ROCK inhibitor and viscosity of gelatin promote hepatic differentiation by regulating organelles in human umbilical cord matrix-mesenchymal stem cells | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article ROCK inhibitor and viscosity of gelatin promote hepatic differentiation by regulating organelles in human umbilical cord matrix-mesenchymal stem cells Jiwan Choi, Seoon Kang, Hye-In An, Chae-Eun Kim, Sanghwa Lee, and 8 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4326689/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 29 Jul, 2024 Read the published version in Stem Cell Research & Therapy → Version 1 posted 5 You are reading this latest preprint version Abstract Background Human mesenchymal stem cells originating from umbilical cord matrix are a promising therapeutic resource, and their differentiated cells are spotlighted as a tissue regeneration treatment. However, there are limitations to the medical use of differentiated cells from human umbilical cord matrix-mesenchymal stem cells (hUCM-MSCs), such as efficient differentiation methods. Methods To effectively differentiate hUCM-MSCs into hepatocyte-like cells (HLCs), we used the ROCK inhibitor, fasudil, which is known to induce endoderm formation, and gelatin, which provides extracellular matrix to the differentiated cells. To estimate a differentiation efficiency of early stage according to combination of gelatin and fasudil, transcription analysis was conducted. Moreover, to demonstrate that organelle states affect differentiation, we performed transcription, tomographic, and mitochondrial function analysis at each stage of hepatic differentiation. Finally, we evaluated hepatocyte function based on the expression of mRNA and protein, secretion of albumin, and activity of CYP3A4 in mature HLCs. Results Fasudil induced endoderm-related genes ( GATA4, SOX17 , and FOXA2 ) in hUCM-MSCs, and it also induced lipid droplets (LDs) inside the differentiated cells. However, the excessive induction of LDs caused by fasudil inhibited mitochondrial function and prevented differentiation into hepatoblasts. To prevent the excessive LDs formation, we used gelatin as a coating material. When hUCM-MSCs were induced into hepatoblasts with fasudil on high-viscosity (1%) gelatin-coated dishes, hepatoblast-related genes ( AFP and HNF4A ) showed significant upregulation on high-viscosity gelatin-coated dishes compared to those treated with low-viscosity (0.1%) gelatin. Moreover, other germline cell fates, such as ectoderm and mesoderm, were repressed under these conditions. In addition, LDs abundance was also reduced, whereas mitochondrial function was increased. On the other hand, unlike early stage of the differentiation, low viscosity gelatin was more effective in generating mature HLCs. In this condition, the accumulation of LDs was inhibited in the cells, and mitochondria were activated. Consequently, HLCs originated from hUCM-MSCs were genetically and functionally more matured in low-viscosity gelatin. Conclusions This study demonstrated an effective method for differentiating hUCM-MSCs into hepatic cells using fasudil and gelatin of varying viscosities. Moreover, we suggest that efficient hepatic differentiation and the function of hepatic cells differentiated from hUCM-MSCs depend not only on genetic changes but also on the regulation of organelle states. human umbilical cord matrix-mesenchymal stem cells gelatin viscosity ROCK inhibitor hepatic differentiation mitochondria activation lipid droplet stem cell organelles Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Background Mesenchymal stem cells (MSCs) originate from human fetal and adult tissues, such as bone marrow, umbilical cord matrix, placenta, and various adult tissues [ 1 ]. Specifically, two fetus-originated tissues, umbilical cord matrix and placenta, are excellent sources of human MSCs because of their prominent advantages, such as a painless collection procedure, faster self-renewal and the ability of differentiation into three germ layers [ 2 ]. Thus, recently, human umbilical cord matrix-derived MSCs (hUCM-MSCs) and their differentiated cells have been used for tissue regeneration in therapeutic medicine to treat various diseases [ 3 ]. The liver, essential for drug detoxification and biosynthesis of proteins and hormones, cannot be easily substituted by other organs. Consequently, many patients remain on transplant waiting lists, as healthy liver cells are the sole replacement for irreversibly damaged hepatic cells [ 4 , 5 ]. Therefore, advanced stem cell technologies can provide great hope for patients facing end-stage diseases with no alternative but organ transplantation [ 6 ]. However, there are restrictions on the medical use of differentiated cells from stem cells in therapies. One of the biggest obstacles to the use of these cells is the efficiency of differentiation protocols and the limited phenotypes of mature cells [ 7 ]. For example, hepatocyte-like cells derived from human MSCs using current protocols exhibit characteristics more similar to fetal hepatocytes than the adult cells in terms of transcriptome profiles, hepatic functions, and metabolic activities [ 8 ]. Thus, numerous differentiation methods have been developed, including approaches using genetic modifications, microenvironment adjustments, and the addition of cytokines and growth factors [ 9 ]. In stem cell fate determinations, transcriptome changes are strongly linked to the differentiation of cell types. Therefore, recently, the transcription of differentiated cells has been world widely analyzed using sequencing tools, such as RNA sequencing [ 10 ]. However, cell fate does not only change transcriptional regulation. Cellular differentiation and lineage commitment are affected by communication between nuclei and various biological processes and signaling pathways involving cytoplasmic macromolecule and organelle interactions [ 11 – 13 ]. In particular, changes of metabolism are accompanied when stem cells are differentiated, and it is known to play a vital role in stem cell fate determinations [ 14 ]. In cell metabolism, mitochondrial dynamics are pivotal in determining cell fate and function [ 15 ]. Moreover, it has been reported that lipid droplets (LDs), which are related to storage organelles at the center of lipid and energy homeostasis, are also linked with stem cell fate determination [ 16 ]. Although the states of stem cell organelles are important for determining stem cell fate, it is still largely unknown whether the regulation of stem cell organelle states affects hepatic differentiation. This study demonstrated that the hepatic differentiation of hUCM-MSCs is significantly influenced not only by transcriptomic alterations but also by the state of organelles. We found that fasudil induced endoderm genes in the early differentiation, but facilitated the excessive accumulation of LDs in stem cells and interfered with hepatic differentiation. However, when hUCM-MSCs were reacted with fasudil in a high-viscosity gelatin-coated dish reduced the accumulation of LDs, activated mitochondrial function, and increased the efficiency and function of differentiated cells. Moreover, in the mature stage of differentiation, low-viscosity gelatin reduced the induction of LDs and activated mitochondria, thereby increasing the differentiation efficiency and function of differentiated cells. Collectively, our study findings highlight the importance of the hepatic differentiation of hUCM–MSCs not only to transcriptome changes but also to the regulation of the organelle states of differentiated cells. Materials and methods Cell culture In this study, hUCM-MSCs were obtained from the Asan Stem Cell Center (Asan Institute for Life Sciences, Seoul, Korea) [ 17 ]. The stem cells were cultured on 0.1% gelatin-coated cell culture dishes in DMEM/F12 medium, supplemented with 10% FBS (fetal bovine serum; GenDEPOT, TX, USA), 1% NEAA (non-essential amino acids), 1% antibiotic-antimycotic (Gibco, USA) and 0.2 mM L-ascorbic acid. Each manually passaged at 1:3 to 1:5 dilutions every 3–4 days. Quantitative RT-PCR Total RNA was extracted using an RNeasy Mini Kit (Qiagen, CA, USA) following the manufacturer’s instructions. Complementary DNA (cDNA) was synthesized using an Ultrascript 2.0 cDNA Synthesis Kit (PCR Biosystems, London, UK), and qRT-PCR was performed using HOT FIREPol EvaGreen qPCR Supermix (SOLIS BIODYNE, Tartu, Estonia) on a CFX Connect Real-Time PCR Detection System (Bio-Rad Laboratories, Hercules, CA, USA). The mRNA levels were normalized to GAPDH for analysis. The primer sequences are listed in Table 1 . Table 1 primer list Gene name Sequence Forward Reverse GATA4 GGCCTGTCATCTCACTACGG ATGGCCAGACATCGCACT SOX17 CAAGGGCGAGTCCCGTAT CGACTTGCCCAGCATCTT FOXA2 GGAGCGGTGAAGATGGA TCATGTTGCTCACGGAGGA PAX6 GAGTTCTTCGCAACCTGGCTA CTGCCCGTTCAACATCCTTAG SOX1 AGTGGAAGGTCATGTCCGA TTCTTGAGCAGCGTCTTGGT OTX2 AGAGCTAAGTGCCGCCAAC TCCGAGCTGGAGATGTCTT T GGTCCACAGCGCATGATC TGATAAGCAGTCACCGCTATGAA MIXL2 TTTGGCTAGGCCGGAGATTA GCAGGCAGTTCACATCTACCT CDX2 ACAGTCGCTACATCACCATCC CTCTCCTTTGCTCTGCGGTT AFP AGACTGCTGCAGCCAAAGTGA GTGGGATCGATGCTGGAGTG HNF4A CAGGCTCAAGAAATGCTTCC GGCTGCTGTCCTCATAGCTT ALBUMIN CACAGAATCCTTGGRGAACAGG ATGGAAGGTGAATGTTTCAGCA CYP3A4 TTTTGTCCTACCATAAGGGCTTT CACAGGCTGTTGACCATCAT CYP1A2 GGACAGCACTTCCCTGAGA AGGCAGGTAGCGAAGGATG HNF1A TGGGTCCTACGTTCACCAAC TCTGCACAGGTGGCATGAG RT-qPCR was conducted to evaluate the expression of hepatic mature miRNAs (miR-122, and miR-192) in undifferentiated and differentiated cells. Briefly, cDNA was synthesized from total RNA using the miRCURY LNA RT Kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions. RT-qPCR analysis was performed using the miRCURY LNA SYBR Green PCR kit (Qiagen) with microRNA-specific primers purchased from Qiagen. Cycling conditions were as follows: incubation at 95°C for 2 min, followed by 40 cycles of denaturation for 10 s at 95°C, and annealing and extension for 1 min at 56°C. The cycle threshold values were determined using Bio-Rad CFX Maestro software (CFX Maestro, version 1.1; Bio-Rad Laboratories). All experiments were repeated three times, and RNU6B was used as an internal control. Mitochondrial DNA copy number estimation Mitochondrial DNA (mtDNA) copy number was determined using the Absolute Human Mitochondrial DNA Copy Number Quantification qPCR assay kit (ScienCell, CA, USA). Before assessing the mtDNA copy number, we isolated total DNA using the QIAamp DNA Mini Kit (Qiagen). Briefly, the cycle threshold values were measured in triplicate for each sample using nuclear-specific and mitochondria-specific probes. The assay was performed according to the manufacturer’s instructions. Detection of secreted human albumin The secreted human albumin from the differentiated cells was detected using a Human Albumin ELISA kit (Bethyl Laboratories, TX, USA) according to the manufacturer’s instructions. Albumin secretion was normalized to the culture day and total cell number. Measurement of CYP3A4 activity in vitro Enzyme activity was determined using the P450-Glo CYP3A4 kit (Promega, WA, USA) according to the manufacturer’s instructions. Luminescence was measured by GloMax 96 Microplate Luminometer (Promega). CYP3A4 Activity was normalized to the culture day and double-stranded DNA content of each sample. In vitro hepatic differentiation Hepatic differentiation was performed as previously reported with slight modifications [ 17 , 18 ]. Briefly, the stem cells were seeded on 0.1% or 1% gelatin-coated dishes at 7000 cells/cm 2 in the cell culture medium. After 1 day, the cells were pretreated with stem cell culture medium and 10 µM fasudil (AdooQ Bioscience, CA, USA) for 3 days. Next, the cells were cultured in a hepatoblast induction medium consisting of step-1 basal medium, 10 ng/ml FGF2, 20 ng/ml BMP4, and 3 µM CHIR99021 for 4 days. Finally, the differentiated cells were cultured in a hepatic maturation medium consisting of a step-2 basal medium and 20 ng/ml oncostatin M (OSM) for 8 days. After 8 days, the medium was replaced with a hepatic maturation medium consisting of step-2 basal medium, 20 ng/ml OSM, 0.1% gelatin, or 1% gelatin or not for 5 days. The differentiation medium was changed every 2 days. The step-1 basal medium consisted of the following steps: IMDM (Iscove’s Modified Dulbecco’s Medium; Gibco) supplemented with 0.1% PVA (polyvinyl alcohol; Sigma Aldrich), 10 mM nicotinamide (Sigma Aldrich), 20 ng/ml hHGF (human hepatocyte growth factor; PeproTech, NJ, USA), 1% ITS (insulin–transferrin–selenium; Gibco), and 1% penicillin/streptomycin (GeneDireX, Taiwan); The step-2 basal medium consisted of the following steps: IMDM supplemented with 1 µM dexamethasone, 1% ITS, 20 ng/ml hHGF, and 1% penicillin/streptomycin. All growth factors were purchased from PeproTech. Protein extraction and Western blotting For Western blotting, cells were trypsinized, washed with ice-cold PBS, and lysed in RIPA lysis buffer (50 mM HEPES pH 7.4, 150 mM NaCl, 1 mM EDTA, 2.5 mM EGTA, 1 mM DTT, 1% Triton X-100) containing a protease and phosphatase inhibitor cocktail (Sigma Aldrich). After lysis, cell debris was removed by centrifugation at 13,000 rpm for 20 min. The protein concentrations were determined using the Bradford assay. Total cellular proteins (15 µg) were separated by 8–15% SDS–PAGE (sodium dodecyl sulfate–polyacrylamide gel electrophoresis) and transferred to Immobilon PVDF (polyvinylidene fluoride) membranes (Millipore, MA, USA). The membranes were blocked with 8% BSA (bovine serum albumin; GenDEPOT) in TBST (Tris-buffered saline with Tween 20; 20 mM Tris-HCl pH 7.4, 150 mM NaCl, 0.1% Tween 20) and probed with anti-albumin (Abcam, Cambridge, UK) and anti-CYP3A4 (Santa Cruz, CA, USA) primary antibodies. After washing with TBST, the primary antibodies were detected using horseradish peroxidase-conjugated anti-mouse secondary antibodies and an enhanced chemiluminescence detection system (Amersham, Buckinghamshire, UK). Full-length Western blotting images are presented in Supplementary Fig. 1. Organelle analysis in the differentiated cells Label-free optical diffraction tomography (ODT) using refractive index (RI) tomography was conducted on hUCM-MSCs using an ODT microscope (HT-X1; Tomocube Inc., Daejeon, Korea). The ODT used three-dimensional RI tomography to reconstruct a single hUCM-MSCs from 48 overlapping two-dimensional holograms captured at various angles, illuminated by a 450-nm LED (light-emitting diode) in a controlled atmosphere of 5% CO 2 at a temperature of 37°C. The HT-X1 microscope, incorporating a Mach-Zehnder interferometer, was utilized for the three-dimensional RI tomographic reconstruction of the cells. LD quantification and volumetric analysis were performed using TomoAnalysis software by TomoCube. Fluorescent staining was employed to ensure precision. MitoTracker dyes (Invitrogen, CA, USA, 250 nM) for mitochondrial labeling and Biotium LipidSpot 488 lipid droplet stain (1:1000 dilution) were used to stain the mitochondria and LDs, respectively. Live cell staining was performed according to the manufacturers’ instructions. We also observed the cells using a Zeiss LSM 880 confocal laser scanning microscope (Carl Zeiss, Oberkochen, Germany). The cells were fixed with 4% formaldehyde overnight, washed with the PBST (PBS with Tween 20), permeabilized in 0.5% Triton X-100, and blocked with PBST containing 1% BSA. The samples were stained with Biotium LipidSpot 488 lipid droplet stain. Nuclei were counterstained with NucBlue Fixed Cell ReadyProbes Reagent (DAPI; Invitrogen) for 10 min, and fluorescence signals were detected using the Zeiss LSM 880 confocal laser scanning microscope. Seahorse assay To measure oxygen consumption rate (OCR) in differentiated cells, stem cells were seeded at 7000 cells/cm 2 in 0.1% or 1% gelatin-coated XFe24 cell culture plates (Agilent Technologies, Santa Clara, CA, USA) and subsequently induced to differentiate. Mitochondrial OCR was measured using an XF Cell MitoStress test kit in an XF24 extracellular flux analyzer (Agilent Technologies). OCR values were normalized by the amount of cellular DNA. Statistical analysis Statistical analysis was performed using GraphPad Prism, version 6.0 (GraphPad Software, MA, USA). Comparisons of three or more data sets were performed by one-way or two-way ANOVA (analysis of variance) followed by Bonferroni’s multiple comparison tests. Two-group comparisons were performed using two-tailed Student’s t-tests. P values < 0.05 were considered statistically significant. Results State of organelles in differentiated cells influence the early stage of hepatic differentiation In our initial work, we tested how the ROCK inhibitor, fasudil, influences the differentiation of hUCM–MSCs into hepatic endoderm, a crucial process in the initial stages of cellular differentiation. Previous studies were reported that ROCK inhibitors not only improve stem cell viability but also promote the induction of human pluripotent stem cells (hPSC) into the endoderm [ 19 ]. Moreover, differentiation efficiency increased when small molecules were used rather than only protein-used [ 20 ]. Thus, in order to confirm the effect of fasudil on the hepatic differentiation of hUCM-MSCs, we first verified a proper concentration and treatment time of fasudil. Unlike the previously reported concentration of fasudil used in hPSCs [ 21 ], endoderm markers ( GATA4, SOX17 and FOXA2 ) were significantly increased at a high concentration of 10 µM, and it was effective when treated for 72 hrs ( P < 0.05, Fig. 1 a, b). We also conducted tomographic analysis to confirm the state of organelles, such as LDs and mitochondria, within differentiated cells, which were known to be important for metabolism and regulation of stem cell fate [ 16 , 22 ]. As a result, the stem cells changed to a more ovoid shape and the mitochondrial morphology was different (Fig. 1 c). Moreover, LDs were induced inside the cells, and the number of LDs increased ( P < 0.001, Fig. 1 c, d). Next, we examined whether the use of fasudil increased the differentiation efficiency of hepatoblasts, as an evaluation of the next step in the hepatic endoderm (Fig. 1 e). The phenotype of differentiated cells was similar in both the control and fasudil-treated groups (Fig. 1 f). However, the expression of hepatoblast-related genes ( AFP and HNF4A ) was suppressed in the fasudil-treated group ( P < 0.001, Fig. 1 g). To explain the hepatoblast differentiation efficiency decreased despite endodermal gene upregulation, we performed mitochondrial function test. Mitochondrial functions, such as adenosine triphosphate (ATP) production, are related to the efficiency of differentiation and are reduced when excessive LDs are induced [ 23 ]. Therefore, we hypothesized that LDs induced by fasudil would affect mitochondrial function. As we expected, mitochondrial function was diminished in the cells treated with fasudil on the day 3 of differentiation ( P < 0.001, Fig. 1 h). Collectively, these results indicated that while fasudil transcriptionally impacts the early stages of hepatic differentiation in hUCM–MSCs, it does not influence next stage of endoderm due to organelle conditions. The effect of gelatin viscosity on hepatoblast induction of hUCM-MSCs Based on fasudil-treated results, we hypothesized that mitochondrial function correlates with differentiation efficiency. Therefore, next, we aimed to enhance mitochondrial function through an extracellular matrix (ECM) component. Gelatin is known to a common biomaterial for cell culture that provides a suitable biological signal for host cells [ 24 ]. Moreover, as confirmed in our result, when hUCM-MSCs were cultured on 0.1% or 1% gelatin-coated dishes, mitochondrial activation levels, such as basal, maximal oxidative phosphorylation, ATP production, and proton leak, were increased ( P < 0.001, Fig. 2 a). Previous studies have shown that enhancement of oxidative phosphorylation levels and ATP production in differentiated cells is necessary for specific lineage differentiation [ 25 , 26 ]. Therefore, we expected that gelatin used as ECM would synergistically improve the efficiency of differentiation with fasudil. To assess gelatin’s impact on hepatic differentiation, we cultured hUCM-MSCs on 0.1% or 1% gelatin-coated dishes, and differentiation proceeded under these conditions (Fig. 2 b). The phenotype of differentiated cells was similar on day 7 between all groups (Fig. 2 c). Next, we analyzed the dynamics of gene expression associated with hepatic endoderm and hepatoblasts on the differentiation day 0, 3, and 7. As a result, endoderm-related genes ( SOX17 and FOXA2 ) except for GATA4 and hepatoblast-related genes ( AFP and HNF4A ) exhibited significant upregulation in the 1% gelatin and fasudil group compared to other groups (Fig. 2 d, e). However, interestingly, when hepatoblast differentiation was progressed, the hepatoblast markers ( AFP and HNF4A ) were decreased in the 0.1% gelatin and fasudil group, in contrast to the 1% gelatin and fasudil group (#a and #b, P < 0.01; Fig. 2 e). To explain the variation in differentiation efficiency observed between the low-viscosity and high-viscosity gelatin groups, we examined the early differentiation fate of stem cells. Notably, fasudil has been documented as a promoter for the differentiation of cells originating from the ectoderm and mesoderm, including neurons and cardiomyocytes [ 27 , 28 ]. Thus, we confirmed the gene expression of ectoderm ( PAX6 , SOX1 and OTX2 ) and mesoderm ( T , MIXL2 and CDX2 ) markers in differentiated cells on day 3. The results showed that the expression of ectoderm genes ( PAX6 and OTX2 ) were suppressed in the 1% gelatin and fasudil group ( P < 0.05; Fig. 2 f). Moreover, the endoderm gene, MIXL2 , was downregulated, but the mesendoderm gene, T , was upregulated in the 1% gelatin and fasudil group ( P < 0.01; Fig. 2 g). These results indicated that high-viscosity gelatin repressed the gene expression of ectoderm- and endoderm-related genes, leading to endodermal fate. Given that stem cell fate determinations according to gelatin viscosity can be influenced by the organelle states, next, we investigated the impact of high-viscosity gelatin on organelles in the differentiated cells. High-viscosity gelatin inhibited the induction of LDs and enhanced mitochondrial function To analyze the effects of high-viscosity gelatin on stem cell fate through regulation of organelles, tomographic and mitochondrial function analyses were performed. It is known that tomographic analysis can be used to observe cell organelles more accurately than confocal laser scanning microscopy [ 29 ]. Therefore, we tomographically analyzed LDs and morphology of the mitochondria in differentiated cells on day 3. As a result, the group treated with 1% gelatin and fasudil showed lower LDs induction than the group treated with 0.1% gelatin and fasudil ( P < 0.001; Fig. 3 a, b), suggesting that high-viscosity gelatin suppressed the production of LDs induced by fasudil. Moreover, in the 0.1% gelatin and fasudil group, mitochondrial morphology appeared to be hyperfusion induced (Fig. 3 a). Next, we performed a seahorse assay to determine how excessive LDs induction and hyperfusion form of mitochondrial affect cellular mitochondrial function. The result showed that overall OCR levels were highest in the 1% gelatin and fasudil group ( P < 0.05, Fig. 3 c, d). Moreover, we measured the mtDNA copy number across all groups. A previous study reported that mtDNA levels gradually increased to support differentiation [ 30 ]. Thus, we expected that the more efficient the differentiation, the higher the mtDNA copy number would be. In our study, the mtDNA copy number was higher in the 1% gelatin and fasudil group ( P < 0.001, Fig. 3 e). In summary, the enhanced differentiation efficiency in the 1% gelatin and fasudil group can be attributed not only to the downregulation of ectodermal and mesodermal gene expression but also to the modulation of organelle states, including reduced LD production and activated mitochondrial function. Low-viscosity gelatin synergistically enhanced the efficiency and function of HLCs Finally, we differentiated the hepatoblasts, which were induced using 1% gelatin coating and fasudil, into HLCs. At this stage, we used gelatin by adding step-2 differentiation medium rather than coating the dishes. Gelatin is known for its use in the long-term maintenance of human hepatocytes [ 31 ]. Thus, we assumed that it would help in the maturation of HLCs from hUCM-MSCs. To confirm the effect of gelatin on hepatocyte maturation, we induced HLCs from the hepatoblasts using OSM for 8 days, and we conducted the maturation by adding gelatin at different viscosities: 0% (no gelatin added) or 0.1% or 1% for 5 days (Fig. 4 a). The HLC phenotypes were similar in all groups on differentiation day 20 (Fig. 4 b). However, transcription analysis revealed that the expression of mature hepatocyte-related genes ( ALB, CYP3A4, CYP1A2, HNF1A , and HNF4A ) was significantly elevated in the low-viscosity (0.1%) gelatin group compared to the others ( P < 0.01, Fig. 4 c). We also confirmed the expression of these proteins (Albumin; ALB and CYP3A4) by Western blotting, wherein ALB levels in the 0.1% gelatin group were comparable to those yielded in the 0% gelatin group, but CYP3A4 expression was notably higher ( P < 0.01, Fig. 4 d, e). Moreover, the maturation efficiency was assessed through the expression of hepatocyte-specific miRNAs, such as miR-122 and miR-192 [ 32 ]. These results also showed that hepatocyte-specific miRNAs expressed significantly upregulated in the presence of 0.1% gelatin (Fig. 4 f). Next, considering the primary roles of hepatocytes in protein synthesis and detoxification, we measured albumin secretion and CYP3A4 activity. Consistent with previous findings, hepatic function was significantly enhanced in HLCs with the addition of 0.1% gelatin ( P < 0.001, Fig. 5 a, b). Overall, the specification and maturation of hepatocytes were more efficient with low-viscosity gelatin, in contrast to hepatoblast differentiation. Therefore, we attempted to understand this phenomenon by analyzing the state of differentiated cell organelles, focusing on LDs and mtDNA copy number in the HLCs on day 20. Confocal imaging analysis confirmed that fewer LDs were induced when 0.1% gelatin was used for hepatocyte maturation ( P < 0.05, Fig. 5 c, d), and a significant increase in mtDNA copy number was observed in the same group ( P < 0.001, Fig. 5 e). These findings imply that low-viscosity gelatin is favorable for the maturation of HLCs, diverging from its role in early differentiation stages, and highlight that organelle states are pivotal in determining the efficiency and functionality of HLCs. Discussion We successfully increased the efficiency of hepatic differentiation of hUCM-MSCs using fasudil and gelatin. Fasudil is a small molecule that is more stable and precise for stem cell differentiation than proteins used in the early stages of hepatic differentiation, such as activin A and Wnt3a [ 33 ]. Moreover, given that fasudil has been approved by the FDA, it can be used in the production of stem cell-based therapies [ 34 ]. Thus, there is a necessary to discuss about the effects of fasudil on hUCM-MSCs. Previous studies have shown that fasudil prevents mitochondrial fission and induces fusion [ 35 ]. Consequently, it is possible that mitochondrial byproducts, such as reactive oxygen species—produced by fusion stress—change stem cell metabolism and increase differentiation-related genes [ 36 ]. For this reason, according to our findings, hepatoblast differentiation may have been hindered by mitochondrial stress. However, this assumption requires further investigation. We also demonstrated that gelatin viscosity affects early and late hepatic differentiation of hUCM–MSCs. According to previous studies, the differentiation efficiency of human MSCs and liver stem cells increases in low-viscosity ECM, which provides soft stiffness [ 37 , 38 ]. As in our study, the efficiency of hepatocyte maturation increased in low-viscosity gelatin in the late stages of differentiation. Contrary to the late stages, hepatoblast differentiation was enhanced on high-viscosity gelatin–coated dishes during the early stages. This means that the ECM requirement for differentiated cells varies depending on the developmental stage, and if not optimized, stem cell fate may change. Thus, our research suggests that to use ECM for differentiation, it is necessary to optimize the viscosity or concentration depending on the differentiation stage. Next, we suggested that it may be important not only to induce appropriate transcription but also to induce the appropriate organelle state. The regulation of LDs and mitochondrial function had a significant impact on stem cell fate. Consistent with our findings, the condition of cellular organelles influences cellular metabolism, which can lead to epigenetic modifications [ 39 ]. Mitochondrial metabolism, glycolysis, and oxidative phosphorylation generate NADH/NAD + and FADH 2 /FAD, which induce epigenetic changes such as histone methylation, acetylation, demethylation, and DNA demethylation [ 40 ]. This may serve as a crucial checkpoint for the therapeutic application of stem cell-derived differentiated cells. Beyond the aspects already described, further detailed investigations are warranted. For example, the upstream factors that influence organelle behavior and transcriptional responses to fasudil and gelatin remain unidentified. Additionally, a comprehensive examination of organelles, including the Golgi apparatus and endoplasmic reticulum—both integral to cellular metabolism—is essential [ 41 ]. Establishing clear associations among organelle states, gene expression, and cellular functions in differentiated cells, and their comparison with human primary hepatocytes, could facilitate the therapeutic application of stem cell-derived hepatocytes in the future. Conclusion In conclusion, we propose an effective protocol for hepatic differentiation using fasudil and gelatin. Fasudil prompted the early-stage induction of hUCM-MSCs into endoderm, while a high-viscosity (1%) gelatin coating modulates transcription and organelle states, thereby enhancing differentiation efficiency. Conversely, during the later stages of differentiation, a low gelatin viscosity (0.1%) enhanced hepatic maturation and function. At this stage, the suppression of lipid droplets and the activation of mitochondria also influenced maturation of HLCs (Fig. 5 f). These results suggest that for the generation of differentiated cells suitable for cell therapy, a thorough analysis of organelle states, in addition to genetic and proteomic profiling, is crucial for the efficacy and functionality of hepatic cells differentiated from hUCM-MSCs. Abbreviations Mesenchymal stem cells: MSCs Human umbilical cord matrix-mesenchymal stem cells: hUCM-MSCs Hepatocyte-like cells: HLCs ROCK: Rho-associated protein kinase Lipid droplets: LDs Mitochondrial DNA: mtDNA Oncostatin M: OSM Label-free optical diffraction tomography: ODT Oxygen consumption rate: OCR Extracellular matrix: ECM Adenosine triphosphate: ATP Albumin: ALB Declarations Ethics approval and consent to participate Ethics approval and consent to human participation for using hUCM-MSCs were approved by the Institutional Review Board (IRB) of Asan Medical Center (Seoul, Korea; title: Evaluation of the Hepatic Protection Effect by Engraftment or Differentiation of Stem cells Using Two-photon Microscopy in Liver Injury Mice Model; approval number: 2022-0431; date of approval: April 06, 2022). Consent for publication Not applicable Availability of data and materials The datasets used and/or analysed during the current study are available from the corresponding author on reasonable request. Competing interests The authors declare that they have no competing interests. Funding This research was supported by the Asan Institute for Life Sciences (grant numbers: J.M.N. –2021IL0009 and E.T. – 2022IP0084), the National Research Foundation of Korea (grant numbers: E.T. – NRF-2015K1A4A3046807 and NRF-2022R1A2C200614111), and the Research Supporting Program of the Korean Association for the Study of the Liver and the Korean Liver Foundation (grant number: 2023-0719). Authors’ contributions J.C. and E.T. conceptualized, drafted, and supervised the study; J.C., S. K., and H.A. conducted the experiments and analyzed the data; C.K. performed the label-free optical diffraction tomography; S.L., C.P., Y.Y., J.N., and J.K. critically revised the manuscript. All authors have read and approved the final manuscript. Acknowledgments We are grateful for the use of the facilities of the Asan Medical Institute of Convergence Science and Technology for use of their equipment, services, and expertise, and Stem cell Center in Asan Medical Center. References Pittenger MF, Discher DE, Péault BM, Phinney DG, Hare JM, Caplan AI. Mesenchymal stem cell perspective: cell biology to clinical progress. npj Regenerative Medicine. 2019;4(1):22. Ding D-C, Chang Y-H, Shyu W-C, Lin S-Z. Human Umbilical Cord Mesenchymal Stem Cells: A New Era for Stem Cell Therapy. 2015;24(3):339-47. Xie Q, Liu R, Jiang J, Peng J, Yang C, Zhang W, Wang S, Song J. What is the impact of human umbilical cord mesenchymal stem cell transplantation on clinical treatment? Stem Cell Research & Therapy. 2020;11(1):519. Rui LJCp. Energy metabolism in the liver. 2014;4(1):177. Jadlowiec CC, Taner TJWjog. Liver transplantation: current status and challenges. 2016;22(18):4438. Stock P, Brückner S, Ebensing S, Hempel M, Dollinger MM, Christ B. The generation of hepatocytes from mesenchymal stem cells and engraftment into murine liver. Nature Protocols. 2010;5(4):617-27. Wnorowski A, Yang H, Wu JC. Progress, obstacles, and limitations in the use of stem cells in organ-on-a-chip models. Advanced drug delivery reviews. 2019;140:3-11. Baxter M, Withey S, Harrison S, Segeritz CP, Zhang F, Atkinson-Dell R, Rowe C, Gerrard DT, Sison-Young R, Jenkins R, Henry J, Berry AA, Mohamet L, Best M, Fenwick SW, Malik H, Kitteringham NR, Goldring CE, Piper Hanley K, Vallier L, Hanley NA. Phenotypic and functional analyses show stem cell-derived hepatocyte-like cells better mimic fetal rather than adult hepatocytes. Journal of hepatology. 2015;62(3):581-9. Afshari A, Shamdani S, Uzan G, Naserian S, Azarpira N. Different approaches for transformation of mesenchymal stem cells into hepatocyte-like cells. Stem Cell Research & Therapy. 2020;11(1):54. Wells CA, Choi J. Transcriptional Profiling of Stem Cells: Moving from Descriptive to Predictive Paradigms. Stem Cell Reports. 2019;13(2):237-46. Julian LM, Stanford WL. Organelle Cooperation in Stem Cell Fate: Lysosomes as Emerging Regulators of Cell Identity. 2020;8. Khacho M, Slack RS. Mitochondrial and Reactive Oxygen Species Signaling Coordinate Stem Cell Fate Decisions and Life Long Maintenance. Antioxidants & redox signaling. 2018;28(11):1090-101. Kinney MA, Vo LT, Frame JM, Barragan J, Conway AJ, Li S, Wong KK, Collins JJ, Cahan P, North TE, Lauffenburger DA, Daley GQ. A systems biology pipeline identifies regulatory networks for stem cell engineering. Nature biotechnology. 2019;37(7):810-8. Intlekofer AM, Finley LWJNm. Metabolic signatures of cancer cells and stem cells. 2019;1(2):177-88. Chen H, Chan DCJCm. Mitochondrial dynamics in regulating the unique phenotypes of cancer and stem cells. 2017;26(1):39-48. Yue F, Oprescu SN, Qiu J, Gu L, Zhang L, Chen J, Narayanan N, Deng M, Kuang S. Lipid droplet dynamics regulate adult muscle stem cell fate. Cell Reports. 2022;38(3):110267. Lee J, Choi J, Kang S, Kim J, Lee R, So S, Yoon YI, Kirchner VA, Song GW, Hwang S, Lee SG, Kang E, Tak E. Hepatogenic Potential and Liver Regeneration Effect of Human Liver-derived Mesenchymal-Like Stem Cells. Cells. 2020;9(6). Choi J, Kang S, Kim B, So S, Han J, Kim G-N, Lee M-Y, Roh S, Lee J-Y, Oh SJ, Sung YH, Lee Y, Kim SH, Kang E. Efficient hepatic differentiation and regeneration potential under xeno-free conditions using mass-producible amnion-derived mesenchymal stem cells. Stem Cell Research & Therapy. 2021;12(1):569. Maldonado M, Luu RJ, Ramos MEP, Nam J. ROCK inhibitor primes human induced pluripotent stem cells to selectively differentiate towards mesendodermal lineage via epithelial-mesenchymal transition-like modulation. Stem Cell Research. 2016;17(2):222-7. Borowiak M, Maehr R, Chen S, Chen AE, Tang W, Fox JL, Schreiber SL, Melton DA. Small Molecules Efficiently Direct Endodermal Differentiation of Mouse and Human Embryonic Stem Cells. Cell Stem Cell. 2009;4(4):348-58. Korostylev A, Mahaddalkar PU, Keminer O, Hadian K, Schorpp K, Gribbon P, Lickert H. A high-content small molecule screen identifies novel inducers of definitive endoderm. Molecular metabolism. 2017;6(7):640-50. Cui L, Liu P. Two Types of Contact Between Lipid Droplets and Mitochondria. 2020;8. Shares BH, Busch M, White N, Shum L, Eliseev RA. Active mitochondria support osteogenic differentiation by stimulating β-catenin acetylation. Journal of Biological Chemistry. 2018;293(41):16019-27. Afewerki S, Sheikhi A, Kannan S, Ahadian S, Khademhosseini A. Gelatin-polysaccharide composite scaffolds for 3D cell culture and tissue engineering: Towards natural therapeutics. 2019;4(1):96-115. Cho YM, Kwon S, Pak YK, Seol HW, Choi YM, Park DJ, Park KS, Lee HKJB, communications br. Dynamic changes in mitochondrial biogenesis and antioxidant enzymes during the spontaneous differentiation of human embryonic stem cells. 2006;348(4):1472-8. Chung S, Arrell DK, Faustino RS, Terzic A, Dzeja PPJJom, cardiology c. Glycolytic network restructuring integral to the energetics of embryonic stem cell cardiac differentiation. 2010;48(4):725-34. Khan AA, Huat TJ, Al Mutery A, El-Serafi AT, Kacem HH, Abdallah SH, Reza MF, Abdullah JM, Jaafar H. Significant transcriptomic changes are associated with differentiation of bone marrow-derived mesenchymal stem cells into neural progenitor-like cells in the presence of bFGF and EGF. Cell & Bioscience. 2020;10(1):126. Hu Y, Li X, Huang G, Wang J, Lu W. Fasudil may induce the differentiation of bone marrow mesenchymal stem cells into neuron‑like cells via the Wnt/β‑catenin pathway. Mol Med Rep. 2019;19(4):3095-104. Kim Y, Kim T-K, Shin Y, Tak E, Song G-W, Oh Y-M, Kim JK, Pack C-G. Characterizing Organelles in Live Stem Cells Using Label-Free Optical Diffraction Tomography. Molecules and Cells. 2021;44(11):851-60. Hu C, Fan L, Cen P, Chen E, Jiang Z, Li L. Energy Metabolism Plays a Critical Role in Stem Cell Maintenance and Differentiation. 2016;17(2):253. Klaas M, Möll K, Mäemets-Allas K, Loog M, Järvekülg M, Jaks V. Long-term maintenance of functional primary human hepatocytes in 3D gelatin matrices produced by solution blow spinning. Scientific Reports. 2021;11(1):20165. Xiaolin W, Yong H, Bryan M, Bin G. MicroRNAs as regulators, biomarkers and therapeutic targets in liver diseases. Gut. 2021;70(4):784. Pavathuparambil Abdul Manaph N, Sivanathan KN, Nitschke J, Zhou X-F, Coates PT, Drogemuller CJ. An overview on small molecule-induced differentiation of mesenchymal stem cells into beta cells for diabetic therapy. Stem Cell Research & Therapy. 2019;10(1):293. Feng Y, LoGrasso PV, Defert O, Li R. Rho Kinase (ROCK) Inhibitors and Their Therapeutic Potential. Journal of Medicinal Chemistry. 2016;59(6):2269-300. Lv J, Yi Y, Qi Y, Yan C, Jin W, Meng L, Zhang D, Jiang W. Mitochondrial homeostasis regulates definitive endoderm differentiation of human pluripotent stem cells. Cell Death Discovery. 2022;8(1):69. Xiao F, Zhang R, Wang L. Inhibitors of Mitochondrial Dynamics Mediated by Dynamin-Related Protein 1 in Pulmonary Arterial Hypertension. 2022;10. Lee K, Chen Y, Yoshitomi T, Kawazoe N, Yang Y, Chen G. Osteogenic and Adipogenic Differentiation of Mesenchymal Stem Cells in Gelatin Solutions of Different Viscosities. 2020;9(23):2000617. Cozzolino AM, Noce V, Battistelli C, Marchetti A, Grassi G, Cicchini C, Tripodi M, Amicone L. Modulating the Substrate Stiffness to Manipulate Differentiation of Resident Liver Stem Cells and to Improve the Differentiation State of Hepatocytes. Stem Cells International. 2016;2016:5481493. Dai Z, Ramesh V, Locasale JW. The evolving metabolic landscape of chromatin biology and epigenetics. Nature Reviews Genetics. 2020;21(12):737-53. Tatapudy S, Aloisio F, Barber D, Nystul T. Cell fate decisions: emerging roles for metabolic signals and cell morphology. EMBO reports. 2017;18(12):2105-18-18. Sekine Y, Houston R, Sekine S. Cellular metabolic stress responses via organelles. Experimental Cell Research. 2021;400(1):112515. Supplementary Files supplementfigure1westernblotfulllength.pdf Supplementary Figure 1. Uncropped full-length of Western blot membrane Whole membrane of Western blotting of human Albumin (a), CYP3A4 (b), and Actin (c). Cite Share Download PDF Status: Published Journal Publication published 29 Jul, 2024 Read the published version in Stem Cell Research & Therapy → Version 1 posted Editorial decision: Major Revision 19 May, 2024 Reviewers agreed at journal 07 May, 2024 Reviewers invited by journal 07 May, 2024 Editor assigned by journal 29 Apr, 2024 First submitted to journal 28 Apr, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4326689","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":299826190,"identity":"749d20ca-f11d-4cca-941c-6cc363b743c6","order_by":0,"name":"Jiwan Choi","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA2ElEQVRIiWNgGAWjYBACxmYwZSPH2N4ApA0siNaSZszccwCkRYJoyw4lts9IADGI0MLczmP4uaDmAGPvzOdXN/wokGDgb+9OIOAwHmPpGcfuMEvOzim72QN0mMSZsxsIaOHdIM3b8IzNcHZO2g0eoBYDiVyCWjb/5m04zGN/80zazT9EatkGtOWwBOMM9mO3ibSF/5s1z7E0A8aeHLbbMgYSPAT9Yth/LPk2T41NfWP78Wc33/yxkeNv7yWgpQHO5DEAk3iVg4A8gsn+gKDqUTAKRsEoGJkAADsoRyVLyG9BAAAAAElFTkSuQmCC","orcid":"https://orcid.org/0000-0002-4957-3219","institution":"Asan medical center","correspondingAuthor":true,"prefix":"","firstName":"Jiwan","middleName":"","lastName":"Choi","suffix":""},{"id":299826191,"identity":"356d3605-8621-447f-831e-3a153a630547","order_by":1,"name":"Seoon Kang","email":"","orcid":"","institution":"University of Ulsan College of Medicine","correspondingAuthor":false,"prefix":"","firstName":"Seoon","middleName":"","lastName":"Kang","suffix":""},{"id":299826192,"identity":"33717a41-a60c-4053-914e-5a80011981ac","order_by":2,"name":"Hye-In An","email":"","orcid":"","institution":"University of Ulsan College of Medicine","correspondingAuthor":false,"prefix":"","firstName":"Hye-In","middleName":"","lastName":"An","suffix":""},{"id":299826193,"identity":"808671c9-1445-4fda-aa0f-db985eccada7","order_by":3,"name":"Chae-Eun Kim","email":"","orcid":"","institution":"University of Ulsan College of Medicine","correspondingAuthor":false,"prefix":"","firstName":"Chae-Eun","middleName":"","lastName":"Kim","suffix":""},{"id":299826194,"identity":"f587e12d-dcd9-47a5-9864-d81fcc35bba4","order_by":4,"name":"Sanghwa Lee","email":"","orcid":"","institution":"Asan Medical Center","correspondingAuthor":false,"prefix":"","firstName":"Sanghwa","middleName":"","lastName":"Lee","suffix":""},{"id":299826195,"identity":"84aff81f-0c74-46b8-85f3-3f234ee0e6d6","order_by":5,"name":"Chan-Gi Pack","email":"","orcid":"","institution":"University of Ulsan College of Medicine","correspondingAuthor":false,"prefix":"","firstName":"Chan-Gi","middleName":"","lastName":"Pack","suffix":""},{"id":299826196,"identity":"09eddcaf-e275-4a2b-866e-7cf9f2f3f6ab","order_by":6,"name":"Young-In Yoon","email":"","orcid":"","institution":"Asan Medical Center Department of Liver Transplantation and Hepatobiliary Surgery","correspondingAuthor":false,"prefix":"","firstName":"Young-In","middleName":"","lastName":"Yoon","suffix":""},{"id":299826197,"identity":"5784fc6e-29c1-4aa6-aff2-f8d55d08c495","order_by":7,"name":"Hana Jin","email":"","orcid":"","institution":"Asan Medical Center","correspondingAuthor":false,"prefix":"","firstName":"Hana","middleName":"","lastName":"Jin","suffix":""},{"id":299826198,"identity":"81ddbfca-0f9c-4812-82ab-2f32a024fb41","order_by":8,"name":"Yong-Pil Cho","email":"","orcid":"","institution":"Asan Medical Center","correspondingAuthor":false,"prefix":"","firstName":"Yong-Pil","middleName":"","lastName":"Cho","suffix":""},{"id":299826200,"identity":"88dfd089-6581-4154-8afd-71983b556a83","order_by":9,"name":"Chong Jai Kim","email":"","orcid":"","institution":"Asan Medical Center","correspondingAuthor":false,"prefix":"","firstName":"Chong","middleName":"Jai","lastName":"Kim","suffix":""},{"id":299826202,"identity":"45612955-f703-4719-bb66-9229504d02aa","order_by":10,"name":"Jung-Man Namgoong","email":"","orcid":"","institution":"Asan Medical Center Children's Hospital","correspondingAuthor":false,"prefix":"","firstName":"Jung-Man","middleName":"","lastName":"Namgoong","suffix":""},{"id":299826204,"identity":"1b66448e-c8d4-4617-a6c8-8b2ecff6251e","order_by":11,"name":"Jun Ki Kim","email":"","orcid":"","institution":"University of Ulsan College of Medicine","correspondingAuthor":false,"prefix":"","firstName":"Jun","middleName":"Ki","lastName":"Kim","suffix":""},{"id":299826205,"identity":"65279ff1-6240-44ed-8b45-c08595bf2ef1","order_by":12,"name":"Eunyoung Tak","email":"","orcid":"","institution":"University of Ulsan College of Medicine","correspondingAuthor":false,"prefix":"","firstName":"Eunyoung","middleName":"","lastName":"Tak","suffix":""}],"badges":[],"createdAt":"2024-04-26 02:17:25","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4326689/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4326689/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1186/s13287-024-03851-9","type":"published","date":"2024-07-29T15:57:11+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":56440304,"identity":"266775b3-547b-4242-897a-e30563fb0e86","added_by":"auto","created_at":"2024-05-14 08:26:39","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":1614922,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEffect of ROCK inhibitor on early hepatic differentiation of hUCM-MSCs\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ea, b\u003c/strong\u003e Transcription analysis of endodermal markers (\u003cem\u003eGATA4\u003c/em\u003e, \u003cem\u003eSOX17\u003c/em\u003e, and \u003cem\u003eFOXA2\u003c/em\u003e) expression in cells treated with fasudil according to concentration (a) and time (b). \u003cstrong\u003ec\u003c/strong\u003eMicroscopic and tomographic analysis of the fasudil non-treated and treated group. Mitochondria (red) and lipid droplets (green) were stained with MitoTracker and Biotium LipidSpot, respectively. Scale bar: microscopic, 200 μm; tomographic, 10 μm. \u003cstrong\u003ed\u003c/strong\u003e The number of lipid droplets in the cells (Control, n = 5 cells; 72 hrs, n = 5 cells). \u003cstrong\u003ee\u003c/strong\u003eExperimental scheme of fasudil treatment in hUCM–MSCs for induction of hepatoblast. \u003cstrong\u003ef\u003c/strong\u003e Morphology of the cells at differentiation day 7. Scale bar = 100 μm. \u003cstrong\u003eG\u003c/strong\u003e RT-qPCR analysis of hepatoblast markers\u003cem\u003e AFP \u003c/em\u003eand\u003cem\u003e HNF4A\u003c/em\u003e on differentiation day 7. GAPDH was used as an internal control for RT-qPCR. \u003cstrong\u003eg\u003c/strong\u003e Time-dependent oxygen consumption rates (OCR) graph and bar charts foreach group on differentiation day 3. Olig: oligomycin, FCCP: carbonyl cyanide 4-(trifluoromethoxy) phenylhydrazone, AA: antimycin A, Rot: rotenone. OCR values were normalized by DNA concentration. Non-mito, non-mitochondrial consumption rate. \u003cem\u003eP\u003c/em\u003e values \u0026lt; 0.05 were considered significant. *, \u003cem\u003eP \u003c/em\u003e\u0026lt; 0.05; **, \u003cem\u003eP \u003c/em\u003e\u0026lt; 0.01; ***, \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.001.\u003c/p\u003e","description":"","filename":"FigureJiwanChoietal.1.png","url":"https://assets-eu.researchsquare.com/files/rs-4326689/v1/f8b54a0ff30efccee145b340.png"},{"id":56440308,"identity":"8150b94a-f9e0-4b5e-b309-d361e4d400d0","added_by":"auto","created_at":"2024-05-14 08:26:42","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":937712,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eTranscription analysis of the effect of gelatin viscosity on hepatic differentiation\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ea\u003c/strong\u003e Time-dependent OCR graph and bar charts depending on gelatin-coating viscosity. OCR values were normalized by DNA concentration. \u003cstrong\u003eb\u003c/strong\u003e Schematic summary of hepatic differentiation using gelatin and fasudil. hUCM-MSCs were seeded on gelatin-coated dishes, and fasudil was treated for 3 days as indicated. \u003cstrong\u003ec\u003c/strong\u003e Morphology of the differentiated cells in each group on differentiation day 7. Scale bar = 100 μm. \u003cstrong\u003ed, e\u003c/strong\u003e RT-qPCR analysis of endoderm (D) and hepatoblast (E) markers on the differentiation day 0, 3, and 7. #a and #b are statistics comparing day 3 and 7 when 1% or 0.1% gelatin and fasudil were used. \u003cstrong\u003ef, g\u003c/strong\u003e Relative mRNA expression analysis of ectoderm (f) and mesoderm (g) markers for the differentiated cells on day 3. GAPDH was used as an internal control. \u003cem\u003eP\u003c/em\u003e values \u0026lt; 0.05 were considered significant. *, \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05; **, \u003cem\u003eP \u003c/em\u003e\u0026lt; 0.01; ***, \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.001.\u003c/p\u003e","description":"","filename":"FigureJiwanChoietal.2.png","url":"https://assets-eu.researchsquare.com/files/rs-4326689/v1/1f6bbfbb67507a1286a62265.png"},{"id":56440313,"identity":"f7dd936b-fe3d-460d-afe7-4e7c61686e4f","added_by":"auto","created_at":"2024-05-14 08:26:43","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":1654228,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eAnalysis of lipid droplets and mitochondrial function in differentiated cells\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ea\u003c/strong\u003e Tomographic analysis of the effect of gelatin and fasudil on hepatic differentiation. Mitochondria (red) and lipid droplets (green) were stained with MitoTracker and Biotium LipidSpot, respectively. Scale bar = 10 μm. \u003cstrong\u003eb\u003c/strong\u003e The number of lipid droplets in the cells (0.1% gel, n = 5 cells; 0.1%gel + Fa, n = 8; 1% gel + Fa, n = 8 cells). \u003cstrong\u003ec\u003c/strong\u003e OCR for each group on differentiation day 3. \u003cstrong\u003ed\u003c/strong\u003e Bar charts showing the results of mitochondrial respiration changes in each group, analyzed with basal and maximal respiration, ATP production, proton leak,and non-mitochondrial respiration. OCR values were normalized by DNA concentration. \u003cstrong\u003ee\u003c/strong\u003eMitochondrial copy number analysis in the differentiated cells on day 3. \u003cem\u003eP\u003c/em\u003e values \u0026lt; 0.05 were considered significant. *, \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05; **, \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01; ***, \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.001.\u003c/p\u003e","description":"","filename":"FigureJiwanChoietal.3.png","url":"https://assets-eu.researchsquare.com/files/rs-4326689/v1/acf6927149be62769479715f.png"},{"id":56440306,"identity":"149e1401-ee84-41cc-a801-48f5dc19de7b","added_by":"auto","created_at":"2024-05-14 08:26:40","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":1627730,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eLow viscosity gelatin affected the maturation of hepatocyte-like cells from hUCM-MSCs\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ea\u003c/strong\u003e The in vitro hepatic differentiation protocols using 0.1% or 1% gelatin at the maturation stage. OSM: Oncostatin M. \u003cstrong\u003eb\u003c/strong\u003e Morphology of the differentiated cells on day 20. Scale bar = 100 μm. \u003cstrong\u003ec\u003c/strong\u003e RT-qPCR analysis of mature hepatocyte markers on differentiation day 20. \u003cem\u003eGAPDH\u003c/em\u003e was used as an internal control. \u003cstrong\u003ed\u003c/strong\u003e Western blotting for albumin and CYP3A4 on the day 20-differentiated cells. Full-length blots are presented in Supplementary Figure 1. \u003cstrong\u003ee\u003c/strong\u003e Densitometry analysis of panel D (Biological replicate, n = 3). The densitometry values were normalized by actin. \u003cstrong\u003ef\u003c/strong\u003e Hepatic miR-122 and miR-192 transcript levels in the differentiated cells of each group at day 20. \u003cem\u003eRNU6B\u003c/em\u003e was used as an internal control. \u003cem\u003eP\u003c/em\u003e values \u0026lt; 0.05 were considered significant. *, \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05; **, \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01; ***, \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.001.\u003c/p\u003e","description":"","filename":"FigureJiwanChoietal.4.png","url":"https://assets-eu.researchsquare.com/files/rs-4326689/v1/54bf23da00a4af05a55fc403.png"},{"id":56440307,"identity":"ad08f1e6-d631-4403-98a9-5a86b439b591","added_by":"auto","created_at":"2024-05-14 08:26:40","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":1569320,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eViscosity of gelatin affected hepatic functions and organelles of mature hepatocyte-like cells\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ea\u003c/strong\u003e Detection of human albumin secretion in the differentiated cells on day 20, derived from each experimentalgroup. Undiff, undifferentiated cells. \u003cstrong\u003eb\u003c/strong\u003e Measurement of CYP3A4 activity using luminescence systems. Neg ctrl, only differentiation medium. \u003cstrong\u003ec\u003c/strong\u003e Immunocytochemical staining analysis of lipid droplets in the differentiated cells on day 20. Nuclei (blue) and lipid droplets (green) were stained with DAPI and Biotium LipidSpot, respectively. The boundariesof cells are indicated by white dotted lines. Scale bar = 20 μm. \u003cstrong\u003ed \u003c/strong\u003eFluorescence intensity of detected LDs in (c) (n = 4). \u003cstrong\u003ee\u003c/strong\u003e Mitochondrial copy number analysis in the differentiated cells on day 20. \u003cstrong\u003ef\u003c/strong\u003e Schematic illustration of the overall flow of this study. \u003cem\u003eP\u003c/em\u003e values \u0026lt; 0.05 were considered significant. *, \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05; **, \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01; ***, \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.001.\u003c/p\u003e","description":"","filename":"FigureJiwanChoietal.5.png","url":"https://assets-eu.researchsquare.com/files/rs-4326689/v1/f5a4d01db79f2c22efd7ecc6.png"},{"id":61793878,"identity":"81c9f587-a0d3-4578-86b3-c4e0ab844069","added_by":"auto","created_at":"2024-08-05 16:16:26","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":8511976,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4326689/v1/cc3a3976-2cf1-4c65-ae4f-b0d7b3136656.pdf"},{"id":56440945,"identity":"f3448d18-139b-4cee-9d1c-ffc5b537af99","added_by":"auto","created_at":"2024-05-14 08:34:39","extension":"pdf","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":79303,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSupplementary Figure 1. Uncropped full-length of Western blot membrane\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWhole membrane of Western blotting of human Albumin (a), CYP3A4 (b), and Actin (c).\u003c/p\u003e","description":"","filename":"supplementfigure1westernblotfulllength.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4326689/v1/c1f157ae382cd33114dd6621.pdf"}],"financialInterests":"","formattedTitle":"ROCK inhibitor and viscosity of gelatin promote hepatic differentiation by regulating organelles in human umbilical cord matrix-mesenchymal stem cells","fulltext":[{"header":"Background","content":"\u003cp\u003eMesenchymal stem cells (MSCs) originate from human fetal and adult tissues, such as bone marrow, umbilical cord matrix, placenta, and various adult tissues [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. Specifically, two fetus-originated tissues, umbilical cord matrix and placenta, are excellent sources of human MSCs because of their prominent advantages, such as a painless collection procedure, faster self-renewal and the ability of differentiation into three germ layers [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. Thus, recently, human umbilical cord matrix-derived MSCs (hUCM-MSCs) and their differentiated cells have been used for tissue regeneration in therapeutic medicine to treat various diseases [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe liver, essential for drug detoxification and biosynthesis of proteins and hormones, cannot be easily substituted by other organs. Consequently, many patients remain on transplant waiting lists, as healthy liver cells are the sole replacement for irreversibly damaged hepatic cells [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e, \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. Therefore, advanced stem cell technologies can provide great hope for patients facing end-stage diseases with no alternative but organ transplantation [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. However, there are restrictions on the medical use of differentiated cells from stem cells in therapies. One of the biggest obstacles to the use of these cells is the efficiency of differentiation protocols and the limited phenotypes of mature cells [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. For example, hepatocyte-like cells derived from human MSCs using current protocols exhibit characteristics more similar to fetal hepatocytes than the adult cells in terms of transcriptome profiles, hepatic functions, and metabolic activities [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. Thus, numerous differentiation methods have been developed, including approaches using genetic modifications, microenvironment adjustments, and the addition of cytokines and growth factors [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eIn stem cell fate determinations, transcriptome changes are strongly linked to the differentiation of cell types. Therefore, recently, the transcription of differentiated cells has been world widely analyzed using sequencing tools, such as RNA sequencing [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. However, cell fate does not only change transcriptional regulation. Cellular differentiation and lineage commitment are affected by communication between nuclei and various biological processes and signaling pathways involving cytoplasmic macromolecule and organelle interactions [\u003cspan additionalcitationids=\"CR12\" citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. In particular, changes of metabolism are accompanied when stem cells are differentiated, and it is known to play a vital role in stem cell fate determinations [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. In cell metabolism, mitochondrial dynamics are pivotal in determining cell fate and function [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. Moreover, it has been reported that lipid droplets (LDs), which are related to storage organelles at the center of lipid and energy homeostasis, are also linked with stem cell fate determination [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. Although the states of stem cell organelles are important for determining stem cell fate, it is still largely unknown whether the regulation of stem cell organelle states affects hepatic differentiation.\u003c/p\u003e \u003cp\u003eThis study demonstrated that the hepatic differentiation of hUCM-MSCs is significantly influenced not only by transcriptomic alterations but also by the state of organelles. We found that fasudil induced endoderm genes in the early differentiation, but facilitated the excessive accumulation of LDs in stem cells and interfered with hepatic differentiation. However, when hUCM-MSCs were reacted with fasudil in a high-viscosity gelatin-coated dish reduced the accumulation of LDs, activated mitochondrial function, and increased the efficiency and function of differentiated cells. Moreover, in the mature stage of differentiation, low-viscosity gelatin reduced the induction of LDs and activated mitochondria, thereby increasing the differentiation efficiency and function of differentiated cells. Collectively, our study findings highlight the importance of the hepatic differentiation of hUCM\u0026ndash;MSCs not only to transcriptome changes but also to the regulation of the organelle states of differentiated cells.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eCell culture\u003c/h2\u003e \u003cp\u003eIn this study, hUCM-MSCs were obtained from the Asan Stem Cell Center (Asan Institute for Life Sciences, Seoul, Korea) [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. The stem cells were cultured on 0.1% gelatin-coated cell culture dishes in DMEM/F12 medium, supplemented with 10% FBS (fetal bovine serum; GenDEPOT, TX, USA), 1% NEAA (non-essential amino acids), 1% antibiotic-antimycotic (Gibco, USA) and 0.2 mM L-ascorbic acid. Each manually passaged at 1:3 to 1:5 dilutions every 3\u0026ndash;4 days.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eQuantitative RT-PCR\u003c/h2\u003e \u003cp\u003eTotal RNA was extracted using an RNeasy Mini Kit (Qiagen, CA, USA) following the manufacturer\u0026rsquo;s instructions. Complementary DNA (cDNA) was synthesized using an Ultrascript 2.0 cDNA Synthesis Kit (PCR Biosystems, London, UK), and qRT-PCR was performed using HOT FIREPol EvaGreen qPCR Supermix (SOLIS BIODYNE, Tartu, Estonia) on a CFX Connect Real-Time PCR Detection System (Bio-Rad Laboratories, Hercules, CA, USA). The mRNA levels were normalized to GAPDH for analysis. The primer sequences are listed in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eprimer list\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene name\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSequence Forward\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eGATA4\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGGCCTGTCATCTCACTACGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eATGGCCAGACATCGCACT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eSOX17\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCAAGGGCGAGTCCCGTAT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCGACTTGCCCAGCATCTT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eFOXA2\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGGAGCGGTGAAGATGGA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTCATGTTGCTCACGGAGGA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003ePAX6\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGAGTTCTTCGCAACCTGGCTA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCTGCCCGTTCAACATCCTTAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eSOX1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAGTGGAAGGTCATGTCCGA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTTCTTGAGCAGCGTCTTGGT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eOTX2\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAGAGCTAAGTGCCGCCAAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTCCGAGCTGGAGATGTCTT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eT\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGGTCCACAGCGCATGATC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTGATAAGCAGTCACCGCTATGAA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eMIXL2\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTTTGGCTAGGCCGGAGATTA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGCAGGCAGTTCACATCTACCT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eCDX2\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eACAGTCGCTACATCACCATCC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCTCTCCTTTGCTCTGCGGTT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eAFP\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAGACTGCTGCAGCCAAAGTGA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGTGGGATCGATGCTGGAGTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eHNF4A\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCAGGCTCAAGAAATGCTTCC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGGCTGCTGTCCTCATAGCTT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eALBUMIN\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCACAGAATCCTTGGRGAACAGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eATGGAAGGTGAATGTTTCAGCA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eCYP3A4\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTTTTGTCCTACCATAAGGGCTTT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCACAGGCTGTTGACCATCAT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eCYP1A2\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGGACAGCACTTCCCTGAGA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAGGCAGGTAGCGAAGGATG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eHNF1A\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTGGGTCCTACGTTCACCAAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTCTGCACAGGTGGCATGAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eRT-qPCR was conducted to evaluate the expression of hepatic mature miRNAs (miR-122, and miR-192) in undifferentiated and differentiated cells. Briefly, cDNA was synthesized from total RNA using the miRCURY LNA RT Kit (Qiagen, Hilden, Germany) according to the manufacturer\u0026rsquo;s instructions. RT-qPCR analysis was performed using the miRCURY LNA SYBR Green PCR kit (Qiagen) with microRNA-specific primers purchased from Qiagen. Cycling conditions were as follows: incubation at 95\u0026deg;C for 2 min, followed by 40 cycles of denaturation for 10 s at 95\u0026deg;C, and annealing and extension for 1 min at 56\u0026deg;C. The cycle threshold values were determined using Bio-Rad CFX Maestro software (CFX Maestro, version 1.1; Bio-Rad Laboratories). All experiments were repeated three times, and \u003cem\u003eRNU6B\u003c/em\u003e was used as an internal control.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eMitochondrial DNA copy number estimation\u003c/h2\u003e \u003cp\u003eMitochondrial DNA (mtDNA) copy number was determined using the Absolute Human Mitochondrial DNA Copy Number Quantification qPCR assay kit (ScienCell, CA, USA). Before assessing the mtDNA copy number, we isolated total DNA using the QIAamp DNA Mini Kit (Qiagen). Briefly, the cycle threshold values were measured in triplicate for each sample using nuclear-specific and mitochondria-specific probes. The assay was performed according to the manufacturer\u0026rsquo;s instructions.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eDetection of secreted human albumin\u003c/h2\u003e \u003cp\u003eThe secreted human albumin from the differentiated cells was detected using a Human Albumin ELISA kit (Bethyl Laboratories, TX, USA) according to the manufacturer\u0026rsquo;s instructions. Albumin secretion was normalized to the culture day and total cell number.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eMeasurement of CYP3A4 activity in vitro\u003c/h2\u003e \u003cp\u003eEnzyme activity was determined using the P450-Glo CYP3A4 kit (Promega, WA, USA) according to the manufacturer\u0026rsquo;s instructions. Luminescence was measured by GloMax 96 Microplate Luminometer (Promega). CYP3A4 Activity was normalized to the culture day and double-stranded DNA content of each sample.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eIn vitro hepatic differentiation\u003c/h2\u003e \u003cp\u003eHepatic differentiation was performed as previously reported with slight modifications [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e, \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. Briefly, the stem cells were seeded on 0.1% or 1% gelatin-coated dishes at 7000 cells/cm\u003csup\u003e2\u003c/sup\u003e in the cell culture medium. After 1 day, the cells were pretreated with stem cell culture medium and 10 \u0026micro;M fasudil (AdooQ Bioscience, CA, USA) for 3 days. Next, the cells were cultured in a hepatoblast induction medium consisting of step-1 basal medium, 10 ng/ml FGF2, 20 ng/ml BMP4, and 3 \u0026micro;M CHIR99021 for 4 days. Finally, the differentiated cells were cultured in a hepatic maturation medium consisting of a step-2 basal medium and 20 ng/ml oncostatin M (OSM) for 8 days. After 8 days, the medium was replaced with a hepatic maturation medium consisting of step-2 basal medium, 20 ng/ml OSM, 0.1% gelatin, or 1% gelatin or not for 5 days. The differentiation medium was changed every 2 days.\u003c/p\u003e \u003cp\u003eThe step-1 basal medium consisted of the following steps: IMDM (Iscove\u0026rsquo;s Modified Dulbecco\u0026rsquo;s Medium; Gibco) supplemented with 0.1% PVA (polyvinyl alcohol; Sigma Aldrich), 10 mM nicotinamide (Sigma Aldrich), 20 ng/ml hHGF (human hepatocyte growth factor; PeproTech, NJ, USA), 1% ITS (insulin\u0026ndash;transferrin\u0026ndash;selenium; Gibco), and 1% penicillin/streptomycin (GeneDireX, Taiwan); The step-2 basal medium consisted of the following steps: IMDM supplemented with 1 \u0026micro;M dexamethasone, 1% ITS, 20 ng/ml hHGF, and 1% penicillin/streptomycin. All growth factors were purchased from PeproTech.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eProtein extraction and Western blotting\u003c/h2\u003e \u003cp\u003eFor Western blotting, cells were trypsinized, washed with ice-cold PBS, and lysed in RIPA lysis buffer (50 mM HEPES pH 7.4, 150 mM NaCl, 1 mM EDTA, 2.5 mM EGTA, 1 mM DTT, 1% Triton X-100) containing a protease and phosphatase inhibitor cocktail (Sigma Aldrich). After lysis, cell debris was removed by centrifugation at 13,000 rpm for 20 min. The protein concentrations were determined using the Bradford assay. Total cellular proteins (15 \u0026micro;g) were separated by 8\u0026ndash;15% SDS\u0026ndash;PAGE (sodium dodecyl sulfate\u0026ndash;polyacrylamide gel electrophoresis) and transferred to Immobilon PVDF (polyvinylidene fluoride) membranes (Millipore, MA, USA). The membranes were blocked with 8% BSA (bovine serum albumin; GenDEPOT) in TBST (Tris-buffered saline with Tween 20; 20 mM Tris-HCl pH 7.4, 150 mM NaCl, 0.1% Tween 20) and probed with anti-albumin (Abcam, Cambridge, UK) and anti-CYP3A4 (Santa Cruz, CA, USA) primary antibodies. After washing with TBST, the primary antibodies were detected using horseradish peroxidase-conjugated anti-mouse secondary antibodies and an enhanced chemiluminescence detection system (Amersham, Buckinghamshire, UK). Full-length Western blotting images are presented in Supplementary Fig.\u0026nbsp;1.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003eOrganelle analysis in the differentiated cells\u003c/h2\u003e \u003cp\u003eLabel-free optical diffraction tomography (ODT) using refractive index (RI) tomography was conducted on hUCM-MSCs using an ODT microscope (HT-X1; Tomocube Inc., Daejeon, Korea). The ODT used three-dimensional RI tomography to reconstruct a single hUCM-MSCs from 48 overlapping two-dimensional holograms captured at various angles, illuminated by a 450-nm LED (light-emitting diode) in a controlled atmosphere of 5% CO\u003csub\u003e2\u003c/sub\u003e at a temperature of 37\u0026deg;C. The HT-X1 microscope, incorporating a Mach-Zehnder interferometer, was utilized for the three-dimensional RI tomographic reconstruction of the cells. LD quantification and volumetric analysis were performed using TomoAnalysis software by TomoCube. Fluorescent staining was employed to ensure precision. MitoTracker dyes (Invitrogen, CA, USA, 250 nM) for mitochondrial labeling and Biotium LipidSpot 488 lipid droplet stain (1:1000 dilution) were used to stain the mitochondria and LDs, respectively. Live cell staining was performed according to the manufacturers\u0026rsquo; instructions.\u003c/p\u003e \u003cp\u003eWe also observed the cells using a Zeiss LSM 880 confocal laser scanning microscope (Carl Zeiss, Oberkochen, Germany). The cells were fixed with 4% formaldehyde overnight, washed with the PBST (PBS with Tween 20), permeabilized in 0.5% Triton X-100, and blocked with PBST containing 1% BSA. The samples were stained with Biotium LipidSpot 488 lipid droplet stain. Nuclei were counterstained with NucBlue Fixed Cell ReadyProbes Reagent (DAPI; Invitrogen) for 10 min, and fluorescence signals were detected using the Zeiss LSM 880 confocal laser scanning microscope.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eSeahorse assay\u003c/h2\u003e \u003cp\u003eTo measure oxygen consumption rate (OCR) in differentiated cells, stem cells were seeded at 7000 cells/cm\u003csup\u003e2\u003c/sup\u003e in 0.1% or 1% gelatin-coated XFe24 cell culture plates (Agilent Technologies, Santa Clara, CA, USA) and subsequently induced to differentiate. Mitochondrial OCR was measured using an XF Cell MitoStress test kit in an XF24 extracellular flux analyzer (Agilent Technologies). OCR values were normalized by the amount of cellular DNA.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eStatistical analysis was performed using GraphPad Prism, version 6.0 (GraphPad Software, MA, USA). Comparisons of three or more data sets were performed by one-way or two-way ANOVA (analysis of variance) followed by Bonferroni\u0026rsquo;s multiple comparison tests. Two-group comparisons were performed using two-tailed Student\u0026rsquo;s t-tests. \u003cem\u003eP\u003c/em\u003e values\u0026thinsp;\u0026lt;\u0026thinsp;0.05 were considered statistically significant.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eState of organelles in differentiated cells influence the early stage of hepatic differentiation\u003c/h2\u003e \u003cp\u003eIn our initial work, we tested how the ROCK inhibitor, fasudil, influences the differentiation of hUCM\u0026ndash;MSCs into hepatic endoderm, a crucial process in the initial stages of cellular differentiation. Previous studies were reported that ROCK inhibitors not only improve stem cell viability but also promote the induction of human pluripotent stem cells (hPSC) into the endoderm [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. Moreover, differentiation efficiency increased when small molecules were used rather than only protein-used [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. Thus, in order to confirm the effect of fasudil on the hepatic differentiation of hUCM-MSCs, we first verified a proper concentration and treatment time of fasudil. Unlike the previously reported concentration of fasudil used in hPSCs [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e], endoderm markers (\u003cem\u003eGATA4, SOX17\u003c/em\u003e and \u003cem\u003eFOXA2\u003c/em\u003e) were significantly increased at a high concentration of 10 \u0026micro;M, and it was effective when treated for 72 hrs (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05, Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ea, b). We also conducted tomographic analysis to confirm the state of organelles, such as LDs and mitochondria, within differentiated cells, which were known to be important for metabolism and regulation of stem cell fate [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e, \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. As a result, the stem cells changed to a more ovoid shape and the mitochondrial morphology was different (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ec). Moreover, LDs were induced inside the cells, and the number of LDs increased (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001, Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ec, d).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eNext, we examined whether the use of fasudil increased the differentiation efficiency of hepatoblasts, as an evaluation of the next step in the hepatic endoderm (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ee). The phenotype of differentiated cells was similar in both the control and fasudil-treated groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ef). However, the expression of hepatoblast-related genes (\u003cem\u003eAFP\u003c/em\u003e and \u003cem\u003eHNF4A\u003c/em\u003e) was suppressed in the fasudil-treated group (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001, Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eg). To explain the hepatoblast differentiation efficiency decreased despite endodermal gene upregulation, we performed mitochondrial function test. Mitochondrial functions, such as adenosine triphosphate (ATP) production, are related to the efficiency of differentiation and are reduced when excessive LDs are induced [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. Therefore, we hypothesized that LDs induced by fasudil would affect mitochondrial function. As we expected, mitochondrial function was diminished in the cells treated with fasudil on the day 3 of differentiation (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001, Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eh). Collectively, these results indicated that while fasudil transcriptionally impacts the early stages of hepatic differentiation in hUCM\u0026ndash;MSCs, it does not influence next stage of endoderm due to organelle conditions.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eThe effect of gelatin viscosity on hepatoblast induction of hUCM-MSCs\u003c/h2\u003e \u003cp\u003eBased on fasudil-treated results, we hypothesized that mitochondrial function correlates with differentiation efficiency. Therefore, next, we aimed to enhance mitochondrial function through an extracellular matrix (ECM) component. Gelatin is known to a common biomaterial for cell culture that provides a suitable biological signal for host cells [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. Moreover, as confirmed in our result, when hUCM-MSCs were cultured on 0.1% or 1% gelatin-coated dishes, mitochondrial activation levels, such as basal, maximal oxidative phosphorylation, ATP production, and proton leak, were increased (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001, Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ea). Previous studies have shown that enhancement of oxidative phosphorylation levels and ATP production in differentiated cells is necessary for specific lineage differentiation [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e, \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. Therefore, we expected that gelatin used as ECM would synergistically improve the efficiency of differentiation with fasudil.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eTo assess gelatin\u0026rsquo;s impact on hepatic differentiation, we cultured hUCM-MSCs on 0.1% or 1% gelatin-coated dishes, and differentiation proceeded under these conditions (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eb). The phenotype of differentiated cells was similar on day 7 between all groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ec). Next, we analyzed the dynamics of gene expression associated with hepatic endoderm and hepatoblasts on the differentiation day 0, 3, and 7. As a result, endoderm-related genes (\u003cem\u003eSOX17\u003c/em\u003e and \u003cem\u003eFOXA2\u003c/em\u003e) except for \u003cem\u003eGATA4\u003c/em\u003e and hepatoblast-related genes (\u003cem\u003eAFP\u003c/em\u003e and \u003cem\u003eHNF4A\u003c/em\u003e) exhibited significant upregulation in the 1% gelatin and fasudil group compared to other groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ed, e). However, interestingly, when hepatoblast differentiation was progressed, the hepatoblast markers (\u003cem\u003eAFP\u003c/em\u003e and \u003cem\u003eHNF4A\u003c/em\u003e) were decreased in the 0.1% gelatin and fasudil group, in contrast to the 1% gelatin and fasudil group (#a and #b, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01; Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ee).\u003c/p\u003e \u003cp\u003eTo explain the variation in differentiation efficiency observed between the low-viscosity and high-viscosity gelatin groups, we examined the early differentiation fate of stem cells. Notably, fasudil has been documented as a promoter for the differentiation of cells originating from the ectoderm and mesoderm, including neurons and cardiomyocytes [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e, \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. Thus, we confirmed the gene expression of ectoderm (\u003cem\u003ePAX6\u003c/em\u003e, \u003cem\u003eSOX1\u003c/em\u003e and \u003cem\u003eOTX2\u003c/em\u003e) and mesoderm (\u003cem\u003eT\u003c/em\u003e, \u003cem\u003eMIXL2\u003c/em\u003e and \u003cem\u003eCDX2\u003c/em\u003e) markers in differentiated cells on day 3. The results showed that the expression of ectoderm genes (\u003cem\u003ePAX6\u003c/em\u003e and \u003cem\u003eOTX2\u003c/em\u003e) were suppressed in the 1% gelatin and fasudil group (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05; Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ef). Moreover, the endoderm gene, \u003cem\u003eMIXL2\u003c/em\u003e, was downregulated, but the mesendoderm gene, \u003cem\u003eT\u003c/em\u003e, was upregulated in the 1% gelatin and fasudil group (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01; Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eg). These results indicated that high-viscosity gelatin repressed the gene expression of ectoderm- and endoderm-related genes, leading to endodermal fate.\u003c/p\u003e \u003cp\u003eGiven that stem cell fate determinations according to gelatin viscosity can be influenced by the organelle states, next, we investigated the impact of high-viscosity gelatin on organelles in the differentiated cells.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003eHigh-viscosity gelatin inhibited the induction of LDs and enhanced mitochondrial function\u003c/h2\u003e \u003cp\u003eTo analyze the effects of high-viscosity gelatin on stem cell fate through regulation of organelles, tomographic and mitochondrial function analyses were performed. It is known that tomographic analysis can be used to observe cell organelles more accurately than confocal laser scanning microscopy [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. Therefore, we tomographically analyzed LDs and morphology of the mitochondria in differentiated cells on day 3. As a result, the group treated with 1% gelatin and fasudil showed lower LDs induction than the group treated with 0.1% gelatin and fasudil (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001; Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ea, b), suggesting that high-viscosity gelatin suppressed the production of LDs induced by fasudil. Moreover, in the 0.1% gelatin and fasudil group, mitochondrial morphology appeared to be hyperfusion induced (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ea).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eNext, we performed a seahorse assay to determine how excessive LDs induction and hyperfusion form of mitochondrial affect cellular mitochondrial function. The result showed that overall OCR levels were highest in the 1% gelatin and fasudil group (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05, Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ec, d). Moreover, we measured the mtDNA copy number across all groups. A previous study reported that mtDNA levels gradually increased to support differentiation [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. Thus, we expected that the more efficient the differentiation, the higher the mtDNA copy number would be. In our study, the mtDNA copy number was higher in the 1% gelatin and fasudil group (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001, Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ee).\u003c/p\u003e \u003cp\u003eIn summary, the enhanced differentiation efficiency in the 1% gelatin and fasudil group can be attributed not only to the downregulation of ectodermal and mesodermal gene expression but also to the modulation of organelle states, including reduced LD production and activated mitochondrial function.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003eLow-viscosity gelatin synergistically enhanced the efficiency and function of HLCs\u003c/h2\u003e \u003cp\u003eFinally, we differentiated the hepatoblasts, which were induced using 1% gelatin coating and fasudil, into HLCs. At this stage, we used gelatin by adding step-2 differentiation medium rather than coating the dishes. Gelatin is known for its use in the long-term maintenance of human hepatocytes [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. Thus, we assumed that it would help in the maturation of HLCs from hUCM-MSCs. To confirm the effect of gelatin on hepatocyte maturation, we induced HLCs from the hepatoblasts using OSM for 8 days, and we conducted the maturation by adding gelatin at different viscosities: 0% (no gelatin added) or 0.1% or 1% for 5 days (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ea). The HLC phenotypes were similar in all groups on differentiation day 20 (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eb). However, transcription analysis revealed that the expression of mature hepatocyte-related genes (\u003cem\u003eALB, CYP3A4, CYP1A2, HNF1A\u003c/em\u003e, and \u003cem\u003eHNF4A\u003c/em\u003e) was significantly elevated in the low-viscosity (0.1%) gelatin group compared to the others (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01, Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ec). We also confirmed the expression of these proteins (Albumin; ALB and CYP3A4) by Western blotting, wherein ALB levels in the 0.1% gelatin group were comparable to those yielded in the 0% gelatin group, but CYP3A4 expression was notably higher (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01, Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ed, e). Moreover, the maturation efficiency was assessed through the expression of hepatocyte-specific miRNAs, such as miR-122 and miR-192 [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. These results also showed that hepatocyte-specific miRNAs expressed significantly upregulated in the presence of 0.1% gelatin (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ef).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eNext, considering the primary roles of hepatocytes in protein synthesis and detoxification, we measured albumin secretion and CYP3A4 activity. Consistent with previous findings, hepatic function was significantly enhanced in HLCs with the addition of 0.1% gelatin (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001, Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ea, b). Overall, the specification and maturation of hepatocytes were more efficient with low-viscosity gelatin, in contrast to hepatoblast differentiation. Therefore, we attempted to understand this phenomenon by analyzing the state of differentiated cell organelles, focusing on LDs and mtDNA copy number in the HLCs on day 20. Confocal imaging analysis confirmed that fewer LDs were induced when 0.1% gelatin was used for hepatocyte maturation (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05, Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ec, d), and a significant increase in mtDNA copy number was observed in the same group (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001, Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ee). These findings imply that low-viscosity gelatin is favorable for the maturation of HLCs, diverging from its role in early differentiation stages, and highlight that organelle states are pivotal in determining the efficiency and functionality of HLCs.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eWe successfully increased the efficiency of hepatic differentiation of hUCM-MSCs using fasudil and gelatin. Fasudil is a small molecule that is more stable and precise for stem cell differentiation than proteins used in the early stages of hepatic differentiation, such as activin A and Wnt3a [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]. Moreover, given that fasudil has been approved by the FDA, it can be used in the production of stem cell-based therapies [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. Thus, there is a necessary to discuss about the effects of fasudil on hUCM-MSCs. Previous studies have shown that fasudil prevents mitochondrial fission and induces fusion [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]. Consequently, it is possible that mitochondrial byproducts, such as reactive oxygen species\u0026mdash;produced by fusion stress\u0026mdash;change stem cell metabolism and increase differentiation-related genes [\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]. For this reason, according to our findings, hepatoblast differentiation may have been hindered by mitochondrial stress. However, this assumption requires further investigation.\u003c/p\u003e \u003cp\u003eWe also demonstrated that gelatin viscosity affects early and late hepatic differentiation of hUCM\u0026ndash;MSCs. According to previous studies, the differentiation efficiency of human MSCs and liver stem cells increases in low-viscosity ECM, which provides soft stiffness [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e, \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e]. As in our study, the efficiency of hepatocyte maturation increased in low-viscosity gelatin in the late stages of differentiation. Contrary to the late stages, hepatoblast differentiation was enhanced on high-viscosity gelatin\u0026ndash;coated dishes during the early stages. This means that the ECM requirement for differentiated cells varies depending on the developmental stage, and if not optimized, stem cell fate may change. Thus, our research suggests that to use ECM for differentiation, it is necessary to optimize the viscosity or concentration depending on the differentiation stage.\u003c/p\u003e \u003cp\u003eNext, we suggested that it may be important not only to induce appropriate transcription but also to induce the appropriate organelle state. The regulation of LDs and mitochondrial function had a significant impact on stem cell fate. Consistent with our findings, the condition of cellular organelles influences cellular metabolism, which can lead to epigenetic modifications [\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e]. Mitochondrial metabolism, glycolysis, and oxidative phosphorylation generate NADH/NAD\u003csup\u003e+\u003c/sup\u003e and FADH\u003csub\u003e2\u003c/sub\u003e/FAD, which induce epigenetic changes such as histone methylation, acetylation, demethylation, and DNA demethylation [\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e]. This may serve as a crucial checkpoint for the therapeutic application of stem cell-derived differentiated cells.\u003c/p\u003e \u003cp\u003eBeyond the aspects already described, further detailed investigations are warranted. For example, the upstream factors that influence organelle behavior and transcriptional responses to fasudil and gelatin remain unidentified. Additionally, a comprehensive examination of organelles, including the Golgi apparatus and endoplasmic reticulum\u0026mdash;both integral to cellular metabolism\u0026mdash;is essential [\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e]. Establishing clear associations among organelle states, gene expression, and cellular functions in differentiated cells, and their comparison with human primary hepatocytes, could facilitate the therapeutic application of stem cell-derived hepatocytes in the future.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eIn conclusion, we propose an effective protocol for hepatic differentiation using fasudil and gelatin. Fasudil prompted the early-stage induction of hUCM-MSCs into endoderm, while a high-viscosity (1%) gelatin coating modulates transcription and organelle states, thereby enhancing differentiation efficiency. Conversely, during the later stages of differentiation, a low gelatin viscosity (0.1%) enhanced hepatic maturation and function. At this stage, the suppression of lipid droplets and the activation of mitochondria also influenced maturation of HLCs (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ef). These results suggest that for the generation of differentiated cells suitable for cell therapy, a thorough analysis of organelle states, in addition to genetic and proteomic profiling, is crucial for the efficacy and functionality of hepatic cells differentiated from hUCM-MSCs.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cp\u003eMesenchymal stem cells: MSCs\u003c/p\u003e\n\u003cp\u003eHuman umbilical cord matrix-mesenchymal stem cells: hUCM-MSCs\u003c/p\u003e\n\u003cp\u003eHepatocyte-like cells: HLCs\u003c/p\u003e\n\u003cp\u003eROCK:\u0026nbsp;Rho-associated protein kinase\u003c/p\u003e\n\u003cp\u003eLipid droplets: LDs\u003c/p\u003e\n\u003cp\u003eMitochondrial DNA: mtDNA\u003c/p\u003e\n\u003cp\u003eOncostatin M: OSM\u003c/p\u003e\n\u003cp\u003eLabel-free optical diffraction tomography: ODT\u003c/p\u003e\n\u003cp\u003eOxygen consumption rate: OCR\u003c/p\u003e\n\u003cp\u003eExtracellular matrix: ECM\u003c/p\u003e\n\u003cp\u003eAdenosine triphosphate: ATP\u003c/p\u003e\n\u003cp\u003eAlbumin: ALB\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cbr\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eEthics approval and consent to human participation for using hUCM-MSCs were approved by the Institutional Review Board (IRB) of Asan Medical Center (Seoul, Korea; title: Evaluation of the Hepatic Protection Effect by Engraftment or Differentiation of Stem cells Using Two-photon Microscopy in Liver Injury Mice Model; approval number: 2022-0431; date of approval: April 06, 2022).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe datasets used and/or analysed during the current study are available from the corresponding author on reasonable request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis research was supported by the Asan Institute for Life Sciences (grant\u0026nbsp;numbers:\u0026nbsp;J.M.N. \u0026ndash;2021IL0009\u0026nbsp;and E.T. \u0026ndash;\u0026nbsp;2022IP0084), the National Research Foundation of Korea (grant\u0026nbsp;numbers: E.T. \u0026ndash;\u0026nbsp;NRF-2015K1A4A3046807 and NRF-2022R1A2C200614111), and the Research Supporting Program of\u0026nbsp;the Korean Association for the Study of the Liver and\u0026nbsp;the Korean Liver Foundation (grant number: 2023-0719).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors\u0026rsquo; contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eJ.C.\u0026nbsp;and E.T.\u0026nbsp;conceptualized, drafted, and supervised the study; J.C.,\u0026nbsp;S.\u0026nbsp;K.,\u0026nbsp;and H.A.\u0026nbsp;conducted the experiments and analyzed the data; C.K.\u0026nbsp;performed\u0026nbsp;the label-free optical diffraction\u0026nbsp;tomography; S.L.,\u0026nbsp;C.P.,\u0026nbsp;Y.Y.,\u0026nbsp;J.N.,\u0026nbsp;and J.K.\u0026nbsp;critically revised\u0026nbsp;the manuscript. All authors\u0026nbsp;have\u0026nbsp;read and approved the final manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe are grateful for the use of the facilities of the Asan Medical Institute of Convergence Science and Technology for use of their equipment, services, and expertise, and Stem cell Center in Asan Medical Center.\u003cbr\u003e\u0026nbsp;\u003c/p\u003e "},{"header":"References","content":"\u003col\u003e\n\u003cli\u003ePittenger MF, Discher DE, P\u0026eacute;ault BM, Phinney DG, Hare JM, Caplan AI. Mesenchymal stem cell perspective: cell biology to clinical progress. npj Regenerative Medicine. 2019;4(1):22.\u003c/li\u003e\n\u003cli\u003eDing D-C, Chang Y-H, Shyu W-C, Lin S-Z. Human Umbilical Cord Mesenchymal Stem Cells: A New Era for Stem Cell Therapy. 2015;24(3):339-47.\u003c/li\u003e\n\u003cli\u003eXie Q, Liu R, Jiang J, Peng J, Yang C, Zhang W, Wang S, Song J. What is the impact of human umbilical cord mesenchymal stem cell transplantation on clinical treatment? Stem Cell Research \u0026amp; Therapy. 2020;11(1):519.\u003c/li\u003e\n\u003cli\u003eRui LJCp. Energy metabolism in the liver. 2014;4(1):177.\u003c/li\u003e\n\u003cli\u003eJadlowiec CC, Taner TJWjog. Liver transplantation: current status and challenges. 2016;22(18):4438.\u003c/li\u003e\n\u003cli\u003eStock P, Br\u0026uuml;ckner S, Ebensing S, Hempel M, Dollinger MM, Christ B. The generation of hepatocytes from mesenchymal stem cells and engraftment into murine liver. Nature Protocols. 2010;5(4):617-27.\u003c/li\u003e\n\u003cli\u003eWnorowski A, Yang H, Wu JC. Progress, obstacles, and limitations in the use of stem cells in organ-on-a-chip models. Advanced drug delivery reviews. 2019;140:3-11.\u003c/li\u003e\n\u003cli\u003eBaxter M, Withey S, Harrison S, Segeritz CP, Zhang F, Atkinson-Dell R, Rowe C, Gerrard DT, Sison-Young R, Jenkins R, Henry J, Berry AA, Mohamet L, Best M, Fenwick SW, Malik H, Kitteringham NR, Goldring CE, Piper Hanley K, Vallier L, Hanley NA. Phenotypic and functional analyses show stem cell-derived hepatocyte-like cells better mimic fetal rather than adult hepatocytes. Journal of hepatology. 2015;62(3):581-9.\u003c/li\u003e\n\u003cli\u003eAfshari A, Shamdani S, Uzan G, Naserian S, Azarpira N. Different approaches for transformation of mesenchymal stem cells into hepatocyte-like cells. Stem Cell Research \u0026amp; Therapy. 2020;11(1):54.\u003c/li\u003e\n\u003cli\u003eWells CA, Choi J. Transcriptional Profiling of Stem Cells: Moving from Descriptive to Predictive Paradigms. Stem Cell Reports. 2019;13(2):237-46.\u003c/li\u003e\n\u003cli\u003eJulian LM, Stanford WL. Organelle Cooperation in Stem Cell Fate: Lysosomes as Emerging Regulators of Cell Identity. 2020;8.\u003c/li\u003e\n\u003cli\u003eKhacho M, Slack RS. Mitochondrial and Reactive Oxygen Species Signaling Coordinate Stem Cell Fate Decisions and Life Long Maintenance. Antioxidants \u0026amp; redox signaling. 2018;28(11):1090-101.\u003c/li\u003e\n\u003cli\u003eKinney MA, Vo LT, Frame JM, Barragan J, Conway AJ, Li S, Wong KK, Collins JJ, Cahan P, North TE, Lauffenburger DA, Daley GQ. A systems biology pipeline identifies regulatory networks for stem cell engineering. Nature biotechnology. 2019;37(7):810-8.\u003c/li\u003e\n\u003cli\u003eIntlekofer AM, Finley LWJNm. Metabolic signatures of cancer cells and stem cells. 2019;1(2):177-88.\u003c/li\u003e\n\u003cli\u003eChen H, Chan DCJCm. Mitochondrial dynamics in regulating the unique phenotypes of cancer and stem cells. 2017;26(1):39-48.\u003c/li\u003e\n\u003cli\u003eYue F, Oprescu SN, Qiu J, Gu L, Zhang L, Chen J, Narayanan N, Deng M, Kuang S. Lipid droplet dynamics regulate adult muscle stem cell fate. Cell Reports. 2022;38(3):110267.\u003c/li\u003e\n\u003cli\u003eLee J, Choi J, Kang S, Kim J, Lee R, So S, Yoon YI, Kirchner VA, Song GW, Hwang S, Lee SG, Kang E, Tak E. Hepatogenic Potential and Liver Regeneration Effect of Human Liver-derived Mesenchymal-Like Stem Cells. Cells. 2020;9(6).\u003c/li\u003e\n\u003cli\u003eChoi J, Kang S, Kim B, So S, Han J, Kim G-N, Lee M-Y, Roh S, Lee J-Y, Oh SJ, Sung YH, Lee Y, Kim SH, Kang E. Efficient hepatic differentiation and regeneration potential under xeno-free conditions using mass-producible amnion-derived mesenchymal stem cells. Stem Cell Research \u0026amp; Therapy. 2021;12(1):569.\u003c/li\u003e\n\u003cli\u003eMaldonado M, Luu RJ, Ramos MEP, Nam J. ROCK inhibitor primes human induced pluripotent stem cells to selectively differentiate towards mesendodermal lineage via epithelial-mesenchymal transition-like modulation. Stem Cell Research. 2016;17(2):222-7.\u003c/li\u003e\n\u003cli\u003eBorowiak M, Maehr R, Chen S, Chen AE, Tang W, Fox JL, Schreiber SL, Melton DA. Small Molecules Efficiently Direct Endodermal Differentiation of Mouse and Human Embryonic Stem Cells. Cell Stem Cell. 2009;4(4):348-58.\u003c/li\u003e\n\u003cli\u003eKorostylev A, Mahaddalkar PU, Keminer O, Hadian K, Schorpp K, Gribbon P, Lickert H. A high-content small molecule screen identifies novel inducers of definitive endoderm. Molecular metabolism. 2017;6(7):640-50.\u003c/li\u003e\n\u003cli\u003eCui L, Liu P. Two Types of Contact Between Lipid Droplets and Mitochondria. 2020;8.\u003c/li\u003e\n\u003cli\u003eShares BH, Busch M, White N, Shum L, Eliseev RA. Active mitochondria support osteogenic differentiation by stimulating \u0026beta;-catenin acetylation. Journal of Biological Chemistry. 2018;293(41):16019-27.\u003c/li\u003e\n\u003cli\u003eAfewerki S, Sheikhi A, Kannan S, Ahadian S, Khademhosseini A. Gelatin-polysaccharide composite scaffolds for 3D cell culture and tissue engineering: Towards natural therapeutics. 2019;4(1):96-115.\u003c/li\u003e\n\u003cli\u003eCho YM, Kwon S, Pak YK, Seol HW, Choi YM, Park DJ, Park KS, Lee HKJB, communications br. Dynamic changes in mitochondrial biogenesis and antioxidant enzymes during the spontaneous differentiation of human embryonic stem cells. 2006;348(4):1472-8.\u003c/li\u003e\n\u003cli\u003eChung S, Arrell DK, Faustino RS, Terzic A, Dzeja PPJJom, cardiology c. Glycolytic network restructuring integral to the energetics of embryonic stem cell cardiac differentiation. 2010;48(4):725-34.\u003c/li\u003e\n\u003cli\u003eKhan AA, Huat TJ, Al Mutery A, El-Serafi AT, Kacem HH, Abdallah SH, Reza MF, Abdullah JM, Jaafar H. Significant transcriptomic changes are associated with differentiation of bone marrow-derived mesenchymal stem cells into neural progenitor-like cells in the presence of bFGF and EGF. Cell \u0026amp; Bioscience. 2020;10(1):126.\u003c/li\u003e\n\u003cli\u003eHu Y, Li X, Huang G, Wang J, Lu W. Fasudil may induce the differentiation of bone marrow mesenchymal stem cells into neuron‑like cells via the Wnt/\u0026beta;‑catenin pathway. Mol Med Rep. 2019;19(4):3095-104.\u003c/li\u003e\n\u003cli\u003eKim Y, Kim T-K, Shin Y, Tak E, Song G-W, Oh Y-M, Kim JK, Pack C-G. Characterizing Organelles in Live Stem Cells Using Label-Free Optical Diffraction Tomography. Molecules and Cells. 2021;44(11):851-60.\u003c/li\u003e\n\u003cli\u003eHu C, Fan L, Cen P, Chen E, Jiang Z, Li L. Energy Metabolism Plays a Critical Role in Stem Cell Maintenance and Differentiation. 2016;17(2):253.\u003c/li\u003e\n\u003cli\u003eKlaas M, M\u0026ouml;ll K, M\u0026auml;emets-Allas K, Loog M, J\u0026auml;rvek\u0026uuml;lg M, Jaks V. Long-term maintenance of functional primary human hepatocytes in 3D gelatin matrices produced by solution blow spinning. Scientific Reports. 2021;11(1):20165.\u003c/li\u003e\n\u003cli\u003eXiaolin W, Yong H, Bryan M, Bin G. MicroRNAs as regulators, biomarkers and therapeutic targets in liver diseases. Gut. 2021;70(4):784.\u003c/li\u003e\n\u003cli\u003ePavathuparambil Abdul Manaph N, Sivanathan KN, Nitschke J, Zhou X-F, Coates PT, Drogemuller CJ. An overview on small molecule-induced differentiation of mesenchymal stem cells into beta cells for diabetic therapy. Stem Cell Research \u0026amp; Therapy. 2019;10(1):293.\u003c/li\u003e\n\u003cli\u003eFeng Y, LoGrasso PV, Defert O, Li R. Rho Kinase (ROCK) Inhibitors and Their Therapeutic Potential. Journal of Medicinal Chemistry. 2016;59(6):2269-300.\u003c/li\u003e\n\u003cli\u003eLv J, Yi Y, Qi Y, Yan C, Jin W, Meng L, Zhang D, Jiang W. Mitochondrial homeostasis regulates definitive endoderm differentiation of human pluripotent stem cells. Cell Death Discovery. 2022;8(1):69.\u003c/li\u003e\n\u003cli\u003eXiao F, Zhang R, Wang L. Inhibitors of Mitochondrial Dynamics Mediated by Dynamin-Related Protein 1 in Pulmonary Arterial Hypertension. 2022;10.\u003c/li\u003e\n\u003cli\u003eLee K, Chen Y, Yoshitomi T, Kawazoe N, Yang Y, Chen G. Osteogenic and Adipogenic Differentiation of Mesenchymal Stem Cells in Gelatin Solutions of Different Viscosities. 2020;9(23):2000617.\u003c/li\u003e\n\u003cli\u003eCozzolino AM, Noce V, Battistelli C, Marchetti A, Grassi G, Cicchini C, Tripodi M, Amicone L. Modulating the Substrate Stiffness to Manipulate Differentiation of Resident Liver Stem Cells and to Improve the Differentiation State of Hepatocytes. Stem Cells International. 2016;2016:5481493.\u003c/li\u003e\n\u003cli\u003eDai Z, Ramesh V, Locasale JW. The evolving metabolic landscape of chromatin biology and epigenetics. Nature Reviews Genetics. 2020;21(12):737-53.\u003c/li\u003e\n\u003cli\u003eTatapudy S, Aloisio F, Barber D, Nystul T. Cell fate decisions: emerging roles for metabolic signals and cell morphology. EMBO reports. 2017;18(12):2105-18-18.\u003c/li\u003e\n\u003cli\u003eSekine Y, Houston R, Sekine S. Cellular metabolic stress responses via organelles. Experimental Cell Research. 2021;400(1):112515.\u003cbr\u003e \u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":true,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"stem-cell-research-and-therapy","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scrt","sideBox":"Learn more about [Stem Cell Research \u0026 Therapy](http://stemcellres.biomedcentral.com)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/scrt/default.aspx","title":"Stem Cell Research \u0026 Therapy","twitterHandle":"@BioMedCentral","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"human umbilical cord matrix-mesenchymal stem cells, gelatin viscosity, ROCK inhibitor, hepatic differentiation, mitochondria activation, lipid droplet, stem cell organelles","lastPublishedDoi":"10.21203/rs.3.rs-4326689/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4326689/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBackground\u003c/h2\u003e \u003cp\u003eHuman mesenchymal stem cells originating from umbilical cord matrix are a promising therapeutic resource, and their differentiated cells are spotlighted as a tissue regeneration treatment. However, there are limitations to the medical use of differentiated cells from human umbilical cord matrix-mesenchymal stem cells (hUCM-MSCs), such as efficient differentiation methods.\u003c/p\u003e\u003ch2\u003eMethods\u003c/h2\u003e \u003cp\u003eTo effectively differentiate hUCM-MSCs into hepatocyte-like cells (HLCs), we used the ROCK inhibitor, fasudil, which is known to induce endoderm formation, and gelatin, which provides extracellular matrix to the differentiated cells. To estimate a differentiation efficiency of early stage according to combination of gelatin and fasudil, transcription analysis was conducted. Moreover, to demonstrate that organelle states affect differentiation, we performed transcription, tomographic, and mitochondrial function analysis at each stage of hepatic differentiation. Finally, we evaluated hepatocyte function based on the expression of mRNA and protein, secretion of albumin, and activity of CYP3A4 in mature HLCs.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e \u003cp\u003eFasudil induced endoderm-related genes (\u003cem\u003eGATA4, SOX17\u003c/em\u003e, and \u003cem\u003eFOXA2\u003c/em\u003e) in hUCM-MSCs, and it also induced lipid droplets (LDs) inside the differentiated cells. However, the excessive induction of LDs caused by fasudil inhibited mitochondrial function and prevented differentiation into hepatoblasts. To prevent the excessive LDs formation, we used gelatin as a coating material. When hUCM-MSCs were induced into hepatoblasts with fasudil on high-viscosity (1%) gelatin-coated dishes, hepatoblast-related genes (\u003cem\u003eAFP\u003c/em\u003e and \u003cem\u003eHNF4A\u003c/em\u003e) showed significant upregulation on high-viscosity gelatin-coated dishes compared to those treated with low-viscosity (0.1%) gelatin. Moreover, other germline cell fates, such as ectoderm and mesoderm, were repressed under these conditions. In addition, LDs abundance was also reduced, whereas mitochondrial function was increased. On the other hand, unlike early stage of the differentiation, low viscosity gelatin was more effective in generating mature HLCs. In this condition, the accumulation of LDs was inhibited in the cells, and mitochondria were activated. Consequently, HLCs originated from hUCM-MSCs were genetically and functionally more matured in low-viscosity gelatin.\u003c/p\u003e\u003ch2\u003eConclusions\u003c/h2\u003e \u003cp\u003eThis study demonstrated an effective method for differentiating hUCM-MSCs into hepatic cells using fasudil and gelatin of varying viscosities. Moreover, we suggest that efficient hepatic differentiation and the function of hepatic cells differentiated from hUCM-MSCs depend not only on genetic changes but also on the regulation of organelle states.\u003c/p\u003e","manuscriptTitle":"ROCK inhibitor and viscosity of gelatin promote hepatic differentiation by regulating organelles in human umbilical cord matrix-mesenchymal stem cells","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-05-14 08:26:33","doi":"10.21203/rs.3.rs-4326689/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Major Revision","date":"2024-05-19T21:20:32+00:00","index":"","fulltext":""},{"type":"reviewerAgreed","content":"","date":"2024-05-07T18:25:06+00:00","index":0,"fulltext":""},{"type":"reviewersInvited","content":"","date":"2024-05-07T16:23:37+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-04-29T22:46:36+00:00","index":"","fulltext":""},{"type":"submitted","content":"Stem Cell Research \u0026 Therapy","date":"2024-04-29T01:45:45+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"stem-cell-research-and-therapy","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scrt","sideBox":"Learn more about [Stem Cell Research \u0026 Therapy](http://stemcellres.biomedcentral.com)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/scrt/default.aspx","title":"Stem Cell Research \u0026 Therapy","twitterHandle":"@BioMedCentral","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"05db34c5-6244-4612-b84e-5a8be30b5026","owner":[],"postedDate":"May 14th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2024-08-05T16:08:25+00:00","versionOfRecord":{"articleIdentity":"rs-4326689","link":"https://doi.org/10.1186/s13287-024-03851-9","journal":{"identity":"stem-cell-research-and-therapy","isVorOnly":false,"title":"Stem Cell Research \u0026 Therapy"},"publishedOn":"2024-07-29 15:57:11","publishedOnDateReadable":"July 29th, 2024"},"versionCreatedAt":"2024-05-14 08:26:33","video":"","vorDoi":"10.1186/s13287-024-03851-9","vorDoiUrl":"https://doi.org/10.1186/s13287-024-03851-9","workflowStages":[]},"version":"v1","identity":"rs-4326689","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4326689","identity":"rs-4326689","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.