Hemizygous loss-of-function variants of EIF1AX are associated with a syndromic neurodevelopmental disorder

Hemizygous loss-of-function variants of EIF1AX are associated with a syndromic neurodevelopmental disorder | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Hemizygous loss-of-function variants of EIF1AX are associated with a syndromic neurodevelopmental disorder Mitsuko Nakashima, Kazuyuki Komatsu, Atsushi Sugie, Yohei Nitta, and 10 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7289882/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 10 You are reading this latest preprint version Abstract Pathogenic variants of genes encoding initiation factors can cause neurological diseases, including neurodevelopmental disorders and brain abnormalities. The eukaryotic translation initiation factor 1A (eIF1A), is an X-linked ( EIF1AX ) gene located at Xp22.12 that plays an important role in the regulation of translation initiation. Here, we identified de novo hemizygous EIF1AX variants in male individuals with neurodevelopmental disorders and explored their possible involvement in these neurological disorders. We performed trio-based exome or whole genome sequencing in four families. The pathogenicity of EIF1AX variants was evaluated using a molecular dynamic simulation and transgenic Drosophila models. We identified four de novo hemizygous EIF1AX variants in four male individuals with variable neurodevelopmental delay, dysmorphic features, behavioral problems, ophthalmological abnormalities, and structural abnormalities in the brain. One variant was predicted to cause a splicing alteration, and minigene analysis confirmed exon skipping leading to the generation of a premature termination codon. In transgenic Drosophila harboring wild-type (WT) EIF1AX or the three other EIF1AX missense variants, overexpression of WT and the p.(Asn17Asp) variant caused structural abnormalities in the compound eye, whereas the p.(Lys64Glu) and p.(Asp90Gly) variants significantly reduced these eye abnormalities. In addition, WT overexpression resulted in significant axonal toxicity in the Drosophila optic nerve, causing a significant reduction in the number of axons, whereas all mutants showed only a mild reduction in axonal number. Our findings indicated that all variants resulted in different degrees of EIF1AX loss-of-function. Overall, the EIF1AX gene is a novel candidate gene for syndromic neurodevelopmental disorders in men. Health sciences/Diseases/Neurological disorders/Neurodevelopmental disorders Biological sciences/Genetics/Development Neurodevelopmental delay EIF1AX LoF variant germline Figures Figure 1 Figure 2 Figure 3 Figure 4 Introduction mRNA translation is a cyclical process highly conserved in eukaryotes that involves initiation, elongation, termination, and ribosome recycling stages [ 1 – 4 ]. Initiation is the first step in mRNA translation, in which elongation-competent 80S ribosomes are assembled. Two ribosomal subunits, 40S and 60S, and at least 12 translation initiation factors (eIFs) are involved in this process [ 4 – 6 ]. The appropriate regulation of RNA translation is necessary for various cellular functions. Neurons exhibit pronounced polar morphology and synaptic plasticity, and thus, translational dysregulation in neurons can induce various neurological dysfunctions [ 7 , 8 ]. The eukaryotic translation initiation factor 1A, eIF1A, is an X-linked ( EIF1AX ) gene located on the X chromosome at position Xp22.12 and is ubiquitously expressed in all tissues [ 3 , 9 , 10 ] and binds to the 40S ribosomal subunit. The 40S ribosomal subunit consists of 33 proteins and an 18S rRNA, and has three functional regions, namely, A, P, and E sites, that play different roles during the translation process [ 11 ]. In eukaryotes, two translation initiation factors, eIF1 and eIF1A, cooperatively bind to the 40S ribosomal subunit at the P and A sites, respectively [ 12 ]. Binding of these proteins induces a conformational change in the 40S subunit, leading to the opening of the mRNA binding channel [ 6 , 10 , 12 ], and facilitates the formation of the 43S preinitiation complex (PIC) via binding of the eIF2/guanosine triphosphate/methionyl initiator tRNA complex (eIF2-ternary complex) [ 2 , 6 ]. The 43S PIC binds to the capped 5′-end of mRNA and initiates ribosomal scanning to locate the first AUG codon [ 2 , 13 , 14 ]. To date, various pathogenic variants of genes encoding eIFs, such as EIF4A2 (MIM: 620455) [ 15 ], EIF2B1 (MIM: 603896) [ 16 ], EIF2B2 (MIM: 620312) [ 17 – 19 ], EIF2B3 (MIM: 620312) [ 16 ], EIF2B4 (MIM: 620314) [ 16 , 18 , 19 ], EIF2B5 (MIM: 620315) [ 17 – 20 ], and EIF4G1 (MIM: 614251) [ 21 , 22 ], have been reported to correlate with neurological diseases, including neurodevelopmental disorders, epilepsy, cognitive dysfunctions, and structural brain abnormalities. Previous studies have suggested that somatic gain-of-function variants of EIF1AX and elevated levels of EIF1AX expression may stimulate tumorigenesis [ 23 , 24 ]. However, no studies are available on the association of germline EIF1AX variants with neurological disorders. Here, we describe a novel neurodevelopmental disorder observed in four male patients carrying hemizygous de novo variants of the EIF1AX gene. In addition, our functional studies indicated that all variants resulted in different degrees of EIF1AX loss-of-function. Materials and methods Individuals This study was approved by the Ethics Committee of the Hamamatsu University School of Medicine (approval number: 17–163) and was conducted according to the guidelines of the Declaration of Helsinki. Informed consent was obtained from all participants or their legal guardians. Medical records and physical findings for each individual were reviewed and examined by the physician in charge of each medical facility. Pediatric neurologists evaluated psychomotor development, electroencephalograms (EEGs), and findings of brain magnetic resonance imaging (MRI). Genetic analyses Trio-based exome sequencing (trio-ES) or genome sequencing was performed for all families. Prediction of significance of variants was performed using the SIFT [ 25 ], PolyPhen-2 [ 26 ], CADD [ 27 ], AlphaMissense [ 28 ], and M-CAP [ 29 ] programs. We used multiple bioinformatic splicing prediction tools, including the deep learning networks SpliceAI [ 30 ], Pangolin [ 31 ], and SpliceRover [ 32 ], to examine the variants affecting mRNA splicing. Further details on the methods used for genetic analysis are provided in the Supplemental Information. In silico molecular analysis We performed molecular dynamics using GROMACS, which includes root-mean-square deviation (RMSD), root-mean-square fluctuation (RMSF), Radius of gyration (ROG), and Hydrogen bonds. Then trajectories were analyzed by principal component analysis (PCA) and free-energy landscape analysis (FEL). These were described in Supplementary data. Plasmid construction Using the minigene splicing method, a 758-bp human wild-type (WT) EIF1AX DNA fragment (NM_001412.4) was amplified from human control DNA. Primer pairs were designed for introns 2–3, including c.204 in exon 3 (Table S1 ). The obtained PCR products were subcloned into the enhanced green fluorescent protein (EGFP)-splice vector, in which a CMV promotor drives split EGFP where a 178-bp intron 6 fragment of SPTAN1 (NM_001130438.3) containing EcoR I and Cla I sites was inserted between EGFP exon 1 and exon 2. This vector also has IRES-DsRed, allowing simultaneous detection of EGFP and DsRed fluorescence. Ligation was performed with EcoRI-HF and ClaI enzymes using the In-Fusion® HD Cloning Kit (Takara Bio, Shiga, Japan). The c.204G > C variant-containing vector was generated from the WT vector using the PrimeSTAR Mutagenesis Basal Kit (Takara Bio). Minigene splicing analysis HEK293FT cells (Thermo Fisher Scientific) were grown to 80% confluence in 6-well plates, transiently transfected with 3 µg of WT or variant-type (VT) plasmids using the polyethylenimine "MAX" reagent (Polysciences, Warrington, PA, USA) and cultured in high glucose-containing Dulbecco’s modified Eagle medium (FUJIFILM Wako Pure Chemical, Osaka, Japan) supplemented with 10% fetal bovine serum at 37°C and 5% CO 2 . After 48 h of incubation, total RNA was extracted using the RNeasy Plus Mini kit (Qiagen, Hilden, Germany), and 1 µg of total RNA was reverse transcribed into cDNA using the PrimeScript RT reagent kit (Takara Bio), according to the manufacturer’s instructions. The WT and VT cDNAs were amplified using PCR with primers targeting EGFP exons 1 and 2 (Table S1 ). The sequence of each amplified product was confirmed by Sanger method on ABI 3500xl or 3130xl Genetic Analyzer (Applied Biosystems, Foster City, CA, USA). Fly strains Flies were maintained at 25°C on standard fly food. GMR-Gal4(II) (Catalogue #1104), tub-Gal80TS (Catalogue #7019), and tub-Gal4 (catalogue #5138) were obtained from the Bloomington Drosophila Stock Center (BDSC, Bloomington, IN, USA). The 40D-UAS control line (Catalogue #60101), which contains an empty UAS insertion at the 40D landing site, was obtained from the Vienna Drosophila Resource Center (VDRC, Vienna, Austria) and used as a genetic background control. Generation of transgenic flies To express human EIF1AX-fused MYC tags at the N terminals of eIF1AX, the MYC-EIF1AX WT , MYC-EIF1AX N17D , MYC-EIF1AX V55I , MYC-EIF1AX K64E , and MYC-EIF1AX D90G sequences were inserted into the pGP-20XUAS-IVS-Syn21-jGCaMP8s-p10 vector (catalogue #162386; Addgene, Watertown, MA, USA) using the following primer set: primer 1 (5′-TTCTTATCCTTTACTTCAGGCGCGGCCGCATGGAGCAAAAGCTCATTTCTGAAGAGGACTTGCCCAAGAATAAAGGTAAAGGAGG-3′) and primer 2 (5′-TTTGTTATTTTAAAAACGATTCATTTCTAGATTAGATGTCATCAATATCTTCATCATCATCTCCAATG-3′) after removal of the jGCaMP8s sequence. The mutations N17D, V55I, K64E, and D90G in EIF1AX were generated using inverse PCR with KOD-Plus-Neo polymerase (TOYOBO, Osaka, Japan), following the manufacturer’s instructions. Each mutated coding sequence was confirmed by Sanger sequencing. Subsequently, these plasmids were injected into fly embryos, which were then integrated into the aTTP40 landing site (Well Genetics, Taipei, Taiwan). To generate a corresponding transgenic construct for Drosophila eIF1A , the fly ortholog of human EIF1AX , total RNA was first extracted from dissected adult fly brains (10 brains per preparation) using the RNeasy Mini Kit (QIAGEN, Hilden, Germany). Reverse transcription was performed using 50 pmol of Oligo dT primer (TKR 3805, TAKARA BIO INC., Japan), 2 mM dNTP mixture (TKR 400, TAKARA BIO INC., Japan), and PrimeScript™ II Reverse Transcriptase (TKR 2690A, TAKARA BIO INC., Japan), following incubation at 65°C for 5 minutes. Full-length cDNA was synthesized and used as the template for PCR amplification of the eIF1A coding region using primers ATGCCCAAGAATAAAGGAAAAGGAGGCAAGAATCGTC (forward) and GATGTTGTCCACGGAGTCGGCGTCAT (reverse). To generate the expression construct, the PCR product of eIF1A was further amplified with the primer set TATCCTTTACTTCAGGCGCGGCCGCCAACATGGAACAAAAACTCATCTCAGAAGAGGATCTGATGCCCAAGAATAAAGGAAAAGGAGGCAAGAATCGTC and TTTGGTTATTTTAAAAACGATTCATTTCTAGACTAAGCGTAATCTGGAACATCGTATGGGTAGATGTTGTCCACGGAGTCGGCGTCAT, which include homology arms for seamless cloning into the pGP-20XUAS-IVS-Syn21-jGCaMP8s-p10 vector. The vector was digested with NotI and XbaI, and the eIF1A amplicon was inserted using the NEBuilder HiFi DNA Assembly Kit. The resulting construct, UAS-myc-eIF1A-HA, contains a myc tag at the N-terminus and an HA tag at the C-terminus of eIF1A . Because eIF1A is highly conserved between Drosophila and humans, the amino acid residues corresponding to N17, V55, K64, and D90 are conserved, allowing introduction of the same point mutations (N17D, V55I, K64E, and D90G) into the Drosophila eIF1A sequenc. The mutated eIF1A constructs were cloned into the same pGP-20XUAS-IVS-Syn21-jGCaMP8s-p10 vector and used for transgenesis at the aTTP40 landing site. Immunoblot analysis of the whole body of Drosophila Temporary dynamics in protein expression were analyzed in the whole bodies of Drosophila by crossing Tub-Gal4 and Tub-GAL80TS flies. Crossed flies carrying each EIF1AX variant were reared at a permissive temperature (20°C), whereas newly eclosed females were reared at a restrictive temperature (29°C). After 2 days, 10 fly heads were sonicated (2 × 30 s) in lysis buffer (10 mM Tris–HCl, pH 7.5; 150 mM NaCl; 1 mM ethylenediaminetetraacetic acid [EDTA]; 2% n-dodecyl-β-D-maltoside) supplemented with 1:1000 (v/v) Protease Inhibitor Cocktail Set III (Calbiochem, La Jolla, CA, USA) using a Q55 sonicator (Qsonica, Newtown, CT, USA). For the analysis of eIF1A variants, transgenic flies expressing each variant were generated using the GMR-Gal4 driver and reared at 29°C. From adult flies, heads were collected from 10 individuals and homogenized by sonication under the same conditions described above to extract proteins. Mouse anti-MYC (4A6; 1:5000; EMD Millipore Corp., USA), rat anti-HA (3F10; 1:4000; Roche, Basel, Switzerland) and mouse anti-α-tubulin (T9026; 1:100 000; Sigma-Aldrich, St. Louis, MO, USA) antibodies were used for western blotting. HRP-conjugated anti-mouse IgG (32430; 1:2000; Thermo Fisher Scientific, Waltham, MA, USA) and HRP-conjugated anti-rat IgG (ab97057; 1:4000; Abcam, Cambridge, UK) were used as secondary antibodies. Immunohistochemistry and imaging Female or male flies reared at 29°C for 4 weeks were used for the experiment. Sample preparation after brain dissection and immunohistochemical analysis were performed as previously described. [ 33 ] The following antibodies were used: mouse anti-chaoptin (24B10; 1:25; Developmental Studies Hybridoma Bank, Iowa City, IA, USA) and anti-mouse Alexa Fluor 568 (1:400; Thermo Fisher Scientific, Waltham, MA, USA). The specimens were mounted using the Vectashield mounting medium (Vector Laboratories, Burlingame, CA, USA). Images were captured under a FV3000 confocal microscope (Olympus, Tokyo, Japan). Brain images were obtained under a confocal microscope equipped with a 60× immersion objective (1.4 numerical aperture) and set to 1× digital zoom. Images were processed using IMARIS, version 9.6.0 (Oxford Instruments, Zurich, Switzerland). Bright-field microscopy for imaging and quantifying morphological defects in the eye To perform light microscopic imaging of adult eyes, 4 weeks flies, reared at 29°C to induce the expression of EIF1AX variants, or 1- to 3-d-old flies, reared at 29°C to induce the expression of eIF1A variants, were immobilized by freezing at -80°C, and then mounted on double-sided tapes. The female or male flies were then imaged under a BX53 microscope system with an MPLFLN 20× objective lens (Olympus). Phenotypic scores were calculated using Flynotyper (version 1.0) to quantitatively assess morphological defects in Drosophila eyes [ 34 ]. Statistical analysis Differences among multiple groups were examined using the Kruskal–Wallis test, followed by the two-stage linear step-up procedure of the Benjamini, Krieger, and Yekutieli tests using Prism version 9 (GraphPad Software, San Diego, CA, USA). The null hypothesis was rejected at a significance level of 0.05, and data are expressed as the mean ± standard error (SE) of the mean. Results Clinical findings Details of the cases of the four individuals harboring the EIF1AX variants are described in the Supplemental Note, while their clinical manifestations are summarized in Table 1 . All individuals exhibited moderate-to-severe global developmental delay, autistic behavior, and facial dysmorphism. Psychomotor development was also severely delayed in all individuals, with little or no speech development. Three individuals failed to thrive and presented with short stature (< -3.0 standard deviation), while all four were diagnosed with congenital microcephaly. Three individuals experienced seizures, but all had normal EEGs. The seizures were either well-controlled with antiepileptic drugs or they spontaneously ceased. Neurological examination revealed abnormal muscular tone in three individuals; two had hypotonia, whereas one had hypertonia. Autistic behaviors such as sleep disturbances, aggressive behavior, and pain insensitivity were observed in all. All four presented with craniofacial dysmorphic features, including mild forehead protrusion, periorbital abnormalities (telecanthus, epicanthus, and downslanted palpebral fissures), ear abnormalities (fleshy lobes, low-set ears, and preauricular tags), nasal abnormalities (flat nasal bridge and prominent nostrils), and oral abnormalities (open mouth, short philtrum, high-arched palate, and laryngeal cleft) (Fig. 1 A). They also exhibited additional congenital abnormalities, including cryptorchidism, tethered spinal cord, inguinal hernia, narrow internal auditory canal, delayed eruption of teeth, skeletal anomalies of the fingers and toes, and nevus spilus. Two individuals had ophthalmological abnormalities, including strabismus and myopia. Brain MRIs of two individuals showed abnormal signal intensities in the cerebrum (Fig. 1 B) and mild dilation of perivascular spaces. Biochemical analysis showed an elevation in the levels of cerotic acid (C26:0), a very-long-chain fatty acid (VLCFA), in two individuals. Of note, VLCFA levels were mildly but consistently elevated in individual 1; however, they were only transiently elevated in individual 2. Reduced concentrations of most amino acids in the cerebrospinal fluid (CSF) were observed in individual 4. Biochemical and metabolic tests revealed no other abnormalities. Table 1 Summary of clinical features of individuals harboring eukaryotic translation initiation factor 1A, X-linked ( EIF1AX ) variants Individuals Individual 1 Individual 2 Individual 3 Individual 4 Sex Male Male Male Male Age at last assessment 5 y 3 y 8 m 31 y 6 y 10 m Ethnicity Japanese (East Asian) White (Irish) and First Nations Dutch German EIF1AX variant c.269A > G c.190A > G c.49A > G c.204G > C Amino acid alteration p.(Asp90Gly) p.(Lys64Glu) p.(Asn17Asp) p.(Lys68Asn) Inheritance de novo de novo de novo de novo Birth 41 weeks 38 weeks 38 weeks 41 + 2 weeks Weight (g) 3410 (+ 1 SD) 3515 (+ 1 SD) 3290 (+ 0.2 SD) 2560 (-2.6 SD) body length (cm) 50.5 (+ 0.7 SD) N.A. 49 (-0.2 SD) 44 (-3.9 SD) OFC (cm) 38 (+ 1 SD) N.A. N.A. 31 (-3.7 SD) Growth at 5 y 1 m at 5 y at 31 y at 6 y 10 m weight (kg) 15.3 (-1.0 SD) 21.1 (Z = 1.0) 85 (+ 3.4 SD) 20 (-1.3 SD) height (cm) 89 (-3.5 SD) 102.7 (Z = -1.5) 162.5 (-3 SD) 107 (-3.2 SD) OFC (cm) 50 (0 SD) 53 (Z = 1.4) 56.2 (-0.8 SD) 47.3 (-4 SD) Seizure onset None 24 m 17 y None Seizure type at onset None GTC Absent None Initial EEG N.A. Normal Normal Normal Course of seizures None Febrile and afebrile, myoclonic jerks Tonic-clonic, possibly also absent 8× febrile convulsions, duration: 20 s, GTC, EEG pending Response to treatment N.A. Controlled with levitiracetam Not seizure-free using carbamazepine N.A. Neurologic problems Mild hypotonia Hypotonia None Mildly increased muscle tone (limbs) Intellectual disabilities Yes (DQ a 46) Yes (GDD) Yes (Moderate intellectual disability) Yes (GDD, IQ-test pending, and no active speech) Development Age at sitting 1 y 6 m 7 m 2 y 1 y Age at walking 3 y 6 m 1 y 8 m 3 y 6 m 2 y 3 m Language None (at 5 y) At 5 y using single words and signs to communicate Verbal, full sentences None (at 7 y) Behavioral problems Feeding problems (imbalanced diet) ASD ASD Sleep disturbances, autistic and aggressive behavior, autistic hypersensitivity, pain insensitivity, and feeding difficulties during infancy Facial dysmorphisms Mild forehead protrusion, flat nasal bridge, and telecanthus Fleshy lobes, preauricular tag, epicanthus, high arched palate, laryngeal cleft, flat nasal bridge, and open mouth Mild downslanted palpebral fissures, high arched palate, short philtrum, and low-set ears Wide nasal bridge, prominent nostrils, narrow nasal tip, telecanthus, epicanthus, open mouth, fleshy lobes, and deep set ears Brain image High signal intensity at the frontal and dorsal horn of the lateral ventricle in MRI at 3 y 4 m Normal CT, abnormal signal intensity of the right temporal lobe, and insular cortex in MRI at 2 years of age CT and MRI: normal Mild dilation of perivascular spaces temporoparietal at 2.5 y Eye abnormalities Strabismus N.A. N.A. Mild myopia Other anomalies Cryptorchidism, tethered spinal cord, neurogenic bladder, and nevus spilus Silent aspiration, short and broad appearance of the mid phalanx of the fifth fingers, short appearance of the first metacarpals, and broad first toes Bilateral inguinal hernia, and recurrent dislocations of the shoulder Inguinal hernia at 3 m, narrow internal auditory canal, recurrent secretory otitis media, and delayed eruption of teeth Metabolic analysis Mild elevation of C26 levels and decrease in docosahexaenoic acid and plasmalogen levels Elevation of C26 levels (5 times the upper limit), normal on repeat with fasting Normal metabolic profiling of urine Reduced concentration of most amino acids in CSF (especially methionine). Unremarkable: VLFCA, acylcarnitin, CDG: transferrin-IEF, MPS SD, standard deviation; N.A., not available; OFC, occipitofrontal circumference; EEG, electroencephalogram; GTC, generalized tonic-clonic seizure; ASD, autism spectrum disorder a , K-type developmental test Identification of hemizygous EIF1AX variants in individuals with neurodevelopmental disorders We performed trio-ES for family 1 and identified a hemizygous de novo c.269A > G, p.(Asp90Gly) variant of EIF1AX . Three additional male individuals with neurodevelopmental disorders carrying hemizygous de novo EIF1AX variants, c.49A > G, p.(Asn17Asp), c.190A > G, p.(Lys64Glu), and c.204G > C, p.(Lys68Asn), were recruited using GeneMatcher ( https://genematcher.org/ ) [ 35 ]. All variants were predicted to be deleterious by multiple pathogenicity prediction tools and were absent in gnomAD version 4.1.0 database. The c.204G > C variant affected the last base of exon 3 and was predicted to cause abnormal splicing by multiple splice-site prediction tools (Table S3). Therefore, we performed in vitro splicing assays using minigene plasmids to evaluate the functional effects of the c.204G > C variant. Minigene analysis demonstrated the skipping of exon 3, leading to frameshift and premature termination of the codon (r. 101_204del, p.[Glu34Gly*19]) (Fig. 2 ). The other three missense variants were highly evolutionarily conserved across species. Among these three variants, p.(Lys64Glu) and p.(Lys68Asn) were located at the oligonucleotide/oligosaccharide-binding (OB) fold domain, while the p.(Asn17Asp) variant was located at the N-terminal tail (NTT) (Fig. 1 C). EIF1AX is highly intolerant to loss-of-function (LoF; probability of being loss-of-function intolerant = 0.91), with all candidate variants being in a hemizygous state. Therefore, we hypothesized that all candidate EIF1AX variants were likely to have a LoF effect. Evaluation of the pathogenicity of EIF1AX variants To understand the impact of missense variants on the structural stability of EIF1AX, we performed a 100 ns molecular dynamic simulation models using GROMACS for the WT, candidate variants and p.(Val55Ile), a benign control variant found in the gnomAD database with hemizygous state. We performed RMSD analysis of the atoms comprising the backbones of the WT and variant molecules. It revealed that the variant models exhibited more remarkable structural stability than WT (Figure S1 A). RMSF showed a highly flexible peaks in the OB-fold in p.(Val55Ile), whereas other VT proteins had fewer flexible peaks (Figure S1 B), indicating the flexibility of residues in the OB-fold was suggested to disrupt the binding of these proteins. Measurement of ROG and the number of hydrogen bond showed no differences among WT and VTs (Figure S1 C and S1D). These findings suggested that both WT and VTs proteins maintained compactness of the protein and intramolecular hydrogen bonds. PCA-based FEL analysis was performed to study structural transitions and retrieve biologically relevant conformations. In this analysis, multiple cluster basins were obtained for the variants p.(Lys64Glu) and p.(Asp90Gly). On the other hand, the p.(Asn17Asp) variant attained a single small cluster, which was like the WT (Figure S2). We retrieved the representative structures from various cluster basins for the WT and variants and observed the changes in their conformational patterns by superimposing the structures. We adopted cluster 1 (C1) structures for all alignments of the minimum energy cluster. The p.(Lys64Glu) showed an extended helix in the variant model and p.(Asp90Gly) disrupted the β-sheet in the variant model (Figure S3). The p.(Asn17Asp) and p.(Val55Ile) models showed no structural changes. These findings suggested that none of the variants have a significant effect on protein stability. To confirm the stability of the WT and VT EIF1AX proteins, we transiently overexpressed them in HEK293FT cells and evaluated their protein levels. Immunoblotting assays revealed that the levels of protein expression did not decrease in cells expressing WT and EIF1AX variants (n = 4; Figure S4). Notably, the level of the p.(Asp90Gly) protein was slightly higher than that of the other proteins. This result showed that the stability of the WT and VT EIF1AX proteins was not significantly different. Next, to evaluate the pathogenicity of the novel EIF1AX variants in Drosophila , we generated transgenic fly lines expressing MYC-tagged WT and variant genes under the control of an upstream activating sequence (UAS). Using the phiC31 integrase system [ 36 ], EIF1AX WT, N17D, V55I, K64E, and D90G were inserted into the same genomic position to eliminate positional effects on gene expression. The Gal4-UAS system [ 37 ] induced the expression of the EIF1AX gene by binding the yeast transcription factor Gal4 to the UAS sequence. EIF1AX was expressed throughout the body, and immunoblotting analyses confirmed the presence of similar protein levels in the WT, N17D, V55I, K64E, and D90G strains (Fig. 3 A). To analyze the effect of each variant on gene function, we expressed the human EIF1AX WT, N17D, V55I, K64E, and D90G proteins in the visual system using the eye-specific GMR-Gal4 driver and assessed the rough eye phenotype (REP). REP has long been used in disease research to evaluate gene functions [ 38 ]. The overexpression of EIF1AX WT , EIF1AX N17D , or EIF1AX V55I caused mild REP, whereas overexpression of EIF1AX K64E or EIF1AX D90G significantly reduced REP in both females and males (Fig. 3 B and 3 C). This suggested that EIF1AX WT , EIF1AX 17D , and EIF1AX V55I function in a neomorphic manner in flies in vivo, resulting in structural abnormalities in the compound eye. Paradoxically, the K64E and D90G variants may be LoF variants because we observed that the structural abnormalities in the eye were alleviated. Considering the clinical manifestations exhibited by the individuals, we hypothesized that EIF1AX plays a crucial role in the nervous system. Thus, to investigate the function of these variants, we used the retinal axons of Drosophila as model neurons. To compare the number of retinal axon terminals among the different variants, we used MeDUsA, a previously developed automated method for quantifying degeneration using fly axons [ 39 ]. We observed that overexpression of EIF1AX WT strongly reduced axonal numbers, whereas overexpression of EIF1AX K64E in both females and males caused a mild reduction in axonal numbers (Fig. 3 D and 3 E). We further investigated the function of eIF1A , the Drosophila homolog of EIF1AX . Drosophila eIF1A exhibits a high degree of sequence conservation with EIF1AX , with key residues—Asn at position 17, Val at 55, Lys at 64, and Asp at 90—being fully conserved. To assess the functional impact of mutations at these conserved sites, we generated transgenic flies expressing WT eIF1A or mutant variants (N17D, V55I, K64E, D90G) under the control of a UAS promoter. Each construct was tagged with a myc epitope at the N-terminus and an HA epitope at the C-terminus. To control for positional effects, all constructs were inserted into the same genomic locus using the phiC31 integrase system. Western blot analysis confirmed comparable protein expression levels across all transgenic lines (Fig. 4 A). In the rough eye assay, overexpression of wild-type eIF1A resulted in structural disorganization of the compound eye consistent with the phenotypes observed with EIF1AX overexpression. In contrast, the K64E and D90G mutants significantly suppressed these phenotypes in both males and females, preserving more normal eye architecture (Fig. 4 B and 4 C). These results suggest that K64E and D90G mutations partially impair the translational regulatory function of eIF1A and do not exhibit the hyperactive translation effects observed with the wild-type protein. We next used the MeDUSA system to quantitatively assess retinal axon integrity. Expression of wild-type eIF1A led to a marked reduction in the number of retinal axons, indicating a neurodegenerative phenotype as EIF1AX . This suggests that the elevated activity of eIF1A as a translation factor disrupts neuronal homeostasis in the photoreceptor neurons. In contrast, expression of the K64E and D90G mutants mitigated axon loss and preserved neuronal structure (Fig. 4 D and 4 E). Although the axon-preserving effect of K64E did not reach statistical significance under one condition ( eIF1A -expressing females), it was clearly observed under other conditions, supporting its classification as a loss-of-function variant overall. In contrast, the N17D and V55I mutations induced minimal structural changes in both the rough eye and retinal axon assays. Although a slight trend toward axon preservation was observed in some instances, these changes were not statistically significant (Fig. 4 E), suggesting that these variants are likely mild loss-of-function or benign mutations. Taken together, we considered that N17D causing mild loss-of-function, whereas K64E and D90G potentially causing severe loss-of-function. Discussion In this study, we identified four de novo hemizygous EIF1AX variants (comprising three missense and one splice variant) in four male individuals exhibiting variable neurodevelopmental disorders. All individuals presented with developmental and language delays, autistic behavioral problems, and facial dysmorphisms. They frequently exhibited short stature (3/4; 75%), abnormal brain imaging findings (3/4; 75%), seizures (2/4; 50%), and ophthalmological abnormalities (2/4; 50%). They had similar facial features, including a flat nasal bridge, telecanthus, epicanthus, fleshy lobes, and an open mouth. Various congenital abnormalities of the nerves, gonads, phalangeal bones, and internal organs were observed in one individual. Notably, temporary or continuous accumulation of VLCFAs in the serum was observed in two individuals. VLCFAs are known to accumulate in the sera of patients with peroxisome biogenesis disorders [ 40 ], but have not been reported in patients carrying variants of genes encoding eIFs [ 15 – 22 ]. Proper RNA translation is required to maintain the metabolic functions of peroxisomes; knockdown of PEX5 , one of the causative genes for peroxisome biogenesis disorders, in human cells and Drosophila oenocytes led to an increase in eIF2α phosphorylation, resulting in suppression of protein translation [ 41 ]. Therefore, functional defects of eIF1A might also cause impairment of peroxisomal biogenesis, and the accumulation of serum VLCFAs could be a helpful biomarker for diagnosing an EIF1AX -related disorder. Brain MRI findings of individual 1 (Asp90Gly) showed lesions with high signal intensities on T2 FLAIR, equal to those of low signal intensity on DWI, and high signal intensity on ADC in the subcortical and deep white matter in the dorsal horn of lateral ventricles, which contained some lesions with isosignal intensity in the cerebrospinal fluid. These lesions suggested the possible presence of degenerative lesions in the white matter, such as those in EIF2B -related diseases [ 16 , 17 ]. The c.204G > C variant detected in individual 4 is located at the 3′-end of exon 2, and minigene analysis showed aberrant mRNA splicing resulting in the generation of a premature termination codon p.(Glu34Gly*19), likely leading to RNA degradation via the nonsense-mediated mRNA decay system. As no individual-derived sample was accessible for RNA studies, we could not exclude the possibility that, to some extent, normal splicing occurred, resulting in a certain amount of protein with the predicted missense variant p.(Lys68Asn). In silico analysis indicated that the mild structural changes of the eIF1A protein with two variants, p.(Lys64Glu) and p.(Asp90Gly) but the p.(Asn17Asp) variant was predicted to cause no structural changes. Transiently expressed WT and VT EIF1AX plasmid showed the same level of protein expression, suggesting that all the variants had no significant effect on protein stability. Functional studies using Drosophila models confirmed p.(Lys64Glu) and p.(Asp90Gly) variants had the LoF effects, whereas the p.(Asn17Asp) had milder effects than other two variants. However, we could not clarify the discrepancy in pathogenicity between the p.(Asn17Asp) and p.(Val55Ile) variants. Individual 3 carrying the p.(Asn17Asp) variant exhibited a milder phenotype than those of the other three affected individuals. Consequently, we assume that highly pathogenic hemizygous LoF variants cause a complete deficit in functional eIF1A, whereas moderate pathogenic missense variants retain the EIF1A function. Considering these findings, we hypothesized that pathogenic variants exhibit a genotype-phenotype correlation, resulting in various degrees of LoF effects and EIF1AX -related phenotypes. Another explanation for this phenotypic variability may be the domain-specific locations of the detected missense variants. The eIF1A protein is composed of an OB-fold domain that is homologous to prokaryotic IF1 [ 42 ], an a-helical domain with two flexible intrinsically disordered tails: a positively charged NTT and a negatively charged C-terminal tail (CTT) [ 9 , 10 ]. The missense variants, p.(Lys64Glu), p.(Lys68Asn), and p.(Asp90Gly), found in individuals exhibiting severe phenotypes, are located within the OB-fold domain, whereas the p.(Asn17Asp) variant is located at the NTT (Fig. 1 C). The OB-fold domain forms a five-stranded closed β barrel that acts as a ligand binding surface or an active site, and has high affinity for single-stranded DNA or RNA [ 43 – 45 ]. The OB-fold domain is crucial for binding to the A site of the 18S rRNA, and variants affecting the OB-fold domain reduce the RNA binding ability [ 9 ]. Therefore, we hypothesized that the variants located in the OB-fold domain impair the binding of RNA, which might explain the severity of the observed phenotype. Both the NTT and CTT are involved in the ribosomal recruitment of eIF2-ternary complexes and initiation codon selection, whereas they have opposite effects on the determinants of start codon selection [ 9 , 46 ]. CTT acts as an enhancer for scanning and recognizing AUG, and CTT mutations weaken the recruitment of eIF2-ternary complexes and increase the initiation of non-AUG codons. NTT acts as a scanning inhibitor, leading to scanning termination, with NTT mutations enhancing the leaky scanning of the AUG codon. In addition, NTT mutations also weaken the assembly of the eIF2-ternary complex, which can be rescued by eIF1. This suggested that the LoF effect of the p.(Asn17Asp) variant was probably rescued by eIF1, potentially explaining the mild phenotypes of patients with this variant. One limitation of this study was that we could not accurately define disease-specific clinical manifestations because of the small number of patients. Therefore, more cases need to be investigated to delineate the phenotypic spectrum of EIF1AX -related disorders and verify the genotype-phenotype correlations. In summary, our findings suggest that the EIF1AX gene is a novel candidate gene for syndromic neurodevelopmental disorders in men. Functional studies have indicated that all variants have various degrees of LoF effects, which might correlate with the severity of clinical phenotypes. Although Drosophila is a useful biological model to evaluate the pathogenicity of variants, further analyses are required to elucidate the pathology of EIF1AX -related disorders. Declarations Acknowledgments We express our gratitude to the patients and their families for their participation in this study. Funding This study was funded by the Japan Society for the Promotion of Science, Grant-in-Aids for Scientific Research (grant numbers: JP20H03641, JP23H02875, and JP21H02837), Grant-in-Aid for Early-Career Scientists (grant number: JP21K15619), Japan Agency for Medical Research and Development (AMED; grant numbers: JP23ek0109549, JP23ek0109674, and JP23ek0109637, JP24ek0109760s4001), GSK Japan Research Grant 2021 (grant number: AS2021A000166849), SENSHIN Medical Research Foundation, Takeda Science Foundation Specific Research Grants and Takeda Science Foundation Bioscience Research Grants (grant number: 2023025566), and HUSM Grant-in-Aid from Hamamatsu University School of Medicine. Dr. Boschann is a participant in the Clinician Scientist Program (grant number: CS4RARE) funded by Alliance4Rare, and is associated with the BIH Charité Clinician Scientist Program. Exome analysis for Individual 2 was performed under the Care4Rare Canada Consortium, funded by Genome Canada and the Ontario Genomics Institute (grant number: OGI-147), the Canadian Institutes of Health Research, the Ontario Research Fund, Genome Alberta, Genome British Columbia, Genome Quebec, and the Children’s Hospital of Eastern Ontario Foundation. Sequencing of family 4 was supported by the Case Analysis and Decision Support (CADS) program of the Berlin Institute of Health at Charité – Universitätsmedizin, Berlin. Author contributions H. S.: conceptualization. P. J. G. Z., Q. W., M. T. C., D. H., F. B., M. K., and N. S.: phenotypic data curation. K.K., M. N., and H.S.: genetic data curation and writing of the original draft. K. K.: investigation (experimental analyses using transfected cells). M. U. H.: formal analysis (in silico protein structural and molecular dynamic analyses). A. S., Y. N. and J. O.: methodology and formal analysis (generated and analyzed morphologies of Drosophila models and performed statistical analyses). All authors: writing, review, and editing. We would like to thank Editage (www.editage.jp) for English language editing. Ethical Approval This study was approved by the Ethics Committee of the Hamamatsu University School of Medicine (approval number: 17-163) and was conducted according to the guidelines of the Declaration of Helsinki. Informed consent was obtained from all participants or their legal guardians. Medical records and physical findings for each individual were reviewed and examined by the physician in charge of each medical facility. Declaration of interests The authors declare that they have no competing interests. Data and code availability The data that support the findings of this study are available from the corresponding authors, M. N. and A. S., upon reasonable request. References Hellen CUT: Translation Termination and Ribosome Recycling in Eukaryotes. Cold Spring Harb Perspect Biol 2018;10. Hinnebusch AG: The scanning mechanism of eukaryotic translation initiation. Annu Rev Biochem 2014;83:779–812. Hussain T, Llácer JL, Fernández IS, Munoz A, Martin-Marcos P, Savva CG et al : Structural changes enable start codon recognition by the eukaryotic translation initiation complex. Cell 2014;159:597–607. Jackson RJ, Hellen CU, Pestova TV: The mechanism of eukaryotic translation initiation and principles of its regulation. Nat Rev Mol Cell Biol 2010;11:113–127. Lomakin IB, Steitz TA: The initiation of mammalian protein synthesis and mRNA scanning mechanism. Nature 2013;500:307–311. Passmore LA, Schmeing TM, Maag D, Applefield DJ, Acker MG, Algire MA et al : The eukaryotic translation initiation factors eIF1 and eIF1A induce an open conformation of the 40S ribosome. Mol Cell 2007;26:41–50. Kapur M, Monaghan CE, Ackerman SL: Regulation of mRNA Translation in Neurons-A Matter of Life and Death. Neuron 2017;96:616–637. Hui KK, Chen YK, Endo R, Tanaka M: Translation from the Ribosome to the Clinic: Implication in Neurological Disorders and New Perspectives from Recent Advances. Biomolecules 2019;9. Fekete CA, Applefield DJ, Blakely SA, Shirokikh N, Pestova T, Lorsch JR et al : The eIF1A C-terminal domain promotes initiation complex assembly, scanning and AUG selection in vivo. Embo j 2005;24:3588–3601. Battiste JL, Pestova TV, Hellen CU, Wagner G: The eIF1A solution structure reveals a large RNA-binding surface important for scanning function. Mol Cell 2000;5:109–119. Moraleva AA, Deryabin AS, Rubtsov YP, Rubtsova MP, Dontsova OA: Eukaryotic Ribosome Biogenesis: The 40S Subunit. Acta Naturae 2022;14:14–30. Weisser M, Voigts-Hoffmann F, Rabl J, Leibundgut M, Ban N: The crystal structure of the eukaryotic 40S ribosomal subunit in complex with eIF1 and eIF1A. Nat Struct Mol Biol 2013;20:1015–1017. Hinnebusch AG: Molecular mechanism of scanning and start codon selection in eukaryotes. Microbiol Mol Biol Rev 2011;75:434–467. Saini AK, Nanda JS, Lorsch JR, Hinnebusch AG: Regulatory elements in eIF1A control the fidelity of start codon selection by modulating tRNA(i)(Met) binding to the ribosome. Genes Dev 2010;24:97–110. Paul MS, Duncan AR, Genetti CA, Pan H, Jackson A, Grant PE et al : Rare EIF4A2 variants are associated with a neurodevelopmental disorder characterized by intellectual disability, hypotonia, and epilepsy. Am J Hum Genet 2023;110:548. van der Knaap MS, Leegwater PA, Könst AA, Visser A, Naidu S, Oudejans CB et al : Mutations in each of the five subunits of translation initiation factor eIF2B can cause leukoencephalopathy with vanishing white matter. Ann Neurol 2002;51:264–270. Leegwater PA, Vermeulen G, Könst AA, Naidu S, Mulders J, Visser A et al : Subunits of the translation initiation factor eIF2B are mutant in leukoencephalopathy with vanishing white matter. Nat Genet 2001;29:383–388. van der Knaap MS, van Berkel CG, Herms J, van Coster R, Baethmann M, Naidu S et al : eIF2B-related disorders: antenatal onset and involvement of multiple organs. Am J Hum Genet 2003;73:1199–1207. Fogli A, Rodriguez D, Eymard-Pierre E, Bouhour F, Labauge P, Meaney BF et al : Ovarian failure related to eukaryotic initiation factor 2B mutations. Am J Hum Genet 2003;72:1544–1550. van der Lei HD, van Berkel CG, van Wieringen WN, Brenner C, Feigenbaum A, Mercimek-Mahmutoglu S et al : Genotype-phenotype correlation in vanishing white matter disease. Neurology 2010;75:1555–1559. Nuytemans K, Bademci G, Inchausti V, Dressen A, Kinnamon DD, Mehta A et al : Whole exome sequencing of rare variants in EIF4G1 and VPS35 in Parkinson disease. Neurology 2013;80:982–989. Chartier-Harlin MC, Dachsel JC, Vilariño-Güell C, Lincoln SJ, Leprêtre F, Hulihan MM et al : Translation initiator EIF4G1 mutations in familial Parkinson disease. Am J Hum Genet 2011;89:398–406. Krishnamoorthy GP, Davidson NR, Leach SD, Zhao Z, Lowe SW, Lee G et al : EIF1AX and RAS Mutations Cooperate to Drive Thyroid Tumorigenesis through ATF4 and c-MYC. Cancer Discov 2019;9:264–281. Li Y, Guo L, Ying S, Feng GH, Zhang Y: Transcriptional repression of p21 by EIF1AX promotes the proliferation of breast cancer cells. Cell Prolif 2020;53:e12903. Ng PC, Henikoff S: Predicting deleterious amino acid substitutions. Genome Res 2001;11:863–874. Adzhubei IA, Schmidt S, Peshkin L, Ramensky VE, Gerasimova A, Bork P et al : A method and server for predicting damaging missense mutations. Nat Methods 2010;7:248–249. Rentzsch P, Witten D, Cooper GM, Shendure J, Kircher M: CADD: predicting the deleteriousness of variants throughout the human genome. Nucleic Acids Res 2019;47:D886-d894. Cheng J, Novati G, Pan J, Bycroft C, Žemgulytė A, Applebaum T et al : Accurate proteome-wide missense variant effect prediction with AlphaMissense. Science 2023;381:eadg7492. Jagadeesh KA, Wenger AM, Berger MJ, Guturu H, Stenson PD, Cooper DN et al : M-CAP eliminates a majority of variants of uncertain significance in clinical exomes at high sensitivity. Nat Genet 2016;48:1581–1586. Jaganathan K, Kyriazopoulou Panagiotopoulou S, McRae JF, Darbandi SF, Knowles D, Li YI et al : Predicting Splicing from Primary Sequence with Deep Learning. Cell 2019;176:535–548.e524. Zeng T, Li YI: Predicting RNA splicing from DNA sequence using Pangolin. Genome Biol 2022;23:103. Zuallaert J, Godin F, Kim M, Soete A, Saeys Y, De Neve W: SpliceRover: interpretable convolutional neural networks for improved splice site prediction. Bioinformatics 2018;34:4180–4188. Sugie A, Marchetti G, Tavosanis G: Structural aspects of plasticity in the nervous system of Drosophila. Neural Dev 2018;13:14. Iyer J, Wang Q, Le T, Pizzo L, Grönke S, Ambegaokar SS et al : Quantitative Assessment of Eye Phenotypes for Functional Genetic Studies Using Drosophila melanogaster. G3 (Bethesda) 2016;6:1427–1437. Sobreira N, Schiettecatte F, Valle D, Hamosh A: GeneMatcher: a matching tool for connecting investigators with an interest in the same gene. Hum Mutat 2015;36:928–930. Groth AC, Fish M, Nusse R, Calos MP: Construction of transgenic Drosophila by using the site-specific integrase from phage phiC31. Genetics 2004;166:1775–1782. Brand AH, Perrimon N: Targeted gene expression as a means of altering cell fates and generating dominant phenotypes. Development 1993;118:401–415. Nitta Y, Sugie A: Studies of neurodegenerative diseases using Drosophila and the development of novel approaches for their analysis. Fly (Austin) 2022;16:275–298. Nitta Y, Kawai H, Maki R, Osaka J, Hakeda-Suzuki S, Nagai Y et al : Direct evaluation of neuroaxonal degeneration with the causative genes of neurodegenerative diseases in Drosophila using the automated axon quantification system, MeDUsA. Hum Mol Genet 2023;32:1524–1538. Suzuki Y, Shimozawa N, Orii T, Tsukamoto T, Osumi T, Fujiki Y et al : Genetic and molecular bases of peroxisome biogenesis disorders. Genet Med 2001;3:372–376. Dahan N, Bykov YS, Boydston EA, Fadel A, Gazi Z, Hochberg-Laufer H et al : Peroxisome function relies on organelle-associated mRNA translation. Sci Adv 2022;8:eabk2141. Sette M, van Tilborg P, Spurio R, Kaptein R, Paci M, Gualerzi CO et al : The structure of the translational initiation factor IF1 from E.coli contains an oligomer-binding motif. Embo j 1997;16:1436–1443. Flynn RL, Zou L: Oligonucleotide/oligosaccharide-binding fold proteins: a growing family of genome guardians. Crit Rev Biochem Mol Biol 2010;45:266–275. Arcus V: OB-fold domains: a snapshot of the evolution of sequence, structure and function. Curr Opin Struct Biol 2002;12:794–801. Theobald DL, Mitton-Fry RM, Wuttke DS: Nucleic acid recognition by OB-fold proteins. Annu Rev Biophys Biomol Struct 2003;32:115–133. Fekete CA, Mitchell SF, Cherkasova VA, Applefield D, Algire MA, Maag D et al : N- and C-terminal residues of eIF1A have opposing effects on the fidelity of start codon selection. Embo j 2007;26:1602–1614. Additional Declarations There is no duality of interest Supplementary Files Supplementaldatafinal.docx Supplemental data The supplemental data include a Supplemental Note, four figures, and three tables. Cite Share Download PDF Status: Under Review Version 1 posted Editorial decision: revise 11 Nov, 2025 Review # 2 received at journal 06 Oct, 2025 Review # 1 received at journal 29 Sep, 2025 Reviewer # 3 agreed at journal 25 Sep, 2025 Reviewer # 2 agreed at journal 14 Sep, 2025 Reviewer # 1 agreed at journal 12 Sep, 2025 Reviewers invited by journal 11 Sep, 2025 Submission checks completed at journal 21 Aug, 2025 First submitted to journal 04 Aug, 2025 Editor assigned by journal 04 Aug, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7289882","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":513834663,"identity":"5f9f3cfb-8904-4a9b-a296-37cc975d4248","order_by":0,"name":"Mitsuko Nakashima","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA/ElEQVRIiWNgGAWjYDACCeaDDxIMbNBF8WphSzb4UJBGkhYeM8kZHw6T4C752W1p0jwG5+X5G9gffvxSw5DYwH74AYPlDtxaDO4cPmzNY3DbcMYBHmNpmWNALTxpBgySZ/BokUhLvA3UkmDAwMMgLcH2P7GBIYeBQbINj8Nm5BgAHXYOqIX98W+Jf0Bb+N/g18JwI8dIcobBAaAWBjPJj21ALRIEbDG4cwwYyAbJhjMO85hZM/YxGLdJPDM4gM8v8rObgVH5x06ev7398c0f3xhk+/mTHz6WxBNiCMAMRDxAmg2ID0s2EKMFCBh/wBgfidUyCkbBKBgFIwEAACrRTOrnqOMuAAAAAElFTkSuQmCC","orcid":"","institution":"Hamamatsu University School of Medicine","correspondingAuthor":true,"prefix":"","firstName":"Mitsuko","middleName":"","lastName":"Nakashima","suffix":""},{"id":513834664,"identity":"03c5bf26-bfa6-4606-ba7b-44645b81c343","order_by":1,"name":"Kazuyuki Komatsu","email":"","orcid":"https://orcid.org/0000-0001-9861-8412","institution":"Hamamatsu university school of medicine","correspondingAuthor":false,"prefix":"","firstName":"Kazuyuki","middleName":"","lastName":"Komatsu","suffix":""},{"id":513834665,"identity":"1b5e9522-d9f6-4139-8965-407b7bdb31dc","order_by":2,"name":"Atsushi Sugie","email":"","orcid":"","institution":"Kyoto Institute of Technology","correspondingAuthor":false,"prefix":"","firstName":"Atsushi","middleName":"","lastName":"Sugie","suffix":""},{"id":513834666,"identity":"05af3449-44b3-425b-992d-ede2e4cb12a2","order_by":3,"name":"Yohei Nitta","email":"","orcid":"https://orcid.org/0000-0002-0712-428X","institution":"Niigata University","correspondingAuthor":false,"prefix":"","firstName":"Yohei","middleName":"","lastName":"Nitta","suffix":""},{"id":513834667,"identity":"67edc846-b4b9-4ee9-a712-a350cad8a6d6","order_by":4,"name":"Jiro Osaka","email":"","orcid":"","institution":"Niigata University","correspondingAuthor":false,"prefix":"","firstName":"Jiro","middleName":"","lastName":"Osaka","suffix":""},{"id":513834668,"identity":"375db81e-d3df-4cb6-b8ed-39476961d564","order_by":5,"name":"M. Ummul Halilunnisa","email":"","orcid":"","institution":"Hamamatsu University School of Medicine","correspondingAuthor":false,"prefix":"","firstName":"M.","middleName":"Ummul","lastName":"Halilunnisa","suffix":""},{"id":513834669,"identity":"7df09ce8-2f1a-4616-9c9d-ac2f8a97d97c","order_by":6,"name":"Mitsuru Kubota","email":"","orcid":"https://orcid.org/0000-0002-5395-8226","institution":"National Center for Child Health and Development","correspondingAuthor":false,"prefix":"","firstName":"Mitsuru","middleName":"","lastName":"Kubota","suffix":""},{"id":513834670,"identity":"94da6d9e-8955-4a71-a0f0-648f44e38331","order_by":7,"name":"Nobuyuki Shimozawa","email":"","orcid":"","institution":"Life Science Research Center, Gifu University","correspondingAuthor":false,"prefix":"","firstName":"Nobuyuki","middleName":"","lastName":"Shimozawa","suffix":""},{"id":513834671,"identity":"8e30a50d-da44-4548-899c-37d76abd5178","order_by":8,"name":"Melissa Carter","email":"","orcid":"","institution":"Children’s Hospital of Eastern Ontario Research Institute","correspondingAuthor":false,"prefix":"","firstName":"Melissa","middleName":"","lastName":"Carter","suffix":""},{"id":513834672,"identity":"5cde9768-ee9e-4a58-a467-667d98c5ac37","order_by":9,"name":"Petra J. G. Zwijnenburg","email":"","orcid":"","institution":"Emma Children's Hospital, Amsterdam University Medical Centers, University of Amsterdam","correspondingAuthor":false,"prefix":"","firstName":"Petra","middleName":"J. G.","lastName":"Zwijnenburg","suffix":""},{"id":513834673,"identity":"8fb1b65f-b10b-4f9a-8753-33c89b88895d","order_by":10,"name":"Quinten Waisfisz","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Quinten","middleName":"","lastName":"Waisfisz","suffix":""},{"id":513834674,"identity":"9809eb38-2aaa-4784-89c5-1c41465bcdb5","order_by":11,"name":"Felix Boschann","email":"","orcid":"https://orcid.org/0000-0001-9410-9290","institution":"Charité - Universitätsmedizin Berlin, corporate member of Freie Universität Berlin and Humboldt-Universität zu Berlin","correspondingAuthor":false,"prefix":"","firstName":"Felix","middleName":"","lastName":"Boschann","suffix":""},{"id":513834675,"identity":"4762f38c-8658-493e-9cf0-2842dc245e89","order_by":12,"name":"Denise Horn","email":"","orcid":"","institution":"Charite - Universitätsmedizin Berlin","correspondingAuthor":false,"prefix":"","firstName":"Denise","middleName":"","lastName":"Horn","suffix":""},{"id":513834676,"identity":"b12b7ba6-1f47-4507-a389-ca60e9e89eda","order_by":13,"name":"Hirotomo Saitsu","email":"","orcid":"https://orcid.org/0000-0003-0723-0960","institution":"Hamamatsu University School of Medicine","correspondingAuthor":false,"prefix":"","firstName":"Hirotomo","middleName":"","lastName":"Saitsu","suffix":""}],"badges":[],"createdAt":"2025-08-04 10:16:06","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7289882/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7289882/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":91651972,"identity":"c506cb88-20fe-4b47-b534-09daf124d917","added_by":"auto","created_at":"2025-09-18 17:27:53","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":30475650,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eClinical features of individuals harboring eukaryotic translation initiation factor 1A X-linked (\u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eEIF1AX\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e) variants and schematic presentation of the EIF1AX protein\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A) Clinical photographs of individual 2 (upper at 16 months and lower at 6 years) and individual 4. (B) T1-weighted axial (i-iii) and midsagittal (iv), T2-weighted axial (v-vii) and coronal (viii), DWI (ix), and ADC (x) brain magnetic resonance images (MRIs) of individual 1 at 3 years of age. T2-weighted (v-viii) images show abnormal hyperintensities in the subcortical (blue arrowheads) and deep white matter in the dorsal horn of lateral ventricles (yellow arrowhead). Part of the lesion forms a low-signal lesion in the deep white matter (white arrows). (C) Locations of the four \u003cem\u003eEIF1AX\u003c/em\u003e variants and schematic protein structures are shown. The green, blue, and purple boxes depict the N-terminal tail (NTT), oligonucleotide/oligosaccharide-binding (OB)-fold domain, and C-terminal tail (CTT), respectively. Multiple amino acid sequences of EIF1AX were aligned using tools available on the CLUSTALW website (http://www.genome.jp/tools/clustalw/). DWI, diffusion-weighted imaging; ADC, apparent diffusion coefficient.\u003c/p\u003e","description":"","filename":"FIGURE1.png","url":"https://assets-eu.researchsquare.com/files/rs-7289882/v1/3112301749679ee7dcfea6c3.png"},{"id":91651956,"identity":"c16353a7-8a67-4dfc-a3bf-6bdf1a8d66da","added_by":"auto","created_at":"2025-09-18 17:27:52","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":5420671,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eIn vitro \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eEIF1AX\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e minigene splicing assay\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A) Schematic representation of the minigene construct containing a 758 bp DNA fragment consisting of two introns (white boxes) and one exon (exon 3; 104 bp; blue box) of the \u003cem\u003eEIF1AX\u003c/em\u003e gene. The enhanced green fluorescent protein (EGFP)-splice vector contains the CMV promoter (arrow), an EGFP sequence flanked by interval sequences containing splice acceptor and donor sites, a DsRed gene sequence (red box) mediated by the internal ribosome entry site (IRES; brown box), and an ampicillin selection marker (orange box). Blue arrows represent the primers used for reverse transcription PCR (RT-PCR). (B) Agarose gel images of RT-PCR products using cDNA derived from the wild-type (WT) and c.204G\u0026gt;C variant-type (VT) minigene constructs. (C) Sanger sequencing of gel-purified products (left) and schematic representation of amplified mRNA sequences of WT and VT \u003cem\u003eEIF1AX\u003c/em\u003e genes (right). We assumed that the c.204G\u0026gt;C variant may cause aberrant exon skipping, leading to a frameshift and premature termination at residue position 52.\u003c/p\u003e","description":"","filename":"FIGURE2.png","url":"https://assets-eu.researchsquare.com/files/rs-7289882/v1/7e30a7428f3f470ba295f402.png"},{"id":91651965,"identity":"66b418bf-c838-4fcf-8ba8-66974e7c4523","added_by":"auto","created_at":"2025-09-18 17:27:52","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":21697584,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eFunctional analysis of human \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eEIF1AX\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e variants in the Drosophila eye.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A) Western blot analysis of N-terminal myc-tagged human EIF1AX wild-type (WT) and four variants (N17D, V55I, K64E, D90G) expressed under Tub-Gal4. Blots were probed with anti-myc and anti-α-Tubulin antibodies as a loading control.\u003cbr\u003e\n(B) Representative images of adult male \u003cem\u003eDrosophila\u003c/em\u003e eyes expressing \u003cem\u003eEIF1AX\u003c/em\u003evariants under GMR-Gal4.\u003cbr\u003e\n(C) Quantification of eye morphology using the P score in female and male flies: control (n = 11), eIF1A WT (n = 9), N17D (n = 8), V55I (n = 10), K64E (n = 16), D90G (n = 9) for female; control (n = 10), eIF1A WT (n = 10), N17D (n = 9), V55I (n = 10), K64E (n = 19), D90G (n = 9) for male. (D) Retinal axons were visualized by immunostaining with anti-Chaoptin antibody. Representative confocal images of optic lobes are shown for each genotype.\u003cbr\u003e\n(E) Quantification of retinal axon number in female and male flies: control (n = 20), eIF1A WT (n = 16), N17D (n = 17), V55I (n = 17), K64E (n = 13), D90G (n = 14) for female; control (n = 21), eIF1A WT (n = 19), N17D (n = 20), V55I (n = 17), K64E (n = 14), D90G (n = 15) for male.. Scale bar: 50 µm.\u003c/p\u003e","description":"","filename":"FIGURE3.png","url":"https://assets-eu.researchsquare.com/files/rs-7289882/v1/9d3726e96808879f6baf27cb.png"},{"id":91651966,"identity":"023bfb17-27de-4c93-b53f-472317629dea","added_by":"auto","created_at":"2025-09-18 17:27:53","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":22390955,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eFunctional analysis of Drosophila \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eeIF1A\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e variants corresponding to human \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eEIF1AX\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003emutations.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A) Western blot of myc- and HA-tagged \u003cem\u003eDrosophila\u003c/em\u003e eIF1A WT and variant proteins (N17D, V55I, K64E, D90G) expressed under GMR-Gal4. Blots were probed with anti-HA and anti-α-Tubulin antibodies.\u003cbr\u003e\n(B) Representative images of adult male eyes expressing eIF1A variants.\u003cbr\u003e\n(C) P score quantification of eye morphology in female and male flies: control (n = 21), eIF1A WT (n = 14), N17D (n = 22), V55I (n = 13), K64E (n = 17), D90G (n = 19) for female; control (n = 19), eIF1A WT (n = 17), N17D (n = 16), V55I (n = 14), K64E (n = 20), D90G (n = 20) for male. \u003cbr\u003e\n(D) Retinal axons were stained with anti-Chaoptin antibody and visualized by confocal microscopy. Representative images of the optic lobe are shown.\u003cbr\u003e\n(E) Quantification of axon number in female and male flies: control (n = 15), eIF1A WT (n = 20), N17D (n = 19), V55I (n = 17), K64E (n = 15), D90G (n = 19) for female; control (n = 22), eIF1A WT (n = 14), N17D (n = 17), V55I (n = 23), K64E (n = 26), D90G (n = 20) for male. Scale bar: 50 µm.\u003c/p\u003e","description":"","filename":"FIGURE4.png","url":"https://assets-eu.researchsquare.com/files/rs-7289882/v1/005cd14321dc4b82ee54225b.png"},{"id":91655539,"identity":"29c44564-90e9-4060-bc06-6864a4f9082e","added_by":"auto","created_at":"2025-09-18 18:00:35","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":78856982,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7289882/v1/7c405db0-beb9-4f82-a962-e1c34bb496b4.pdf"},{"id":91651960,"identity":"0db18694-5cfb-4bda-bcb2-6b14867fab94","added_by":"auto","created_at":"2025-09-18 17:27:52","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":6054524,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSupplemental data\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe supplemental data include a Supplemental Note, four figures, and three tables.\u003c/p\u003e","description":"","filename":"Supplementaldatafinal.docx","url":"https://assets-eu.researchsquare.com/files/rs-7289882/v1/c44bbccd2b9c6aa9e0ca8a0e.docx"}],"financialInterests":"There is no duality of interest","formattedTitle":"Hemizygous loss-of-function variants of EIF1AX are associated with a syndromic neurodevelopmental disorder","fulltext":[{"header":"Introduction","content":"\u003cp\u003emRNA translation is a cyclical process highly conserved in eukaryotes that involves initiation, elongation, termination, and ribosome recycling stages [\u003cspan additionalcitationids=\"CR2 CR3\" citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. Initiation is the first step in mRNA translation, in which elongation-competent 80S ribosomes are assembled. Two ribosomal subunits, 40S and 60S, and at least 12 translation initiation factors (eIFs) are involved in this process [\u003cspan additionalcitationids=\"CR5\" citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. The appropriate regulation of RNA translation is necessary for various cellular functions. Neurons exhibit pronounced polar morphology and synaptic plasticity, and thus, translational dysregulation in neurons can induce various neurological dysfunctions [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eThe eukaryotic translation initiation factor 1A, eIF1A, is an X-linked (\u003cem\u003eEIF1AX\u003c/em\u003e) gene located on the X chromosome at position Xp22.12 and is ubiquitously expressed in all tissues [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e, \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e] and binds to the 40S ribosomal subunit. The 40S ribosomal subunit consists of 33 proteins and an 18S rRNA, and has three functional regions, namely, A, P, and E sites, that play different roles during the translation process [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. In eukaryotes, two translation initiation factors, eIF1 and eIF1A, cooperatively bind to the 40S ribosomal subunit at the P and A sites, respectively [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. Binding of these proteins induces a conformational change in the 40S subunit, leading to the opening of the mRNA binding channel [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e, \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e], and facilitates the formation of the 43S preinitiation complex (PIC) via binding of the eIF2/guanosine triphosphate/methionyl initiator tRNA complex (eIF2-ternary complex) [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e, \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. The 43S PIC binds to the capped 5\u0026prime;-end of mRNA and initiates ribosomal scanning to locate the first AUG codon [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eTo date, various pathogenic variants of genes encoding eIFs, such as \u003cem\u003eEIF4A2\u003c/em\u003e (MIM: 620455) [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e], \u003cem\u003eEIF2B1\u003c/em\u003e (MIM: 603896) [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e], \u003cem\u003eEIF2B2\u003c/em\u003e (MIM: 620312) [\u003cspan additionalcitationids=\"CR18\" citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e], \u003cem\u003eEIF2B3\u003c/em\u003e (MIM: 620312) [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e], \u003cem\u003eEIF2B4\u003c/em\u003e (MIM: 620314) [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e, \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e, \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e], \u003cem\u003eEIF2B5\u003c/em\u003e (MIM: 620315) [\u003cspan additionalcitationids=\"CR18 CR19\" citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e], and \u003cem\u003eEIF4G1\u003c/em\u003e (MIM: 614251) [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e, \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e], have been reported to correlate with neurological diseases, including neurodevelopmental disorders, epilepsy, cognitive dysfunctions, and structural brain abnormalities. Previous studies have suggested that somatic gain-of-function variants of \u003cem\u003eEIF1AX\u003c/em\u003e and elevated levels of \u003cem\u003eEIF1AX\u003c/em\u003e expression may stimulate tumorigenesis [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e, \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. However, no studies are available on the association of germline \u003cem\u003eEIF1AX\u003c/em\u003e variants with neurological disorders.\u003c/p\u003e\u003cp\u003eHere, we describe a novel neurodevelopmental disorder observed in four male patients carrying hemizygous \u003cem\u003ede novo\u003c/em\u003e variants of the \u003cem\u003eEIF1AX\u003c/em\u003e gene. In addition, our functional studies indicated that all variants resulted in different degrees of EIF1AX loss-of-function.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cp\u003e\u003cb\u003eIndividuals\u003c/b\u003e\u003c/p\u003e\u003cp\u003eThis study was approved by the Ethics Committee of the Hamamatsu University School of Medicine (approval number: 17\u0026ndash;163) and was conducted according to the guidelines of the Declaration of Helsinki. Informed consent was obtained from all participants or their legal guardians. Medical records and physical findings for each individual were reviewed and examined by the physician in charge of each medical facility. Pediatric neurologists evaluated psychomotor development, electroencephalograms (EEGs), and findings of brain magnetic resonance imaging (MRI).\u003c/p\u003e\u003cp\u003e\u003cb\u003eGenetic analyses\u003c/b\u003e\u003c/p\u003e\u003cp\u003eTrio-based exome sequencing (trio-ES) or genome sequencing was performed for all families. Prediction of significance of variants was performed using the SIFT [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e], PolyPhen-2 [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e], CADD [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e], AlphaMissense [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e], and M-CAP [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e] programs. We used multiple bioinformatic splicing prediction tools, including the deep learning networks SpliceAI [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e], Pangolin [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e], and SpliceRover [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e], to examine the variants affecting mRNA splicing. Further details on the methods used for genetic analysis are provided in the Supplemental Information.\u003c/p\u003e\u003cp\u003e\u003cb\u003eIn silico molecular analysis\u003c/b\u003e\u003c/p\u003e\u003cp\u003eWe performed molecular dynamics using GROMACS, which includes root-mean-square deviation (RMSD), root-mean-square fluctuation (RMSF), Radius of gyration (ROG), and Hydrogen bonds. Then trajectories were analyzed by principal component analysis (PCA) and free-energy landscape analysis (FEL). These were described in Supplementary data.\u003c/p\u003e\u003cp\u003e\u003cb\u003ePlasmid construction\u003c/b\u003e\u003c/p\u003e\u003cp\u003eUsing the minigene splicing method, a 758-bp human wild-type (WT) \u003cem\u003eEIF1AX\u003c/em\u003e DNA fragment (NM_001412.4) was amplified from human control DNA. Primer pairs were designed for introns 2\u0026ndash;3, including c.204 in exon 3 (Table \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e). The obtained PCR products were subcloned into the enhanced green fluorescent protein (EGFP)-splice vector, in which a CMV promotor drives split EGFP where a 178-bp intron 6 fragment of \u003cem\u003eSPTAN1\u003c/em\u003e (NM_001130438.3) containing \u003cem\u003eEcoR\u003c/em\u003eI and \u003cem\u003eCla\u003c/em\u003eI sites was inserted between \u003cem\u003eEGFP\u003c/em\u003e exon 1 and exon 2. This vector also has IRES-DsRed, allowing simultaneous detection of EGFP and DsRed fluorescence.\u003c/p\u003e\u003cp\u003eLigation was performed with EcoRI-HF and ClaI enzymes using the In-Fusion\u0026reg; HD Cloning Kit (Takara Bio, Shiga, Japan). The c.204G\u0026thinsp;\u0026gt;\u0026thinsp;C variant-containing vector was generated from the WT vector using the PrimeSTAR Mutagenesis Basal Kit (Takara Bio).\u003c/p\u003e\u003cp\u003e\u003cb\u003eMinigene splicing analysis\u003c/b\u003e\u003c/p\u003e\u003cp\u003eHEK293FT cells (Thermo Fisher Scientific) were grown to 80% confluence in 6-well plates, transiently transfected with 3 \u0026micro;g of WT or variant-type (VT) plasmids using the polyethylenimine \"MAX\" reagent (Polysciences, Warrington, PA, USA) and cultured in high glucose-containing Dulbecco\u0026rsquo;s modified Eagle medium (FUJIFILM Wako Pure Chemical, Osaka, Japan) supplemented with 10% fetal bovine serum at 37\u0026deg;C and 5% CO\u003csub\u003e2\u003c/sub\u003e. After 48 h of incubation, total RNA was extracted using the RNeasy Plus Mini kit (Qiagen, Hilden, Germany), and 1 \u0026micro;g of total RNA was reverse transcribed into cDNA using the PrimeScript RT reagent kit (Takara Bio), according to the manufacturer\u0026rsquo;s instructions. The WT and VT cDNAs were amplified using PCR with primers targeting EGFP exons 1 and 2 (Table \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e). The sequence of each amplified product was confirmed by Sanger method on ABI 3500xl or 3130xl Genetic Analyzer (Applied Biosystems, Foster City, CA, USA).\u003c/p\u003e\u003cp\u003e\u003cb\u003eFly strains\u003c/b\u003e\u003c/p\u003e\u003cp\u003eFlies were maintained at 25\u0026deg;C on standard fly food. GMR-Gal4(II) (Catalogue #1104), tub-Gal80TS (Catalogue #7019), and tub-Gal4 (catalogue #5138) were obtained from the Bloomington Drosophila Stock Center (BDSC, Bloomington, IN, USA). The 40D-UAS control line (Catalogue #60101), which contains an empty UAS insertion at the 40D landing site, was obtained from the Vienna Drosophila Resource Center (VDRC, Vienna, Austria) and used as a genetic background control.\u003c/p\u003e\u003cp\u003e\u003cb\u003eGeneration of transgenic flies\u003c/b\u003e\u003c/p\u003e\u003cp\u003eTo express human EIF1AX-fused MYC tags at the N terminals of eIF1AX, the \u003cem\u003eMYC-EIF1AX\u003c/em\u003e\u003csup\u003e\u003cem\u003eWT\u003c/em\u003e\u003c/sup\u003e, \u003cem\u003eMYC-EIF1AX\u003c/em\u003e\u003csup\u003e\u003cem\u003eN17D\u003c/em\u003e\u003c/sup\u003e, \u003cem\u003eMYC-EIF1AX\u003c/em\u003e\u003csup\u003e\u003cem\u003eV55I\u003c/em\u003e\u003c/sup\u003e, \u003cem\u003eMYC-EIF1AX\u003c/em\u003e\u003csup\u003e\u003cem\u003eK64E\u003c/em\u003e\u003c/sup\u003e, and \u003cem\u003eMYC-EIF1AX\u003c/em\u003e\u003csup\u003e\u003cem\u003eD90G\u003c/em\u003e\u003c/sup\u003e sequences were inserted into the pGP-20XUAS-IVS-Syn21-jGCaMP8s-p10 vector (catalogue #162386; Addgene, Watertown, MA, USA) using the following primer set: primer 1 (5\u0026prime;-TTCTTATCCTTTACTTCAGGCGCGGCCGCATGGAGCAAAAGCTCATTTCTGAAGAGGACTTGCCCAAGAATAAAGGTAAAGGAGG-3\u0026prime;) and primer 2 (5\u0026prime;-TTTGTTATTTTAAAAACGATTCATTTCTAGATTAGATGTCATCAATATCTTCATCATCATCTCCAATG-3\u0026prime;) after removal of the jGCaMP8s sequence. The mutations N17D, V55I, K64E, and D90G in EIF1AX were generated using inverse PCR with KOD-Plus-Neo polymerase (TOYOBO, Osaka, Japan), following the manufacturer\u0026rsquo;s instructions. Each mutated coding sequence was confirmed by Sanger sequencing. Subsequently, these plasmids were injected into fly embryos, which were then integrated into the \u003cem\u003eaTTP40\u003c/em\u003e landing site (Well Genetics, Taipei, Taiwan).\u003c/p\u003e\u003cp\u003eTo generate a corresponding transgenic construct for \u003cem\u003eDrosophila eIF1A\u003c/em\u003e, the fly ortholog of human \u003cem\u003eEIF1AX\u003c/em\u003e, total RNA was first extracted from dissected adult fly brains (10 brains per preparation) using the RNeasy Mini Kit (QIAGEN, Hilden, Germany). Reverse transcription was performed using 50 pmol of Oligo dT primer (TKR 3805, TAKARA BIO INC., Japan), 2 mM dNTP mixture (TKR 400, TAKARA BIO INC., Japan), and PrimeScript\u0026trade; II Reverse Transcriptase (TKR 2690A, TAKARA BIO INC., Japan), following incubation at 65\u0026deg;C for 5 minutes. Full-length cDNA was synthesized and used as the template for PCR amplification of the \u003cem\u003eeIF1A\u003c/em\u003e coding region using primers ATGCCCAAGAATAAAGGAAAAGGAGGCAAGAATCGTC (forward) and GATGTTGTCCACGGAGTCGGCGTCAT (reverse).\u003c/p\u003e\u003cp\u003eTo generate the expression construct, the PCR product of \u003cem\u003eeIF1A\u003c/em\u003e was further amplified with the primer set TATCCTTTACTTCAGGCGCGGCCGCCAACATGGAACAAAAACTCATCTCAGAAGAGGATCTGATGCCCAAGAATAAAGGAAAAGGAGGCAAGAATCGTC and TTTGGTTATTTTAAAAACGATTCATTTCTAGACTAAGCGTAATCTGGAACATCGTATGGGTAGATGTTGTCCACGGAGTCGGCGTCAT, which include homology arms for seamless cloning into the pGP-20XUAS-IVS-Syn21-jGCaMP8s-p10 vector. The vector was digested with NotI and XbaI, and the \u003cem\u003eeIF1A\u003c/em\u003e amplicon was inserted using the NEBuilder HiFi DNA Assembly Kit. The resulting construct, UAS-myc-eIF1A-HA, contains a myc tag at the N-terminus and an HA tag at the C-terminus of \u003cem\u003eeIF1A\u003c/em\u003e. Because \u003cem\u003eeIF1A\u003c/em\u003e is highly conserved between \u003cem\u003eDrosophila\u003c/em\u003e and humans, the amino acid residues corresponding to N17, V55, K64, and D90 are conserved, allowing introduction of the same point mutations (N17D, V55I, K64E, and D90G) into the \u003cem\u003eDrosophila eIF1A\u003c/em\u003e sequenc. The mutated \u003cem\u003eeIF1A\u003c/em\u003e constructs were cloned into the same pGP-20XUAS-IVS-Syn21-jGCaMP8s-p10 vector and used for transgenesis at the aTTP40 landing site.\u003c/p\u003e\u003cp\u003e\u003cb\u003eImmunoblot analysis of the whole body of\u003c/b\u003e \u003cb\u003eDrosophila\u003c/b\u003e\u003c/p\u003e\u003cp\u003eTemporary dynamics in protein expression were analyzed in the whole bodies of \u003cem\u003eDrosophila\u003c/em\u003e by crossing Tub-Gal4 and Tub-GAL80TS flies. Crossed flies carrying each \u003cem\u003eEIF1AX\u003c/em\u003e variant were reared at a permissive temperature (20\u0026deg;C), whereas newly eclosed females were reared at a restrictive temperature (29\u0026deg;C). After 2 days, 10 fly heads were sonicated (2 \u0026times; 30 s) in lysis buffer (10 mM Tris\u0026ndash;HCl, pH 7.5; 150 mM NaCl; 1 mM ethylenediaminetetraacetic acid [EDTA]; 2% n-dodecyl-β-D-maltoside) supplemented with 1:1000 (v/v) Protease Inhibitor Cocktail Set III (Calbiochem, La Jolla, CA, USA) using a Q55 sonicator (Qsonica, Newtown, CT, USA). For the analysis of \u003cem\u003eeIF1A\u003c/em\u003e variants, transgenic flies expressing each variant were generated using the GMR-Gal4 driver and reared at 29\u0026deg;C. From adult flies, heads were collected from 10 individuals and homogenized by sonication under the same conditions described above to extract proteins. Mouse anti-MYC (4A6; 1:5000; EMD Millipore Corp., USA), rat anti-HA (3F10; 1:4000; Roche, Basel, Switzerland) and mouse anti-α-tubulin (T9026; 1:100 000; Sigma-Aldrich, St. Louis, MO, USA) antibodies were used for western blotting. HRP-conjugated anti-mouse IgG (32430; 1:2000; Thermo Fisher Scientific, Waltham, MA, USA) and HRP-conjugated anti-rat IgG (ab97057; 1:4000; Abcam, Cambridge, UK) were used as secondary antibodies.\u003c/p\u003e\u003cp\u003e\u003cb\u003eImmunohistochemistry and imaging\u003c/b\u003e\u003c/p\u003e\u003cp\u003eFemale or male flies reared at 29\u0026deg;C for 4 weeks were used for the experiment. Sample preparation after brain dissection and immunohistochemical analysis were performed as previously described. [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e] The following antibodies were used: mouse anti-chaoptin (24B10; 1:25; Developmental Studies Hybridoma Bank, Iowa City, IA, USA) and anti-mouse Alexa Fluor 568 (1:400; Thermo Fisher Scientific, Waltham, MA, USA). The specimens were mounted using the Vectashield mounting medium (Vector Laboratories, Burlingame, CA, USA). Images were captured under a FV3000 confocal microscope (Olympus, Tokyo, Japan). Brain images were obtained under a confocal microscope equipped with a 60\u0026times; immersion objective (1.4 numerical aperture) and set to 1\u0026times; digital zoom. Images were processed using IMARIS, version 9.6.0 (Oxford Instruments, Zurich, Switzerland).\u003c/p\u003e\u003cp\u003e\u003cb\u003eBright-field microscopy for imaging and quantifying morphological defects in the eye\u003c/b\u003e\u003c/p\u003e\u003cp\u003eTo perform light microscopic imaging of adult eyes, 4 weeks flies, reared at 29\u0026deg;C to induce the expression of EIF1AX variants, or 1- to 3-d-old flies, reared at 29\u0026deg;C to induce the expression of eIF1A variants, were immobilized by freezing at -80\u0026deg;C, and then mounted on double-sided tapes. The female or male flies were then imaged under a BX53 microscope system with an MPLFLN 20\u0026times; objective lens (Olympus). Phenotypic scores were calculated using Flynotyper (version 1.0) to quantitatively assess morphological defects in \u003cem\u003eDrosophila\u003c/em\u003e eyes [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e].\u003c/p\u003e\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\u003ch2\u003eStatistical analysis\u003c/h2\u003e\u003cp\u003eDifferences among multiple groups were examined using the Kruskal\u0026ndash;Wallis test, followed by the two-stage linear step-up procedure of the Benjamini, Krieger, and Yekutieli tests using Prism version 9 (GraphPad Software, San Diego, CA, USA). The null hypothesis was rejected at a significance level of 0.05, and data are expressed as the mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard error (SE) of the mean.\u003c/p\u003e\u003c/div\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cb\u003eClinical findings\u003c/b\u003e\u003c/p\u003e\u003cp\u003eDetails of the cases of the four individuals harboring the \u003cem\u003eEIF1AX\u003c/em\u003e variants are described in the Supplemental Note, while their clinical manifestations are summarized in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. All individuals exhibited moderate-to-severe global developmental delay, autistic behavior, and facial dysmorphism. Psychomotor development was also severely delayed in all individuals, with little or no speech development. Three individuals failed to thrive and presented with short stature (\u0026lt; -3.0 standard deviation), while all four were diagnosed with congenital microcephaly. Three individuals experienced seizures, but all had normal EEGs. The seizures were either well-controlled with antiepileptic drugs or they spontaneously ceased. Neurological examination revealed abnormal muscular tone in three individuals; two had hypotonia, whereas one had hypertonia. Autistic behaviors such as sleep disturbances, aggressive behavior, and pain insensitivity were observed in all. All four presented with craniofacial dysmorphic features, including mild forehead protrusion, periorbital abnormalities (telecanthus, epicanthus, and downslanted palpebral fissures), ear abnormalities (fleshy lobes, low-set ears, and preauricular tags), nasal abnormalities (flat nasal bridge and prominent nostrils), and oral abnormalities (open mouth, short philtrum, high-arched palate, and laryngeal cleft) (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). They also exhibited additional congenital abnormalities, including cryptorchidism, tethered spinal cord, inguinal hernia, narrow internal auditory canal, delayed eruption of teeth, skeletal anomalies of the fingers and toes, and nevus spilus. Two individuals had ophthalmological abnormalities, including strabismus and myopia. Brain MRIs of two individuals showed abnormal signal intensities in the cerebrum (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB) and mild dilation of perivascular spaces. Biochemical analysis showed an elevation in the levels of cerotic acid (C26:0), a very-long-chain fatty acid (VLCFA), in two individuals. Of note, VLCFA levels were mildly but consistently elevated in individual 1; however, they were only transiently elevated in individual 2. Reduced concentrations of most amino acids in the cerebrospinal fluid (CSF) were observed in individual 4. Biochemical and metabolic tests revealed no other abnormalities.\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eSummary of clinical features of individuals harboring eukaryotic translation initiation factor 1A, X-linked (\u003cem\u003eEIF1AX\u003c/em\u003e) variants\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"5\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eIndividuals\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eIndividual 1\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eIndividual 2\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003eIndividual 3\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c5\"\u003e\u003cp\u003eIndividual 4\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eSex\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eMale\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eMale\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eMale\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eMale\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eAge at last assessment\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e5 y\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e3 y 8 m\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e31 y\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e6 y 10 m\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eEthnicity\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eJapanese (East Asian)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eWhite (Irish) and First Nations\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eDutch\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eGerman\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eEIF1AX\u003c/em\u003e variant\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003ec.269A\u0026thinsp;\u0026gt;\u0026thinsp;G\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003ec.190A\u0026thinsp;\u0026gt;\u0026thinsp;G\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003ec.49A\u0026thinsp;\u0026gt;\u0026thinsp;G\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003ec.204G\u0026thinsp;\u0026gt;\u0026thinsp;C\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eAmino acid alteration\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003ep.(Asp90Gly)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003ep.(Lys64Glu)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003ep.(Asn17Asp)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003ep.(Lys68Asn)\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eInheritance\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003ede novo\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003ede novo\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003ede novo\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003ede novo\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eBirth\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e41 weeks\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e38 weeks\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e38 weeks\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e41\u0026thinsp;+\u0026thinsp;2 weeks\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eWeight (g)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e3410 (+\u0026thinsp;1 SD)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e3515 (+\u0026thinsp;1 SD)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e3290 (+\u0026thinsp;0.2 SD)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e2560 (-2.6 SD)\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003ebody length (cm)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e50.5 (+\u0026thinsp;0.7 SD)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eN.A.\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e49 (-0.2 SD)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e44 (-3.9 SD)\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eOFC (cm)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e38 (+\u0026thinsp;1 SD)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eN.A.\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eN.A.\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e31 (-3.7 SD)\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eGrowth\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eat 5 y 1 m\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eat 5 y\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eat 31 y\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eat 6 y 10 m\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eweight (kg)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e15.3 (-1.0 SD)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e21.1 (Z\u0026thinsp;=\u0026thinsp;1.0)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e85 (+\u0026thinsp;3.4 SD)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e20 (-1.3 SD)\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eheight (cm)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e89 (-3.5 SD)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e102.7 (Z = -1.5)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e162.5 (-3 SD)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e107 (-3.2 SD)\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eOFC (cm)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e50 (0 SD)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e53 (Z\u0026thinsp;=\u0026thinsp;1.4)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e56.2 (-0.8 SD)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e47.3 (-4 SD)\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eSeizure onset\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eNone\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e24 m\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e17 y\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eNone\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eSeizure type at onset\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eNone\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eGTC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eAbsent\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eNone\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eInitial EEG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eN.A.\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eNormal\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eNormal\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eNormal\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eCourse of seizures\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eNone\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eFebrile and afebrile, myoclonic jerks\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eTonic-clonic, possibly also absent\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e8\u0026times; febrile convulsions, duration: 20 s, GTC, EEG pending\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eResponse to treatment\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eN.A.\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eControlled with levitiracetam\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eNot seizure-free using carbamazepine\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eN.A.\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eNeurologic problems\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eMild hypotonia\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eHypotonia\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eNone\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eMildly increased muscle tone (limbs)\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eIntellectual disabilities\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eYes (DQ\u003csup\u003ea\u003c/sup\u003e 46)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eYes (GDD)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eYes (Moderate intellectual disability)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eYes (GDD, IQ-test pending, and no active speech)\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eDevelopment\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eAge at sitting\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e1 y 6 m\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e7 m\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e2 y\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e1 y\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eAge at walking\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e3 y 6 m\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e1 y 8 m\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e3 y 6 m\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e2 y 3 m\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eLanguage\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eNone (at 5 y)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eAt 5 y using single words and signs to communicate\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eVerbal, full sentences\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eNone (at 7 y)\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eBehavioral problems\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eFeeding problems (imbalanced diet)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eASD\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eASD\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eSleep disturbances, autistic and aggressive behavior, autistic hypersensitivity, pain insensitivity, and feeding difficulties during infancy\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eFacial dysmorphisms\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eMild forehead protrusion, flat nasal bridge, and telecanthus\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eFleshy lobes, preauricular tag, epicanthus, high arched palate, laryngeal cleft, flat nasal bridge, and open mouth\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eMild downslanted palpebral fissures, high arched palate, short philtrum, and low-set ears\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eWide nasal bridge, prominent nostrils, narrow nasal tip, telecanthus, epicanthus, open mouth, fleshy lobes, and deep set ears\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eBrain image\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eHigh signal intensity at the frontal and dorsal horn of the lateral ventricle in MRI at 3 y 4 m\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eNormal CT, abnormal signal intensity of the right temporal lobe, and insular cortex in MRI at 2 years of age\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eCT and MRI: normal\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eMild dilation of perivascular spaces temporoparietal at 2.5 y\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eEye abnormalities\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eStrabismus\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eN.A.\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eN.A.\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eMild myopia\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eOther anomalies\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCryptorchidism, tethered spinal cord, neurogenic bladder, and nevus spilus\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eSilent aspiration, short and broad appearance of the mid phalanx of the fifth fingers, short appearance of the first metacarpals, and broad first toes\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eBilateral inguinal hernia, and recurrent dislocations of the shoulder\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eInguinal hernia at 3 m, narrow internal auditory canal, recurrent secretory otitis media, and delayed eruption of teeth\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eMetabolic analysis\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eMild elevation of C26 levels and decrease in docosahexaenoic acid and plasmalogen levels\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eElevation of C26 levels (5 times the upper limit), normal on repeat with fasting\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eNormal metabolic profiling of urine\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eReduced concentration of most amino acids in CSF (especially methionine). Unremarkable: VLFCA, acylcarnitin, CDG: transferrin-IEF, MPS\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003ctfoot\u003e\u003ctr\u003e\u003ctd colspan=\"5\"\u003eSD, standard deviation; N.A., not available; OFC, occipitofrontal circumference; EEG, electroencephalogram; GTC, generalized tonic-clonic seizure; ASD, autism spectrum disorder \u003csup\u003ea\u003c/sup\u003e, K-type developmental test\u003c/td\u003e\u003c/tr\u003e\u003c/tfoot\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eIdentification of hemizygous\u003c/b\u003e \u003cb\u003eEIF1AX\u003c/b\u003e \u003cb\u003evariants in individuals with neurodevelopmental disorders\u003c/b\u003e\u003c/p\u003e\u003cp\u003eWe performed trio-ES for family 1 and identified a hemizygous de novo c.269A\u0026thinsp;\u0026gt;\u0026thinsp;G, p.(Asp90Gly) variant of \u003cem\u003eEIF1AX\u003c/em\u003e. Three additional male individuals with neurodevelopmental disorders carrying hemizygous de novo \u003cem\u003eEIF1AX\u003c/em\u003e variants, c.49A\u0026thinsp;\u0026gt;\u0026thinsp;G, p.(Asn17Asp), c.190A\u0026thinsp;\u0026gt;\u0026thinsp;G, p.(Lys64Glu), and c.204G\u0026thinsp;\u0026gt;\u0026thinsp;C, p.(Lys68Asn), were recruited using GeneMatcher (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://genematcher.org/\u003c/span\u003e\u003cspan address=\"https://genematcher.org/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]. All variants were predicted to be deleterious by multiple pathogenicity prediction tools and were absent in gnomAD version 4.1.0 database. The c.204G\u0026thinsp;\u0026gt;\u0026thinsp;C variant affected the last base of exon 3 and was predicted to cause abnormal splicing by multiple splice-site prediction tools (Table S3). Therefore, we performed in vitro splicing assays using minigene plasmids to evaluate the functional effects of the c.204G\u0026thinsp;\u0026gt;\u0026thinsp;C variant. Minigene analysis demonstrated the skipping of exon 3, leading to frameshift and premature termination of the codon (r. 101_204del, p.[Glu34Gly*19]) (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). The other three missense variants were highly evolutionarily conserved across species. Among these three variants, p.(Lys64Glu) and p.(Lys68Asn) were located at the oligonucleotide/oligosaccharide-binding (OB) fold domain, while the p.(Asn17Asp) variant was located at the N-terminal tail (NTT) (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC). \u003cem\u003eEIF1AX\u003c/em\u003e is highly intolerant to loss-of-function (LoF; probability of being loss-of-function intolerant\u0026thinsp;=\u0026thinsp;0.91), with all candidate variants being in a hemizygous state. Therefore, we hypothesized that all candidate \u003cem\u003eEIF1AX\u003c/em\u003e variants were likely to have a LoF effect.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eEvaluation of the pathogenicity of\u003c/b\u003e \u003cb\u003eEIF1AX\u003c/b\u003e \u003cb\u003evariants\u003c/b\u003e\u003c/p\u003e\u003cp\u003eTo understand the impact of missense variants on the structural stability of EIF1AX, we performed a 100 ns molecular dynamic simulation models using GROMACS for the WT, candidate variants and p.(Val55Ile), a benign control variant found in the gnomAD database with hemizygous state. We performed RMSD analysis of the atoms comprising the backbones of the WT and variant molecules. It revealed that the variant models exhibited more remarkable structural stability than WT (Figure \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003eA). RMSF showed a highly flexible peaks in the OB-fold in p.(Val55Ile), whereas other VT proteins had fewer flexible peaks (Figure \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003eB), indicating the flexibility of residues in the OB-fold was suggested to disrupt the binding of these proteins. Measurement of ROG and the number of hydrogen bond showed no differences among WT and VTs (Figure \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003eC and S1D). These findings suggested that both WT and VTs proteins maintained compactness of the protein and intramolecular hydrogen bonds. PCA-based FEL analysis was performed to study structural transitions and retrieve biologically relevant conformations. In this analysis, multiple cluster basins were obtained for the variants p.(Lys64Glu) and p.(Asp90Gly). On the other hand, the p.(Asn17Asp) variant attained a single small cluster, which was like the WT (Figure S2). We retrieved the representative structures from various cluster basins for the WT and variants and observed the changes in their conformational patterns by superimposing the structures. We adopted cluster 1 (C1) structures for all alignments of the minimum energy cluster. The p.(Lys64Glu) showed an extended helix in the variant model and p.(Asp90Gly) disrupted the β-sheet in the variant model (Figure S3). The p.(Asn17Asp) and p.(Val55Ile) models showed no structural changes. These findings suggested that none of the variants have a significant effect on protein stability.\u003c/p\u003e\u003cp\u003eTo confirm the stability of the WT and VT EIF1AX proteins, we transiently overexpressed them in HEK293FT cells and evaluated their protein levels. Immunoblotting assays revealed that the levels of protein expression did not decrease in cells expressing WT and EIF1AX variants (n\u0026thinsp;=\u0026thinsp;4; Figure S4). Notably, the level of the p.(Asp90Gly) protein was slightly higher than that of the other proteins. This result showed that the stability of the WT and VT EIF1AX proteins was not significantly different.\u003c/p\u003e\u003cp\u003eNext, to evaluate the pathogenicity of the novel EIF1AX variants in \u003cem\u003eDrosophila\u003c/em\u003e, we generated transgenic fly lines expressing MYC-tagged WT and variant genes under the control of an upstream activating sequence (UAS). Using the phiC31 integrase system [\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e], EIF1AX WT, N17D, V55I, K64E, and D90G were inserted into the same genomic position to eliminate positional effects on gene expression. The Gal4-UAS system [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e] induced the expression of the \u003cem\u003eEIF1AX\u003c/em\u003e gene by binding the yeast transcription factor Gal4 to the UAS sequence. EIF1AX was expressed throughout the body, and immunoblotting analyses confirmed the presence of similar protein levels in the WT, N17D, V55I, K64E, and D90G strains (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eTo analyze the effect of each variant on gene function, we expressed the human EIF1AX WT, N17D, V55I, K64E, and D90G proteins in the visual system using the eye-specific GMR-Gal4 driver and assessed the rough eye phenotype (REP). REP has long been used in disease research to evaluate gene functions [\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e]. The overexpression of \u003cem\u003eEIF1AX\u003c/em\u003e\u003csup\u003e\u003cem\u003eWT\u003c/em\u003e\u003c/sup\u003e, \u003cem\u003eEIF1AX\u003c/em\u003e\u003csup\u003e\u003cem\u003eN17D\u003c/em\u003e\u003c/sup\u003e, or \u003cem\u003eEIF1AX\u003c/em\u003e\u003csup\u003e\u003cem\u003eV55I\u003c/em\u003e\u003c/sup\u003e caused mild REP, whereas overexpression of \u003cem\u003eEIF1AX\u003c/em\u003e\u003csup\u003e\u003cem\u003eK64E\u003c/em\u003e\u003c/sup\u003e or \u003cem\u003eEIF1AX\u003c/em\u003e\u003csup\u003e\u003cem\u003eD90G\u003c/em\u003e\u003c/sup\u003e significantly reduced REP in both females and males (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB and \u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC). This suggested that \u003cem\u003eEIF1AX\u003c/em\u003e\u003csup\u003e\u003cem\u003eWT\u003c/em\u003e\u003c/sup\u003e, \u003cem\u003eEIF1AX\u003c/em\u003e\u003csup\u003e\u003cem\u003e17D\u003c/em\u003e\u003c/sup\u003e, and \u003cem\u003eEIF1AX\u003c/em\u003e\u003csup\u003e\u003cem\u003eV55I\u003c/em\u003e\u003c/sup\u003e function in a neomorphic manner in flies in vivo, resulting in structural abnormalities in the compound eye. Paradoxically, the K64E and D90G variants may be LoF variants because we observed that the structural abnormalities in the eye were alleviated. Considering the clinical manifestations exhibited by the individuals, we hypothesized that EIF1AX plays a crucial role in the nervous system. Thus, to investigate the function of these variants, we used the retinal axons of \u003cem\u003eDrosophila\u003c/em\u003e as model neurons. To compare the number of retinal axon terminals among the different variants, we used MeDUsA, a previously developed automated method for quantifying degeneration using fly axons [\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e]. We observed that overexpression of \u003cem\u003eEIF1AX\u003c/em\u003e\u003csup\u003e\u003cem\u003eWT\u003c/em\u003e\u003c/sup\u003e strongly reduced axonal numbers, whereas overexpression of \u003cem\u003eEIF1AX\u003c/em\u003e\u003csup\u003e\u003cem\u003eK64E\u003c/em\u003e\u003c/sup\u003e in both females and males caused a mild reduction in axonal numbers (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD and \u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eE).\u003c/p\u003e\u003cp\u003eWe further investigated the function of \u003cem\u003eeIF1A\u003c/em\u003e, the \u003cem\u003eDrosophila\u003c/em\u003e homolog of \u003cem\u003eEIF1AX\u003c/em\u003e. \u003cem\u003eDrosophila eIF1A\u003c/em\u003e exhibits a high degree of sequence conservation with \u003cem\u003eEIF1AX\u003c/em\u003e, with key residues\u0026mdash;Asn at position 17, Val at 55, Lys at 64, and Asp at 90\u0026mdash;being fully conserved. To assess the functional impact of mutations at these conserved sites, we generated transgenic flies expressing WT \u003cem\u003eeIF1A\u003c/em\u003e or mutant variants (N17D, V55I, K64E, D90G) under the control of a UAS promoter. Each construct was tagged with a myc epitope at the N-terminus and an HA epitope at the C-terminus. To control for positional effects, all constructs were inserted into the same genomic locus using the phiC31 integrase system. Western blot analysis confirmed comparable protein expression levels across all transgenic lines (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA). In the rough eye assay, overexpression of wild-type \u003cem\u003eeIF1A\u003c/em\u003e resulted in structural disorganization of the compound eye consistent with the phenotypes observed with \u003cem\u003eEIF1AX\u003c/em\u003e overexpression. In contrast, the K64E and D90G mutants significantly suppressed these phenotypes in both males and females, preserving more normal eye architecture (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB and \u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC). These results suggest that K64E and D90G mutations partially impair the translational regulatory function of \u003cem\u003eeIF1A\u003c/em\u003e and do not exhibit the hyperactive translation effects observed with the wild-type protein.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eWe next used the MeDUSA system to quantitatively assess retinal axon integrity. Expression of wild-type eIF1A led to a marked reduction in the number of retinal axons, indicating a neurodegenerative phenotype as \u003cem\u003eEIF1AX\u003c/em\u003e. This suggests that the elevated activity of \u003cem\u003eeIF1A\u003c/em\u003e as a translation factor disrupts neuronal homeostasis in the photoreceptor neurons. In contrast, expression of the K64E and D90G mutants mitigated axon loss and preserved neuronal structure (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD and \u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eE). Although the axon-preserving effect of K64E did not reach statistical significance under one condition (\u003cem\u003eeIF1A\u003c/em\u003e-expressing females), it was clearly observed under other conditions, supporting its classification as a loss-of-function variant overall. In contrast, the N17D and V55I mutations induced minimal structural changes in both the rough eye and retinal axon assays. Although a slight trend toward axon preservation was observed in some instances, these changes were not statistically significant (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eE), suggesting that these variants are likely mild loss-of-function or benign mutations. Taken together, we considered that N17D causing mild loss-of-function, whereas K64E and D90G potentially causing severe loss-of-function.\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eIn this study, we identified four de novo hemizygous \u003cem\u003eEIF1AX\u003c/em\u003e variants (comprising three missense and one splice variant) in four male individuals exhibiting variable neurodevelopmental disorders. All individuals presented with developmental and language delays, autistic behavioral problems, and facial dysmorphisms. They frequently exhibited short stature (3/4; 75%), abnormal brain imaging findings (3/4; 75%), seizures (2/4; 50%), and ophthalmological abnormalities (2/4; 50%). They had similar facial features, including a flat nasal bridge, telecanthus, epicanthus, fleshy lobes, and an open mouth. Various congenital abnormalities of the nerves, gonads, phalangeal bones, and internal organs were observed in one individual. Notably, temporary or continuous accumulation of VLCFAs in the serum was observed in two individuals. VLCFAs are known to accumulate in the sera of patients with peroxisome biogenesis disorders [\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e], but have not been reported in patients carrying variants of genes encoding eIFs [\u003cspan additionalcitationids=\"CR16 CR17 CR18 CR19 CR20 CR21\" citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. Proper RNA translation is required to maintain the metabolic functions of peroxisomes; knockdown of \u003cem\u003ePEX5\u003c/em\u003e, one of the causative genes for peroxisome biogenesis disorders, in human cells and \u003cem\u003eDrosophila\u003c/em\u003e oenocytes led to an increase in eIF2α phosphorylation, resulting in suppression of protein translation [\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e]. Therefore, functional defects of eIF1A might also cause impairment of peroxisomal biogenesis, and the accumulation of serum VLCFAs could be a helpful biomarker for diagnosing an \u003cem\u003eEIF1AX\u003c/em\u003e-related disorder. Brain MRI findings of individual 1 (Asp90Gly) showed lesions with high signal intensities on T2 FLAIR, equal to those of low signal intensity on DWI, and high signal intensity on ADC in the subcortical and deep white matter in the dorsal horn of lateral ventricles, which contained some lesions with isosignal intensity in the cerebrospinal fluid. These lesions suggested the possible presence of degenerative lesions in the white matter, such as those in \u003cem\u003eEIF2B\u003c/em\u003e-related diseases [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eThe c.204G\u0026thinsp;\u0026gt;\u0026thinsp;C variant detected in individual 4 is located at the 3\u0026prime;-end of exon 2, and minigene analysis showed aberrant mRNA splicing resulting in the generation of a premature termination codon p.(Glu34Gly*19), likely leading to RNA degradation via the nonsense-mediated mRNA decay system. As no individual-derived sample was accessible for RNA studies, we could not exclude the possibility that, to some extent, normal splicing occurred, resulting in a certain amount of protein with the predicted missense variant p.(Lys68Asn). In silico analysis indicated that the mild structural changes of the eIF1A protein with two variants, p.(Lys64Glu) and p.(Asp90Gly) but the p.(Asn17Asp) variant was predicted to cause no structural changes. Transiently expressed WT and VT EIF1AX plasmid showed the same level of protein expression, suggesting that all the variants had no significant effect on protein stability. Functional studies using Drosophila models confirmed p.(Lys64Glu) and p.(Asp90Gly) variants had the LoF effects, whereas the p.(Asn17Asp) had milder effects than other two variants. However, we could not clarify the discrepancy in pathogenicity between the p.(Asn17Asp) and p.(Val55Ile) variants.\u003c/p\u003e\u003cp\u003eIndividual 3 carrying the p.(Asn17Asp) variant exhibited a milder phenotype than those of the other three affected individuals. Consequently, we assume that highly pathogenic hemizygous LoF variants cause a complete deficit in functional eIF1A, whereas moderate pathogenic missense variants retain the EIF1A function. Considering these findings, we hypothesized that pathogenic variants exhibit a genotype-phenotype correlation, resulting in various degrees of LoF effects and \u003cem\u003eEIF1AX\u003c/em\u003e-related phenotypes.\u003c/p\u003e\u003cp\u003eAnother explanation for this phenotypic variability may be the domain-specific locations of the detected missense variants. The eIF1A protein is composed of an OB-fold domain that is homologous to prokaryotic IF1 [\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e], an a-helical domain with two flexible intrinsically disordered tails: a positively charged NTT and a negatively charged C-terminal tail (CTT) [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e, \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. The missense variants, p.(Lys64Glu), p.(Lys68Asn), and p.(Asp90Gly), found in individuals exhibiting severe phenotypes, are located within the OB-fold domain, whereas the p.(Asn17Asp) variant is located at the NTT (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC). The OB-fold domain forms a five-stranded closed β barrel that acts as a ligand binding surface or an active site, and has high affinity for single-stranded DNA or RNA [\u003cspan additionalcitationids=\"CR44\" citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e]. The OB-fold domain is crucial for binding to the A site of the 18S rRNA, and variants affecting the OB-fold domain reduce the RNA binding ability [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. Therefore, we hypothesized that the variants located in the OB-fold domain impair the binding of RNA, which might explain the severity of the observed phenotype. Both the NTT and CTT are involved in the ribosomal recruitment of eIF2-ternary complexes and initiation codon selection, whereas they have opposite effects on the determinants of start codon selection [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e, \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e]. CTT acts as an enhancer for scanning and recognizing AUG, and CTT mutations weaken the recruitment of eIF2-ternary complexes and increase the initiation of non-AUG codons. NTT acts as a scanning inhibitor, leading to scanning termination, with NTT mutations enhancing the leaky scanning of the AUG codon. In addition, NTT mutations also weaken the assembly of the eIF2-ternary complex, which can be rescued by eIF1. This suggested that the LoF effect of the p.(Asn17Asp) variant was probably rescued by eIF1, potentially explaining the mild phenotypes of patients with this variant. One limitation of this study was that we could not accurately define disease-specific clinical manifestations because of the small number of patients. Therefore, more cases need to be investigated to delineate the phenotypic spectrum of \u003cem\u003eEIF1AX\u003c/em\u003e-related disorders and verify the genotype-phenotype correlations.\u003c/p\u003e\u003cp\u003eIn summary, our findings suggest that the \u003cem\u003eEIF1AX\u003c/em\u003e gene is a novel candidate gene for syndromic neurodevelopmental disorders in men. Functional studies have indicated that all variants have various degrees of LoF effects, which might correlate with the severity of clinical phenotypes. Although \u003cem\u003eDrosophila\u003c/em\u003e is a useful biological model to evaluate the pathogenicity of variants, further analyses are required to elucidate the pathology of \u003cem\u003eEIF1AX\u003c/em\u003e-related disorders.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe express our gratitude to the patients and their families for their participation in this study.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study was funded by the Japan Society for the Promotion of Science, Grant-in-Aids for Scientific Research (grant numbers: JP20H03641, JP23H02875, and JP21H02837), Grant-in-Aid for Early-Career Scientists (grant number: JP21K15619), Japan Agency for Medical Research and Development (AMED; grant numbers: JP23ek0109549, JP23ek0109674, and JP23ek0109637, JP24ek0109760s4001), GSK Japan Research Grant 2021 (grant number: AS2021A000166849), SENSHIN Medical Research Foundation, Takeda Science Foundation Specific Research Grants and Takeda Science Foundation Bioscience Research Grants (grant number: 2023025566), and HUSM Grant-in-Aid from Hamamatsu University School of Medicine. Dr. Boschann is a participant in the Clinician Scientist Program (grant number: CS4RARE) funded by Alliance4Rare, and is associated with the BIH Charité Clinician Scientist Program. Exome analysis for Individual 2 was performed under the Care4Rare Canada Consortium, funded by Genome Canada and the Ontario Genomics Institute (grant number: OGI-147), the Canadian Institutes of Health Research, the Ontario Research Fund, Genome Alberta, Genome British Columbia, Genome Quebec, and the Children’s Hospital of Eastern Ontario Foundation. Sequencing of family 4 was supported by the Case Analysis and Decision Support (CADS) program of the Berlin Institute of Health at Charité – Universitätsmedizin, Berlin.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eH. S.: conceptualization. P. J. G. Z., Q. W., M. T. C., D. H., F. B., M. K., and N. S.: phenotypic data curation. K.K., M. N., and H.S.: genetic data curation and writing of the original draft. K. K.: investigation (experimental analyses using transfected cells). M. U. H.: formal analysis (in silico protein structural and molecular dynamic analyses). A. S., Y. N. and J. O.: methodology and formal analysis (generated and analyzed morphologies of \u003cem\u003eDrosophila\u003c/em\u003e models and performed statistical analyses). All authors: writing, review, and editing. We would like to thank Editage (www.editage.jp) for English language editing.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthical Approval\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study was approved by the Ethics Committee of the Hamamatsu University School of Medicine (approval number: 17-163) and was conducted according to the guidelines of the Declaration of Helsinki. Informed consent was obtained from all participants or their legal guardians. Medical records and physical findings for each individual were reviewed and examined by the physician in charge of each medical facility.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDeclaration of interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no competing interests.\u0026nbsp;\u003c/p\u003e\u003ch2\u003eData and code availability\u003c/h2\u003e\u003cp\u003eThe data that support the findings of this study are available from the corresponding authors, M. N. and A. S., upon reasonable request.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eHellen CUT: Translation Termination and Ribosome Recycling in Eukaryotes. \u003cem\u003eCold Spring Harb Perspect Biol\u003c/em\u003e 2018;10.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHinnebusch AG: The scanning mechanism of eukaryotic translation initiation. \u003cem\u003eAnnu Rev Biochem\u003c/em\u003e 2014;83:779\u0026ndash;812.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHussain T, Ll\u0026aacute;cer JL, Fern\u0026aacute;ndez IS, Munoz A, Martin-Marcos P, Savva CG \u003cem\u003eet al\u003c/em\u003e: Structural changes enable start codon recognition by the eukaryotic translation initiation complex. \u003cem\u003eCell\u003c/em\u003e 2014;159:597\u0026ndash;607.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eJackson RJ, Hellen CU, Pestova TV: The mechanism of eukaryotic translation initiation and principles of its regulation. \u003cem\u003eNat Rev Mol Cell Biol\u003c/em\u003e 2010;11:113\u0026ndash;127.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLomakin IB, Steitz TA: The initiation of mammalian protein synthesis and mRNA scanning mechanism. \u003cem\u003eNature\u003c/em\u003e 2013;500:307\u0026ndash;311.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePassmore LA, Schmeing TM, Maag D, Applefield DJ, Acker MG, Algire MA \u003cem\u003eet al\u003c/em\u003e: The eukaryotic translation initiation factors eIF1 and eIF1A induce an open conformation of the 40S ribosome. \u003cem\u003eMol Cell\u003c/em\u003e 2007;26:41\u0026ndash;50.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKapur M, Monaghan CE, Ackerman SL: Regulation of mRNA Translation in Neurons-A Matter of Life and Death. \u003cem\u003eNeuron\u003c/em\u003e 2017;96:616\u0026ndash;637.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHui KK, Chen YK, Endo R, Tanaka M: Translation from the Ribosome to the Clinic: Implication in Neurological Disorders and New Perspectives from Recent Advances. \u003cem\u003eBiomolecules\u003c/em\u003e 2019;9.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eFekete CA, Applefield DJ, Blakely SA, Shirokikh N, Pestova T, Lorsch JR \u003cem\u003eet al\u003c/em\u003e: The eIF1A C-terminal domain promotes initiation complex assembly, scanning and AUG selection in vivo. \u003cem\u003eEmbo j\u003c/em\u003e 2005;24:3588\u0026ndash;3601.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBattiste JL, Pestova TV, Hellen CU, Wagner G: The eIF1A solution structure reveals a large RNA-binding surface important for scanning function. \u003cem\u003eMol Cell\u003c/em\u003e 2000;5:109\u0026ndash;119.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMoraleva AA, Deryabin AS, Rubtsov YP, Rubtsova MP, Dontsova OA: Eukaryotic Ribosome Biogenesis: The 40S Subunit. \u003cem\u003eActa Naturae\u003c/em\u003e 2022;14:14\u0026ndash;30.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWeisser M, Voigts-Hoffmann F, Rabl J, Leibundgut M, Ban N: The crystal structure of the eukaryotic 40S ribosomal subunit in complex with eIF1 and eIF1A. \u003cem\u003eNat Struct Mol Biol\u003c/em\u003e 2013;20:1015\u0026ndash;1017.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHinnebusch AG: Molecular mechanism of scanning and start codon selection in eukaryotes. \u003cem\u003eMicrobiol Mol Biol Rev\u003c/em\u003e 2011;75:434\u0026ndash;467.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSaini AK, Nanda JS, Lorsch JR, Hinnebusch AG: Regulatory elements in eIF1A control the fidelity of start codon selection by modulating tRNA(i)(Met) binding to the ribosome. \u003cem\u003eGenes Dev\u003c/em\u003e 2010;24:97\u0026ndash;110.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePaul MS, Duncan AR, Genetti CA, Pan H, Jackson A, Grant PE \u003cem\u003eet al\u003c/em\u003e: Rare EIF4A2 variants are associated with a neurodevelopmental disorder characterized by intellectual disability, hypotonia, and epilepsy. \u003cem\u003eAm J Hum Genet\u003c/em\u003e 2023;110:548.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003evan der Knaap MS, Leegwater PA, K\u0026ouml;nst AA, Visser A, Naidu S, Oudejans CB \u003cem\u003eet al\u003c/em\u003e: Mutations in each of the five subunits of translation initiation factor eIF2B can cause leukoencephalopathy with vanishing white matter. \u003cem\u003eAnn Neurol\u003c/em\u003e 2002;51:264\u0026ndash;270.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLeegwater PA, Vermeulen G, K\u0026ouml;nst AA, Naidu S, Mulders J, Visser A \u003cem\u003eet al\u003c/em\u003e: Subunits of the translation initiation factor eIF2B are mutant in leukoencephalopathy with vanishing white matter. \u003cem\u003eNat Genet\u003c/em\u003e 2001;29:383\u0026ndash;388.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003evan der Knaap MS, van Berkel CG, Herms J, van Coster R, Baethmann M, Naidu S \u003cem\u003eet al\u003c/em\u003e: eIF2B-related disorders: antenatal onset and involvement of multiple organs. \u003cem\u003eAm J Hum Genet\u003c/em\u003e 2003;73:1199\u0026ndash;1207.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eFogli A, Rodriguez D, Eymard-Pierre E, Bouhour F, Labauge P, Meaney BF \u003cem\u003eet al\u003c/em\u003e: Ovarian failure related to eukaryotic initiation factor 2B mutations. \u003cem\u003eAm J Hum Genet\u003c/em\u003e 2003;72:1544\u0026ndash;1550.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003evan der Lei HD, van Berkel CG, van Wieringen WN, Brenner C, Feigenbaum A, Mercimek-Mahmutoglu S \u003cem\u003eet al\u003c/em\u003e: Genotype-phenotype correlation in vanishing white matter disease. \u003cem\u003eNeurology\u003c/em\u003e 2010;75:1555\u0026ndash;1559.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eNuytemans K, Bademci G, Inchausti V, Dressen A, Kinnamon DD, Mehta A \u003cem\u003eet al\u003c/em\u003e: Whole exome sequencing of rare variants in EIF4G1 and VPS35 in Parkinson disease. \u003cem\u003eNeurology\u003c/em\u003e 2013;80:982\u0026ndash;989.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eChartier-Harlin MC, Dachsel JC, Vilari\u0026ntilde;o-G\u0026uuml;ell C, Lincoln SJ, Lepr\u0026ecirc;tre F, Hulihan MM \u003cem\u003eet al\u003c/em\u003e: Translation initiator EIF4G1 mutations in familial Parkinson disease. \u003cem\u003eAm J Hum Genet\u003c/em\u003e 2011;89:398\u0026ndash;406.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKrishnamoorthy GP, Davidson NR, Leach SD, Zhao Z, Lowe SW, Lee G \u003cem\u003eet al\u003c/em\u003e: EIF1AX and RAS Mutations Cooperate to Drive Thyroid Tumorigenesis through ATF4 and c-MYC. \u003cem\u003eCancer Discov\u003c/em\u003e 2019;9:264\u0026ndash;281.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLi Y, Guo L, Ying S, Feng GH, Zhang Y: Transcriptional repression of p21 by EIF1AX promotes the proliferation of breast cancer cells. \u003cem\u003eCell Prolif\u003c/em\u003e 2020;53:e12903.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eNg PC, Henikoff S: Predicting deleterious amino acid substitutions. \u003cem\u003eGenome Res\u003c/em\u003e 2001;11:863\u0026ndash;874.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAdzhubei IA, Schmidt S, Peshkin L, Ramensky VE, Gerasimova A, Bork P \u003cem\u003eet al\u003c/em\u003e: A method and server for predicting damaging missense mutations. \u003cem\u003eNat Methods\u003c/em\u003e 2010;7:248\u0026ndash;249.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eRentzsch P, Witten D, Cooper GM, Shendure J, Kircher M: CADD: predicting the deleteriousness of variants throughout the human genome. \u003cem\u003eNucleic Acids Res\u003c/em\u003e 2019;47:D886-d894.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCheng J, Novati G, Pan J, Bycroft C, Žemgulytė A, Applebaum T \u003cem\u003eet al\u003c/em\u003e: Accurate proteome-wide missense variant effect prediction with AlphaMissense. \u003cem\u003eScience\u003c/em\u003e 2023;381:eadg7492.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eJagadeesh KA, Wenger AM, Berger MJ, Guturu H, Stenson PD, Cooper DN \u003cem\u003eet al\u003c/em\u003e: M-CAP eliminates a majority of variants of uncertain significance in clinical exomes at high sensitivity. \u003cem\u003eNat Genet\u003c/em\u003e 2016;48:1581\u0026ndash;1586.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eJaganathan K, Kyriazopoulou Panagiotopoulou S, McRae JF, Darbandi SF, Knowles D, Li YI \u003cem\u003eet al\u003c/em\u003e: Predicting Splicing from Primary Sequence with Deep Learning. \u003cem\u003eCell\u003c/em\u003e 2019;176:535\u0026ndash;548.e524.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZeng T, Li YI: Predicting RNA splicing from DNA sequence using Pangolin. \u003cem\u003eGenome Biol\u003c/em\u003e 2022;23:103.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZuallaert J, Godin F, Kim M, Soete A, Saeys Y, De Neve W: SpliceRover: interpretable convolutional neural networks for improved splice site prediction. \u003cem\u003eBioinformatics\u003c/em\u003e 2018;34:4180\u0026ndash;4188.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSugie A, Marchetti G, Tavosanis G: Structural aspects of plasticity in the nervous system of Drosophila. \u003cem\u003eNeural Dev\u003c/em\u003e 2018;13:14.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eIyer J, Wang Q, Le T, Pizzo L, Gr\u0026ouml;nke S, Ambegaokar SS \u003cem\u003eet al\u003c/em\u003e: Quantitative Assessment of Eye Phenotypes for Functional Genetic Studies Using Drosophila melanogaster. \u003cem\u003eG3 (Bethesda)\u003c/em\u003e 2016;6:1427\u0026ndash;1437.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSobreira N, Schiettecatte F, Valle D, Hamosh A: GeneMatcher: a matching tool for connecting investigators with an interest in the same gene. \u003cem\u003eHum Mutat\u003c/em\u003e 2015;36:928\u0026ndash;930.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGroth AC, Fish M, Nusse R, Calos MP: Construction of transgenic Drosophila by using the site-specific integrase from phage phiC31. \u003cem\u003eGenetics\u003c/em\u003e 2004;166:1775\u0026ndash;1782.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBrand AH, Perrimon N: Targeted gene expression as a means of altering cell fates and generating dominant phenotypes. \u003cem\u003eDevelopment\u003c/em\u003e 1993;118:401\u0026ndash;415.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eNitta Y, Sugie A: Studies of neurodegenerative diseases using Drosophila and the development of novel approaches for their analysis. \u003cem\u003eFly (Austin)\u003c/em\u003e 2022;16:275\u0026ndash;298.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eNitta Y, Kawai H, Maki R, Osaka J, Hakeda-Suzuki S, Nagai Y \u003cem\u003eet al\u003c/em\u003e: Direct evaluation of neuroaxonal degeneration with the causative genes of neurodegenerative diseases in Drosophila using the automated axon quantification system, MeDUsA. \u003cem\u003eHum Mol Genet\u003c/em\u003e 2023;32:1524\u0026ndash;1538.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSuzuki Y, Shimozawa N, Orii T, Tsukamoto T, Osumi T, Fujiki Y \u003cem\u003eet al\u003c/em\u003e: Genetic and molecular bases of peroxisome biogenesis disorders. \u003cem\u003eGenet Med\u003c/em\u003e 2001;3:372\u0026ndash;376.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eDahan N, Bykov YS, Boydston EA, Fadel A, Gazi Z, Hochberg-Laufer H \u003cem\u003eet al\u003c/em\u003e: Peroxisome function relies on organelle-associated mRNA translation. \u003cem\u003eSci Adv\u003c/em\u003e 2022;8:eabk2141.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSette M, van Tilborg P, Spurio R, Kaptein R, Paci M, Gualerzi CO \u003cem\u003eet al\u003c/em\u003e: The structure of the translational initiation factor IF1 from E.coli contains an oligomer-binding motif. \u003cem\u003eEmbo j\u003c/em\u003e 1997;16:1436\u0026ndash;1443.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eFlynn RL, Zou L: Oligonucleotide/oligosaccharide-binding fold proteins: a growing family of genome guardians. \u003cem\u003eCrit Rev Biochem Mol Biol\u003c/em\u003e 2010;45:266\u0026ndash;275.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eArcus V: OB-fold domains: a snapshot of the evolution of sequence, structure and function. \u003cem\u003eCurr Opin Struct Biol\u003c/em\u003e 2002;12:794\u0026ndash;801.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eTheobald DL, Mitton-Fry RM, Wuttke DS: Nucleic acid recognition by OB-fold proteins. \u003cem\u003eAnnu Rev Biophys Biomol Struct\u003c/em\u003e 2003;32:115\u0026ndash;133.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eFekete CA, Mitchell SF, Cherkasova VA, Applefield D, Algire MA, Maag D \u003cem\u003eet al\u003c/em\u003e: N- and C-terminal residues of eIF1A have opposing effects on the fidelity of start codon selection. \u003cem\u003eEmbo j\u003c/em\u003e 2007;26:1602\u0026ndash;1614.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"european-journal-of-human-genetics","isNatureJournal":false,"hasQc":false,"allowDirectSubmit":false,"externalIdentity":"ejhg","sideBox":"Learn more about [European Journal of Human Genetics](http://www.nature.com/ejhg/)","snPcode":"41431","submissionUrl":"https://mts-ejhg.nature.com/cgi-bin/main.plex","title":"European Journal of Human Genetics","twitterHandle":"@ejhg_journal","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"ejp","reportingPortfolio":"Nature AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"Neurodevelopmental delay, EIF1AX, LoF variant, germline","lastPublishedDoi":"10.21203/rs.3.rs-7289882/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7289882/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003ePathogenic variants of genes encoding initiation factors can cause neurological diseases, including neurodevelopmental disorders and brain abnormalities. The eukaryotic translation initiation factor 1A (eIF1A), is an X-linked (\u003cem\u003eEIF1AX\u003c/em\u003e) gene located at Xp22.12 that plays an important role in the regulation of translation initiation. Here, we identified \u003cem\u003ede novo\u003c/em\u003e hemizygous \u003cem\u003eEIF1AX\u003c/em\u003e variants in male individuals with neurodevelopmental disorders and explored their possible involvement in these neurological disorders. We performed trio-based exome or whole genome sequencing in four families. The pathogenicity of \u003cem\u003eEIF1AX\u003c/em\u003e variants was evaluated using a molecular dynamic simulation and transgenic \u003cem\u003eDrosophila\u003c/em\u003e models. We identified four \u003cem\u003ede novo\u003c/em\u003e hemizygous \u003cem\u003eEIF1AX\u003c/em\u003e variants in four male individuals with variable neurodevelopmental delay, dysmorphic features, behavioral problems, ophthalmological abnormalities, and structural abnormalities in the brain. One variant was predicted to cause a splicing alteration, and minigene analysis confirmed exon skipping leading to the generation of a premature termination codon. In transgenic \u003cem\u003eDrosophila\u003c/em\u003e harboring wild-type (WT) \u003cem\u003eEIF1AX\u003c/em\u003e or the three other \u003cem\u003eEIF1AX\u003c/em\u003e missense variants, overexpression of WT and the p.(Asn17Asp) variant caused structural abnormalities in the compound eye, whereas the p.(Lys64Glu) and p.(Asp90Gly) variants significantly reduced these eye abnormalities. In addition, WT overexpression resulted in significant axonal toxicity in the \u003cem\u003eDrosophila\u003c/em\u003e optic nerve, causing a significant reduction in the number of axons, whereas all mutants showed only a mild reduction in axonal number. Our findings indicated that all variants resulted in different degrees of \u003cem\u003eEIF1AX\u003c/em\u003e loss-of-function. Overall, the \u003cem\u003eEIF1AX\u003c/em\u003e gene is a novel candidate gene for syndromic neurodevelopmental disorders in men.\u003c/p\u003e","manuscriptTitle":"Hemizygous loss-of-function variants of EIF1AX are associated with a syndromic neurodevelopmental disorder","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-09-18 17:27:48","doi":"10.21203/rs.3.rs-7289882/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"revise","date":"2025-11-11T16:55:57+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"This content is not available.","date":"2025-10-07T01:45:49+00:00","index":2,"fulltext":"This content is not available."},{"type":"editorInvitedReview","content":"This content is not available.","date":"2025-09-29T07:59:12+00:00","index":1,"fulltext":"This content is not available."},{"type":"reviewerAgreed","content":"This content is not available.","date":"2025-09-25T07:44:05+00:00","index":3,"fulltext":"This content is not available."},{"type":"reviewerAgreed","content":"This content is not available.","date":"2025-09-15T01:27:55+00:00","index":2,"fulltext":"This content is not available."},{"type":"reviewerAgreed","content":"This content is not available.","date":"2025-09-12T05:35:23+00:00","index":1,"fulltext":"This content is not available."},{"type":"reviewersInvited","content":"","date":"2025-09-11T19:20:29+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-08-21T22:57:12+00:00","index":"","fulltext":""},{"type":"submitted","content":"European Journal of Human Genetics","date":"2025-08-04T10:13:10+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-08-04T10:13:10+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"european-journal-of-human-genetics","isNatureJournal":false,"hasQc":false,"allowDirectSubmit":false,"externalIdentity":"ejhg","sideBox":"Learn more about [European Journal of Human Genetics](http://www.nature.com/ejhg/)","snPcode":"41431","submissionUrl":"https://mts-ejhg.nature.com/cgi-bin/main.plex","title":"European Journal of Human Genetics","twitterHandle":"@ejhg_journal","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"ejp","reportingPortfolio":"Nature AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"c0760ebc-a1fa-4be7-ac5a-7d7d2886893e","owner":[],"postedDate":"September 18th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[{"id":54591776,"name":"Health sciences/Diseases/Neurological disorders/Neurodevelopmental disorders"},{"id":54591777,"name":"Biological sciences/Genetics/Development"}],"tags":[],"updatedAt":"2026-04-02T12:46:14+00:00","versionOfRecord":[],"versionCreatedAt":"2025-09-18 17:27:48","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-7289882","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7289882","identity":"rs-7289882","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}