then injected for analysis. HPLC was performed using a C18 reversed-phase column (250 mm × 4.6 mm, 5 µm) with a mobile phase of methanol/water (60:40, v/v) at a flow rate of 1.0 mL/min, a column temperature of 30°C, and a detection wavelength of 265 nm. The ABA content in the samples was calculated based on peak area using a standard curve generated from ABA standard solutions. Total RNA Extraction and cDNA Synthesis Fresh-cut lily flowers were collected, and different floral tissues were separated. Approximately 50 mg of each sample was weighed and rapidly ground into a fine powder in liquid nitrogen. Subsequently, 1 mL of Trizol reagent was added (ensuring the sample volume did not exceed 10% of the Trizol volume). The mixture was left at room temperature for 5 min, followed by the addition of 0.2 mL chloroform per 1 mL Trizol. The tubes were tightly capped and vigorously shaken for 15 s to ensure thorough mixing. After a complete reaction, samples were centrifuged at 12,000 rpm for 10 min, and the upper aqueous phase was transferred to a new centrifuge tube. RNA precipitation was performed by adding 0.5 mL isopropanol per 1 mL Trizol, incubating at room temperature for 10 min, and centrifuging at 12,000 rpm for another 10 min. The supernatant was discarded, and the RNA pellet was washed with 75% ethanol, vortexed briefly, and centrifuged at 7,500 rpm at 4°C for 5 min. The ethanol was carefully removed, and the RNA pellet was dried at room temperature or under vacuum for 5–10 min before dissolving in RNase-free water. If necessary, the RNA was further solubilized by incubation at 55–60°C for 10 min. The extracted RNA samples were stored at -80°C. cDNA synthesis was performed according to the manufacturer’s protocol. A 10 µL reaction system was prepared for gDNA removal and incubated on ice, followed by a 10 µL reverse transcription reaction system. After thorough mixing, the reaction was incubated at 42°C for 15 min, followed by inactivation at 95°C for 1 min, and then cooled on ice. The synthesized cDNA was stored at -20°C for further use. qRT-PCR Expression Analysis of LoNCED GeneTotal RNA was extracted from anthers at different developmental stages of fertile and sterile lily progeny and reverse-transcribed into cDNA. Specific primers for the LoNCED gene were designed using the NCBI database ( http://www.ncbi.nlm.nih.gov/Structure/cdd/wrpsb.cgi ). qRT-PCR was performed using the TaKaRa TB Green Premix Ex Taq Ⅱ kit in a 20 µL reaction system containing 10 µL TB Green Premix Ex Taq Ⅱ (Tli RNaseH Plus), 0.8 µL of each forward and reverse primer, 0.4 µL ROX Reference Dye (50X), 2 µL cDNA template, and 6 µL ddH₂O. The qRT-PCR program was as follows: pre-denaturation at 95°C for 2 min, followed by 40 cycles of 95°C for 15 s, 60°C for 30 s, and 72°C for 30 s. A melting curve analysis was performed with the following steps: 95°C for 15 s, 60°C for 60 s, and 95°C for 15 s. Each sample was analyzed in triplicate. The β-actin gene was used as an internal reference, and the relative expression of LoNCED in fertile and sterile lily anthers at key developmental stages was calculated using the 2 −ΔΔCt method. Table 1 information of primers Primer name Primer sequence(5′-3′) LoNCED-cloning F: TGCTGACCGTATGAGCAAGG; R: GACGATGGCTGGACCAGATT pNC-Cam23FC-LoNCED F: TTTCCATAGGCCGCCCCTGA; R: CGCGTAATCTGCTGCTTGCA LoActin F: TGCTGACCGTATGAGCAAGG; R: GACGATGGCTGGACCAGATT LoNCED F: GTGGTCTCTGTCCAGTCCTGGCCTC; R: GTCTCAGCAGACCACAAGTG AtActin F: TGAGATTCGACATGCCCGA; R: TGGATTCCAGCAGCTTCCAT At-LoNCED F: GCTTCATCGTCCCCATCTC; R: GAAGACAGTATCCTCGCCATGG DYT1 F: CATGCCAAACCACAGGGTTCCC; R: ATATACGCAGCGACCGCATGG TDF1 F: GAGCTGCCCATTCTTGAGTCC; R: CACGCAGCGCGTGAGCTAC CYP703A2 F: TAGCACGTACATTGGGAACCC; R: AAGCCGTACATTGGGAACCG CALS5 F: GCTCTTCCGCTTCCTCGCT; R: CACTGACTCGCTGCGCTCG DEX1 F: TATGTCCTGATAGCGGTCCGC; R: CAGCTGCGCAAGGAACGC Cloning of LoNCED Gene Based on transcriptome sequencing data from pollen mother cell stages of fertile and sterile lily progeny, a differentially expressed gene annotated as NCED3 was selected for amplification and validation in fertile lily anthers. Specific primers were designed, and PCR amplification was performed using cDNA as a template. The 25 µL PCR reaction system included 12.5 µL Q5 High-Fidelity 2X Master Mix, 1.25 µL of each forward and reverse primer, 1 µL cDNA template, and 9 µL ddH₂O. The PCR program was as follows: pre-denaturation at 98°C for 2 min, followed by 35 cycles of 98°C for 15 s, 56°C for 30 s, and 72°C for 30 s. PCR products were verified by 1% agarose gel electrophoresis, and the target band was excised and purified. The purified product was ligated into the pRI101-GFP vector and transformed into competent Escherichia coli cells. Positive clones were screened by colony PCR, and selected clones were sent for sequencing validation. Bioinformatics Analysis of LoNCED Gene Various bioinformatics tools were employed to analyze the properties of the LoNCED protein. The amino acid sequence of the LoNCED gene was subjected to BLASTP analysis in the NCBI database ( http://www.ncbi.nlm.nih.gov/Structure/cdd/wrpsb.cgi ) to determine sequence homology and evolutionary relationships. Construction of the Overexpression Vector The correctly sequenced bacterial culture was incubated in LB medium containing Kanamycin at 37°C for 12–16 hours. Plasmid extraction was performed following the steps outlined in the TanGen Plasmid Mini Kit, and the concentration and purity of the extracted plasmid were assessed. Using the extracted plasmid as a template, primers were designed based on the In-Fusion cloning principle for vector construction. The target fragment was amplified using the high-fidelity 2X F8 FastLong PCR MasterMix, following the recommended amplification protocol. The amplified fragment was recovered using 1% agarose gel electrophoresis and purified before being recombined with the vector. For linearization of the plant expression vector pNC-Cam23FC-eGFP, a single restriction enzyme digestion was performed using SfiI, following the manufacturer’s protocol. The digestion reaction was carried out at 37°C for 1 hour, and the digested product was purified and recovered. The purified vector fragment was then treated using a PCR purification kit, and the linearized plant expression vector was ligated with the digested target fragment at 37°C for 30 hours. The ligation product was subsequently transformed into Escherichia coli DH5α. Single colonies were selected, cultured, and validated by sequencing. Agrobacterium-Mediated Genetic Transformation of Lilium for Overexpression of LoNCED Competent cells of Agrobacterium tumefaciens strain EHA105, stored at -80°C, were thawed on ice or in a greenhouse. Under sterile conditions, the constructed plasmid was added to the freshly thawed competent cell suspension for transformation. The transformed Agrobacterium culture was plated onto YEP solid medium supplemented with 50 µL Kanamycin and 50 µL Rifampicin. After the liquid had fully absorbed, the plates were inverted and incubated at 28°C for 48–72 hours. Once bacterial colonies had grown, a single colony was picked and inoculated into 500 µL YEP liquid medium (containing 50 µL Kanamycin) in a centrifuge tube and cultured at 28°C with shaking at 220 rpm overnight. The incubation time was adjusted according to colony size, typically kept within 20 hours.The overnight bacterial culture was subjected to colony PCR identification. Positive bacterial cultures displaying the correct PCR band were diluted at ratios of 1:50 or 1:25 into fresh YEP medium containing 50 µL Kanamycin and 50 µL Rifampicin and incubated at 28°C with shaking at 220 rpm for 8–16 hours. This step was repeated in 50 mL centrifuge tubes, followed by further incubation in 250 mL Erlenmeyer flasks containing 50 mL YEP medium under the same conditions for 12 hours. After incubation, the bacterial suspension was centrifuged at 2,000 rpm for 10 minutes, and the supernatant was discarded. The bacterial pellet was washed twice with sterile water and then resuspended in MS liquid medium supplemented with 0.1 mM acetosyringone. The final bacterial suspension was adjusted to OD600 = 0.6. Freshly excised Lilium anthers at the pollen mother cell stage and tetrad stage were punctured with small holes and immersed in the Agrobacterium suspension. The anthers were incubated in a shaker for 15 minutes, then transferred onto sterile filter paper to remove excess bacterial solution. The anthers were subsequently placed on MS solid medium and co-cultivated in darkness at 28°C ± 2°C for 3 days. Following co-cultivation, the anthers were washed with Cefotaxime, then transferred to selection medium (MS medium containing 50 mg/L Kanamycin) and incubated at 28°C ± 2°C. After 1 day of MS medium culture, transgene expression was analyzed using marker gene detection. Agrobacterium-Mediated Transformation of Arabidopsis and Selection of Transgenic Plants Floral dip transformation was used for Agrobacterium-mediated genetic transformation of Arabidopsis thaliana. The recombinant plasmid was first introduced into Agrobacterium strain EHA105, and the bacterial suspension was prepared at OD600 = 0.8–1.2. Silwet-L77 was added to a final concentration of 0.02%, and the entire inflorescence of Arabidopsis plants was dipped into the bacterial suspension for 2–3 seconds. After dipping, the plants were covered with plastic wrap to maintain humidity and incubated in the dark at 25°C for 24 hours. This infection process was repeated three times at 7-day intervals. Following infection, the plants were cultivated under 16-hour light/8-hour dark conditions at 23°C until seed maturation. Mature seeds were carefully collected by gently rubbing the siliques onto clean white paper, then wrapped and dried at 37°C for 24 hours. Once dried, the seeds were sieved using a 60-mesh screen. A portion of the harvested T0 transgenic seeds was vernalized in darkness at 4°C for 2–3 days, then surface-sterilized with 10% NaClO for 10 minutes and rinsed 4–5 times with sterile water. The sterilized seeds were evenly spread onto MS selection medium containing 50 mg·L -1 Kanamycin and incubated in a growth chamber for 10–14 days. Healthy, normally growing seedlings were identified as transgenic and transferred to nutrient soil (vermiculite + perlite) for further growth. Statistical analysis Data were analyzed using descriptive statistics in Excel 2024 and plotted by GraphPad. SPSS statistics 20 statistical analysis software was used for difference significance test, and Duncan test the difference of the average value of different treatments at the level of P < 0.05. Declarations Acknowledgements We thank the Xiangning Wang for experimental site support. We also thank for improving the scientific language of the manuscript. Funding The study was supported by the Program of Yunnan Seed Laboratory (202205AR070001-14), the Science and Technology Project of Yunnan Provincial Department of Science and Technology (202301AT070345), Yunnan Fundamental Research Projects (202401BD070001-098) and Yunnan Academy of Agricultural Sciences Pre-research Project (2024KYZX-04). Availability of data and materials The data that support the findings of this study are available from the first author upon reasonable request. Ethics approval and consent to participate We confirm that our study does not involve human subjects. Competing interests The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper. Consent for publication Not applicable. Authors’ contributions HY.Z. and WJ.J. conducted field experiments and collected data. Q.D and L.M. supervised the project. HY.Z. and X.L. performed statistical analysis and produced charts and diagrams. HY.Z., X.L. and WW.D. contributed to writing the manuscript. GF.C., XW.W. and H.Z. provided critical comments in planning the the manuscript. All the authors discussed the results and revised the manuscript. The author(s) read and approved the final manuscript. Author details 1 School of Agriculture, Yunnan University, Kunming 650205, China. 2 Flower Research Institute of Yunnan Academy of Agricultural Sciences, Yunnan Provincial Key Laboratory of Flower Breeding, National Engineering Research Center for Ornamental Horticulture, Yunnan Seed Laboratory, Kunming, 650205, China. References Liang Y, Gao Q, Li F, Du Y, Wu J, Pan W, et al. The giant genome of lily provides insights into the hybridization of cultivated lilies. NATURE COMMUNICATIONS. 2025;16:45. Moriyama T, Shea DJ, Yokoi N, Imakiire S, Saito T, Ohshima H, et al. Identification of a Male Sterile Candidate Gene in Lilium x formolongi and Transfer of the Gene to Easter Lily (L. longiflorum) via Hybridization. FRONTIERS IN PLANT SCIENCE. 2022;13. Wilson ZA, Song J, Taylor B, Yang C. The final split: the regulation of anther dehiscence. J Exp Bot. 2011;62:1633–49. doi:10.1093/jxb/err014. Li H, Yuan Z, Vizcay-Barrena G, Yang CY, Liang WQ, Zong J, et al. PERSISTENT TAPETAL CELL1 Encodes a PHD-Finger Protein That Is Required for Tapetal Cell Death and Pollen Development in Rice. PLANT PHYSIOLOGY. 2011;156:615–30. doi:10.1104/pp.111.175760. Sanders PM, Bui AQ, Le BH, Goldberg RB. Differentiation and degeneration of cells that play a major role in tobacco anther dehiscence. SEXUAL PLANT REPRODUCTION. 2005;17:219–41. doi:10.1007/s00497-004-0231-y. Chaban IA, Kononenko NV, Gulevich AA, Bogoutdinova LR, Khaliluev MR, Baranova EN. Morphological Features of the Anther Development in Tomato Plants with Non-Specific Male Sterility. Biology 2020. doi:10.3390/biology9020032. Jia WJ, Li X, Wang R, Duan Q, He JN, Gao JP, Wang JH. Disruption of the Contents of Endogenous Hormones Cause Pollen Development Obstruction and Abortion in Male-Sterile Hybrid Lily Populations. PLANTS-BASEL 2023. doi:10.3390/plants12223804. Huang Y, Guo Y, Liu Y, Zhang F, Wang Z, Wang H, et al. 9-cis-Epoxycarotenoid Dioxygenase 3 Regulates Plant Growth and Enhances Multi-Abiotic Stress Tolerance in Rice. FRONTIERS IN PLANT SCIENCE. 2018;9. Doerffling K. The Discovery of Abscisic Acid: A Retrospect. JOURNAL OF PLANT GROWTH REGULATION. 2015;34:795–808. doi:10.1007/s00344-015-9525-6. Qin XQ, Zeevaart JA. The 9- cis -epoxycarotenoid cleavage reaction is the key regulatory step of abscisic acid biosynthesis in water-stressed bean. PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF THE UNITED STATES OF AMERICA. 1999;96:15354–61. doi:10.1073/pnas.96.26.15354. Xu P, Cai W. Functional characterization of the BnNCED3 gene in Brassica napus. Plant Science. 2017;256:16–24. doi:10.1016/j.plantsci.2016.11.012. Xu Z, Ma J, Lei P, Wang Q, Feng X, Xu H. Poly-γ-glutamic acid induces system tolerance to drought stress by promoting abscisic acid accumulation in Brassica napus L. Scientific Reports. 2020;10:252. doi:10.1038/s41598-019-57190-4. Kende H, Zeevaart JA. The five ''classical'' plant hormones. PLANT CELL. 1997;9:1197–210. doi:10.1105/tpc.9.7.1197. Zhao W, Hou Q, Qi Y, Wu S, Wan X. Structural and molecular basis of pollen germination. PLANT PHYSIOLOGY AND BIOCHEMISTRY. 2023;203:108042. doi:10.1016/j.plaphy.2023.108042. Zhang X, Bei Z, Ma H, Wei Z, Zhou J, Ren Y, et al. Abnormal Programmed Cell Death of Tapetum Leads to the Pollen Abortion of Lycium barbarum Linnaeus. Horticulturae. 2022;8:1056. Gu J-N, Zhu J, Yu Y, Teng X-D, Lou Y, Xu X-F, et al. DYT1 directly regulates the expression of TDF1 for tapetum development and pollen wall formation in Arabidopsis. PLANT JOURNAL. 2014;80:1005–13. doi:10.1111/tpj.12694. Ma H, Wu Y, Lv R, Chi H, Zhao Y, Li Y, et al. Cytochrome P450 mono‐oxygenase CYP703A2 plays a central role in sporopollenin formation and ms5ms6 fertility in cotton. JOURNAL OF INTEGRATIVE PLANT BIOLOGY. 2022;64:2009–25. Dong XY, Hong ZL, Sivaramakrishnan M, Mahfouz M, Verma DP. Callose synthase (CalS5) is required for exine formation during microgametogenesis and for pollen viability in Arabidopsis. PLANT JOURNAL. 2005;42:315–28. doi:10.1111/j.1365-313X.2005.02379.x. Paxson-Sowders DM, Dodrill CH, Owen HA, Makaroff CA. DEX1, a novel plant protein, is required for exine pattern formation during pollen development in Arabidopsis. PLANT PHYSIOLOGY. 2001;127:1739–49. doi:10.1104/pp.010517. Quilichini TD, Douglas CJ, Samuels AL. New views of tapetum ultrastructure and pollen exine development in Arabidopsis thaliana. ANNALS OF BOTANY. 2014;114:1189–201. Imakiire S, Okazaki K, Yokoi N, Saito T. Development of pollen-free easter lily strains by cross-breeding Lilium× formolongi Hort. and easter lily (Lilium longiflorum Thunb.). 2023. Jenkins ES, Paul W, Craze M, Whitelaw CA, Weigand A, Roberts JA. Dehiscence-related expression of an Arabidopsis thaliana gene encoding a polygalacturonase in transgenic plants of Brassica napus . PLANT CELL AND ENVIRONMENT. 1999;22:159–67. doi:10.1046/j.1365-3040.1999.00372.x. An XL, Ba B, Duan MJ, Dong ZY, Liu RG, Yuan DY, et al. Molecular regulation of ZmMs7 required for maize male fertility and development of a dominant male-sterility system in multiple species. PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF THE UNITED STATES OF AMERICA. 2020;117:23499–509. doi:10.1073/pnas.2010255117. Mao Shengli, Du Yongchen, Wang Xiaoxuan, Zhu Dewei, Gao Jianchang, Dai Shanshu. Changes of Endogenous Abscisic Acid and the Effent of Exogenous ABA onPollen Germination under Heat Stress Tomato. Acta Horticulturae Sinica. 2005;32:234–8. Wu B, Xia Y, Zhang G, Wang Y, Wang J, Ma S, et al. Transcriptomics reveals a core transcriptional network of K-type cytoplasmic male sterility microspore abortion in wheat (Triticum aestivum L.). BMC Plant Biology. 2023;23:618. Marchler-Bauer A, Lu S, Anderson JB, Chitsaz F, Derbyshire MK, DeWeese-Scott C, et al. CDD: a Conserved Domain Database for the functional annotation of proteins. Nucleic acids research. 2011;39:D225-9. doi:10.1093/nar/gkq1189. Burbidge A, Grieve T, Jackson A, Thompson A, Taylor I. Structure and expression of a cDNA encoding a putative neoxanthin cleavage enzyme (NCE), isolated from a wilt-related tomato ( Lycopersicon esculentum Mill.) library. JOURNAL OF EXPERIMENTAL BOTANY. 1997;48:2111–2. doi:10.1093/jxb/48.12.2111. Behnam B, Iuchi S, Fujita M, Fujita Y, Takasaki H, Osakabe Y, et al. Characterization of the promoter region of an Arabidopsis gene for 9-cis-epoxycarotenoid dioxygenase involved in dehydration-inducible transcription. DNA research. 2013;20:315–24. Chernys JT, Zeevaart JA. Characterization of the 9-cis-epoxycarotenoid dioxygenase gene family and the regulation of abscisic acid biosynthesis in avocado. PLANT PHYSIOLOGY. 2000;124:343–53. doi:10.1104/pp.124.1.343. Iuchi S, Kobayashi M, Yamaguchi-Shinozaki K, Shinozaki K. A stress-inducible gene for 9-cis-epoxycarotenoid dioxygenase involved in abscisic acid biosynthesis under water stress in drought-tolerant cowpea. PLANT PHYSIOLOGY. 2000;123:553–62. doi:10.1104/pp.123.2.553. Zhang M, Leng P, Zhang G, Li X. Cloning and functional analysis of 9-cis-epoxycarotenoid dioxygenase (NCED) genes encoding a key enzyme during abscisic acid biosynthesis from peach and grape fruits. Journal of Plant Physiology. 2009;166:1241–52. Wan XR, Li L. Molecular cloning and characterization of a dehydration-inducible cDNA encoding a putative 9- cis -epoxycarotenoid dioxygenase in Arachis hygogaea L. DNA SEQUENCE. 2005;16:217–23. doi:10.1080/10425170500129785. Wang L, Sun W, Liu X, Xu Y, Lyu Z, Liu R, et al. Genome-wide identification of the NCED gene family and functional characterization of PavNCED5 related to bud dormancy in sweet cherry. SCIENTIA HORTICULTURAE 2023. doi:10.1016/j.scienta.2023.112186. Debnath T, Dhar DG, Dhar P. Molecular switches in plant stress adaptation. Molecular Biology Reports. 2024;51:20. Mo W, Zheng X, Shi Q, Zhao X, Chen X, Yang Z, Zuo Z. Unveiling the crucial roles of abscisic acid in plant physiology: implications for enhancing stress tolerance and productivity. FRONTIERS IN PLANT SCIENCE. 2024;15:1437184. Brookbank BP, Patel J, Gazzarrini S, Nambara E. Role of basal ABA in plant growth and development. Genes. 2021;12:1936. Liu Y, He J, Chen Z, Ren X, Hong X, Gong Z. ABA overly‐sensitive 5 (ABO5), encoding a pentatricopeptide repeat protein required for cis‐splicing of mitochondrial nad2 intron 3, is involved in the abscisic acid response in Arabidopsis. The Plant Journal. 2010;63:749–65. Wang P, Lu S, Zhang X, Hyden B, Qin L, Liu L, et al. Double NCED isozymes control ABA biosynthesis for ripening and senescent regulation in peach fruits. Plant Science. 2021;304:110739. Richardt S, Timmerhaus G, Lang D, Qudeimat E, Corrêa LGG, Reski R, et al. Microarray analysis of the moss Physcomitrella patens reveals evolutionarily conserved transcriptional regulation of salt stress and abscisic acid signalling. Plant molecular biology. 2010;72:27–45. Wei M, Song M, Fan S, Yu S. Transcriptomic analysis of differentially expressed genes during anther development in genetic male sterile and wild type cotton by digital gene-expression profiling. BMC genomics. 2013;14:1–16. Zhao Q, Guan XY, Zhou LJ, Asad MA, Xu YQ, Pan G, Cheng FM. ABA-triggered ROS burst in rice developing anthers is critical for tapetal programmed cell death induction and heat stress-induced pollen abortion. PLANT CELL AND ENVIRONMENT. 2023;46:1453–71. doi:10.1111/pce.14551. Zou T, Xiong PP, Zhou FX, Zhou D, Chen H, Li GW, et al. Grass-specific ABERRANT MICROSPORE DEVELOPMENT 1 is required for maintaining pollen fertility in rice. PLANT JOURNAL. 2022;111:1509–26. doi:10.1111/tpj.15921. Zhang TB, Yuan SH, Liu ZH, Luo LQ, Guo HY, Li YM, et al. Comparative Transcriptome Analysis Reveals Hormone Signal Transduction and Sucrose Metabolism Related Genes Involved in the Regulation of Anther Dehiscence in Photo-Thermo-Sensitive Genic Male Sterile Wheat. BIOMOLECULES 2022. doi:10.3390/biom12081149. He C, Liu X, Teixeira da Silva, Jaime A, Liu N, Zhang M, Duan J. Transcriptome sequencing and metabolite profiling analyses provide comprehensive insight into molecular mechanisms of flower development in Dendrobium officinale (Orchidaceae). Plant molecular biology. 2020;104:529–48. Gan Z, Shan N, Fei L, Wan C, Chen J. Isolation of the 9-cis-epoxycarotenoid dioxygenase (NCED) gene from kiwifruit and its effects on postharvest softening and ripening. SCIENTIA HORTICULTURAE. 2020;261:109020. Goldberg RB, Beals TP, Sanders PM. Anther development: basic principles and practical applications. The Plant Cell. 1993;5:1217. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Published Journal Publication published 02 Oct, 2025 Read the published version in BMC Plant Biology → Version 1 posted Editorial decision: Revision requested 17 Apr, 2025 Reviews received at journal 10 Apr, 2025 Reviewers agreed at journal 06 Apr, 2025 Reviews received at journal 29 Mar, 2025 Reviewers agreed at journal 02 Mar, 2025 Reviewers invited by journal 20 Feb, 2025 Editor invited by journal 19 Feb, 2025 Editor assigned by journal 13 Feb, 2025 Submission checks completed at journal 13 Feb, 2025 First submitted to journal 12 Feb, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-6013825","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":415241969,"identity":"9c8cbfa5-5c77-46c4-9d02-3149fe029ed1","order_by":0,"name":"Haiyan Zhou","email":"","orcid":"","institution":"Yunnan University","correspondingAuthor":false,"prefix":"","firstName":"Haiyan","middleName":"","lastName":"Zhou","suffix":""},{"id":415241970,"identity":"d2c9ebf8-a956-4bf6-9b4a-d0d99be94e42","order_by":1,"name":"Xiang Li","email":"","orcid":"","institution":"Flower Research Institute of Yunnan Academy of Agricultural Sciences","correspondingAuthor":false,"prefix":"","firstName":"Xiang","middleName":"","lastName":"Li","suffix":""},{"id":415241971,"identity":"9ce49392-24c7-4a2c-8879-40b816c8762f","order_by":2,"name":"Lan Ma","email":"","orcid":"","institution":"Flower Research Institute of Yunnan Academy of Agricultural Sciences","correspondingAuthor":false,"prefix":"","firstName":"Lan","middleName":"","lastName":"Ma","suffix":""},{"id":415241972,"identity":"6791b998-0211-48b9-9a45-e4d054dcd2c4","order_by":3,"name":"Qing Duan","email":"","orcid":"","institution":"Flower Research Institute of Yunnan Academy of Agricultural Sciences","correspondingAuthor":false,"prefix":"","firstName":"Qing","middleName":"","lastName":"Duan","suffix":""},{"id":415241973,"identity":"c66285fc-e120-4101-9d73-2c5d2ccb3ba3","order_by":4,"name":"Wenwen Du","email":"","orcid":"","institution":"Flower Research Institute of Yunnan Academy of Agricultural Sciences","correspondingAuthor":false,"prefix":"","firstName":"Wenwen","middleName":"","lastName":"Du","suffix":""},{"id":415241974,"identity":"2993a100-d821-4c42-af3e-038802f979a2","order_by":5,"name":"Guangfen Cui","email":"","orcid":"","institution":"Flower Research Institute of Yunnan Academy of Agricultural Sciences","correspondingAuthor":false,"prefix":"","firstName":"Guangfen","middleName":"","lastName":"Cui","suffix":""},{"id":415241975,"identity":"fd9044e1-42b5-4e75-93cd-f2c1e85adfdf","order_by":6,"name":"Xuewei Wu","email":"","orcid":"","institution":"Yunnan University","correspondingAuthor":false,"prefix":"","firstName":"Xuewei","middleName":"","lastName":"Wu","suffix":""},{"id":415241976,"identity":"5de24ef1-75a2-4ef0-88d6-c7cff738a9bf","order_by":7,"name":"Wenjie Jia","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABBUlEQVRIiWNgGAWjYBACxmYwxcbDwN7Y/uODwX85Nvb2A0Rq4TncIDmjgNmYj+dMApH2SaQ3SPN8YE6cJ+FggFchczvzM4mPO/hk+CUSG4x5DNjS2yQYEhh+VGzD4zA2M8mZZ9h4JHseNiTOMeDJbZNuPMDYc+Y2Pr+Y3eZtY+MxOJ7YcOCNgURum8yBBGbGNnxa2L/d/gvUYn8gsbGBx8AgnU0iwYCAFh6z24wgWzgSmxl5DBISiNFS/rMXqEXizME2xhkGBwzbgIF8EJ9fDPuPbzb42XbMnr+9/RnDhz8H5OXb2w8++FGBR0sDmDqGKnoAp3ogkIdQNfjUjIJRMApGwUgHACC1V2QHRB3MAAAAAElFTkSuQmCC","orcid":"","institution":"Flower Research Institute of Yunnan Academy of Agricultural Sciences","correspondingAuthor":true,"prefix":"","firstName":"Wenjie","middleName":"","lastName":"Jia","suffix":""},{"id":415241977,"identity":"9be84dc6-2443-4f23-ac28-7b43152e03dd","order_by":8,"name":"Hao Zhang","email":"","orcid":"","institution":"Yunnan University","correspondingAuthor":false,"prefix":"","firstName":"Hao","middleName":"","lastName":"Zhang","suffix":""}],"badges":[],"createdAt":"2025-02-12 09:38:14","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-6013825/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-6013825/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1186/s12870-025-07210-5","type":"published","date":"2025-10-02T15:58:15+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":76427985,"identity":"0d5eee4a-3c68-4013-ae6d-d0ec003b128c","added_by":"auto","created_at":"2025-02-17 06:05:40","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":286109,"visible":true,"origin":"","legend":"\u003cp\u003eObservation of lily paraffin sections. HF: fertile offspring; HS: sterile offspring; Mmc: microspore mother cell; Td: tetrad of a microspore; T: tapetum layer.\u003c/p\u003e","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-6013825/v1/e6c769fe584025846d74293c.png"},{"id":76427987,"identity":"01b3dcc5-20fc-455d-a7ae-8008b5c59c85","added_by":"auto","created_at":"2025-02-17 06:05:40","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":74461,"visible":true,"origin":"","legend":"\u003cp\u003eDetermination of endogenous ABA content in fertile and sterile lines of Lilium. HF: fertile offspring; HS: sterile offspring; I: microspore mother cell stage; II: tetrad stage. Different letters correspond to significant differences among different treatments (\u003cem\u003eP\u003c/em\u003e\u0026lt;0.05).\u003c/p\u003e","description":"","filename":"floatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-6013825/v1/9ca930c2efeb31ddf77a598b.png"},{"id":76428585,"identity":"3429a406-ce97-4c61-8d55-2fd1fd3d1d03","added_by":"auto","created_at":"2025-02-17 06:13:40","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":262901,"visible":true,"origin":"","legend":"\u003cp\u003eCloning of LoNCED gene and homologous comparison.\u003c/p\u003e","description":"","filename":"floatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-6013825/v1/f72016929a969daa28248ed7.png"},{"id":76428929,"identity":"ca7d4c25-47ef-4f5d-a56a-7ce7a512505b","added_by":"auto","created_at":"2025-02-17 06:21:40","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":123860,"visible":true,"origin":"","legend":"\u003cp\u003eDomain and evolutionary analysis of LoNCED\u003c/p\u003e","description":"","filename":"floatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-6013825/v1/9ad3527bed1a6b7f76257fbb.png"},{"id":76427998,"identity":"feb3e1d5-1256-41a8-adce-f3ed6490f3ce","added_by":"auto","created_at":"2025-02-17 06:05:40","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":269523,"visible":true,"origin":"","legend":"\u003cp\u003eRelative expression levels of different varieties of Lilium at different times and in different parts. A: Lilium sterile line at the pollen mother cell stage; B: Lilium fertile line at pollen mother cell stage; C: Lilium sterile line in tetrad stage; D: Lilium fertile line in tetrad. Different letters correspond to significant differences among different treatments (\u003cem\u003eP\u003c/em\u003e\u0026lt;0.05).\u003c/p\u003e","description":"","filename":"floatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-6013825/v1/365542405ea20091f95c3f5a.png"},{"id":76427999,"identity":"590e622c-99f2-4e5f-a0ba-133234a65933","added_by":"auto","created_at":"2025-02-17 06:05:40","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":401488,"visible":true,"origin":"","legend":"\u003cp\u003eBioinformatics prediction of Lily LoNCED protein.\u003c/p\u003e","description":"","filename":"floatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-6013825/v1/dcb0c0565042e25c756edc35.png"},{"id":76428002,"identity":"f3956da5-f483-450b-830f-8d99d260cebf","added_by":"auto","created_at":"2025-02-17 06:05:41","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":244783,"visible":true,"origin":"","legend":"\u003cp\u003ePhylogenetic analysis of LoNCED protein.\u003c/p\u003e","description":"","filename":"floatimage7.png","url":"https://assets-eu.researchsquare.com/files/rs-6013825/v1/9b98e82d8d4cb82290c11960.png"},{"id":76428010,"identity":"8f593ebb-070c-416c-8cbf-50146ec8c4fe","added_by":"auto","created_at":"2025-02-17 06:05:41","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":480286,"visible":true,"origin":"","legend":"\u003cp\u003eThe effect of transient overexpression of LoNCED on lily pollen development and regulation of gene expression. LoNCED-OE: transient overexpression of LoNCED; HF: fertile offspring; HS: sterile offspring; Mmc: microspore mother cell; Td: tetrad of a microspore; T: tapetum layer. Different letters correspond to significant differences among different treatments (\u003cem\u003eP\u003c/em\u003e\u0026lt;0.05).\u003c/p\u003e","description":"","filename":"floatimage8.png","url":"https://assets-eu.researchsquare.com/files/rs-6013825/v1/3ac20c791d82dcae232bcc00.png"},{"id":76428000,"identity":"47c10172-1da1-4b09-b745-3281044266c6","added_by":"auto","created_at":"2025-02-17 06:05:41","extension":"png","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":748396,"visible":true,"origin":"","legend":"\u003cp\u003eLoNCED overexpression transgenic \u003cem\u003eArabidopsis thaliana\u003c/em\u003e phenotypic analysis.\u003c/p\u003e","description":"","filename":"floatimage9.png","url":"https://assets-eu.researchsquare.com/files/rs-6013825/v1/066a27aca8a9c3ab60f6d7a9.png"},{"id":92884045,"identity":"9aba8efc-4316-4465-8fdc-76d304d7f3c7","added_by":"auto","created_at":"2025-10-06 16:12:18","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":3834826,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6013825/v1/3ad5fb59-03f8-43cc-b1e3-301f660878c5.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Expression Profiling and Functional Characterization of LoNCED Gene in Pollen Abortion of Lilium spp.","fulltext":[{"header":"Background","content":"\u003cp\u003e \u003cem\u003eLilium\u003c/em\u003e spp., or lilies, are perennial bulbous flowers in the Liliaceae family, valued for their vibrant colors, fragrance, and cultural symbolism of harmony and good fortune [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. Despite their prominence as cut flowers, lilies pose challenges due to abundant, lightweight pollen grains that adhere to petals and clothing, causing contamination. Manual emasculation, commonly used to address this issue, increases labor costs and risks mechanical damage, reducing ornamental value [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. Therefore, the cultivation of male-sterile, pollen-free lilies represents a pivotal direction for future breeding efforts.\u003c/p\u003e \u003cp\u003eUnlike fertile hybrids, the tapetum in male-sterile lilies behaves differently during microspore mother cell development, preventing microspores from progressing to the tetrad stage. The tapetum, located in the innermost layer of the anther, plays a critical role in supplying nutrients and hormones for microspore development [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. Disruptions in tapetum degradation can lead to male sterility [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e, \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. In tomato, mutations in tapetum cells early in meiosis lead to stamen degeneration and male sterility [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. High-throughput RNA sequencing identified significant differences in gene expression between male-sterile (HS) and fertile (HF) lines, with the differentially expressed genes primarily involved in hormone signal transduction, including auxin, cytokinin, gibberellin, and abscisic acid (ABA) metabolism. Notably, the ABA content was elevated during the tetrad stage. The upregulation of genes associated with ABA biosynthesis, such as NCED, SDR, and AAO, suggested that ABA plays a critical role in regulating tapetum degradation and male sterility [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e].\u003c/p\u003e \u003cp\u003e9-cis-epoxycarotenoid dioxygenase (NCED) is a key enzyme in the biosynthesis of abscisic acid (ABA) through the indirect pathway and plays a crucial role in regulating this process. NCED is part of a multigene family, and studies have shown that it can induce increased ABA levels in response to environmental stress, thereby enhancing plant stress tolerance [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. In tobacco, the NCED gene has been linked to ABA synthesis under drought conditions, with findings indicating that NCED can promote ABA production both under normal and drought conditions [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. Similarly, research on soybean has revealed a correlation between NCED gene expression, protein levels, and ABA content in leaves and roots under water stress, further confirming the role of NCED in ABA regulation under drought stress [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e].In \u003cem\u003eBrassica napus\u003c/em\u003e, the NCED gene family led to the isolation of BnNCED3, which shares significant amino acid sequence similarity with Arabidopsis NCED3 [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. Overexpression of BnNCED3 in transgenic Arabidopsis resulted in increased ABA accumulation and enhanced production of nitric oxide (NO) and reactive oxygen species (ROS), contributing to improved tolerance to abiotic stresses. Furthermore, BnNCED3 was shown to regulate plant growth, including inhibiting seed germination, affecting early-stage development, and promoting ABA-related leaf senescence. These findings suggest that BnNCED3, through modulation of ABA biosynthesis, plays a role in both stress adaptation and plant development [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e].These studies highlight the importance of continuous activation of NCED and the coordination between ABA biosynthesis and catabolism in regulating ABA signaling and its various functions [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e].\u003c/p\u003e \u003cp\u003ePollen development is a crucial stage in plant sexual reproduction, regulated by a complex molecular network involving multiple coordinated processes, such as tapetum function, sporopollenin deposition, callose dynamics, and exine formation [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. The tapetum, often referred to as the \"nutrient factory\" for pollen development, plays a vital role, and its functional abnormalities directly lead to pollen abortion [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. The transcription factor \u003cem\u003eDYT1\u003c/em\u003e (Defective in Tapetal Development and Function 1) regulates the timing of tapetal cell programmed cell death (PCD) by activating downstream genes such as \u003cem\u003eTDF1\u003c/em\u003e (Tapetum Development Delay 1) [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. \u003cem\u003eTDF1\u003c/em\u003e further controls the expression of genes involved in sporopollenin precursor biosynthesis, and its loss of function results in tapetum retention and defective pollen wall formation. Sporopollenin, the primary component of the pollen exine, is synthesized through the action of cytochrome P450 family genes, particularly \u003cem\u003eCYP703A2\u003c/em\u003e, which catalyzes the hydroxylation of fatty acids to generate sporopollenin precursors [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. Mutations in \u003cem\u003eCYP703A2\u003c/em\u003e lead to pollen exine rupture and male sterility, highlighting its indispensable role in pollen wall formation. Callose, synthesized by \u003cem\u003eCALS5\u003c/em\u003e (Callose Synthase 5), forms a protective layer surrounding the tetrads, preventing the leakage of microspore contents [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. Abnormal callose degradation can result in microspore adhesion or rupture. Additionally, \u003cem\u003eDEX1\u003c/em\u003e (Defective in Exine Formation 1) mediates the formation of a scaffold for the initial exine layer, guiding the orderly deposition of sporopollenin [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. The loss of \u003cem\u003eDEX1\u003c/em\u003e function leads to complete disintegration of the exine structure [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. The functional defects of these genes ultimately result in the loss of pollen viability, manifesting as abnormal tapetal PCD (\u003cem\u003eDYT1\u003c/em\u003e/\u003cem\u003eTDF1\u003c/em\u003e), sporopollenin deficiency (\u003cem\u003eCYP703A2\u003c/em\u003e), disruption of the callose barrier (\u003cem\u003eCALS5\u003c/em\u003e), or exine structural collapse (\u003cem\u003eDEX1\u003c/em\u003e).\u003c/p\u003e \u003cp\u003eIn this study, to investigate the role of the LoNCED gene in anther and pollen development in lilies, a male-sterile hybrid population of Oriental Lily, bred over many years by the Institute of Floriculture, Yunnan Academy of Agricultural Sciences, was utilized. Parental individuals, including the maternal (F) and paternal (M) lines, as well as hybrid fertile offspring (HF) and hybrid sterile offspring (HS), were analyzed. Transcriptomic studies of fertile (HF) and sterile (HS) lines identified the LoNCED gene, which was significantly upregulated in the ABA signaling pathway during key stages of pollen development [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. The LoNCED gene was cloned, and its encoded protein was further analyzed and functionally predicted using bioinformatics tools. Overexpression of LoNCED in fertile progeny during the pollen mother cell and tetrad stages was performed to observe its impact on anther development, and the gene was introduced into the model plant Arabidopsis thaliana to explore its expression characteristics and functions. We hypothesized that the LoNCED gene contributes to ABA accumulation, which disrupts pollen development and leads to male sterility in lilies. This study provides insights into the regulatory network of ABA-mediated male sterility by linking LoNCED expression to changes in pollen development and ABA content. These findings establish a theoretical foundation for understanding the role of LoNCED in male sterility in lilies and offer insights for developing pollen-free lily germplasm resources.\u003c/p\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eCytological Differences in Anther Development Between Fertile and Sterile Lily Progenies\u003c/h2\u003e \u003cp\u003eBy comparing paraffin sections of pollen mother cells and tetrads between fertile and sterile lily progenies (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e), we found clear differences in the anther development of the two groups. In sterile progenies, the anther cross-sections at the pollen mother cell stage were similar to those of fertile progenies. The pollen sacs were normally shaped, the epidermal cells were regularly arranged, and the sporogenous cells had large nuclei and dense cytoplasm surrounded by tapetum cells. However, the development of both tapetum cells and pollen mother cells was weaker in sterile progenies compared to fertile ones. At the tetrad stage, tapetum cells in sterile progenies stopped developing and began to break down abnormally. The pollen mother cells showed signs of vacuolation. After the tapetum cells broke down, their contents fused to form a periplasmodium, which entered the anther chamber and surrounded the pollen mother cells, blocking normal progression to the tetrad stage. In contrast, fertile progenies showed microspore mother cells in the center of the microsporangia. These cells had large volumes, prominent nuclei, and dense cytoplasm, gradually growing to the tetrad stage. The tapetum cells were larger, quadrilateral-elongate, and arranged in regular concentric circles. Some tapetum cells had two or more nuclei.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eABA Hormone Content Changes in Sterile and Fertile Hybrids During Anther Development\u003c/h3\u003e\n\u003cp\u003eThe ABA hormone content in sterile hybrids (HS) is significantly higher than in fertile hybrids (HF), particularly during the tetrad stage, where it can reach approximately twice the level in HF. ABA content in HF pollen is notably reduced during the pollen mother cell and tetrad stages, while no significant change is observed in HS pollen. This suggests a more active ABA biosynthesis process in sterile hybrids, potentially linked to changes in hormone regulation during anther development. (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e\n\u003ch3\u003eLily NCED Gene Cloning\u003c/h3\u003e\n\u003cp\u003eThe target band corresponding to the NCED gene CDS sequence was cloned and obtained. Electrophoresis detection showed that the amplified fragment was 1812 bp, consistent with the target band (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). Sequencing results indicated the full length of the gene was 1812 bp, encoding 603 amino acids. Analysis of the conserved domain in the lily NCED amino acid sequence revealed that the LoNCED amino acid sequence contains one conserved NCED domain between positions 4 and 603. Additionally, a comparison of this protein sequence with homologous proteins in Arabidopsis showed that the LoNCED protein is closer to NCED5 and NCED2 based on the clustering results (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e). It was named LoNCED.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eExpression of the LoNCED gene in different parts of lilies.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eDuring the development of lily pollen, at the microspore mother cell stage and the tetrad stage, there are significant differences in gene expression levels in different parts (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e). At the microspore mother cell stage, in the sterile offspring of lilies, the expression level of the Lily LoNCED gene is relatively high in the flower organs, with the highest expression in the anther, reaching an average relative value of 1.35; while the expression in the style is extremely low, with an average relative value of 0.22. In fertile offspring, compared with sterile offspring, the expression level of the Lily LoNCED gene is relatively lower, and the expression in the leaves is also very low. At the tetrad stage, the relative expression trend of the LoNCED gene is roughly the same as that at the microspore mother cell stage, with the expression in sterile offspring of lilies being significantly higher than that in fertile offspring, and the anther also has the highest expression among all flower organs.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e\n\u003ch3\u003eBioinformatics prediction analysis of the protein encoded by the LoNCED gene\u003c/h3\u003e\n\u003cp\u003eThe physicochemical properties and structural characteristics of the amino acid sequence encoded by the LoNCED gene were analyzed using the Prot Param online software in the ExPASy system (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://web.expasy.org/protparam/\u003c/span\u003e\u003cspan address=\"http://web.expasy.org/protparam/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). Prot Param predicted that the protein molecular mass was approximately 66.69 KD, the theoretical isoelectric point (pl) was 5.87, the molecular formula was C2987H4594N814O884S20, and the total number of atoms was 9299. Its amino acid sequence was composed of 20 kinds of amino acids, among which serine (Ser) was the most abundant, accounting for 8.6% of the total amino acids; cysteine (Cys) had the lowest content, accounting for 1.0% of the total amino acids; the total number of negatively charged residues (Asp\u0026thinsp;+\u0026thinsp;Glu) was 69, the total number of positively charged residues (Arg\u0026thinsp;+\u0026thinsp;Lys) was 56, the instability index of the protein was 47.01, and it belonged to unstable proteins. The number of fat (lipophilic) offspring was 78.96, and the total average hydrophilicity (Grand verage of hydropathicity) was 0.381.\u003c/p\u003e \u003cp\u003eThe hydrophobicity and hydrophilicity of the protein encoded by the LoNCED gene were analyzed using the Prot Scale online software in the ExPASy system (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://web.expasy.org/protscale/\u003c/span\u003e\u003cspan address=\"http://web.expasy.org/protscale/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e), with positive values representing hydrophobicity and negative values representing hydrophilicity. The largest site of the amino acids encoded by the LoNCED gene was site 431, with a hydrophobic value of 2.178; the smallest site was site 202, with a hydrophilic value of -2.822. This indicated that the number of hydrophilic amino acids was greater than that of hydrophobic amino acids, so it was speculated that the protein was a stable hydrophilic protein (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA).\u003c/p\u003e \u003cp\u003eThe online software TMHMM Server (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://www.cbs.dtu.dk/services/TMHMM/\u003c/span\u003e\u003cspan address=\"http://www.cbs.dtu.dk/services/TMHMM/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) and SignalP (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://services.healthtech.dtu.dk/services/SignalP-6.0/\u003c/span\u003e\u003cspan address=\"https://services.healthtech.dtu.dk/services/SignalP-6.0/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) were used to predict the transmembrane region and signal peptide of the protein encoded by the LoNCED gene. The results showed that the protein did not have transmembrane regions and signal peptides (Fig.\u0026nbsp;6BC). It was predicted that the protein was located in the cytoplasmic matrix or organelle matrix, and did not belong to membrane proteins or secretory proteins.\u003c/p\u003e \u003cp\u003eThe subcellular localization of the LoNCED protein was predicted using the WoLF PSORT online software (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://wolfpsort.hgc.jp/\u003c/span\u003e\u003cspan address=\"https://wolfpsort.hgc.jp/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e), and the results showed that the scores of the LoNCED protein located in the subcellular were 7 for chloroplast and 7 for mitochondrion, indicating that the LoNCED gene mainly played a role in the cytoplasm and organelles.\u003c/p\u003e \u003cp\u003eThe secondary structure of the LoNCED protein was analyzed using PSIPRED V4.0 (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://bioinf.cs.ucl.ac.uk/psipred\u003c/span\u003e\u003cspan address=\"http://bioinf.cs.ucl.ac.uk/psipred\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e), and the results showed that the protein had three types of secondary structures, including 72 amino acids forming alpha helix, accounting for 11.94%; 187 amino acids forming extended strand, accounting for 31.01%; and 344 amino acids forming random coil, accounting for 57.05%. The main structure of the protein was random coil (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eD).\u003c/p\u003e \u003cp\u003eBy inputting the amino acid sequence into the Swiss-Model program (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.swissmodel.expasy.org/\u003c/span\u003e\u003cspan address=\"https://www.swissmodel.expasy.org/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e), the tertiary structure of the protein encoded by the Lily ATPase3 gene was predicted (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eF). The protein was mainly composed of random coils, and the predictions of the two models were consistent with the results of the secondary structure prediction.\u003c/p\u003e \u003cp\u003eThe protein sequences of LoNCED were compared by multiple sequence alignment method, and the analysis results showed that the amino acid sequence homology with NCED3 was very high, which met the prediction requirements of the STRING database. In order to further analyze the potential functions of LoNCED, we used the STRING website to predict the protein interaction regulatory mechanism of LoNCED. The results showed that there were 10 proteins interacting with it, namely ABA2, PSY1, ZEP, ABI1, RD29A, ABA3, ABI5, ABI2, AAO3 and LTI65 proteins. The straight line (Edge) between the circle and the node corresponded to the interaction between the two proteins connected by the line, and the different colors represented different types of protein-protein interactions (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eE).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e\n\u003ch3\u003eHomology comparison analysis of LoNCED\u003c/h3\u003e\n\u003cp\u003eBy aligning the LoNCED with the NCED sequences of different species and blasting the Lily ATPase3 protein sequence in the NCBI database, the ATPase protein sequences of other species with the highest consistency in the alignment results were selected for phylogenetic tree analysis (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003e). The protein was most closely related to \u003cem\u003eIris pallida\u003c/em\u003e, \u003cem\u003eGladiolus hybrid\u003c/em\u003e cultivar, \u003cem\u003eNarcissus tazetta\u003c/em\u003e and clustered together. Moreover, the amino acid sequence of the LoNCED protein had high similarity with that of other species.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eThe impact of transient overexpression of LoNCED on lily pollen development\u003c/h2\u003e \u003cp\u003eThe relative gene expression levels in the control and overexpression groups of lilies were detected by real-time fluorescence quantitative assay (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eA). It was found that the expression level of LoNCED in the anthers of fertile offspring after overexpression was significantly higher than that in the control group, indicating that the LoNCED gene was successfully overexpressed in the fertile offspring.\u003c/p\u003e \u003cp\u003eIn the microspore mother cell stage and tetrad stage of fertile offspring, overexpression of LoNCED was compared with the empty vector control, and there were significant differences in the morphology of anther development in the microspore mother cell stage and tetrad stage (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eG). In the microspore mother cell stage, the tapetum cells in the anthers overexpressing LoNCED disintegrated in large numbers, and the microspore mother cells were located in the center of the microspore sac, with large cell volume and large nucleus. At this time, in the empty vector control group, the tapetum developed relatively normally, with large cells, square and slender, regularly arranged in a palisade state, and the microspore mother cells developed relatively normally. In the tetrad stage, due to the abnormal development of tapetum cells in the early stage and large-scale disintegration in the anthers overexpressing LoNCED, they could not provide the nutrients and energy substances needed for microspore development, and the microspores began to develop abnormally and gradually disintegrated. The whole anther developed abnormally towards pollen abortion. In the control group, the tapetum cells began to disintegrate in the tetrad stage, and some microspores developed normally. However, since they were grown in vitro tissue culture environment, compared with the normally grown tetrad anthers, there were many abnormal states in microspore development, and many microspores disintegrated and could not normally develop into the mononuclear pollen stage.\u003c/p\u003e \u003cp\u003eIn the two stages of microspore mother cell and tetrad period, the expression of genes related to tapetum development, \u003cem\u003eDYT1\u003c/em\u003e and \u003cem\u003eTDF1\u003c/em\u003e, were significantly downregulated in the anthers overexpressing LoNCED(Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eB-F). In the microspore mother cell stage, the expression of \u003cem\u003eDYT1\u003c/em\u003e in the anthers overexpressing LoNCED was about four times that of the control group, and the expression of \u003cem\u003eTDF1\u003c/em\u003e was reduced by about 30%. In the tetrad stage, the expression of \u003cem\u003eDYT1\u003c/em\u003e in the anthers overexpressing LoNCED was downregulated by about 50%, and the expression of \u003cem\u003eTDF1\u003c/em\u003e was reduced by about 60%. The expression levels of these related genes were all significantly reduced. In the microspore mother cell stage and tetrad stage, the expression of genes related to sporopollenin synthesis (\u003cem\u003eCYP703A2\u003c/em\u003e), callose synthase gene (\u003cem\u003eCALS5\u003c/em\u003e), and primary exine formation gene (\u003cem\u003eDEX1\u003c/em\u003e) were also significantly downregulated in the anthers overexpressing LoNCED.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eThe impact of the LoNCED gene on Arabidopsis pollen development\u003c/h3\u003e\n\u003cp\u003eIn order to explore the regulatory role of the LoNCED gene in anther development, the gene was transferred into the model plant Arabidopsis thaliana, and the relative expression level of the gene in transgenic plants was measured after positive selection (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003eA). The results showed that the LoNCED gene was highly expressed in transgenic plants, with the expression level significantly higher than that in wild-type Arabidopsis (WT), reaching up to 1.3 (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003eB). After harvesting and sowing the Arabidopsis infected by Agrobacterium, resistance selection was carried out again. Seeds were sown on 1/2 MS medium containing 50 mg\u0026middot;L\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e kanamycin. Positive plants emerged about 10 days later, with about four leaves. After emergence, they were transplanted into a 1:1 mixture of nutrient soil and vermiculite for further cultivation. After 20 days of cultivation, it was observed that transgenic Arabidopsis was smaller and weaker than WT, with earlier bolting and thinner leaf growth, but the stem grew faster than the leaves (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003eC). Compared with WT, transgenic Arabidopsis was under obvious stress, with a more delayed growth state and thinner growth of all tissues. Detailed observation of Arabidopsis flower buds through a stereomicroscope revealed that the anthers of transgenic Arabidopsis were underdeveloped and the number of pollen grains was significantly reduced (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003eD). Meanwhile, paraffin sections were made from the flower buds for histological observation (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003eE). Through cytological observation, it was found that the pollen sac and its contents in wild - type Arabidopsis developed completely and could form normal anthers. In contrast, in transgenic Arabidopsis, the microspore mother cells and contents in the anthers gradually degraded during development, the tapetum disintegrated prematurely, the pollen sac gradually deformed, the sac wall became thinner, the contents inside the sac gradually disintegrated, forming a large cavity or the sac wall cracked, thus failing to form anther with normal function. This further indicates that the LoNCED gene is specifically expressed in anther development and may be involved in its regulatory function.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eThe issue of lily pollen contamination remains a key factor affecting the commercial value and market expansion of cut lilies. Pollen not only shortens the ornamental period of flowers but also adheres easily to the skin and clothing, making it difficult to remove and reducing consumer satisfaction. To address this issue, breeding techniques such as hybridization have been successfully used to develop lily varieties with degraded anthers, significantly mitigating the problem of pollen contamination [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e, \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. The formation of pollen-free lilies is mainly attributed to pollen abortion and degradation or the inability to produce normal pollen grains [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. In maize research, abnormalities in the development and degradation of tapetum cells have been identified as key factors leading to pollen abortion. The tapetum is a crucial tissue that provides nutrients and enzymes during pollen development, and its proper differentiation and timely degradation are essential for pollen maturation [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. Therefore, utilizing male sterility traits in lilies for targeted breeding of pollen-free varieties is a reasonable research direction. Studies have shown that insufficient energy supply and hormonal metabolism disorders during anther development may lead to fertility abnormalities, with abscisic acid (ABA) playing a central regulatory role in these processes. For instance, in the tomato male-sterile mutant sl2, endogenous ABA levels in stamens are six times higher than in fertile plants, indicating that ABA accumulation may directly impact normal stamen development [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. Similarly, in K and T cytoplasmic male-sterile materials, ABA levels significantly increase during the critical period of pollen abortion, suggesting that ABA accumulation may be closely related to the activation of male sterility gene expression [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eIn the regulation of ABA biosynthesis, 9-cis-epoxycarotenoid dioxygenase (NCED) serves as a key rate-limiting enzyme, with its expression levels positively correlated with ABA accumulation [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. The LeNCED1 gene, isolated from tomatoes, exhibits significantly increased transcription levels under drought stress, and its overexpression results in a marked accumulation of ABA, leading to prolonged seed dormancy [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. In Arabidopsis, the AtNCED3 gene was cloned, and transgenic plants with sense expression exhibited significantly higher ABA levels and enhanced drought tolerance, whereas antisense transgenic plants were more sensitive to drought stress [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. These findings suggest that NCED genes not only regulate ABA accumulation under stress conditions but may also influence plant growth, development, and reproductive processes. Studies in crops such as avocado [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e], cowpea [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e], grape [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e], peanut [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e], and common bean leaves [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e] have also revealed that NCED genes are significantly induced under stress conditions, promoting ABA accumulation and conferring stress resistance. Research on sweet cherry has shown that the PavNCED gene is highly expressed during floral bud dormancy, regulating ABA metabolism and controlling the transition between floral bud growth and dormancy [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]. More recent studies further indicate that NCED subfamily genes play an important regulatory role in plant pollen development [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e, \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThis study conducted the cloning and functional expression analysis of the LoNCED gene in lilies, clarifying its regulatory role in anther abortion and laying a theoretical foundation for further exploration of its specific regulatory functions in lily male sterility. The study demonstrated a positive correlation between LoNCED expression and abscisic acid (ABA) accumulation, a key phytohormone involved in stress responses and reproductive development [\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]. The protein encoded by this gene contains an open reading frame (ORF) of 1,812 bp, encoding 603 amino acids. Bioinformatics analysis of the encoded protein revealed a relative molecular weight of approximately 66.69 kDa and a theoretical isoelectric point of 5.87. It is a hydrophilic protein with no transmembrane domains or signal peptides. The protein is primarily localized in chloroplasts and mitochondria, consistent with its involvement in ABA biosynthesis [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]. Furthermore, secondary structure predictions revealed a high proportion of random coils, indicating potential structural flexibility and functional stability, in agreement with tertiary structure predictions.\u003c/p\u003e \u003cp\u003eThe LoNCED gene in sterile lily progeny was found to be significantly upregulated in anthers during the pollen mother cell and tetrad stages, suggesting that its increased expression leads to ABA accumulation, thereby affecting normal pollen development. This study further quantified ABA levels in lily anthers and analyzed the relative expression of LoNCED during key stages of anther development. Gene cloning and bioinformatics analyses revealed that the LoNCED protein lacks transmembrane domains and signal peptides, is hydrophilic, and exhibits high sequence similarity with NCED proteins from other species. The functional characterization of LoNCED as an NCED-family enzyme\u0026mdash;known for catalyzing the rate-limiting step in ABA biosynthesis\u0026mdash;supports the hypothesis that its misregulation contributes to male sterility in lilies [\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e]. Phylogenetic analysis revealed high sequence similarity between LoNCED and NCED homologs from other species, reinforcing its evolutionary conservation and functional importance in reproductive development [\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eTransient expression experiments in lily anthers revealed that LoNCED overexpression caused abnormal microspore development, accompanied by the significant downregulation of genes critical for microspore formation and maturation [\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e, \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e]. Similar effects have been observed in other plant species, where ABA accumulation has been linked to tapetum degeneration, pollen abortion, and defective anther dehiscence, as seen in rice [\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e] and wheat [\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e]. These findings further reinforce the role of LoNCED as a key regulator of ABA biosynthesis, directly influencing lily anther development and ultimately contributing to male sterility. For functional validation, the LoNCED gene was overexpressed in Arabidopsis, leading to phenotypic changes such as inhibited growth, early bolting, and accelerated flowering. These findings suggest that LoNCED may play a role in plant developmental timing and hormonal regulation. Given that ABA is a key phytohormone regulating both stress responses and floral development, its misregulation due to LoNCED overexpression could severely disrupt anther development and pollen formation, ultimately contributing to male sterility. These findings further support the hypothesis that LoNCED-mediated ABA accumulation plays a crucial role in reproductive abnormalities.\u003c/p\u003e \u003cp\u003eAlthough this study provides an initial understanding of LoNCED expression in lily anthers and its effect on ABA accumulation, its precise regulatory mechanisms require further investigation. Future research should focus on LoNCED signaling pathways, its interactions with ABA biosynthesis and metabolism, and its specific role in lily fertility regulation to provide stronger theoretical support. Notably, previous studies have demonstrated the importance of bioinformatics in NCED functional research, with the cloning and bioinformatics analysis of the AcNCED gene in kiwifruit (\u003cem\u003eActinidia chinensis\u003c/em\u003e) and NCED genes in \u003cem\u003eDendrobium officinale\u003c/em\u003e, revealing their high expression patterns under abiotic stress [\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e, \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e]. Drawing on these research experiences and integrating genetic transformation with functional validation will further enhance our understanding of LoNCED, providing new technological pathways and theoretical foundations for molecular breeding of pollen-free lilies.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eThe LoNCED gene exhibits differential expression in various floral organs and at different developmental stages in lilies, with predominant expression in anthers during the pollen mother cell stage. Overexpression of LoNCED resulted in abnormal anther development in lilies, preventing the formation of normal microspores, with a significant downregulation of microspore development-related genes. In transgenic Arabidopsis plants overexpressing LoNCED, phenotypic abnormalities such as defective anther development, weak growth, and early bolting were observed. Additionally, the contents of anthers gradually degraded, the tapetum disintegrated prematurely, pollen sacs became deformed, and the inner substances of the sacs degraded, leading to the formation of a large cavity or breakdown of the sac walls, ultimately preventing the formation of functional anthers.\u003c/p\u003e "},{"header":"Methods","content":"\u003ch2\u003ePlant materials\u003c/h2\u003e\u003cp\u003eThis study examines fertile (HF) and sterile (HS) offspring from the hybridization of pollen-bearing ‘Siberia’ lily (maternal, F) and ‘Marco polo’ lily (paternal, M), grown at the Lily Breeding Base of the Yunnan Academy of Agricultural Sciences (25° 7’33’’ N, 102° 45’48’’ E). Anthers and floral organs at various developmental stages were collected based on bud size [\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e]. \u003cem\u003eArabidopsis thaliana\u003c/em\u003e wild-type Col was used for transgenic plants. All plants were cultivated in a growth chamber, under 22 ± 2°C, 16 h light/8 h dark, with a vermiculite-peat substrate (1:1). Fresh anthers were collected and immediately weighed. The samples were rapidly frozen in liquid nitrogen and stored at -80°C for subsequent analysis.\u003c/p\u003e\u003ch2\u003eParameters determination\u003c/h2\u003e\u003ch2\u003eCytological observation\u003c/h2\u003e\u003cp\u003ePollen samples were fixed in FAA solution (100 mL containing 5 mL of 38% formaldehyde, 5 mL of acetic acid, and 90 mL of 70% ethanol) for 24 hours, followed by dehydration through ethanol gradients (75%, 85%, 90%, and 95%) for 4, 2, 2, and 1 hours, respectively. The samples were soaked in anhydrous ethanol for 60 minutes, then immersed in a benzene-ethanol mixture for 5–10 minutes, followed by two xylene treatments for 5–10 minutes each. The samples were infiltrated with molten paraffin at 65°C for three 1-hour cycles, then embedded using a paraffin embedding machine. For sectioning, 4 µm thick paraffin sections were cut with a rotary microtome, and dried at 60°C. Then, the slices were classified by safranin O-fast green staining, sections were stained with 1% safranin-O for 1 h, washed with distilled water, discoloured and then counter-stained with 0.5% fast green for 1 min (G1031, Servicebio, Wuhan, China). The sections were finally observed and photographed under an optical microscope (YS100; Nikon, Tokyo, Japan).\u003c/p\u003e\u003ch2\u003eExamination of the ABA content\u003c/h2\u003e\u003cp\u003eThe ABA content was determined using high-performance liquid chromatography (HPLC). An appropriate amount of plant sample was extracted with 80% methanol using ultrasonic treatment for 30 min, followed by centrifugation at 12,000 rpm for 10 min. The supernatant was collected, filtered through a 0.22 µm membrane, and then injected for analysis. HPLC was performed using a C18 reversed-phase column (250 mm × 4.6 mm, 5 µm) with a mobile phase of methanol/water (60:40, v/v) at a flow rate of 1.0 mL/min, a column temperature of 30°C, and a detection wavelength of 265 nm. The ABA content in the samples was calculated based on peak area using a standard curve generated from ABA standard solutions.\u003c/p\u003e\u003ch2\u003eTotal RNA Extraction and cDNA Synthesis\u003c/h2\u003e\u003cp\u003eFresh-cut lily flowers were collected, and different floral tissues were separated. Approximately 50 mg of each sample was weighed and rapidly ground into a fine powder in liquid nitrogen. Subsequently, 1 mL of Trizol reagent was added (ensuring the sample volume did not exceed 10% of the Trizol volume). The mixture was left at room temperature for 5 min, followed by the addition of 0.2 mL chloroform per 1 mL Trizol. The tubes were tightly capped and vigorously shaken for 15 s to ensure thorough mixing. After a complete reaction, samples were centrifuged at 12,000 rpm for 10 min, and the upper aqueous phase was transferred to a new centrifuge tube. RNA precipitation was performed by adding 0.5 mL isopropanol per 1 mL Trizol, incubating at room temperature for 10 min, and centrifuging at 12,000 rpm for another 10 min. The supernatant was discarded, and the RNA pellet was washed with 75% ethanol, vortexed briefly, and centrifuged at 7,500 rpm at 4°C for 5 min. The ethanol was carefully removed, and the RNA pellet was dried at room temperature or under vacuum for 5–10 min before dissolving in RNase-free water. If necessary, the RNA was further solubilized by incubation at 55–60°C for 10 min. The extracted RNA samples were stored at -80°C. cDNA synthesis was performed according to the manufacturer’s protocol. A 10 µL reaction system was prepared for gDNA removal and incubated on ice, followed by a 10 µL reverse transcription reaction system. After thorough mixing, the reaction was incubated at 42°C for 15 min, followed by inactivation at 95°C for 1 min, and then cooled on ice. The synthesized cDNA was stored at -20°C for further use.\u003c/p\u003e\u003ch2\u003eqRT-PCR Expression\u003c/h2\u003e\u003cp\u003eAnalysis of LoNCED GeneTotal RNA was extracted from anthers at different developmental stages of fertile and sterile lily progeny and reverse-transcribed into cDNA. Specific primers for the LoNCED gene were designed using the NCBI database (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://www.ncbi.nlm.nih.gov/Structure/cdd/wrpsb.cgi\u003c/span\u003e\u003cspan address=\"http://www.ncbi.nlm.nih.gov/Structure/cdd/wrpsb.cgi\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). qRT-PCR was performed using the TaKaRa TB Green Premix Ex Taq Ⅱ kit in a 20 µL reaction system containing 10 µL TB Green Premix Ex Taq Ⅱ (Tli RNaseH Plus), 0.8 µL of each forward and reverse primer, 0.4 µL ROX Reference Dye (50X), 2 µL cDNA template, and 6 µL ddH₂O. The qRT-PCR program was as follows: pre-denaturation at 95°C for 2 min, followed by 40 cycles of 95°C for 15 s, 60°C for 30 s, and 72°C for 30 s. A melting curve analysis was performed with the following steps: 95°C for 15 s, 60°C for 60 s, and 95°C for 15 s. Each sample was analyzed in triplicate. The β-actin gene was used as an internal reference, and the relative expression of LoNCED in fertile and sterile lily anthers at key developmental stages was calculated using the 2\u003csup\u003e−ΔΔCt\u003c/sup\u003e method.\u003c/p\u003e\u003cdiv class=\"gridtable\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003einformation of primers\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e\u003ccolgroup cols=\"2\"\u003e\u003c/colgroup\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePrimer name\u003c/p\u003e \u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePrimer sequence(5′-3′)\u003c/p\u003e \u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLoNCED-cloning\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: TGCTGACCGTATGAGCAAGG; R: GACGATGGCTGGACCAGATT\u003c/p\u003e \u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003epNC-Cam23FC-LoNCED\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: TTTCCATAGGCCGCCCCTGA; R: CGCGTAATCTGCTGCTTGCA\u003c/p\u003e \u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLoActin\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: TGCTGACCGTATGAGCAAGG; R: GACGATGGCTGGACCAGATT\u003c/p\u003e \u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLoNCED\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: GTGGTCTCTGTCCAGTCCTGGCCTC; R: GTCTCAGCAGACCACAAGTG\u003c/p\u003e \u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAtActin\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: TGAGATTCGACATGCCCGA; R: TGGATTCCAGCAGCTTCCAT\u003c/p\u003e \u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAt-LoNCED\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: GCTTCATCGTCCCCATCTC; R: GAAGACAGTATCCTCGCCATGG\u003c/p\u003e \u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eDYT1\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: CATGCCAAACCACAGGGTTCCC; R: ATATACGCAGCGACCGCATGG\u003c/p\u003e \u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTDF1\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: GAGCTGCCCATTCTTGAGTCC; R: CACGCAGCGCGTGAGCTAC\u003c/p\u003e \u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCYP703A2\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: TAGCACGTACATTGGGAACCC; R: AAGCCGTACATTGGGAACCG\u003c/p\u003e \u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCALS5\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: GCTCTTCCGCTTCCTCGCT; R: CACTGACTCGCTGCGCTCG\u003c/p\u003e \u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eDEX1\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: TATGTCCTGATAGCGGTCCGC; R: CAGCTGCGCAAGGAACGC\u003c/p\u003e \u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/table\u003e\u003c/div\u003e\u003ch2\u003eCloning of LoNCED Gene\u003c/h2\u003e\u003cp\u003eBased on transcriptome sequencing data from pollen mother cell stages of fertile and sterile lily progeny, a differentially expressed gene annotated as NCED3 was selected for amplification and validation in fertile lily anthers. Specific primers were designed, and PCR amplification was performed using cDNA as a template. The 25 µL PCR reaction system included 12.5 µL Q5 High-Fidelity 2X Master Mix, 1.25 µL of each forward and reverse primer, 1 µL cDNA template, and 9 µL ddH₂O. The PCR program was as follows: pre-denaturation at 98°C for 2 min, followed by 35 cycles of 98°C for 15 s, 56°C for 30 s, and 72°C for 30 s. PCR products were verified by 1% agarose gel electrophoresis, and the target band was excised and purified. The purified product was ligated into the pRI101-GFP vector and transformed into competent Escherichia coli cells. Positive clones were screened by colony PCR, and selected clones were sent for sequencing validation.\u003c/p\u003e\u003ch2\u003eBioinformatics Analysis of LoNCED Gene\u003c/h2\u003e\u003cp\u003eVarious bioinformatics tools were employed to analyze the properties of the LoNCED protein. The amino acid sequence of the LoNCED gene was subjected to BLASTP analysis in the NCBI database (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://www.ncbi.nlm.nih.gov/Structure/cdd/wrpsb.cgi\u003c/span\u003e\u003cspan address=\"http://www.ncbi.nlm.nih.gov/Structure/cdd/wrpsb.cgi\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) to determine sequence homology and evolutionary relationships.\u003c/p\u003e\u003ch2\u003eConstruction of the Overexpression Vector\u003c/h2\u003e\u003cp\u003eThe correctly sequenced bacterial culture was incubated in LB medium containing Kanamycin at 37°C for 12–16 hours. Plasmid extraction was performed following the steps outlined in the TanGen Plasmid Mini Kit, and the concentration and purity of the extracted plasmid were assessed. Using the extracted plasmid as a template, primers were designed based on the In-Fusion cloning principle for vector construction. The target fragment was amplified using the high-fidelity 2X F8 FastLong PCR MasterMix, following the recommended amplification protocol. The amplified fragment was recovered using 1% agarose gel electrophoresis and purified before being recombined with the vector. For linearization of the plant expression vector pNC-Cam23FC-eGFP, a single restriction enzyme digestion was performed using SfiI, following the manufacturer’s protocol. The digestion reaction was carried out at 37°C for 1 hour, and the digested product was purified and recovered. The purified vector fragment was then treated using a PCR purification kit, and the linearized plant expression vector was ligated with the digested target fragment at 37°C for 30 hours. The ligation product was subsequently transformed into Escherichia coli DH5α. Single colonies were selected, cultured, and validated by sequencing.\u003c/p\u003e\u003ch2\u003eAgrobacterium-Mediated Genetic Transformation of Lilium for Overexpression of LoNCED\u003c/h2\u003e\u003cp\u003eCompetent cells of Agrobacterium tumefaciens strain EHA105, stored at -80°C, were thawed on ice or in a greenhouse. Under sterile conditions, the constructed plasmid was added to the freshly thawed competent cell suspension for transformation. The transformed Agrobacterium culture was plated onto YEP solid medium supplemented with 50 µL Kanamycin and 50 µL Rifampicin. After the liquid had fully absorbed, the plates were inverted and incubated at 28°C for 48–72 hours. Once bacterial colonies had grown, a single colony was picked and inoculated into 500 µL YEP liquid medium (containing 50 µL Kanamycin) in a centrifuge tube and cultured at 28°C with shaking at 220 rpm overnight. The incubation time was adjusted according to colony size, typically kept within 20 hours.The overnight bacterial culture was subjected to colony PCR identification. Positive bacterial cultures displaying the correct PCR band were diluted at ratios of 1:50 or 1:25 into fresh YEP medium containing 50 µL Kanamycin and 50 µL Rifampicin and incubated at 28°C with shaking at 220 rpm for 8–16 hours. This step was repeated in 50 mL centrifuge tubes, followed by further incubation in 250 mL Erlenmeyer flasks containing 50 mL YEP medium under the same conditions for 12 hours. After incubation, the bacterial suspension was centrifuged at 2,000 rpm for 10 minutes, and the supernatant was discarded. The bacterial pellet was washed twice with sterile water and then resuspended in MS liquid medium supplemented with 0.1 mM acetosyringone. The final bacterial suspension was adjusted to OD600 = 0.6. Freshly excised Lilium anthers at the pollen mother cell stage and tetrad stage were punctured with small holes and immersed in the Agrobacterium suspension. The anthers were incubated in a shaker for 15 minutes, then transferred onto sterile filter paper to remove excess bacterial solution. The anthers were subsequently placed on MS solid medium and co-cultivated in darkness at 28°C ± 2°C for 3 days. Following co-cultivation, the anthers were washed with Cefotaxime, then transferred to selection medium (MS medium containing 50 mg/L Kanamycin) and incubated at 28°C ± 2°C. After 1 day of MS medium culture, transgene expression was analyzed using marker gene detection.\u003c/p\u003e\u003ch2\u003eAgrobacterium-Mediated Transformation of Arabidopsis and Selection of Transgenic Plants\u003c/h2\u003e\u003cp\u003eFloral dip transformation was used for Agrobacterium-mediated genetic transformation of Arabidopsis thaliana. The recombinant plasmid was first introduced into Agrobacterium strain EHA105, and the bacterial suspension was prepared at OD600 = 0.8–1.2. Silwet-L77 was added to a final concentration of 0.02%, and the entire inflorescence of Arabidopsis plants was dipped into the bacterial suspension for 2–3 seconds. After dipping, the plants were covered with plastic wrap to maintain humidity and incubated in the dark at 25°C for 24 hours. This infection process was repeated three times at 7-day intervals. Following infection, the plants were cultivated under 16-hour light/8-hour dark conditions at 23°C until seed maturation. Mature seeds were carefully collected by gently rubbing the siliques onto clean white paper, then wrapped and dried at 37°C for 24 hours. Once dried, the seeds were sieved using a 60-mesh screen. A portion of the harvested T0 transgenic seeds was vernalized in darkness at 4°C for 2–3 days, then surface-sterilized with 10% NaClO for 10 minutes and rinsed 4–5 times with sterile water. The sterilized seeds were evenly spread onto MS selection medium containing 50 mg·L\u003csup\u003e-1\u003c/sup\u003e Kanamycin and incubated in a growth chamber for 10–14 days. Healthy, normally growing seedlings were identified as transgenic and transferred to nutrient soil (vermiculite + perlite) for further growth.\u003c/p\u003e\u003ch2\u003eStatistical analysis\u003c/h2\u003e\u003cp\u003eData were analyzed using descriptive statistics in Excel 2024 and plotted by GraphPad. SPSS statistics 20 statistical analysis software was used for difference significance test, and Duncan test the difference of the average value of different treatments at the level of \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003eAcknowledgements\u003c/p\u003e\n\u003cp\u003eWe thank the Xiangning Wang for experimental site support. We also thank for improving the scientific language of the manuscript.\u003c/p\u003e\n\u003cp\u003eFunding\u003c/p\u003e\n\u003cp\u003eThe study was supported by the Program of Yunnan Seed Laboratory (202205AR070001-14), the Science and Technology Project of Yunnan Provincial Department of Science and Technology (202301AT070345), Yunnan Fundamental Research Projects (202401BD070001-098) and Yunnan Academy of Agricultural Sciences Pre-research Project (2024KYZX-04). \u0026nbsp;\u003c/p\u003e\n\u003cp\u003eAvailability of data and materials\u003c/p\u003e\n\u003cp\u003eThe data that support the findings of this study are available from the first author upon reasonable request.\u003c/p\u003e\n\u003cp\u003eEthics approval and consent to participate\u003c/p\u003e\n\u003cp\u003eWe confirm that our study does not involve human subjects.\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCompeting interests\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.\u003c/p\u003e\n\u003cp\u003eConsent for publication\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003eAuthors\u0026rsquo; contributions\u003c/p\u003e\n\u003cp\u003eHY.Z. and WJ.J. conducted field experiments and collected data. Q.D and L.M. supervised the project. HY.Z. and X.L. performed statistical analysis and produced charts and diagrams. HY.Z., X.L. and WW.D. contributed to writing the manuscript. GF.C., XW.W. and H.Z. provided critical comments in planning the the manuscript. All the authors discussed the results and revised the manuscript. The author(s) read and approved the final manuscript.\u003c/p\u003e\n\u003cp\u003eAuthor details\u003c/p\u003e\n\u003cp\u003e\u003csup\u003e1\u003c/sup\u003e School of Agriculture, Yunnan University, Kunming 650205, China.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003csup\u003e2\u003c/sup\u003e Flower Research Institute of Yunnan Academy of Agricultural Sciences, Yunnan Provincial Key\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eLaboratory of Flower Breeding, National Engineering Research Center for Ornamental Horticulture,\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eYunnan Seed Laboratory, Kunming, 650205, China.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eLiang Y, Gao Q, Li F, Du Y, Wu J, Pan W, et al. The giant genome of lily provides insights into the hybridization of cultivated lilies. NATURE COMMUNICATIONS. 2025;16:45.\u003c/li\u003e\n\u003cli\u003eMoriyama T, Shea DJ, Yokoi N, Imakiire S, Saito T, Ohshima H, et al. Identification of a Male Sterile Candidate Gene in Lilium x formolongi and Transfer of the Gene to Easter Lily (L. longiflorum) via Hybridization. FRONTIERS IN PLANT SCIENCE. 2022;13.\u003c/li\u003e\n\u003cli\u003eWilson ZA, Song J, Taylor B, Yang C. The final split: the regulation of anther dehiscence. J Exp Bot. 2011;62:1633\u0026ndash;49. doi:10.1093/jxb/err014.\u003c/li\u003e\n\u003cli\u003eLi H, Yuan Z, Vizcay-Barrena G, Yang CY, Liang WQ, Zong J, et al. \u003cem\u003ePERSISTENT TAPETAL CELL1\u003c/em\u003e Encodes a PHD-Finger Protein That Is Required for Tapetal Cell Death and Pollen Development in Rice. PLANT PHYSIOLOGY. 2011;156:615\u0026ndash;30. doi:10.1104/pp.111.175760.\u003c/li\u003e\n\u003cli\u003eSanders PM, Bui AQ, Le BH, Goldberg RB. Differentiation and degeneration of cells that play a major role in tobacco anther dehiscence. SEXUAL PLANT REPRODUCTION. 2005;17:219\u0026ndash;41. doi:10.1007/s00497-004-0231-y.\u003c/li\u003e\n\u003cli\u003eChaban IA, Kononenko NV, Gulevich AA, Bogoutdinova LR, Khaliluev MR, Baranova EN. Morphological Features of the Anther Development in Tomato Plants with Non-Specific Male Sterility. Biology 2020. doi:10.3390/biology9020032.\u003c/li\u003e\n\u003cli\u003eJia WJ, Li X, Wang R, Duan Q, He JN, Gao JP, Wang JH. Disruption of the Contents of Endogenous Hormones Cause Pollen Development Obstruction and Abortion in Male-Sterile Hybrid Lily Populations. PLANTS-BASEL 2023. doi:10.3390/plants12223804.\u003c/li\u003e\n\u003cli\u003eHuang Y, Guo Y, Liu Y, Zhang F, Wang Z, Wang H, et al. 9-cis-Epoxycarotenoid Dioxygenase 3 Regulates Plant Growth and Enhances Multi-Abiotic Stress Tolerance in Rice. FRONTIERS IN PLANT SCIENCE. 2018;9.\u003c/li\u003e\n\u003cli\u003eDoerffling K. The Discovery of Abscisic Acid: A Retrospect. JOURNAL OF PLANT GROWTH REGULATION. 2015;34:795\u0026ndash;808. doi:10.1007/s00344-015-9525-6.\u003c/li\u003e\n\u003cli\u003eQin XQ, Zeevaart JA. The 9-\u003cem\u003ecis\u003c/em\u003e-epoxycarotenoid cleavage reaction is the key regulatory step of abscisic acid biosynthesis in water-stressed bean. PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF THE UNITED STATES OF AMERICA. 1999;96:15354\u0026ndash;61. doi:10.1073/pnas.96.26.15354.\u003c/li\u003e\n\u003cli\u003eXu P, Cai W. Functional characterization of the BnNCED3 gene in Brassica napus. Plant Science. 2017;256:16\u0026ndash;24. doi:10.1016/j.plantsci.2016.11.012.\u003c/li\u003e\n\u003cli\u003eXu Z, Ma J, Lei P, Wang Q, Feng X, Xu H. Poly-\u0026gamma;-glutamic acid induces system tolerance to drought stress by promoting abscisic acid accumulation in Brassica napus L. Scientific Reports. 2020;10:252. doi:10.1038/s41598-019-57190-4.\u003c/li\u003e\n\u003cli\u003eKende H, Zeevaart JA. The five \u0026apos;\u0026apos;classical\u0026apos;\u0026apos; plant hormones. PLANT CELL. 1997;9:1197\u0026ndash;210. doi:10.1105/tpc.9.7.1197.\u003c/li\u003e\n\u003cli\u003eZhao W, Hou Q, Qi Y, Wu S, Wan X. Structural and molecular basis of pollen germination. PLANT PHYSIOLOGY AND BIOCHEMISTRY. 2023;203:108042. doi:10.1016/j.plaphy.2023.108042.\u003c/li\u003e\n\u003cli\u003eZhang X, Bei Z, Ma H, Wei Z, Zhou J, Ren Y, et al. Abnormal Programmed Cell Death of Tapetum Leads to the Pollen Abortion of Lycium barbarum Linnaeus. Horticulturae. 2022;8:1056.\u003c/li\u003e\n\u003cli\u003eGu J-N, Zhu J, Yu Y, Teng X-D, Lou Y, Xu X-F, et al. DYT1 directly regulates the expression of \u003cem\u003eTDF1\u003c/em\u003e for tapetum development and pollen wall formation in Arabidopsis. PLANT JOURNAL. 2014;80:1005\u0026ndash;13. doi:10.1111/tpj.12694.\u003c/li\u003e\n\u003cli\u003eMa H, Wu Y, Lv R, Chi H, Zhao Y, Li Y, et al. Cytochrome P450 mono‐oxygenase CYP703A2 plays a central role in sporopollenin formation and ms5ms6 fertility in cotton. JOURNAL OF INTEGRATIVE PLANT BIOLOGY. 2022;64:2009\u0026ndash;25.\u003c/li\u003e\n\u003cli\u003eDong XY, Hong ZL, Sivaramakrishnan M, Mahfouz M, Verma DP. Callose synthase (CalS5) is required for exine formation during microgametogenesis and for pollen viability in Arabidopsis. PLANT JOURNAL. 2005;42:315\u0026ndash;28. doi:10.1111/j.1365-313X.2005.02379.x.\u003c/li\u003e\n\u003cli\u003ePaxson-Sowders DM, Dodrill CH, Owen HA, Makaroff CA. DEX1, a novel plant protein, is required for exine pattern formation during pollen development in Arabidopsis. PLANT PHYSIOLOGY. 2001;127:1739\u0026ndash;49. doi:10.1104/pp.010517.\u003c/li\u003e\n\u003cli\u003eQuilichini TD, Douglas CJ, Samuels AL. New views of tapetum ultrastructure and pollen exine development in Arabidopsis thaliana. ANNALS OF BOTANY. 2014;114:1189\u0026ndash;201.\u003c/li\u003e\n\u003cli\u003eImakiire S, Okazaki K, Yokoi N, Saito T. Development of pollen-free easter lily strains by cross-breeding Lilium\u0026times; formolongi Hort. and easter lily (Lilium longiflorum Thunb.). 2023.\u003c/li\u003e\n\u003cli\u003eJenkins ES, Paul W, Craze M, Whitelaw CA, Weigand A, Roberts JA. Dehiscence-related expression of an \u003cem\u003eArabidopsis thaliana\u003c/em\u003e gene encoding a polygalacturonase in transgenic plants of \u003cem\u003eBrassica napus\u003c/em\u003e. PLANT CELL AND ENVIRONMENT. 1999;22:159\u0026ndash;67. doi:10.1046/j.1365-3040.1999.00372.x.\u003c/li\u003e\n\u003cli\u003eAn XL, Ba B, Duan MJ, Dong ZY, Liu RG, Yuan DY, et al. Molecular regulation of \u003cem\u003eZmMs7\u003c/em\u003e required for maize male fertility and development of a dominant male-sterility system in multiple species. PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF THE UNITED STATES OF AMERICA. 2020;117:23499\u0026ndash;509. doi:10.1073/pnas.2010255117.\u003c/li\u003e\n\u003cli\u003eMao Shengli, Du Yongchen, Wang Xiaoxuan, Zhu Dewei, Gao Jianchang, Dai Shanshu. Changes of Endogenous Abscisic Acid and the Effent of Exogenous ABA onPollen Germination under Heat Stress Tomato. Acta Horticulturae Sinica. 2005;32:234\u0026ndash;8.\u003c/li\u003e\n\u003cli\u003eWu B, Xia Y, Zhang G, Wang Y, Wang J, Ma S, et al. Transcriptomics reveals a core transcriptional network of K-type cytoplasmic male sterility microspore abortion in wheat (Triticum aestivum L.). BMC Plant Biology. 2023;23:618.\u003c/li\u003e\n\u003cli\u003eMarchler-Bauer A, Lu S, Anderson JB, Chitsaz F, Derbyshire MK, DeWeese-Scott C, et al. CDD: a Conserved Domain Database for the functional annotation of proteins. Nucleic acids research. 2011;39:D225-9. doi:10.1093/nar/gkq1189.\u003c/li\u003e\n\u003cli\u003eBurbidge A, Grieve T, Jackson A, Thompson A, Taylor I. Structure and expression of a cDNA encoding a putative neoxanthin cleavage enzyme (NCE), isolated from a wilt-related tomato (\u003cem\u003eLycopersicon esculentum\u003c/em\u003e Mill.) library. JOURNAL OF EXPERIMENTAL BOTANY. 1997;48:2111\u0026ndash;2. doi:10.1093/jxb/48.12.2111.\u003c/li\u003e\n\u003cli\u003eBehnam B, Iuchi S, Fujita M, Fujita Y, Takasaki H, Osakabe Y, et al. Characterization of the promoter region of an Arabidopsis gene for 9-cis-epoxycarotenoid dioxygenase involved in dehydration-inducible transcription. DNA research. 2013;20:315\u0026ndash;24.\u003c/li\u003e\n\u003cli\u003eChernys JT, Zeevaart JA. Characterization of the 9-cis-epoxycarotenoid dioxygenase gene family and the regulation of abscisic acid biosynthesis in avocado. PLANT PHYSIOLOGY. 2000;124:343\u0026ndash;53. doi:10.1104/pp.124.1.343.\u003c/li\u003e\n\u003cli\u003eIuchi S, Kobayashi M, Yamaguchi-Shinozaki K, Shinozaki K. A stress-inducible gene for 9-cis-epoxycarotenoid dioxygenase involved in abscisic acid biosynthesis under water stress in drought-tolerant cowpea. PLANT PHYSIOLOGY. 2000;123:553\u0026ndash;62. doi:10.1104/pp.123.2.553.\u003c/li\u003e\n\u003cli\u003eZhang M, Leng P, Zhang G, Li X. Cloning and functional analysis of 9-cis-epoxycarotenoid dioxygenase (NCED) genes encoding a key enzyme during abscisic acid biosynthesis from peach and grape fruits. Journal of Plant Physiology. 2009;166:1241\u0026ndash;52.\u003c/li\u003e\n\u003cli\u003eWan XR, Li L. Molecular cloning and characterization of a dehydration-inducible cDNA encoding a putative 9-\u003cem\u003ecis\u003c/em\u003e-epoxycarotenoid dioxygenase in \u003cem\u003eArachis hygogaea\u003c/em\u003e L. DNA SEQUENCE. 2005;16:217\u0026ndash;23. doi:10.1080/10425170500129785.\u003c/li\u003e\n\u003cli\u003eWang L, Sun W, Liu X, Xu Y, Lyu Z, Liu R, et al. Genome-wide identification of the NCED gene family and functional characterization of PavNCED5 related to bud dormancy in sweet cherry. SCIENTIA HORTICULTURAE 2023. doi:10.1016/j.scienta.2023.112186.\u003c/li\u003e\n\u003cli\u003eDebnath T, Dhar DG, Dhar P. Molecular switches in plant stress adaptation. Molecular Biology Reports. 2024;51:20.\u003c/li\u003e\n\u003cli\u003eMo W, Zheng X, Shi Q, Zhao X, Chen X, Yang Z, Zuo Z. Unveiling the crucial roles of abscisic acid in plant physiology: implications for enhancing stress tolerance and productivity. FRONTIERS IN PLANT SCIENCE. 2024;15:1437184.\u003c/li\u003e\n\u003cli\u003eBrookbank BP, Patel J, Gazzarrini S, Nambara E. Role of basal ABA in plant growth and development. Genes. 2021;12:1936.\u003c/li\u003e\n\u003cli\u003eLiu Y, He J, Chen Z, Ren X, Hong X, Gong Z. ABA overly‐sensitive 5 (ABO5), encoding a pentatricopeptide repeat protein required for cis‐splicing of mitochondrial nad2 intron 3, is involved in the abscisic acid response in Arabidopsis. The Plant Journal. 2010;63:749\u0026ndash;65.\u003c/li\u003e\n\u003cli\u003eWang P, Lu S, Zhang X, Hyden B, Qin L, Liu L, et al. Double NCED isozymes control ABA biosynthesis for ripening and senescent regulation in peach fruits. Plant Science. 2021;304:110739.\u003c/li\u003e\n\u003cli\u003eRichardt S, Timmerhaus G, Lang D, Qudeimat E, Corr\u0026ecirc;a LGG, Reski R, et al. Microarray analysis of the moss Physcomitrella patens reveals evolutionarily conserved transcriptional regulation of salt stress and abscisic acid signalling. Plant molecular biology. 2010;72:27\u0026ndash;45.\u003c/li\u003e\n\u003cli\u003eWei M, Song M, Fan S, Yu S. Transcriptomic analysis of differentially expressed genes during anther development in genetic male sterile and wild type cotton by digital gene-expression profiling. BMC genomics. 2013;14:1\u0026ndash;16.\u003c/li\u003e\n\u003cli\u003eZhao Q, Guan XY, Zhou LJ, Asad MA, Xu YQ, Pan G, Cheng FM. ABA-triggered ROS burst in rice developing anthers is critical for tapetal programmed cell death induction and heat stress-induced pollen abortion. PLANT CELL AND ENVIRONMENT. 2023;46:1453\u0026ndash;71. doi:10.1111/pce.14551.\u003c/li\u003e\n\u003cli\u003eZou T, Xiong PP, Zhou FX, Zhou D, Chen H, Li GW, et al. Grass-specific ABERRANT MICROSPORE DEVELOPMENT 1 is required for maintaining pollen fertility in rice. PLANT JOURNAL. 2022;111:1509\u0026ndash;26. doi:10.1111/tpj.15921.\u003c/li\u003e\n\u003cli\u003eZhang TB, Yuan SH, Liu ZH, Luo LQ, Guo HY, Li YM, et al. Comparative Transcriptome Analysis Reveals Hormone Signal Transduction and Sucrose Metabolism Related Genes Involved in the Regulation of Anther Dehiscence in Photo-Thermo-Sensitive Genic Male Sterile Wheat. BIOMOLECULES 2022. doi:10.3390/biom12081149.\u003c/li\u003e\n\u003cli\u003eHe C, Liu X, Teixeira da Silva, Jaime A, Liu N, Zhang M, Duan J. Transcriptome sequencing and metabolite profiling analyses provide comprehensive insight into molecular mechanisms of flower development in Dendrobium officinale (Orchidaceae). Plant molecular biology. 2020;104:529\u0026ndash;48.\u003c/li\u003e\n\u003cli\u003eGan Z, Shan N, Fei L, Wan C, Chen J. Isolation of the 9-cis-epoxycarotenoid dioxygenase (NCED) gene from kiwifruit and its effects on postharvest softening and ripening. SCIENTIA HORTICULTURAE. 2020;261:109020.\u003c/li\u003e\n\u003cli\u003eGoldberg RB, Beals TP, Sanders PM. Anther development: basic principles and practical applications. The Plant Cell. 1993;5:1217.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"bmc-plant-biology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"pbio","sideBox":"Learn more about [BMC Plant Biology](http://bmcplantbiol.biomedcentral.com/)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/pbio/default.aspx","title":"BMC Plant Biology","twitterHandle":"BMC_series","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"em","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Lilium spp., Male sterility, LoNCED gene, Anther development","lastPublishedDoi":"10.21203/rs.3.rs-6013825/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-6013825/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e \u003cem\u003eLilium\u003c/em\u003e spp. are widely cultivated for their ornamental value, but excessive pollen production poses commercial challenges. Male sterility, especially pollen-free cultivars, offers a promising breeding strategy to improve market appeal. ABA, a key hormone in regulating anther development, is influenced by the NCED gene. To investigate its role in male sterility, we isolated the LoNCED gene from both fertile and sterile lily progenies. After cloning and analyzing its tissue-specific expression, we explored its function through homologous transient overexpression and heterologous expression. Results showed that sterile progenies had significantly higher ABA levels, with LoNCED expression elevated in their anthers compared to fertile progenies. The LoNCED gene, with a 1812 bp open reading frame encoding 603 amino acids, encodes a hydrophilic protein (66.69 kDa) localized in chloroplasts and mitochondria. Sequence analysis revealed high similarity to NCED proteins from other species. Overexpression of LoNCED downregulated key anther development genes (\u003cem\u003eDYT1\u003c/em\u003e, \u003cem\u003eTDF1\u003c/em\u003e, \u003cem\u003eCYP703A2\u003c/em\u003e, \u003cem\u003eCALS5\u003c/em\u003e, \u003cem\u003eDEX1\u003c/em\u003e) and caused tapetum degradation, abnormal microspore development, and pollen sterility. Transgenic Arabidopsis plants overexpressing LoNCED exhibited incomplete anther development, premature tapetum degradation, and reduced pollen grain production. These findings highlight the critical role of LoNCED in regulating anther sterility in lilies.\u003c/p\u003e","manuscriptTitle":"Expression Profiling and Functional Characterization of LoNCED Gene in Pollen Abortion of Lilium spp.","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-02-17 06:05:35","doi":"10.21203/rs.3.rs-6013825/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2025-04-17T22:50:20+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-04-11T01:09:20+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"97618887572048422776551456612327730051","date":"2025-04-07T01:49:24+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-03-29T15:51:24+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"106910848655019912311411755665465143754","date":"2025-03-02T11:51:45+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-02-20T08:30:59+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2025-02-19T22:52:17+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-02-13T10:06:52+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-02-13T10:03:03+00:00","index":"","fulltext":""},{"type":"submitted","content":"BMC Plant Biology","date":"2025-02-12T09:25:28+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"bmc-plant-biology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"pbio","sideBox":"Learn more about [BMC Plant Biology](http://bmcplantbiol.biomedcentral.com/)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/pbio/default.aspx","title":"BMC Plant Biology","twitterHandle":"BMC_series","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"em","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"e7a64c19-f212-423a-9551-e80ad81378e6","owner":[],"postedDate":"February 17th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2025-10-06T16:08:15+00:00","versionOfRecord":{"articleIdentity":"rs-6013825","link":"https://doi.org/10.1186/s12870-025-07210-5","journal":{"identity":"bmc-plant-biology","isVorOnly":false,"title":"BMC Plant Biology"},"publishedOn":"2025-10-02 15:58:15","publishedOnDateReadable":"October 2nd, 2025"},"versionCreatedAt":"2025-02-17 06:05:35","video":"","vorDoi":"10.1186/s12870-025-07210-5","vorDoiUrl":"https://doi.org/10.1186/s12870-025-07210-5","workflowStages":[]},"version":"v1","identity":"rs-6013825","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-6013825","identity":"rs-6013825","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}