Uncovering the pharmacological mechanisms of GuBenZhiKe decoction in treating chronic obstructive pulmonary disease by an integrative pharmacology strategy

Uncovering the pharmacological mechanisms of GuBenZhiKe decoction in treating chronic obstructive pulmonary disease by an integrative pharmacology strategy | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Uncovering the pharmacological mechanisms of GuBenZhiKe decoction in treating chronic obstructive pulmonary disease by an integrative pharmacology strategy Mingzhe Wang, Ying Liu, Yao Xiao, Miao Cheng, Lin Pan, Yueqi Wang, and 3 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-5271698/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract We aimed to study the mechanisms of GuBenZhiKe decoction (GBZKD) in treating Chronic obstructive pulmonary disease (COPD). Components of GBZKD were analyzed using liquid chromatography-mass spectrometry. ICR mice were exposed to cigarette smoke and administered lipopolysaccharide to establish a COPD model, followed by treatment with GBZKD. Lung function test, hematoxylin and eosin staining, electron microscopic observation, and immunohistochemistry assays were performed. The expressions of genes were examined using an antibody array, qRT-PCR and western blot. GBZKD reduced structural failure and inflammatory response in airways, terminal bronchioles, and alveoli of COPD mice. GBZKD suppressed the levels of α-SMA, MMP-9, TIMP-1, and MMP-9/TIMP-1 ratio in COPD mice. GBZKD suppressed the mRNA levels of JAK1 and STAT3 , and elevated SOCS3 mRNA expression. GBZKD treatment significantly suppressed the protein levels of p-JAK1 and p-STAT3, and significantly elevated the SOCS3 protein expression. GBZKD alleviated respiratory tract injury by regulating the JAK-STAT pathway. Guben Zhike decoction chronic obstructive pulmonary disease respiratory injury repair JAK-STAT signaling pathway integrative pharmacology strategy Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 1. Introduction Chronic Obstructive Pulmonary Disease (COPD) is a heterogeneous lung condition characterized by chronic respiratory symptoms (dyspnea, cough, sputum production, and/or exacerbations) due to abnormalities of the airways (bronchitis, bronchiolitis) and/or alveoli (emphysema) that cause persistent, often progressive, airflow obstruction[ 1 ]. The global incidence of COPD is 11.7%, and this level can be as high as 50% among long-term heavy smokers; COPD causes more than 3.2 million deaths worldwide every year[ 2 ]. Meanwhile, patients with COPD often have other systemic issues, including diabetes, cardiovascular disease, osteoporosis, and anxiety[ 3 ]. More maddeningly still, the incidence of COPD will continue to rise with the increase in air pollution, the number of smokers, and the aging population in the future[ 4 ], making COPD a major public health safety issue. Repeated epithelial injury-repair-remodeling circus in the respiratory tract is one of the main pathogenesis of COPD, which runs through the whole course of COPD[ 5 ]. Airway remodeling is characterized by narrowing the airway lumen, the formation of emphysema, and progressive or incomplete reversible airflow limitation. As an important step in the progression of COPD, airway remodeling is associated with repeated inflammatory stimulation caused by abnormal particles, such as cigarette smoke[ 6 ]. Thus, therapies targeting the injury repair process could effectively improve the repair and recovery of lung tissue in patients with COPD[ 7 ]. Extensive clinical evidence suggests that traditional Chinese medicine may prevent and control the occurrence and development of COPD by regulating respiratory lung injury based on the theory of holistic concepts and syndrome differentiation[ 8 ]. Our previous clinical study demonstrated that GuBenZhiKe decoction (GBZKD), and symptom scores in patients with COPD[ 9 ]. Additionally, our preliminary studies have shown that GBZKD treatment could downregulate the expression of sIgA[ 10 ], interleukin (IL)-17[ 11 ], neutrophil elastase[ 12 ]; and upregulated the expression of KGF and γδT lymphocytes in a mouse model of COPD, which indicates the crucial role in the regulation of respiratory inflammation injury repair and respiratory mucosal immune injury repair of GBZKD via JAK-STAT signaling[ 13 , 14 ]. In Chinese medicine theory, GBZDK could facilitate strengthening and maintaining healthy energy, clearing phlegm heat, removing stasis, restoring defensive effects of vital energy, and improving lung function, blood gas composition, This study aims to figure out the regulation effect and mechanism of GBZKD on injury repair in the respiratory tract of COPD by an integrative pharmacology strategy with in vivo experiments and multiple detection approaches. 2. Materials and methods 2.1 Drugs GBZKD was provided by the Pharmaceutical Section of China-Japan Friendship Hospital (Beijing, China). The ingredients of GBZKD are presented in Table 1 . In detail, Astragali Radix , Stemonae Radix , and Paeoniae Radix rubra were extracted with 70% ethanol twice; Epimedii Herba , Atractylodis Macrocephalae Rhizoma , Saposhnikoviae Radix , and Scutellariae Radix were extracted with distilled water twice. The extraction solution was subjected to combination, filtration, and concentration, resulting in a solution with a relative density of 1.1 (80°C). The sediment of the concentrated solution was filtered and washed with 70% ethanol. The precipitation supernatant and concentrated solution were combined, dealcoholized, re-concentrated into a solution at a relative density of 1.25 (70°C), and vacuum-dried to dry extracts containing 3.6 g of raw herbal pieces per milliliter. GBZKD extracts were formulated with distilled water to a concentration of 0.28 g of raw herbal pieces per milliliter according to the doses required for experimentation. Table 1 Composition of GBZKD. Botanical name Herbal name Chinese Name Ratio (%) Astragalus membranaceus (Fisch.) Bge. Var. mongholicus (Bge.) Hsiao Astragali Radix Huang Qi 22.2 Epimedium brevicornum Maxim. Epimedii Herba Yin Yang Huo 16.7 Stemona sessilifolia (Miq.) Miq. Stemonae Radix Bai Bu 16.7 Scutellaria baicalensis Georgi Scutellariae Radix Huang Qin 16.7 Atractylodes macrocephala Koidz. Atractylodis macrocephalae Rhizoma Bai Zhu 11.2 Paeonia lactiflora Pall. Paeoniae Radix rubra Chi Shao 11.0 Saposhnikovia divaricata (Turcz.) Schischk. Saposhnikoviae Radix Fang Feng 5.5 2.2 UHPLC-MS/MS analysis of GBZKD GBZKD extracts (10 mg) were dissolved in 500 µL of methanol-water (70:30, v/v) and centrifuged at 12,000 rpm for 20 min. GBZKD compounds were analyzed using a high-performance liquid chromatography (triple-time-of-flight mass spectrometry (MS) system (SCIEX, Foster City, CA, USA). Separation was achieved using an HSS T3 column (2.1×100 mm, 1.8 µm) (Waters, Milford, MA, USA) at 45°C and a flow rate of 0.20 mL/min. The mobile phase comprised 0.1% formic acid in water (A) and acetonitrile (B). The gradient system contained the following components: 0–1 min, 5% B; 1–3 min, 5–10% B; 3–5 min, 10–65% B; 5–21 min, 65–98% B; 21–21.1, min 98–5% B; and 21.1–24, 5% B. MS data was acquired at a range of 50–1200 m/z. The spray voltages of negative and positive modes were − 4500 V and 5500 V, respectively. The data were analyzed using PeakView software (AB SCIEX, Foster, CA, USA), MultiQuant software (AB SCIEX), and MarkerView software (AB SCIEX). 2.3 Animals A total of 66 female Institute of Cancer Research mice (6–8 weeks, 18–20 g) were obtained from Charles River Laboratories (Beijing, China) and housed under specific pathogen-free conditions in the Animal Center of China-Japan Friendship Hospital (Beijing, China). The study was approved by the Ethics Committee for Experimental Animal Welfare at China-Japan Friendship Hospital (No. Y200103). All mice were housed in groups of 5 per cage and were permitted free access to water and food under a 12-hour light cycle. 2.4 Design of mice experiments After 7 days of adaption, animals were allocated into three groups by a random number table: Control group (n = 22), COPD group (n = 22), and GBZKD group (n = 22). The mice in the GBZKD and COPD groups were exposed to cigarette smoke 10 cigarettes (12 mg tar, 0.9 mg nicotine, 14 mg carbon monoxide) twice a day with a 5 min smoke-free interval in a customized glass chamber (length/width/height: 80cm/70cm60cm) for 12 weeks. Additionally, the mice were injected intranasally with lipopolysaccharide (LPS, GBZKD, and COPD groups) or saline (Control group) on days 1, 29, and 57. From the eighth week of cigarette smoke exposure, mice were intragastrically administered with GBZKD solution (0.01 ml/g, GBZKD group) of stilled water (Control and COPD groups) for 4 weeks. The body weights of the mice in each group were monitored and recorded regularly. 2.5 Antibodies Antibodies against tumor necrosis factor-alpha (TNF-α, 17590-1-AP), granulocyte-macrophage colony-stimulating factor (GM-CSF, 17762-1-AP), matrix metalloprotein 9 (MMP-9, 10375-2-AP), alpha-smooth muscle actin (α-SMA, 23081-1-AP), glyceraldehyde-3-phosphate dehydrogenase (GAPDH, 0494-1-AP), and immunohistochemistry kits were purchased from Proteintech (Rosemont, IL, USA). Antibodies against interferon gamma (IFN-γ, ab216642), hypoxia-inducible factor-1 alpha (HIF-1α, ab8366), Janus kinase 1 (JAK1, ab133666), signal transducer, and activator of transcription 3 (STAT3, ab68153), phospho-STAT3 (p-STAT3, ab76315), collagen-1 (CLO1A1, ab21286), and suppressor of cytokine signaling 3 (SOCS3, ab16030) were purchased from Abcam (Cambridge, UK). Antibodies against tissue inhibitor of phospho-Janus kinase 1 (p-JAK1, bs-3238R) and metalloproteinases 1 (TIMP-1, bs-0415R) were purchased from Bioss Antibodies (Beijing, China). 2.6 Reagents and kits Pentobarbital sodium, LPS, ammonium hydroxide, and skimmed milk powder were purchased from Sigma-Aldrich (St. Louis, MO, USA). Daqianmen cigarettes were purchased from Shanghai Tobacco Co. Ltd (Shanghai, China). The DAB chromogen kit was purchased from ZSGB-BIO (Beijing, China). The hematoxylin solution was purchased from KeyGen Biotech (Nanjing, China). The H&E staining kit was purchased from Beyotime (Shanghai, China). Tris-ethylenediaminetetraacetic acid, 2.5% glutaraldehyde, 10% neutral formalin solution, phosphate buffer saline, xylene, hydrogen peroxide solution, goat serum, osmic acid, gradient ethanol, gradient acetone, and Meyer’s hematoxylin were provided by the Clinical Research Institute of China-Japan Friendship Hospital (Beijing, China). The cell lysis buffer was purchased from BioVision (San Francisco, CA). The BCA protein assay kit (No. 23227) and TRIZOL were purchased from Thermo Fisher Scientific (Waltham, MA, USA). The protease inhibitor cocktail was purchased from Roche Diagnostics (Abbott Park, IL). The GSM-INF-1 mouse antibody array kit was purchased from RayBiotech (Norcross, GA). DNase/RNase-free water and RIPA lysate (Strong) were purchased from Solarbio (Solarbio, Beijing, China). Hifair III 1st Strand cDNA Synthesis Kit (11139ES60) and Hieff UNICON power qPCR SYBR Green Master Mix (No Rox) were purchased from Yeason (Shanghai, China). Tris base (0497-500G), glycine (M103-1KG), sodium dodecyl sulfate (M107-250G), bromophenol blue (0449-100G), and ammonium persulfate (0486-100G) were purchased from Amresco (Solon, OH). Chloroform, isopropyl alcohol, methanol, and hydrochloric acid were purchased from Beijing Chemical Works (Beijing, China). The SDS-PAGE gel rapid preparation kit (PG-112) was purchased from Epizyme (Shanghai, China). The pre-stained protein marker (P1103) was purchased from Applygen (Beijing China). The nitrocellulose filter membrane (NC membrane) was purchased from Millipore (Billerica, MA, USA). The eECL (CW0049) Western Blot Kit was purchased from Cwbio (Beijing, China). 2.7 Instruments A flexiVent ventilator was obtained from Scireq (Montreal, QC, Canada). Ultra-low-temperature refrigerator, ultracentrifuge, microplate reader (Synogen4), spectrophotometer (NanoDrop One), and vacuum drier were obtained from Thermo Fisher Scientific (Waltham, MA, USA). Thermal Cycler (Veriti) and real-time fluorescence quantitative PCR system (Quantstudio 5) were obtained from Applied Biosystems (Foster, CA, USA). A decolorized shaker was obtained from the Beijing Institute of New Technology Applications (Beijing, China). A thermostat water bath was obtained from Rong-feng Scientific (Shanghai, China). A microwave oven was obtained from Whirlpool (Benton Harbor, MI). A transmission electron microscopy (JEM-1400) was obtained from JEOL (Mitakashi, Tokyo, Japan). An upright microscope was obtained from Olympus (BX-53, Tokyo, Japan). An InnoScan 300 Microarray Scanner was obtained from Innopsys (Parc d'Activités Activestre, Carbonne, France). An electrophoresis tank (DYCZ-24DN) and electrophoresis apparatus power supply (DYY-7C) were obtained from Beijing Liuyi Biological Technology (Beijing, China). A trans-Blot system (Mini-TRANS-BLOT CELL) was obtained from Bio-rad (Hercules, CA, USA). A chemiluminescence image analysis system (Tanon-4600) was obtained from Tanon (Shanghai, China). 2.8 Lung function detection The mice were anesthetized by an intraperitoneal injection of 1% pentobarbital sodium at 0.1 mL/10 g body weight. The endotracheal intubation tube was placed and fixed in the mouse trachea and connected to a Flexivent FX computer-controlled ventilator. Forced expiratory volume (FEV) at 0.05 s, 0.1 s, and 0.2 s and peak expiratory flow were measured and recorded according to the manufacturer’s protocols. 2.9 Histology staining analysis Lung tissue samples were fixed in 10% formalin for 72 h and then dehydrated, embedded in paraffin, sectioned, and stained with H&E according to standard operating procedures and observed under an optical microscope. Immunohistochemistry (IHC) was used to analyze TNF-α, GM-CSF, IFN-γ, HIF-1α, MMP-9, TIMP-1, α-SMA, and collagen-1 expression (n = 4 per group). Briefly, lung tissue paraffin sections were dewaxed, subjected to antigen retrieval, incubated in 0.3% hydrogen peroxide, and blocked with goat serum. Sections were incubated with primary antibodies using the following dilutions: 1:200 for MMP-9 and TIMP-1; 1:480 for collagen I; 1:800 for TNF-α, IFN-γ, and GM-CSF; 1:1000 for HIF-1α; and 1:2000 for α-SMA. Sections were incubated at 18–25℃ with primary antibodies against TNF-α, GM-CSF, IFN-γ, HIF-1α, MMP-9, TIMP-1, α-SMA, and collagen-1 for 2 h at room temperature. The sections were then incubated with the anti-mouse/rabbit universal immunohistochemistry test kit. A DAB test kit was used to produce the brown chromogenic reaction. IPP 6.0 software was used for identifying immunopositive areas. The left lung lobe was fixed in 2.5% glutaraldehyde at 4°C for 72 h and then soaked, dehydrated, infiltrated by pure resin, sectioned, and double-stained with uranium-lead according to standard staining methods, followed by observation under a transmission electron microscope. 2.10 Antibody array assay In total, 40 mouse inflammatory cytokines were measured in the control group (n = 5), COPD group (n = 5), and GBZKD group (n = 5) using a GSM-INF-1 mouse antibody array according to the manufacturer’s instructions. Briefly, the dried antibody chips were blocked with sample diluent, and the samples were added to the wells after decanting the buffer from each well. The wells were washed and incubated with a biotinylated antibody cocktail followed by Cy3 equivalent dye-conjugated streptavidin in a dark room to avoid exposure to light. InnoScan 300 Microarray Scanne was used for fluorescence detection. The GSM-INF-1 analysis software was used for data analysis. 2.11 Quantitative real-time PCR (qRT-PCR) qRT-PCR was used to measure JAK1 , Janus kinase 2 ( JAK2 ), Janus kinase 3 ( JAK3 ), signal transducer and activator of transcription 1 ( STAT1 ), STAT3 , and SOCS3 mRNA expression in the control, COPD, and GBZKD groups (n = 9 per group). Total RNA was extracted from lung tissues using Trizol after a one-step extraction protocol. cDNA was synthesized by reverse transcription. Gene expression was calculated using the 2 ΔΔCt method. The primers used in this study are provided in Table 2 , using GAPDH as an internal control gene. The experiments were performed in triplicate and repeated 3 times. Table 2 Primer sequences. Gene Sequence (5’-3’) JAK1 Forward AGTGCAGTATCTCTCCTCTCTG Reverse GATTCGGTTCGGAGCGTACC JAK2 Forward GGAATGGCCTGCCTTACAATG Reverse TGGCTCTATCTGCTTCACAGAAT JAK3 Forward CCTGCCTGTTTATCATTCGCT Reverse AAGACTTGAGTGTCCACGTCC STAT1 Forward CTCATTGTCACCGAAGAAC Reverse CTGCCAACTCAACACCTC STAT3 Forward GACCCGCCAACAAATTAAGA Reverse TCGTGGTAAACTGGACACCA SOCS3 Forward TGCGCCTCAAGACCTTCAG Reverse GCTCCAGTAGAATCCGCTCTC GAPDH Forward AGGTCGGTGTGAACGGATTTG Reverse GGGGTCGTTGATGGCAACA 2.12 Western blot Western blot was used to measure JAK1, p-JAK1, STAT3, p-STAT3, and SOCS3 protein expression in the control, COPD, and GBZKD groups (n = 4 per group). The total protein expression of each sample was quantified using a BCA protein assay kit. The proteins were separated by 10% SDS-PAGE, transferred to an NC membrane, and blocked with blocking buffer diluted with Tris-buffered saline and Tween. The membranes were incubated overnight at 4℃ with primary antibodies against GAPDH, phospho-JAK1, JAK1, phospho-STAT3, STAT-3, and SOCS3. The membranes were then washed and incubated with Horse Radish Peroxidase (HRP)-labeled sheep anti-rabbit secondary antibody or sheep anti-mice secondary antibody at a 1:5000 dilution. The ECL luminescent solution was used for imaging. Image J software (National Institutes of Health, Bethesda, MD, USA) was used to analyze the gray value of the target bands. 2.13 Statistical analysis SPSS22.0 software (IBM, Armonk, NY, USA) was authorized by Beijing University of Chinese Medicine and used for statistical analysis. Data are expressed as mean ± standard deviation. Comparisons among multiple groups were performed using a one-way analysis of variance. The least significant difference multi-range test was used when the variances were equal, whereas Dunnett's T3 postposition test was used when the variances were not equal. P value < 0.05 were considered statistically significant. 3. Results 3.1 GBZKD treatment improved lung function in COPD mice With COPD mice, we first detected the effect of GBZKD on lung function. The results showed that forced expiratory volume (FEV) 0.05, FEV 0.1, FEV 0.2, and peak expiratory flow (PEF) were significantly lower in the COPD group than in the control group (P<0.01). While, FEV 0.05, FEV 0.1, and FEV 0.2 were significantly higher in the GBZKD group than in the COPD group (P<0.05). However, no significant difference in PEF was observed between the GBZKD and COPD groups (Table 3 ). These analyses of lung function indicated that obstructive ventilation dysfunction was a major factor in generating COPD symptoms in mice, and GBZKD treatment improved lung function by relieving the dysfunction in airway obstructive ventilation. Table 3 Lung function parameters in the three groups. Group FEV 0.05 (mL) FEV 0.1 (mL) FEV 0.2 (mL) PEF (mL·s) Control 1.35 ± 0.12 1.60 ± 0.12 1.66 ± 0.13 47.25 ± 2.7 COPD 0.88 ± 0.09 ## 1.04 ± 0.14 ## 1.13 ± 0.20 ## 33.98 ± 6.92 ## GBZKD 1.08 ± 0.11 ∗∗ 1.30 ± 0.15 ∗∗ 1.35 ± 0.15 ∗ 39.01 ± 5.82 # Notes : FEV 0.05, forced expiratory volume in 0.05 s; FEV 0.1, forced expiratory volume in 0.1 s; FEV 0.2, forced expiratory volume in 0.2 s; PEF, peak expiratory flow. Data are expressed as means ± SD. N = 7. # P < 0.05, ## P < 0.01 versus the control group; ∗ P < 0.05, ∗∗ P < 0.01 versus the COPD group. 3.2 GBZKD treatment alleviated pathological lesions in COPD mice The characteristic pathological changes of COPD occur in the small airway, alveoli, and lung parenchyma predominantly. In our study, H&E staining results revealed evident destruction of alveolar structure, formation of pulmonary bullae, infiltration of inflammatory cells, destruction of airway mucosal epithelium, adhesion and shedding of airway cilia, and obstruction of the small airway in COPD mice. Pathological lesions, such as bronchial remodeling and increased collagen content, were also evident in COPD mice. While, compared to the COPD group, the GBZKD group exhibited significantly less airway obstruction and destruction, bronchial remodeling, alveolar destruction, and infiltration of inflammatory cells (Fig. 1 ). 3.3 GBZKD treatment reduced mitochondrial damage of type II epithelial cells in COPD mice Furthermore, the mice’s lung ultrastructure was observed by transmission electron microscopy. The results revealed multilayering of bronchial epithelial cells, formation of pulmonary bullae, and destruction of type II epithelial cells in COPD mice. While GBZKD treatment significantly reduced the number of bronchial epithelial cell layers and pulmonary bullae. Notably, GBZKD treatment significantly alleviated the vacuolization of lamellar bodies and the swelling and fracturing of mitochondria in type II epithelial cells (Fig. 2 ). Transmission electron microscopy observations revealed that GBZKD treatment significantly reduced the damage to lamellar bodies and mitochondria in alveolar type II (AT-II) epithelial cells in COPD mice. 3.4 Identification of GBZKD compounds We next detected the compounds of the GBZKD in solution forms by UHPLC-MS/MS analysis. The total ion chromatography (TIC) diagrams of positive ( Fig. 3 A ) and negative ( Fig. 3 B ) ion modes were shown respectively. In total, 41 major components of GBZKD were identified, and the detailed information for these compounds was shown in Table 4 . Among these GBZKD compounds, albiflorin (No. 6)[ 15 ], luteolin (No. 27)[ 16 ], glycyrrhizic acid (No. 28)[ 17 ], isoimperatorin (No.29)[ 18 ], baicalein (No. 30)[ 19 ], atractylenolide III (No. 34)[ 20 ], and dehydroandrographolide (No. 37)[ 21 ] are known to have anti-inflammatory effects. Moreover, neoandrographolide (No. 5) has been reported to inhibit the production of activated macrophages[ 22 ]. Thus, these results further supported that GBZKD has a powerful anti-inflammation function. Table 4 Chemical components of GBZKD identified using LC-MS. No. RT (min) Formula Adduct m/z Identification 1 1.2 C5H9NO2 +H 116.0706 Proline 2 1.25 C6H11NO2 +H 130.0863 Pipecolinic acid 3 1.38 C6H5NO2 +H 124.0393 Nicotinic acid 4 1.38 C6H6N2O +H 123.0553 Nicotinamide 5 7.23 C26H40O8 +H 481.2796 Neoandro grapholide 6 7.64 C21H20O13 +H 481.0977 Albiflorin 7 1.19 C7H12O6 -H 191.05611 Quinic acid 8 1.25 C6H11NO2 -H 128.0717 Pipecolinic acid 9 1.57 C7H6O5 -H 169.01425 Gallic acid 10 1.63 C27H22O18 -H 633.07335 Corilagin 11 6.85 C15H14O6 -H 289.07176 Catechin 12 6.9 C16H18O9 -H 353.08782 Cryptochlorogenic acid 13 7.1 C26H28O14 -H 563.14061 Schaftoside 14 7.23 C23H28O11.HCOOH -H 525.16136 Paeoniflorin 15 7.27 C29H36O15 -H 623.19817 Acteoside isomer 16 7.28 C22H22O10.HCOOH -H 491.11949 Calycosin-7-o-glucoside 17 7.43 C11H12N2O2 -H 203.0826 L-Tryptophan 18 7.44 C21H20O9 -H 415.10344 Puerarin 19 7.45 C39H50O20.HCOOH -H 883.28777 Epimedin A 20 7.45 C23H28O11 -H 479.15587 Albiflorin 21 7.47 C38H48O19.HCOOH -H 853.27721 Epimedin B 22 7.49 C31H40O15.HCOOH -H 697.23491 Cistanoside D 23 7.57 C31H40O15 -H 651.22942 Rehmannioside 24 7.58 C22H22O9.HCOOH -H 475.12459 Ononin 25 7.59 C33H40O15.HCOOH -H 721.23491 Icarrin 26 7.69 C23H28O10 -H 463.16097 Isomucronulatol-7-O-glucoside 27 7.95 C15H10O6 -H 285.04045 Luteolin 28 8.05 C42H62O16 -H 821.39653 Glycyrrhizic acid 29 8.23 C16H14O4 -H 269.08193 Isoimperatorin 30 8.32 C15H10O5 -H 269.04555 Baicalein 31 8.52 C16H12O4 -H 267.06627 Formononetin 32 9 C15H10O4 -H 253.05063 Chrysin 33 9.34 C18H16O7 -H 343.08232 Eupatilin 34 9.6 C15H20O3 -H 247.13397 Atractylenolide III 35 9.62 C30H44O7 -H 515.30144 Ganoderic acid A 36 10.3 C33H58O14.HCOOH -H 723.38085 Gingerglycolipid B 37 10.98 C20H28O4 -H 331.19148 Dehydroandrographolide 38 12.01 C20H24O4 -H 327.16017 Anwulignan 39 14.86 C30H46O4 -H 469.33232 16α-Hydroxydehydrotrametenolic acid 40 15.87 C30H48O3 -H 455.35308 Ursolic acid 41 17.08 C18H32O2 -H 279.23296 Linoleic acid 3.5 GBZKD treatment reduced lung inflammation in COPD mice To evaluate the inflammation status of mice lung tissues, we performed IHC staining for TNF-α, GM-CSF, IFN-γ, and HIF-1α on serial paraffin sections in each group. The results showed that the integrated optical density (IOD) values of TNF-α, GM-CSF, IFN-γ, and HIF-1α were significantly higher in the COPD group than in the control group (P < 0.05), suggesting the upregulation of inflammatory factors and severe inflammation status in COPD mice. While, the IOD values of TNF-α, GM-CSF, IFN-γ, and HIF-1α were significantly lower in the GBZKD group than in the COPD group (P < 0.05), suggesting that GBZKD treatment attenuated inflammatory lung injury in COPD mice (Fig. 4 ) . 3.6 GBZKD treatment reduced lung structural damage in COPD mice Primarily, MMP-9 and the TIMP-1 are major members of the protease and antiprotease families respectively to regulate the dynamic balance of proteases and antiproteases of the respiratory tract[ 23 ]. And during injury-repair-remodelling circus in lung tissue, the α-SMA is closely associated with airway remodeling, enabling strong contraction and collagen synthesis[ 24 ]. To evaluate the structural damage of mice lung tissues, we next performed IHC staining for MMP-9, TIMP-1, α-SMA, and collagen-1 on serial paraffin sections in each group. IOD values of MMP-9, TIMP-1, MMP-9/TIMP-1, and α-SMA were significantly higher in the COPD group than in the control group (P < 0.05), indicative of structural damage and airway remodeling in the lung tissue of COPD mice. While, MMP-9, TIMP-1, MMP-9/TIMP-1, and α-SMA values were significantly lower in the GBZKD group than in the COPD group (P < 0.05), suggesting that GBZKD treatment ameliorated structural damage in the lungs of COPD mice. No significant difference in collagen-1 values was observed between the GBZKD and COPD groups (Fig. 5 ). 3.7 GBZKD correlated to the regulation of the JAK-STAT pathway in COPD mice To explore which inflammation pathway correlated to the GBZKD treatment in COPD mice, the levels of multiple inflammatory cytokines were measured using an antibody array. As Fig. 6 showed, IL-1β, GM-CSF, TNF-α, IFN-γ, IL-6, IL-3, IL-17, and IL-12p70 levels were significantly higher in the COPD group than in the control group. And IL-1β, GM-CSF, TNF-α, IFN-γ, IL-6, IL-3, and TCA-3 levels were significantly lower in the GBZKD group than in the COPD group. It's very directional that, 5/8 of the differentially expressed cytokines between the control and COPD groups and 4/7 of the differentially expressed cytokines between the COPD and GBZKD groups were associated with the JAK-STAT signaling pathway. These results indicated that GBZKD correlated to the regulation of the JAK-STAT pathway in COPD mice. 3.8 GBZKD inhibited the JAK-STAT pathway in COPD mice To further determine the correlation between GBZKD and JAK-STAT pathway in COPD mice, we detected key genes expression of the JAK-STAT pathway in the mice’s lung tissues. RT-PCR results revealed that JAK1, JAK2, JAK3, STAT3 , and SOCS3 mRNA expression was significantly higher in the COPD group than in the control group. While, GBZKD treatment significantly suppressed JAK1 and STAT3 mRNA levels and significantly elevated SOCS3 mRNA levels in COPD mice ( Fig. 7 A ) . and the Western blot results revealed that GBZKD treatment significantly suppressed the protein levels of p-JAK1, p-STAT3, and significantly elevated the protein levels of SOCS3 ( Fig. 7 B ) . Collectively, these results identified the JAK-STAT signaling pathway as a key player in COPD pathogenesis and curative mechanisms of GBZKD. 4. Discussion A key underlying pathogenesis in the progression of COPD is inflammatory injury, which plays a key role in the destruction of epithelial cells, endothelial cells, and the proliferation of fibroblasts, which in turn results in the destruction of lung structure and airway remodeling [ 25 ]. The inflammatory injury in the respiratory tract could be caused by a variety of triggers like tobacco smoking, the inhalation of toxic particles, and gases from household and outdoor air pollution[ 26 ], and the mechanisms and targeted therapy for this amplified inflammation are not yet fully understood. In this study, we first detected the treatment effect of GBZKD in COPD and further focused on whether GBZKD could reduce lung inflammation and damage to alleviate the process of COPD and explored the key targets and pathways. Previous studies have evidenced that the abnormal activation of the JAK-STAT pathway plays an important role in COPD[ 27 ]. Using antibody array assay and genes expression examination, we not only confirmed the activation of the JAK-STAT pathway in COPD but also obtained targets that GBZKD could regulate including JAK1, STAT3, SOCS3, IL-1β, GM-CSF, TNF-α, IFN-γ, IL-6, IL-3, and TCA-3. Among these targets, JAK1 and STAT3 are two key molecules to run the whole pathway[ 28 ], and GBZKD showed a double function to downregulate their mRNA expression and protein phosphorylation levels. Other targets, as downstream genes of the JAK-STAT pathway, are not only regulated by this pathway but also engage in feedback regulation of the JAK-STAT pathway. However, whether GBZKD had a direct regulatory effect on these other targets, or just regulated their expression by the JAK1-STAT3 axis, needs further study. Based on the identification assay of GBZKD ingredients, we identified several components of GBZKD that may exert protective effects in lung injury via various mechanisms, especially the JAK-STAT pathway. In terms of regulating respiratory inflammatory repair, nicotinamide downregulates the expression of IL-8[ 29 ], neo-andrographolide reduces PGE2 generated by LPS-stimulated macrophages[ 22 ], and icariin attenuates acute lung inflammation by inhibiting the expression of TNF-α, IL-6 , Cyclooxygenase-2, and nitric oxide synthase ( iNOS) mRNA in the lung tissue of LPS-treated mice[ 30 ]. Further, ursolic acid reduces the expression of TNF-α, IL-1β, IL-6, toll-like receptor 4 (TLR4), My D88, and p-p65 in COPD rats[ 31 ]. Concerning anti-oxidative effects, crocetin significantly increases the activity of antioxidant enzymes such as superoxide dismutase and glutathione peroxidase in rat serum and inhibits IL-6, TNF-α, iNOS , and MCP-1 mRNA expression in LPS-stimulated macrophages[ 32 ]. Moreover, luteolin inhibits the expression of IL-1β, IL-4, IL-5, IL-6, IL-8, IL-10, IL-13, TNF-α, IFN-β, and GM-CSF and luteolin reduces nitric oxide (NO) production by inhibiting reactive oxygen species (ROS) production and reducing the synthesis of iNOS[ 16 ]. Considering GBZKD as a formula that contains lots of ingredients, in-depth pharmacological mechanistic studies of GBZKD in COPD are needed in the future. At last, in addition to histological level studies, at the cell level, we found that GBZKD had a significant influence on AT-II cells. AT-II cells act as stem cells in the process of lung epithelial renewal and tissue injury repair by repairing damaged alveolar epithelial cells and promoting the synthesis of alveolar surfactants[ 33 ]. AT-II cells play a crucial role in mediating inflammatory responses in the lung tissue[ 34 ]. In response to inflammatory stimulation in the lung tissue, AT-II cells secrete various chemokines, promote neutrophil aggregation, and release several inflammatory factors including IL-6 and TNF-α, further resulting in an augmented inflammatory response, and activation of the JAK-STAT signaling pathway[ 35 ]. Hence, AT-II cells might be an important target for GBZKD in treating COPD. 5. Limitation This study has some limitations. First of all, there was an absence of proper medicine control to compare the effect of GBZKD on COPD, such as a well-studied TCM. Next, the GBZKD ingredients we obtained here were not conducted in a thorough and detailed study, which needs more research in future studies. Thirdly, the JAK-STAT pathway inhibition experiments were missing, which made the study less convincing. 6. Conclusion This study demonstrated that GBZKD treatment improved lung function and pathological conditions in COPD mice, highlighting its therapeutic potential as a treatment method for COPD. Mechanically, these findings suggest that GBZKD significantly alleviates lung inflammatory injury by reducing the overexpression of inflammatory factors related to JAK-STAT signaling in the lung tissue, thereby attenuating airway remodeling in COPD mice. Furthermore, our findings provide insight into the mechanisms of action of GBZKD and serve as a foundation for further basic and clinical research on GBZKD. Abbreviations Chronic obstructive pulmonary disease (COPD); GuBenZhiKe decoction (GBZKD); Traditional Chinese medicine (TCM); lipopolysaccharide (LPS); alpha smooth muscle actin (α-SMA); matrix metalloprotein 9 (MMP-9); metalloproteinases 1 (TIMP-1); Janus kinase 1 (JAK1); ignal transducer and activator of transcription 1 (STAT1); suppressor of cytokine signaling 3 (SOCS3); tumor necrosis factor-alpha (TNF-α); granulocyte-macrophage colony-stimulating factor (GM-CSF); reverse transcription polymerase chain reaction (RT-PCR); phospho-JAK1 (p-JAK1); phospho-STAT3 (p-STAT3); interleukin (IL); mass spectrometry (MS); Immunohistochemistry (IHC); Forced expiratory volume (FEV); Quantitative real-time PCR (qRT-PCR) ; Horse Radish Peroxidase (HRP); peak expiratory flow (PEF); alveolar type II (AT-II); total ion chromatography (TIC); integrated optical density (IOD); nitric oxide synthase (iNOS); toll-like receptor 4 (TLR4); reactive oxygen species (ROS); nitric oxide (NO); Hematoxylin-Eosin (HE). Declarations Funding Statement This study was supported by the National Natural Science Foundation of China (82074367) and Chinese Medicine Inheritance and Innovation “One Hundred Million” Talent Project Qihuang Scholar (to Zhang Hongchun) (2019-QTL-003). Disclosure statement All authors have read the policy on disclosure of potential conflicts of interest outlined by the Annals of Medicine. Conflict of Interest The authors declare that there are no conflicts of interest. Data availability All the relevant data is provided within the paper and its supporting information files. The datasets analyzed during the current study are available from the corresponding author upon reasonable request. This work described was original research that has not been published previously and is not under consideration for publication elsewhere, in whole or in part. Author contributions MW: Data curation, visualization, formal analysis, methodology, and writing the original draft. YX and YL: Data curation, formal analysis, and visualization. MC and LP: Methodology. ML and YW: Data curation, methodology, and software. ZC: Project administration and supervision. HZ: Conceptualization, project administration, supervision, and funding acquisition. All authors contributed to the article and approved the submitted manuscript. References Celli B, et al. Definition and Nomenclature of Chronic Obstructive Pulmonary Disease: Time for Its Revision. Am J Respir Crit Care Med. 2022;206(11):1317–25. Global regional. national age-sex-specific mortality for 282 causes of death in 195 countries and territories, 1980–2017: a systematic analysis for the Global Burden of Disease Study 2017. Lancet. 2018;392(10159):1736–88. Christenson SA, et al. Chronic obstructive pulmonary disease. Lancet. 2022;399(10342):2227–42. Mathers CD, Loncar D. Projections of global mortality and burden of disease from 2002 to 2030. PLoS Med. 2006;3(11):e442. Hogg JC, Timens W. The pathology of chronic obstructive pulmonary disease. Annu Rev Pathol. 2009;4:435–59. Higham A et al. Relationships between Airway Remodeling and Clinical Characteristics in COPD Patients. Biomedicines, 2022. 10(8). Sergio L, et al. Chronic Obstructive Pulmonary Disease: From Injury to Genomic Stability. Copd. 2017;14(4):439–50. Vogelmeier CF, et al. Goals of COPD treatment: Focus on symptoms and exacerbations. Respir Med. 2020;166:105938. Cao X, et al. Advances in traditional Chinese medicine for the treatment of chronic obstructive pulmonary disease. J Ethnopharmacol. 2023;307:116229. Hong-Chun Z, En-Xiang C. Clinical study on Tiaobufeishen capsule in the treatment of stable COPD [J]. J Beijing Univ Traditional Chin Med. 2003;26(2):53–6. (In Chinese). Xue L, Zhe C, Qing-Sheng YU, et al. Effect of Gubenzhike recipe on pulmonary function and sIgA in respiratory tract of COPD mice[J]. China J Traditional Chin Med Pharm. 2012;27(12):3064–7. (In Chinese). Ying L, Yue J, Li-Li G, et al. Effects of Gubenzhike recipe on gamma delta-T cell and IL-17 in lung of COPD mice[J]. China J Traditional Chin Med Pharm. 2014;29(12):3981–4. (In Chinese). Xue L, Zhe C, Yue J, et al. Effects of Gubenzhike Recipe on expression of neutrophil elastase in the lung tissue of COPD mice[J]. China J Traditional Chin Med Pharm. 2015;30(07):2512–4. (In Chinese). Wang M, et al. Proteomic analysis of a chronic obstructive pulmonary disease mouse model to determine the efficacy of treatment using Guben Zhike decoction. J Traditional Chin Med Sci. 2021;8(1):34–42. Wang YQ et al. Gubenzhike Recipe Ameliorates Respiratory Mucosal Immunity in Mice with Chronic Obstructive Pulmonary Disease through Upregulation of the γδT Lymphocytes and KGF Levels. Evid Based Complement Alternat Med, 2020. 2020: p. 3056797. Chen G, et al. Upregulation of matrix metalloproteinase 9 (MMP9)/tissue inhibitor of metalloproteinase 1 (TIMP1) and MMP2/TIMP2 ratios may be involved in lipopolysaccharide-induced acute lung injury. J Int Med Res. 2020;48(4):300060520919592. Zou W, et al. PM2.5 Induces Airway Remodeling in Chronic Obstructive Pulmonary Diseases via the Wnt5a/β-Catenin Pathway. Int J Chron Obstruct Pulmon Dis. 2021;16:3285–95. L Z. W.W.J. Pharmacology, and therapeutics, Anti-inflammatory and immunoregulatory effects of paeoniflorin and total glucosides of paeony. 2020. 207: p. 107452. Gendrisch F, et al. Luteolin as a modulator of skin aging and inflammation. BioFactors. 2021;47(2):170–80. Ming LJ, Yin AC. Therapeutic effects of glycyrrhizic acid. Nat Prod Commun. 2013;8(3):415–8. Fan L, et al. Isoimperatorin alleviates lipopolysaccharide-induced periodontitis by downregulating ERK1/2 and NF-κB pathways. Open Life Sci. 2023;18(1):20220541. 17, Wang X et al. Baicalein alleviates pyroptosis and inflammation in hyperlipidemic pancreatitis by inhibiting NLRP3/Caspase-1 pathway through the miR-192-5p/TXNIP axis. Int Immunopharmacol, 2021. 101(Pt B): p. 108315. Deng M, et al. Atractylenolides (I, II, and III): a review of their pharmacology and pharmacokinetics. Arch Pharm Res. 2021;44(7):633–54. Weng Z, et al. Anti-Inflammatory Activity of Dehydroandrographolide by TLR4/NF-κB Signaling Pathway Inhibition in Bile Duct-Ligated Mice. Cell Physiol Biochem. 2018;49(3):1083–96. Liu J, et al. Inhibitory effects of neoandrographolide on nitric oxide and prostaglandin E2 production in LPS-stimulated murine macrophage. Mol Cell Biochem. 2007;298(1–2):49–57. Pettersen CA, Adler KB. Airways inflammation and COPD: epithelial-neutrophil interactions. Chest. 2002;121(5 Suppl):s142–50. Bacharier LB, Mori A, Kita H. Advances in asthma, asthma-COPD overlap, and related biologics in 2018. J Allergy Clin Immunol. 2019;144(4):906–19. Yang IA, Jenkins CR, Salvi SS. Chronic obstructive pulmonary disease in never-smokers: risk factors, pathogenesis, and implications for prevention and treatment. Lancet Respir Med. 2022;10(5):497–511. Yew-Booth L, et al. JAK-STAT pathway activation in COPD. Eur Respir J. 2015;46(3):843–5. Purohit M, et al. Janus kinase/signal transducers and activator of transcription (JAK/STAT) and its role in Lung inflammatory disease. Chem Biol Interact. 2023;371:110334. Zhao K, et al. Cigarette smoke-induced lung inflammation in COPD mediated via CCR1/JAK/STAT /NF-κB pathway. Aging. 2020;12(10):9125–38. Hu X, et al. The JAK/STAT signaling pathway: from bench to clinic. Signal Transduct Target Ther. 2021;6(1):402. Grange PA, et al. Nicotinamide inhibits Propionibacterium acnes-induced IL-8 production in keratinocytes through the NF-kappaB and MAPK pathways. J Dermatol Sci. 2009;56(2):106–12. Xu CQ, et al. Icariin attenuates LPS-induced acute inflammatory responses: involvement of PI3K/Akt and NF-kappaB signaling pathway. Eur J Pharmacol. 2010;642(1–3):146–53. Li C, et al. Preventive effect of ursolic acid derivative on particulate matter 2.5-induced chronic obstructive pulmonary disease involves suppression of lung inflammation. IUBMB Life. 2020;72(4):632–40. Guo ZL et al. Crocetin: A Systematic Review. Front Pharmacol, 2021. 12: p. 745683. Desai TJ, Brownfield DG, Krasnow MA. Alveolar progenitor and stem cells in lung development, renewal and cancer. Nature. 2014;507(7491):190–4. Imielinski M, Guo G, Meyerson M. Insertions and Deletions Target Lineage-Defining Genes in Human Cancers. Cell. 2017;168(3):460–e47214. Sutherland KD, Berns A. Cell of origin of lung cancer. Mol Oncol. 2010;4(5):397–403. McRitchie DI, et al. Production of tumour necrosis factor alpha by primary cultured rat alveolar epithelial cells. Cytokine. 2000;12(6):644–54. Sharma AK, et al. Proinflammatory response of alveolar epithelial cells is enhanced by alveolar macrophage-produced TNF-alpha during pulmonary ischemia-reperfusion injury. Am J Physiol Lung Cell Mol Physiol. 2007;293(1):L105–13. Wissel H, et al. Chlamydophila pneumoniae induces expression of toll-like receptor 4 and release of TNF-alpha and MIP-2 via an NF-kappaB pathway in rat type II pneumocytes. Respir Res. 2005;6(1):51. Additional Declarations No competing interests reported. Supplementary Files Supplementarytables.xlsx Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-5271698","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":370052383,"identity":"43c98017-32f3-43ae-8a01-b546cadbd321","order_by":0,"name":"Mingzhe Wang","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAuklEQVRIiWNgGAWjYJCCw38qauTY2JsPEK2D8QHPmWPGfDzHEojWwmzA28acOE8iR4E49QbXjj+TkGBjS29jyGFg+FGxjQgttxPSJAx4ZHLbGM4eYOw5c5uwFrPbCcckEiTYctsY+xKYGduI0pLYJnHAgDmdjZnHgFgtycyGDQnMCWxsxGqxv53G+JjhwDHDNh62hINE+UVydvqDw4z/auTl5z8++OBHBRFaUMABEtWPglEwCkbBKMAFANrAOk8Nz0x4AAAAAElFTkSuQmCC","orcid":"","institution":"Beijing University of Chinese Medicine","correspondingAuthor":true,"prefix":"","firstName":"Mingzhe","middleName":"","lastName":"Wang","suffix":""},{"id":370052386,"identity":"95df3c55-adff-437c-b691-0e6b1dde63a5","order_by":1,"name":"Ying Liu","email":"","orcid":"","institution":"China-Japan Friendship Hospital","correspondingAuthor":false,"prefix":"","firstName":"Ying","middleName":"","lastName":"Liu","suffix":""},{"id":370052389,"identity":"2f00d839-00c8-4c64-9df1-d9f3488b63e7","order_by":2,"name":"Yao Xiao","email":"","orcid":"","institution":"Beijing University of Chinese Medicine Third Affiliated Hospital","correspondingAuthor":false,"prefix":"","firstName":"Yao","middleName":"","lastName":"Xiao","suffix":""},{"id":370052390,"identity":"36ed9a82-0d94-443a-ad56-3ed864afa3ed","order_by":3,"name":"Miao Cheng","email":"","orcid":"","institution":"Beijing University of Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Miao","middleName":"","lastName":"Cheng","suffix":""},{"id":370052391,"identity":"87d00001-50c0-48af-9fa9-a9b4e52eb789","order_by":4,"name":"Lin Pan","email":"","orcid":"","institution":"China-Japan Friendship Hospital","correspondingAuthor":false,"prefix":"","firstName":"Lin","middleName":"","lastName":"Pan","suffix":""},{"id":370052392,"identity":"c0b65084-8127-42cf-8a58-a1fc22487836","order_by":5,"name":"Yueqi Wang","email":"","orcid":"","institution":"China-Japan Friendship Hospital","correspondingAuthor":false,"prefix":"","firstName":"Yueqi","middleName":"","lastName":"Wang","suffix":""},{"id":370052393,"identity":"5863d876-8648-4ba7-8842-8ae8429bb7c4","order_by":6,"name":"Mengchao Liu","email":"","orcid":"","institution":"Capital Medical University","correspondingAuthor":false,"prefix":"","firstName":"Mengchao","middleName":"","lastName":"Liu","suffix":""},{"id":370052394,"identity":"d399a6d6-90c0-49a4-87f7-a8f6e48968ab","order_by":7,"name":"Zhe Cai","email":"","orcid":"","institution":"China-Japan Friendship Hospital","correspondingAuthor":false,"prefix":"","firstName":"Zhe","middleName":"","lastName":"Cai","suffix":""},{"id":370052395,"identity":"82eb0316-53e3-425e-86e0-d68e4fc698be","order_by":8,"name":"Hongchun Zhang","email":"","orcid":"","institution":"China-Japan Friendship Hospital","correspondingAuthor":false,"prefix":"","firstName":"Hongchun","middleName":"","lastName":"Zhang","suffix":""}],"badges":[],"createdAt":"2024-10-16 01:08:14","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-5271698/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-5271698/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":68210114,"identity":"9399bb56-71f4-4663-9a1d-e67ac72a57ee","added_by":"auto","created_at":"2024-11-04 17:15:18","extension":"jpeg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":1238670,"visible":true,"origin":"","legend":"\u003cp\u003eH\u0026amp;E staining of paraffin lung sections in each group. (A and C) indicate the pathological conditions of the airway at magnifications of 200× and 400×, respectively. (B and D) indicate the pathological conditions of pulmonary alveoli at magnifications of 200× and 400×, respectively.\u003c/p\u003e","description":"","filename":"floatimage1.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-5271698/v1/ee0800ae7abd41ec2d6e5d09.jpeg"},{"id":68210348,"identity":"63c72943-7cfc-4136-ac86-40433428f7b0","added_by":"auto","created_at":"2024-11-04 17:23:18","extension":"jpeg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":698182,"visible":true,"origin":"","legend":"\u003cp\u003eUltrastructure of the lung tissues in each group. (A‒C) indicate the ultrastructure of the lung tissues at magnifications of 1500×, 3000×, and 12,000×, respectively.\u003c/p\u003e","description":"","filename":"floatimage2.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-5271698/v1/698592909ca39977815d41ec.jpeg"},{"id":68210115,"identity":"7e98f4ae-61fc-4c55-ae03-e94a5de6384f","added_by":"auto","created_at":"2024-11-04 17:15:18","extension":"jpeg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":961943,"visible":true,"origin":"","legend":"\u003cp\u003eIon chromatograms of GBZKD were analyzed using LC-MS. The letters A and B indicate spectra of positive and negative ion modes, respectively.\u003c/p\u003e","description":"","filename":"floatimage3.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-5271698/v1/a6546974be6540d09ce2169b.jpeg"},{"id":68210113,"identity":"cccad387-b6b0-4980-8f5d-7dcb6e88c760","added_by":"auto","created_at":"2024-11-04 17:15:18","extension":"jpeg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":1144524,"visible":true,"origin":"","legend":"\u003cp\u003eIHC staining of paraffinized lung sections from each group for (A) TNF-α, (B) GM-CSF, (C) IFN-γ, and (D) HIF-1α, at a magnification of 200×. (E) IOD values of TNF-α, GM-CSF, IFN-γ, and HIF-1α in each group. *, P \u0026lt; 0.05; **, P \u0026lt; 0.01.\u003c/p\u003e","description":"","filename":"floatimage4.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-5271698/v1/9eba2a648d1bf23c0fc2ffb7.jpeg"},{"id":68210347,"identity":"6423f40f-c2fa-4125-9e60-8f998b48a1aa","added_by":"auto","created_at":"2024-11-04 17:23:18","extension":"jpeg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":966576,"visible":true,"origin":"","legend":"\u003cp\u003eIHC staining of paraffinized lung sections from each group for (A) MMP-9, (B) TIMP-1, (C) α-SMA, and (D) collagen-1. Magnification: 400× for MMP-9 and TIMP-1; 200× for α-SMA and collagen-1. *, P \u0026lt; 0.05; **, P \u0026lt; 0.01.\u003c/p\u003e","description":"","filename":"floatimage5.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-5271698/v1/06bb795d9b5e05f5ec3e4e14.jpeg"},{"id":68210120,"identity":"f7d0eb6a-1724-48f4-af05-0884c5870602","added_by":"auto","created_at":"2024-11-04 17:15:18","extension":"jpeg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":540403,"visible":true,"origin":"","legend":"\u003cp\u003eAntibody array assay of lung tissue in each group. (A-C) scanning photo, (D) antibody array map, and (E) gray-scale value in each group. *, P \u0026lt; 0.05; **, P \u0026lt; 0.01.\u003c/p\u003e","description":"","filename":"floatimage6.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-5271698/v1/49a62bd4f9dc63df17aee4e8.jpeg"},{"id":68210121,"identity":"0be70458-814a-4570-82ad-0b965e8abaed","added_by":"auto","created_at":"2024-11-04 17:15:18","extension":"jpeg","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":422895,"visible":true,"origin":"","legend":"\u003cp\u003eRT-PCR (A) and western blot (B) assay of lung tissue in each group. P \u0026lt; 0.05, P \u0026lt; 0.01.\u003c/p\u003e","description":"","filename":"floatimage7.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-5271698/v1/0dcdde100e77b7bd1e3fda64.jpeg"},{"id":79453737,"identity":"506a3f6f-b00e-4475-be30-64d3903ebe0c","added_by":"auto","created_at":"2025-03-28 15:23:58","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":7154693,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-5271698/v1/c508b7b6-e85f-4b65-9669-fc4fba2931d5.pdf"},{"id":68210346,"identity":"a7684711-cace-4a72-bf28-0cfbd11b70c0","added_by":"auto","created_at":"2024-11-04 17:23:18","extension":"xlsx","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":15392,"visible":true,"origin":"","legend":"","description":"","filename":"Supplementarytables.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-5271698/v1/af3c7da5a824a5d4c7a0942d.xlsx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Uncovering the pharmacological mechanisms of GuBenZhiKe decoction in treating chronic obstructive pulmonary disease by an integrative pharmacology strategy","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eChronic Obstructive Pulmonary Disease (COPD) is a heterogeneous lung condition characterized by chronic respiratory symptoms (dyspnea, cough, sputum production, and/or exacerbations) due to abnormalities of the airways (bronchitis, bronchiolitis) and/or alveoli (emphysema) that cause persistent, often progressive, airflow obstruction[\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. The global incidence of COPD is 11.7%, and this level can be as high as 50% among long-term heavy smokers; COPD causes more than 3.2\u0026nbsp;million deaths worldwide every year[\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. Meanwhile, patients with COPD often have other systemic issues, including diabetes, cardiovascular disease, osteoporosis, and anxiety[\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. More maddeningly still, the incidence of COPD will continue to rise with the increase in air pollution, the number of smokers, and the aging population in the future[\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e], making COPD a major public health safety issue.\u003c/p\u003e \u003cp\u003eRepeated epithelial injury-repair-remodeling circus in the respiratory tract is one of the main pathogenesis of COPD, which runs through the whole course of COPD[\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. Airway remodeling is characterized by narrowing the airway lumen, the formation of emphysema, and progressive or incomplete reversible airflow limitation. As an important step in the progression of COPD, airway remodeling is associated with repeated inflammatory stimulation caused by abnormal particles, such as cigarette smoke[\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. Thus, therapies targeting the injury repair process could effectively improve the repair and recovery of lung tissue in patients with COPD[\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eExtensive clinical evidence suggests that traditional Chinese medicine may prevent and control the occurrence and development of COPD by regulating respiratory lung injury based on the theory of holistic concepts and syndrome differentiation[\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. Our previous clinical study demonstrated that GuBenZhiKe decoction (GBZKD), and symptom scores in patients with COPD[\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. Additionally, our preliminary studies have shown that GBZKD treatment could downregulate the expression of sIgA[\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e], interleukin (IL)-17[\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e], neutrophil elastase[\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]; and upregulated the expression of KGF and γδT lymphocytes in a mouse model of COPD, which indicates the crucial role in the regulation of respiratory inflammation injury repair and respiratory mucosal immune injury repair of GBZKD via JAK-STAT signaling[\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. In Chinese medicine theory, GBZDK could facilitate strengthening and maintaining healthy energy, clearing phlegm heat, removing stasis, restoring defensive effects of vital energy, and improving lung function, blood gas composition,\u003c/p\u003e \u003cp\u003eThis study aims to figure out the regulation effect and mechanism of GBZKD on injury repair in the respiratory tract of COPD by an integrative pharmacology strategy with \u003cem\u003ein vivo\u003c/em\u003e experiments and multiple detection approaches.\u003c/p\u003e"},{"header":"2. Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e2.1 Drugs\u003c/h2\u003e \u003cp\u003eGBZKD was provided by the Pharmaceutical Section of China-Japan Friendship Hospital (Beijing, China). The ingredients of GBZKD are presented in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. In detail, \u003cem\u003eAstragali Radix\u003c/em\u003e, \u003cem\u003eStemonae Radix\u003c/em\u003e, and \u003cem\u003ePaeoniae Radix rubra\u003c/em\u003e were extracted with 70% ethanol twice; \u003cem\u003eEpimedii Herba\u003c/em\u003e, \u003cem\u003eAtractylodis Macrocephalae Rhizoma\u003c/em\u003e, \u003cem\u003eSaposhnikoviae Radix\u003c/em\u003e, and \u003cem\u003eScutellariae Radix\u003c/em\u003e were extracted with distilled water twice. The extraction solution was subjected to combination, filtration, and concentration, resulting in a solution with a relative density of 1.1 (80\u0026deg;C). The sediment of the concentrated solution was filtered and washed with 70% ethanol. The precipitation supernatant and concentrated solution were combined, dealcoholized, re-concentrated into a solution at a relative density of 1.25 (70\u0026deg;C), and vacuum-dried to dry extracts containing 3.6 g of raw herbal pieces per milliliter. GBZKD extracts were formulated with distilled water to a concentration of 0.28 g of raw herbal pieces per milliliter according to the doses required for experimentation.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eComposition of GBZKD.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBotanical name\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eHerbal name\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eChinese Name\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eRatio (%)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eAstragalus membranaceus\u003c/em\u003e (Fisch.) Bge. Var. \u003cem\u003emongholicus\u003c/em\u003e (Bge.) Hsiao\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eAstragali Radix\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eHuang Qi\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e22.2\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eEpimedium brevicornum\u003c/em\u003e Maxim.\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eEpimedii Herba\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eYin Yang Huo\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e16.7\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eStemona sessilifolia\u003c/em\u003e (Miq.) Miq.\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eStemonae Radix\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eBai Bu\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e16.7\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eScutellaria baicalensis\u003c/em\u003e\u003c/p\u003e \u003cp\u003eGeorgi\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eScutellariae Radix\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eHuang Qin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e16.7\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eAtractylodes macrocephala\u003c/em\u003e Koidz.\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eAtractylodis macrocephalae Rhizoma\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eBai Zhu\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e11.2\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003ePaeonia lactiflora\u003c/em\u003e Pall.\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003ePaeoniae Radix rubra\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eChi Shao\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e11.0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eSaposhnikovia divaricata\u003c/em\u003e (Turcz.) Schischk.\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eSaposhnikoviae Radix\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eFang Feng\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e5.5\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003e2.2 UHPLC-MS/MS analysis of GBZKD\u003c/h2\u003e \u003cp\u003eGBZKD extracts (10 mg) were dissolved in 500 \u0026micro;L of methanol-water (70:30, v/v) and centrifuged at 12,000 rpm for 20 min. GBZKD compounds were analyzed using a high-performance liquid chromatography (triple-time-of-flight mass spectrometry (MS) system (SCIEX, Foster City, CA, USA). Separation was achieved using an HSS T3 column (2.1\u0026times;100 mm, 1.8 \u0026micro;m) (Waters, Milford, MA, USA) at 45\u0026deg;C and a flow rate of 0.20 mL/min. The mobile phase comprised 0.1% formic acid in water (A) and acetonitrile (B). The gradient system contained the following components: 0\u0026ndash;1 min, 5% B; 1\u0026ndash;3 min, 5\u0026ndash;10% B; 3\u0026ndash;5 min, 10\u0026ndash;65% B; 5\u0026ndash;21 min, 65\u0026ndash;98% B; 21\u0026ndash;21.1, min 98\u0026ndash;5% B; and 21.1\u0026ndash;24, 5% B. MS data was acquired at a range of 50\u0026ndash;1200 m/z. The spray voltages of negative and positive modes were \u0026minus;\u0026thinsp;4500 V and 5500 V, respectively. The data were analyzed using PeakView software (AB SCIEX, Foster, CA, USA), MultiQuant software (AB SCIEX), and MarkerView software (AB SCIEX).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003e2.3 Animals\u003c/h2\u003e \u003cp\u003eA total of 66 female Institute of Cancer Research mice (6\u0026ndash;8 weeks, 18\u0026ndash;20 g) were obtained from Charles River Laboratories (Beijing, China) and housed under specific pathogen-free conditions in the Animal Center of China-Japan Friendship Hospital (Beijing, China). The study was approved by the Ethics Committee for Experimental Animal Welfare at China-Japan Friendship Hospital (No. Y200103). All mice were housed in groups of 5 per cage and were permitted free access to water and food under a 12-hour light cycle.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003e2.4 Design of mice experiments\u003c/h2\u003e \u003cp\u003eAfter 7 days of adaption, animals were allocated into three groups by a random number table: Control group (n\u0026thinsp;=\u0026thinsp;22), COPD group (n\u0026thinsp;=\u0026thinsp;22), and GBZKD group (n\u0026thinsp;=\u0026thinsp;22). The mice in the GBZKD and COPD groups were exposed to cigarette smoke 10 cigarettes (12 mg tar, 0.9 mg nicotine, 14 mg carbon monoxide) twice a day with a 5 min smoke-free interval in a customized glass chamber (length/width/height: 80cm/70cm60cm) for 12 weeks. Additionally, the mice were injected intranasally with lipopolysaccharide (LPS, GBZKD, and COPD groups) or saline (Control group) on days 1, 29, and 57. From the eighth week of cigarette smoke exposure, mice were intragastrically administered with GBZKD solution (0.01 ml/g, GBZKD group) of stilled water (Control and COPD groups) for 4 weeks. The body weights of the mice in each group were monitored and recorded regularly.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003e2.5 Antibodies\u003c/h2\u003e \u003cp\u003eAntibodies against tumor necrosis factor-alpha (TNF-α, 17590-1-AP), granulocyte-macrophage colony-stimulating factor (GM-CSF, 17762-1-AP), matrix metalloprotein 9 (MMP-9, 10375-2-AP), alpha-smooth muscle actin (α-SMA, 23081-1-AP), glyceraldehyde-3-phosphate dehydrogenase (GAPDH, 0494-1-AP), and immunohistochemistry kits were purchased from Proteintech (Rosemont, IL, USA). Antibodies against interferon gamma (IFN-γ, ab216642), hypoxia-inducible factor-1 alpha (HIF-1α, ab8366), Janus kinase 1 (JAK1, ab133666), signal transducer, and activator of transcription 3 (STAT3, ab68153), phospho-STAT3 (p-STAT3, ab76315), collagen-1 (CLO1A1, ab21286), and suppressor of cytokine signaling 3 (SOCS3, ab16030) were purchased from Abcam (Cambridge, UK). Antibodies against tissue inhibitor of phospho-Janus kinase 1 (p-JAK1, bs-3238R) and metalloproteinases 1 (TIMP-1, bs-0415R) were purchased from Bioss Antibodies (Beijing, China).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003e2.6 Reagents and kits\u003c/h2\u003e \u003cp\u003ePentobarbital sodium, LPS, ammonium hydroxide, and skimmed milk powder were purchased from Sigma-Aldrich (St. Louis, MO, USA). Daqianmen cigarettes were purchased from Shanghai Tobacco Co. Ltd (Shanghai, China). The DAB chromogen kit was purchased from ZSGB-BIO (Beijing, China). The hematoxylin solution was purchased from KeyGen Biotech (Nanjing, China). The H\u0026amp;E staining kit was purchased from Beyotime (Shanghai, China). Tris-ethylenediaminetetraacetic acid, 2.5% glutaraldehyde, 10% neutral formalin solution, phosphate buffer saline, xylene, hydrogen peroxide solution, goat serum, osmic acid, gradient ethanol, gradient acetone, and Meyer\u0026rsquo;s hematoxylin were provided by the Clinical Research Institute of China-Japan Friendship Hospital (Beijing, China). The cell lysis buffer was purchased from BioVision (San Francisco, CA). The BCA protein assay kit (No. 23227) and TRIZOL were purchased from Thermo Fisher Scientific (Waltham, MA, USA). The protease inhibitor cocktail was purchased from Roche Diagnostics (Abbott Park, IL). The GSM-INF-1 mouse antibody array kit was purchased from RayBiotech (Norcross, GA). DNase/RNase-free water and RIPA lysate (Strong) were purchased from Solarbio (Solarbio, Beijing, China). Hifair III 1st Strand cDNA Synthesis Kit (11139ES60) and Hieff UNICON power qPCR SYBR Green Master Mix (No Rox) were purchased from Yeason (Shanghai, China). Tris base (0497-500G), glycine (M103-1KG), sodium dodecyl sulfate (M107-250G), bromophenol blue (0449-100G), and ammonium persulfate (0486-100G) were purchased from Amresco (Solon, OH). Chloroform, isopropyl alcohol, methanol, and hydrochloric acid were purchased from Beijing Chemical Works (Beijing, China). The SDS-PAGE gel rapid preparation kit (PG-112) was purchased from Epizyme (Shanghai, China). The pre-stained protein marker (P1103) was purchased from Applygen (Beijing China). The nitrocellulose filter membrane (NC membrane) was purchased from Millipore (Billerica, MA, USA). The eECL (CW0049) Western Blot Kit was purchased from Cwbio (Beijing, China).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003e2.7 Instruments\u003c/h2\u003e \u003cp\u003eA flexiVent ventilator was obtained from Scireq (Montreal, QC, Canada). Ultra-low-temperature refrigerator, ultracentrifuge, microplate reader (Synogen4), spectrophotometer (NanoDrop One), and vacuum drier were obtained from Thermo Fisher Scientific (Waltham, MA, USA). Thermal Cycler (Veriti) and real-time fluorescence quantitative PCR system (Quantstudio 5) were obtained from Applied Biosystems (Foster, CA, USA). A decolorized shaker was obtained from the Beijing Institute of New Technology Applications (Beijing, China). A thermostat water bath was obtained from Rong-feng Scientific (Shanghai, China). A microwave oven was obtained from Whirlpool (Benton Harbor, MI). A transmission electron microscopy (JEM-1400) was obtained from JEOL (Mitakashi, Tokyo, Japan). An upright microscope was obtained from Olympus (BX-53, Tokyo, Japan). An InnoScan 300 Microarray Scanner was obtained from Innopsys (Parc d'Activit\u0026eacute;s Activestre, Carbonne, France). An electrophoresis tank (DYCZ-24DN) and electrophoresis apparatus power supply (DYY-7C) were obtained from Beijing Liuyi Biological Technology (Beijing, China). A trans-Blot system (Mini-TRANS-BLOT CELL) was obtained from Bio-rad (Hercules, CA, USA). A chemiluminescence image analysis system (Tanon-4600) was obtained from Tanon (Shanghai, China).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003e2.8 Lung function detection\u003c/h2\u003e \u003cp\u003eThe mice were anesthetized by an intraperitoneal injection of 1% pentobarbital sodium at 0.1 mL/10 g body weight. The endotracheal intubation tube was placed and fixed in the mouse trachea and connected to a Flexivent FX computer-controlled ventilator. Forced expiratory volume (FEV) at 0.05 s, 0.1 s, and 0.2 s and peak expiratory flow were measured and recorded according to the manufacturer\u0026rsquo;s protocols.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003e2.9 Histology staining analysis\u003c/h2\u003e \u003cp\u003eLung tissue samples were fixed in 10% formalin for 72 h and then dehydrated, embedded in paraffin, sectioned, and stained with H\u0026amp;E according to standard operating procedures and observed under an optical microscope. Immunohistochemistry (IHC) was used to analyze TNF-α, GM-CSF, IFN-γ, HIF-1α, MMP-9, TIMP-1, α-SMA, and collagen-1 expression (n\u0026thinsp;=\u0026thinsp;4 per group). Briefly, lung tissue paraffin sections were dewaxed, subjected to antigen retrieval, incubated in 0.3% hydrogen peroxide, and blocked with goat serum. Sections were incubated with primary antibodies using the following dilutions: 1:200 for MMP-9 and TIMP-1; 1:480 for collagen I; 1:800 for TNF-α, IFN-γ, and GM-CSF; 1:1000 for HIF-1α; and 1:2000 for α-SMA. Sections were incubated at 18\u0026ndash;25℃ with primary antibodies against TNF-α, GM-CSF, IFN-γ, HIF-1α, MMP-9, TIMP-1, α-SMA, and collagen-1 for 2 h at room temperature. The sections were then incubated with the anti-mouse/rabbit universal immunohistochemistry test kit. A DAB test kit was used to produce the brown chromogenic reaction. IPP 6.0 software was used for identifying immunopositive areas. The left lung lobe was fixed in 2.5% glutaraldehyde at 4\u0026deg;C for 72 h and then soaked, dehydrated, infiltrated by pure resin, sectioned, and double-stained with uranium-lead according to standard staining methods, followed by observation under a transmission electron microscope.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003e2.10 Antibody array assay\u003c/h2\u003e \u003cp\u003e In total, 40 mouse inflammatory cytokines were measured in the control group (n\u0026thinsp;=\u0026thinsp;5), COPD group (n\u0026thinsp;=\u0026thinsp;5), and GBZKD group (n\u0026thinsp;=\u0026thinsp;5) using a GSM-INF-1 mouse antibody array according to the manufacturer\u0026rsquo;s instructions. Briefly, the dried antibody chips were blocked with sample diluent, and the samples were added to the wells after decanting the buffer from each well. The wells were washed and incubated with a biotinylated antibody cocktail followed by Cy3 equivalent dye-conjugated streptavidin in a dark room to avoid exposure to light. InnoScan 300 Microarray Scanne was used for fluorescence detection. The GSM-INF-1 analysis software was used for data analysis.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003e2.11 Quantitative real-time PCR (qRT-PCR)\u003c/h2\u003e \u003cp\u003eqRT-PCR was used to measure \u003cem\u003eJAK1\u003c/em\u003e, Janus kinase 2 (\u003cem\u003eJAK2\u003c/em\u003e), Janus kinase 3 (\u003cem\u003eJAK3\u003c/em\u003e), signal transducer and activator of transcription 1 (\u003cem\u003eSTAT1\u003c/em\u003e), \u003cem\u003eSTAT3\u003c/em\u003e, and \u003cem\u003eSOCS3\u003c/em\u003e mRNA expression in the control, COPD, and GBZKD groups (n\u0026thinsp;=\u0026thinsp;9 per group). Total RNA was extracted from lung tissues using Trizol after a one-step extraction protocol. cDNA was synthesized by reverse transcription. Gene expression was calculated using the 2\u003csup\u003eΔΔCt\u003c/sup\u003e method. The primers used in this study are provided in Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e, using GAPDH as an internal control gene. The experiments were performed in triplicate and repeated 3 times.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimer sequences.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003eSequence (5\u0026rsquo;-3\u0026rsquo;)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eJAK1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAGTGCAGTATCTCTCCTCTCTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGATTCGGTTCGGAGCGTACC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eJAK2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGGAATGGCCTGCCTTACAATG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTGGCTCTATCTGCTTCACAGAAT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eJAK3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCCTGCCTGTTTATCATTCGCT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAAGACTTGAGTGTCCACGTCC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSTAT1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCTCATTGTCACCGAAGAAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCTGCCAACTCAACACCTC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSTAT3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGACCCGCCAACAAATTAAGA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTCGTGGTAAACTGGACACCA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSOCS3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTGCGCCTCAAGACCTTCAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGCTCCAGTAGAATCCGCTCTC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGAPDH\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAGGTCGGTGTGAACGGATTTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGGGGTCGTTGATGGCAACA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003e2.12 Western blot\u003c/h2\u003e \u003cp\u003eWestern blot was used to measure JAK1, p-JAK1, STAT3, p-STAT3, and SOCS3 protein expression in the control, COPD, and GBZKD groups (n\u0026thinsp;=\u0026thinsp;4 per group). The total protein expression of each sample was quantified using a BCA protein assay kit. The proteins were separated by 10% SDS-PAGE, transferred to an NC membrane, and blocked with blocking buffer diluted with Tris-buffered saline and Tween. The membranes were incubated overnight at 4℃ with primary antibodies against GAPDH, phospho-JAK1, JAK1, phospho-STAT3, STAT-3, and SOCS3. The membranes were then washed and incubated with Horse Radish Peroxidase (HRP)-labeled sheep anti-rabbit secondary antibody or sheep anti-mice secondary antibody at a 1:5000 dilution. The ECL luminescent solution was used for imaging. Image J software (National Institutes of Health, Bethesda, MD, USA) was used to analyze the gray value of the target bands.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003e2.13 Statistical analysis\u003c/h2\u003e \u003cp\u003e SPSS22.0 software (IBM, Armonk, NY, USA) was authorized by Beijing University of Chinese Medicine and used for statistical analysis. Data are expressed as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation. Comparisons among multiple groups were performed using a one-way analysis of variance. The least significant difference multi-range test was used when the variances were equal, whereas Dunnett's T3 postposition test was used when the variances were not equal. P value \u0026lt; 0.05 were considered statistically significant.\u003c/p\u003e \u003c/div\u003e"},{"header":"3. Results","content":"\u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003e3.1 GBZKD treatment improved lung function in COPD mice\u003c/h2\u003e \u003cp\u003eWith COPD mice, we first detected the effect of GBZKD on lung function. The results showed that forced expiratory volume (FEV) 0.05, FEV 0.1, FEV 0.2, and peak expiratory flow (PEF) were significantly lower in the COPD group than in the control group (P\u0026lt;0.01). While, FEV 0.05, FEV 0.1, and FEV 0.2 were significantly higher in the GBZKD group than in the COPD group (P\u0026lt;0.05). However, no significant difference in PEF was observed between the GBZKD and COPD groups (Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). These analyses of lung function indicated that obstructive ventilation dysfunction was a major factor in generating COPD symptoms in mice, and GBZKD treatment improved lung function by relieving the dysfunction in airway obstructive ventilation.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eLung function parameters in the three groups.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"5\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGroup\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFEV 0.05 (mL)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eFEV 0.1 (mL)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eFEV 0.2 (mL)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003ePEF (mL\u0026middot;s)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eControl\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e1.35\u0026thinsp;\u0026plusmn;\u0026thinsp;0.12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e1.60\u0026thinsp;\u0026plusmn;\u0026thinsp;0.12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e1.66\u0026thinsp;\u0026plusmn;\u0026thinsp;0.13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e47.25\u0026thinsp;\u0026plusmn;\u0026thinsp;2.7\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCOPD\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e0.88\u0026thinsp;\u0026plusmn;\u0026thinsp;0.09\u003csup\u003e##\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e1.04\u0026thinsp;\u0026plusmn;\u0026thinsp;0.14\u003csup\u003e##\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e1.13\u0026thinsp;\u0026plusmn;\u0026thinsp;0.20\u003csup\u003e##\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e33.98\u0026thinsp;\u0026plusmn;\u0026thinsp;6.92\u003csup\u003e##\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGBZKD\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e1.08\u0026thinsp;\u0026plusmn;\u0026thinsp;0.11\u003csup\u003e\u0026lowast;\u0026lowast;\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e1.30\u0026thinsp;\u0026plusmn;\u0026thinsp;0.15\u003csup\u003e\u0026lowast;\u0026lowast;\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e1.35\u0026thinsp;\u0026plusmn;\u0026thinsp;0.15\u003csup\u003e\u0026lowast;\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e39.01\u0026thinsp;\u0026plusmn;\u0026thinsp;5.82\u003csup\u003e#\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"5\"\u003e\u003cb\u003eNotes\u003c/b\u003e: FEV 0.05, forced expiratory volume in 0.05 s; FEV 0.1, forced expiratory volume in 0.1 s; FEV 0.2, forced expiratory volume in 0.2 s; PEF, peak expiratory flow. Data are expressed as means\u0026thinsp;\u0026plusmn;\u0026thinsp;SD. N\u0026thinsp;=\u0026thinsp;7. \u003csup\u003e#\u003c/sup\u003eP\u0026thinsp;\u0026lt;\u0026thinsp;0.05, \u003csup\u003e##\u003c/sup\u003eP\u0026thinsp;\u0026lt;\u0026thinsp;0.01 versus the control group; \u003csup\u003e\u0026lowast;\u003c/sup\u003eP\u0026thinsp;\u0026lt;\u0026thinsp;0.05, \u003csup\u003e\u0026lowast;\u0026lowast;\u003c/sup\u003eP\u0026thinsp;\u0026lt;\u0026thinsp;0.01 versus the COPD group.\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003e3.2 GBZKD treatment alleviated pathological lesions in COPD mice\u003c/h2\u003e \u003cp\u003eThe characteristic pathological changes of COPD occur in the small airway, alveoli, and lung parenchyma predominantly. In our study, H\u0026amp;E staining results revealed evident destruction of alveolar structure, formation of pulmonary bullae, infiltration of inflammatory cells, destruction of airway mucosal epithelium, adhesion and shedding of airway cilia, and obstruction of the small airway in COPD mice. Pathological lesions, such as bronchial remodeling and increased collagen content, were also evident in COPD mice. While, compared to the COPD group, the GBZKD group exhibited significantly less airway obstruction and destruction, bronchial remodeling, alveolar destruction, and infiltration of inflammatory cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003e3.3 GBZKD treatment reduced mitochondrial damage of type II epithelial cells in COPD mice\u003c/h2\u003e \u003cp\u003eFurthermore, the mice\u0026rsquo;s lung ultrastructure was observed by transmission electron microscopy. The results revealed multilayering of bronchial epithelial cells, formation of pulmonary bullae, and destruction of type II epithelial cells in COPD mice. While GBZKD treatment significantly reduced the number of bronchial epithelial cell layers and pulmonary bullae. Notably, GBZKD treatment significantly alleviated the vacuolization of lamellar bodies and the swelling and fracturing of mitochondria in type II epithelial cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). Transmission electron microscopy observations revealed that GBZKD treatment significantly reduced the damage to lamellar bodies and mitochondria in alveolar type II (AT-II) epithelial cells in COPD mice.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003e3.4 Identification of GBZKD compounds\u003c/h2\u003e \u003cp\u003eWe next detected the compounds of the GBZKD in solution forms by UHPLC-MS/MS analysis. The total ion chromatography (TIC) diagrams of positive \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA\u003cb\u003e)\u003c/b\u003e and negative \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB\u003cb\u003e)\u003c/b\u003e ion modes were shown respectively. In total, 41 major components of GBZKD were identified, and the detailed information for these compounds was shown in Table\u0026nbsp;\u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e4\u003c/span\u003e. Among these GBZKD compounds, albiflorin (No. 6)[\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e], luteolin (No. 27)[\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e], glycyrrhizic acid (No. 28)[\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e], isoimperatorin (No.29)[\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e], baicalein (No. 30)[\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e], atractylenolide III (No. 34)[\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e], and dehydroandrographolide (No. 37)[\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e] are known to have anti-inflammatory effects. Moreover, neoandrographolide (No. 5) has been reported to inhibit the production of activated macrophages[\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. Thus, these results further supported that GBZKD has a powerful anti-inflammation function.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab4\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 4\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eChemical components of GBZKD identified using LC-MS.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"6\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNo.\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eRT (min)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eFormula\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eAdduct\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003em/z\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eIdentification\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1.2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eC5H9NO2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e+H\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e116.0706\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eProline\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1.25\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eC6H11NO2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e+H\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e130.0863\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003ePipecolinic acid\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1.38\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eC6H5NO2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e+H\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e124.0393\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eNicotinic acid\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1.38\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eC6H6N2O\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e+H\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e123.0553\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eNicotinamide\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e7.23\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eC26H40O8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e+H\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e481.2796\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eNeoandro grapholide\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e7.64\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eC21H20O13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e+H\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e481.0977\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eAlbiflorin\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1.19\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eC7H12O6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-H\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e191.05611\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eQuinic acid\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1.25\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eC6H11NO2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-H\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e128.0717\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003ePipecolinic acid\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1.57\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eC7H6O5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-H\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e169.01425\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eGallic acid\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1.63\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eC27H22O18\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-H\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e633.07335\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eCorilagin\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e6.85\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eC15H14O6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-H\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e289.07176\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eCatechin\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e6.9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eC16H18O9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-H\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e353.08782\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eCryptochlorogenic acid\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e7.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eC26H28O14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-H\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e563.14061\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eSchaftoside\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e7.23\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eC23H28O11.HCOOH\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-H\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e525.16136\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003ePaeoniflorin\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e7.27\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eC29H36O15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-H\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e623.19817\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eActeoside isomer\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e7.28\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eC22H22O10.HCOOH\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-H\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e491.11949\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eCalycosin-7-o-glucoside\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e17\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e7.43\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eC11H12N2O2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-H\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e203.0826\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eL-Tryptophan\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e18\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e7.44\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eC21H20O9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-H\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e415.10344\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003ePuerarin\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e19\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e7.45\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eC39H50O20.HCOOH\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-H\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e883.28777\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eEpimedin A\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e7.45\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eC23H28O11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-H\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e479.15587\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eAlbiflorin\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e21\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e7.47\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eC38H48O19.HCOOH\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-H\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e853.27721\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eEpimedin B\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e22\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e7.49\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eC31H40O15.HCOOH\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-H\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e697.23491\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eCistanoside D\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e23\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e7.57\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eC31H40O15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-H\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e651.22942\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eRehmannioside\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e24\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e7.58\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eC22H22O9.HCOOH\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-H\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e475.12459\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eOnonin\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e25\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e7.59\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eC33H40O15.HCOOH\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-H\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e721.23491\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eIcarrin\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e26\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e7.69\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eC23H28O10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-H\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e463.16097\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eIsomucronulatol-7-O-glucoside\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e27\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e7.95\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eC15H10O6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-H\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e285.04045\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eLuteolin\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e28\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e8.05\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eC42H62O16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-H\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e821.39653\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eGlycyrrhizic acid\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e29\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e8.23\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eC16H14O4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-H\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e269.08193\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eIsoimperatorin\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e30\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e8.32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eC15H10O5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-H\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e269.04555\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eBaicalein\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e31\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e8.52\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eC16H12O4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-H\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e267.06627\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eFormononetin\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eC15H10O4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-H\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e253.05063\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eChrysin\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e33\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e9.34\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eC18H16O7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-H\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e343.08232\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eEupatilin\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e34\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e9.6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eC15H20O3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-H\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e247.13397\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eAtractylenolide III\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e35\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e9.62\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eC30H44O7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-H\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e515.30144\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eGanoderic acid A\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e36\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e10.3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eC33H58O14.HCOOH\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-H\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e723.38085\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eGingerglycolipid B\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e37\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e10.98\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eC20H28O4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-H\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e331.19148\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eDehydroandrographolide\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e38\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e12.01\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eC20H24O4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-H\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e327.16017\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eAnwulignan\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e39\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e14.86\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eC30H46O4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-H\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e469.33232\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e16α-Hydroxydehydrotrametenolic acid\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e40\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e15.87\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eC30H48O3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-H\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e455.35308\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eUrsolic acid\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e41\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e17.08\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eC18H32O2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-H\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e279.23296\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eLinoleic acid\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec21\" class=\"Section2\"\u003e \u003ch2\u003e3.5 GBZKD treatment reduced lung inflammation in COPD mice\u003c/h2\u003e \u003cp\u003eTo evaluate the inflammation status of mice lung tissues, we performed IHC staining for TNF-α, GM-CSF, IFN-γ, and HIF-1α on serial paraffin sections in each group. The results showed that the integrated optical density (IOD) values of TNF-α, GM-CSF, IFN-γ, and HIF-1α were significantly higher in the COPD group than in the control group (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05), suggesting the upregulation of inflammatory factors and severe inflammation status in COPD mice. While, the IOD values of TNF-α, GM-CSF, IFN-γ, and HIF-1α were significantly lower in the GBZKD group than in the COPD group (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05), suggesting that GBZKD treatment attenuated inflammatory lung injury in COPD mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e\u003cb\u003e)\u003c/b\u003e.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec22\" class=\"Section2\"\u003e \u003ch2\u003e3.6 GBZKD treatment reduced lung structural damage in COPD mice\u003c/h2\u003e \u003cp\u003ePrimarily, MMP-9 and the TIMP-1 are major members of the protease and antiprotease families respectively to regulate the dynamic balance of proteases and antiproteases of the respiratory tract[\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. And during injury-repair-remodelling circus in lung tissue, the α-SMA is closely associated with airway remodeling, enabling strong contraction and collagen synthesis[\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. To evaluate the structural damage of mice lung tissues, we next performed IHC staining for MMP-9, TIMP-1, α-SMA, and collagen-1 on serial paraffin sections in each group. IOD values of MMP-9, TIMP-1, MMP-9/TIMP-1, and α-SMA were significantly higher in the COPD group than in the control group (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05), indicative of structural damage and airway remodeling in the lung tissue of COPD mice. While, MMP-9, TIMP-1, MMP-9/TIMP-1, and α-SMA values were significantly lower in the GBZKD group than in the COPD group (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05), suggesting that GBZKD treatment ameliorated structural damage in the lungs of COPD mice. No significant difference in collagen-1 values was observed between the GBZKD and COPD groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec23\" class=\"Section2\"\u003e \u003ch2\u003e3.7 GBZKD correlated to the regulation of the JAK-STAT pathway in COPD mice\u003c/h2\u003e \u003cp\u003eTo explore which inflammation pathway correlated to the GBZKD treatment in COPD mice, the levels of multiple inflammatory cytokines were measured using an antibody array. As Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e showed, IL-1β, GM-CSF, TNF-α, IFN-γ, IL-6, IL-3, IL-17, and IL-12p70 levels were significantly higher in the COPD group than in the control group. And IL-1β, GM-CSF, TNF-α, IFN-γ, IL-6, IL-3, and TCA-3 levels were significantly lower in the GBZKD group than in the COPD group. It's very directional that, 5/8 of the differentially expressed cytokines between the control and COPD groups and 4/7 of the differentially expressed cytokines between the COPD and GBZKD groups were associated with the JAK-STAT signaling pathway. These results indicated that GBZKD correlated to the regulation of the JAK-STAT pathway in COPD mice.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec24\" class=\"Section2\"\u003e \u003ch2\u003e3.8 GBZKD inhibited the JAK-STAT pathway in COPD mice\u003c/h2\u003e \u003cp\u003eTo further determine the correlation between GBZKD and JAK-STAT pathway in COPD mice, we detected key genes expression of the JAK-STAT pathway in the mice\u0026rsquo;s lung tissues. RT-PCR results revealed that \u003cem\u003eJAK1, JAK2, JAK3, STAT3\u003c/em\u003e, and \u003cem\u003eSOCS3\u003c/em\u003e mRNA expression was significantly higher in the COPD group than in the control group. While, GBZKD treatment significantly suppressed \u003cem\u003eJAK1\u003c/em\u003e and \u003cem\u003eSTAT3\u003c/em\u003e mRNA levels and significantly elevated \u003cem\u003eSOCS3\u003c/em\u003e mRNA levels in COPD mice \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eA\u003cb\u003e)\u003c/b\u003e. and the Western blot results revealed that GBZKD treatment significantly suppressed the protein levels of p-JAK1, p-STAT3, and significantly elevated the protein levels of SOCS3 \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eB\u003cb\u003e)\u003c/b\u003e. Collectively, these results identified the JAK-STAT signaling pathway as a key player in COPD pathogenesis and curative mechanisms of GBZKD.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"4. Discussion","content":"\u003cp\u003eA key underlying pathogenesis in the progression of COPD is inflammatory injury, which plays a key role in the destruction of epithelial cells, endothelial cells, and the proliferation of fibroblasts, which in turn results in the destruction of lung structure and airway remodeling [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. The inflammatory injury in the respiratory tract could be caused by a variety of triggers like tobacco smoking, the inhalation of toxic particles, and gases from household and outdoor air pollution[\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e], and the mechanisms and targeted therapy for this amplified inflammation are not yet fully understood. In this study, we first detected the treatment effect of GBZKD in COPD and further focused on whether GBZKD could reduce lung inflammation and damage to alleviate the process of COPD and explored the key targets and pathways.\u003c/p\u003e \u003cp\u003ePrevious studies have evidenced that the abnormal activation of the JAK-STAT pathway plays an important role in COPD[\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. Using antibody array assay and genes expression examination, we not only confirmed the activation of the JAK-STAT pathway in COPD but also obtained targets that GBZKD could regulate including JAK1, STAT3, SOCS3, IL-1β, GM-CSF, TNF-α, IFN-γ, IL-6, IL-3, and TCA-3. Among these targets, JAK1 and STAT3 are two key molecules to run the whole pathway[\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e], and GBZKD showed a double function to downregulate their mRNA expression and protein phosphorylation levels. Other targets, as downstream genes of the JAK-STAT pathway, are not only regulated by this pathway but also engage in feedback regulation of the JAK-STAT pathway. However, whether GBZKD had a direct regulatory effect on these other targets, or just regulated their expression by the JAK1-STAT3 axis, needs further study.\u003c/p\u003e \u003cp\u003eBased on the identification assay of GBZKD ingredients, we identified several components of GBZKD that may exert protective effects in lung injury via various mechanisms, especially the JAK-STAT pathway. In terms of regulating respiratory inflammatory repair, nicotinamide downregulates the expression of IL-8[\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e], neo-andrographolide reduces PGE2 generated by LPS-stimulated macrophages[\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e], and icariin attenuates acute lung inflammation by inhibiting the expression of \u003cem\u003eTNF-α, IL-6\u003c/em\u003e, Cyclooxygenase-2, and nitric oxide synthase (\u003cem\u003eiNOS)\u003c/em\u003e mRNA in the lung tissue of LPS-treated mice[\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. Further, ursolic acid reduces the expression of TNF-α, IL-1β, IL-6, toll-like receptor 4 (TLR4), My D88, and p-p65 in COPD rats[\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. Concerning anti-oxidative effects, crocetin significantly increases the activity of antioxidant enzymes such as superoxide dismutase and glutathione peroxidase in rat serum and inhibits \u003cem\u003eIL-6, TNF-α, iNOS\u003c/em\u003e, and \u003cem\u003eMCP-1\u003c/em\u003e mRNA expression in LPS-stimulated macrophages[\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. Moreover, luteolin inhibits the expression of IL-1β, IL-4, IL-5, IL-6, IL-8, IL-10, IL-13, TNF-α, IFN-β, and GM-CSF and luteolin reduces nitric oxide (NO) production by inhibiting reactive oxygen species (ROS) production and reducing the synthesis of iNOS[\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. Considering GBZKD as a formula that contains lots of ingredients, in-depth pharmacological mechanistic studies of GBZKD in COPD are needed in the future.\u003c/p\u003e \u003cp\u003eAt last, in addition to histological level studies, at the cell level, we found that GBZKD had a significant influence on AT-II cells. AT-II cells act as stem cells in the process of lung epithelial renewal and tissue injury repair by repairing damaged alveolar epithelial cells and promoting the synthesis of alveolar surfactants[\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]. AT-II cells play a crucial role in mediating inflammatory responses in the lung tissue[\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. In response to inflammatory stimulation in the lung tissue, AT-II cells secrete various chemokines, promote neutrophil aggregation, and release several inflammatory factors including IL-6 and TNF-α, further resulting in an augmented inflammatory response, and activation of the JAK-STAT signaling pathway[\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]. Hence, AT-II cells might be an important target for GBZKD in treating COPD.\u003c/p\u003e"},{"header":"5. Limitation","content":"\u003cp\u003eThis study has some limitations. First of all, there was an absence of proper medicine control to compare the effect of GBZKD on COPD, such as a well-studied TCM. Next, the GBZKD ingredients we obtained here were not conducted in a thorough and detailed study, which needs more research in future studies. Thirdly, the JAK-STAT pathway inhibition experiments were missing, which made the study less convincing.\u003c/p\u003e"},{"header":"6. Conclusion","content":"\u003cp\u003eThis study demonstrated that GBZKD treatment improved lung function and pathological conditions in COPD mice, highlighting its therapeutic potential as a treatment method for COPD. Mechanically, these findings suggest that GBZKD significantly alleviates lung inflammatory injury by reducing the overexpression of inflammatory factors related to JAK-STAT signaling in the lung tissue, thereby attenuating airway remodeling in COPD mice. Furthermore, our findings provide insight into the mechanisms of action of GBZKD and serve as a foundation for further basic and clinical research on GBZKD.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cdiv id=\"AGS1\" class=\"AbbreviationGroupSection\"\u003e \u003cdiv class=\"Heading\"\u003e\u003c/div\u003e \u003cdiv class=\"DefinitionList\"\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eChronic obstructive pulmonary disease (COPD); GuBenZhiKe decoction (GBZKD); Traditional Chinese medicine (TCM); lipopolysaccharide (LPS); alpha\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003esmooth muscle actin (α-SMA); matrix metalloprotein 9 (MMP-9); metalloproteinases 1 (TIMP-1); Janus kinase 1 (JAK1); ignal transducer and activator of transcription 1 (STAT1); suppressor of cytokine signaling 3 (SOCS3); tumor necrosis factor-alpha (TNF-α); granulocyte-macrophage colony-stimulating factor (GM-CSF); reverse transcription polymerase chain reaction (RT-PCR); phospho-JAK1 (p-JAK1); phospho-STAT3 (p-STAT3); interleukin (IL); mass spectrometry (MS); Immunohistochemistry (IHC); Forced expiratory volume (FEV); Quantitative real-time PCR (qRT-PCR) ; Horse Radish Peroxidase (HRP); peak expiratory flow (PEF); alveolar type II (AT-II); total ion chromatography (TIC); integrated optical density (IOD); nitric oxide synthase (iNOS); toll-like receptor 4 (TLR4); reactive oxygen species (ROS); nitric oxide (NO); Hematoxylin-Eosin (HE).\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003c/div\u003e \u003c/div\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eFunding Statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study was supported by the National Natural Science Foundation of China (82074367) and Chinese Medicine Inheritance and Innovation \u0026ldquo;One Hundred Million\u0026rdquo; Talent Project Qihuang Scholar (to Zhang Hongchun) (2019-QTL-003).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDisclosure statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll authors have read the policy on disclosure of potential conflicts of interest outlined by the Annals of Medicine.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflict of Interest\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that there are no conflicts of interest.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll the relevant data is provided within the paper and its supporting information files. The datasets analyzed during the current study are available from the corresponding author upon reasonable request.\u0026nbsp;This work described was original research that has not been published previously and is not under consideration for publication elsewhere, in whole or in part.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eMW: Data curation, visualization, formal analysis, methodology, and writing the original draft.\u0026nbsp;YX\u0026nbsp;and YL: Data curation, formal analysis, and visualization.\u0026nbsp;MC and LP:\u0026nbsp;Methodology. ML and YW: Data curation, methodology, and software. ZC: Project administration and supervision. HZ: Conceptualization, project administration, supervision, and funding acquisition.\u0026nbsp;All authors contributed to the\u0026nbsp;article and approved the submitted manuscript.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eCelli B, et al. Definition and Nomenclature of Chronic Obstructive Pulmonary Disease: Time for Its Revision. Am J Respir Crit Care Med. 2022;206(11):1317\u0026ndash;25.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGlobal regional. national age-sex-specific mortality for 282 causes of death in 195 countries and territories, 1980\u0026ndash;2017: a systematic analysis for the Global Burden of Disease Study 2017. Lancet. 2018;392(10159):1736\u0026ndash;88.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChristenson SA, et al. Chronic obstructive pulmonary disease. Lancet. 2022;399(10342):2227\u0026ndash;42.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMathers CD, Loncar D. Projections of global mortality and burden of disease from 2002 to 2030. PLoS Med. 2006;3(11):e442.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHogg JC, Timens W. The pathology of chronic obstructive pulmonary disease. Annu Rev Pathol. 2009;4:435\u0026ndash;59.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHigham A et al. Relationships between Airway Remodeling and Clinical Characteristics in COPD Patients. Biomedicines, 2022. 10(8).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSergio L, et al. Chronic Obstructive Pulmonary Disease: From Injury to Genomic Stability. Copd. 2017;14(4):439\u0026ndash;50.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVogelmeier CF, et al. Goals of COPD treatment: Focus on symptoms and exacerbations. Respir Med. 2020;166:105938.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCao X, et al. Advances in traditional Chinese medicine for the treatment of chronic obstructive pulmonary disease. J Ethnopharmacol. 2023;307:116229.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHong-Chun Z, En-Xiang C. Clinical study on Tiaobufeishen capsule in the treatment of stable COPD [J]. J Beijing Univ Traditional Chin Med. 2003;26(2):53\u0026ndash;6. (In Chinese).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXue L, Zhe C, Qing-Sheng YU, et al. Effect of Gubenzhike recipe on pulmonary function and sIgA in respiratory tract of COPD mice[J]. China J Traditional Chin Med Pharm. 2012;27(12):3064\u0026ndash;7. (In Chinese).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYing L, Yue J, Li-Li G, et al. Effects of Gubenzhike recipe on gamma delta-T cell and IL-17 in lung of COPD mice[J]. China J Traditional Chin Med Pharm. 2014;29(12):3981\u0026ndash;4. (In Chinese).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXue L, Zhe C, Yue J, et al. Effects of Gubenzhike Recipe on expression of neutrophil elastase in the lung tissue of COPD mice[J]. China J Traditional Chin Med Pharm. 2015;30(07):2512\u0026ndash;4. (In Chinese).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang M, et al. Proteomic analysis of a chronic obstructive pulmonary disease mouse model to determine the efficacy of treatment using Guben Zhike decoction. J Traditional Chin Med Sci. 2021;8(1):34\u0026ndash;42.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang YQ et al. Gubenzhike Recipe Ameliorates Respiratory Mucosal Immunity in Mice with Chronic Obstructive Pulmonary Disease through Upregulation of the γδT Lymphocytes and KGF Levels. Evid Based Complement Alternat Med, 2020. 2020: p. 3056797.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen G, et al. Upregulation of matrix metalloproteinase 9 (MMP9)/tissue inhibitor of metalloproteinase 1 (TIMP1) and MMP2/TIMP2 ratios may be involved in lipopolysaccharide-induced acute lung injury. J Int Med Res. 2020;48(4):300060520919592.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZou W, et al. PM2.5 Induces Airway Remodeling in Chronic Obstructive Pulmonary Diseases via the Wnt5a/β-Catenin Pathway. Int J Chron Obstruct Pulmon Dis. 2021;16:3285\u0026ndash;95.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eL Z. W.W.J. Pharmacology, and therapeutics, Anti-inflammatory and immunoregulatory effects of paeoniflorin and total glucosides of paeony. 2020. 207: p. 107452.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGendrisch F, et al. Luteolin as a modulator of skin aging and inflammation. BioFactors. 2021;47(2):170\u0026ndash;80.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMing LJ, Yin AC. Therapeutic effects of glycyrrhizic acid. Nat Prod Commun. 2013;8(3):415\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFan L, et al. Isoimperatorin alleviates lipopolysaccharide-induced periodontitis by downregulating ERK1/2 and NF-κB pathways. Open Life Sci. 2023;18(1):20220541.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e17, Wang X et al. Baicalein alleviates pyroptosis and inflammation in hyperlipidemic pancreatitis by inhibiting NLRP3/Caspase-1 pathway through the miR-192-5p/TXNIP axis. Int Immunopharmacol, 2021. 101(Pt B): p. 108315.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDeng M, et al. Atractylenolides (I, II, and III): a review of their pharmacology and pharmacokinetics. Arch Pharm Res. 2021;44(7):633\u0026ndash;54.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWeng Z, et al. Anti-Inflammatory Activity of Dehydroandrographolide by TLR4/NF-κB Signaling Pathway Inhibition in Bile Duct-Ligated Mice. Cell Physiol Biochem. 2018;49(3):1083\u0026ndash;96.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu J, et al. Inhibitory effects of neoandrographolide on nitric oxide and prostaglandin E2 production in LPS-stimulated murine macrophage. Mol Cell Biochem. 2007;298(1\u0026ndash;2):49\u0026ndash;57.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePettersen CA, Adler KB. Airways inflammation and COPD: epithelial-neutrophil interactions. Chest. 2002;121(5 Suppl):s142\u0026ndash;50.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBacharier LB, Mori A, Kita H. Advances in asthma, asthma-COPD overlap, and related biologics in 2018. J Allergy Clin Immunol. 2019;144(4):906\u0026ndash;19.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang IA, Jenkins CR, Salvi SS. Chronic obstructive pulmonary disease in never-smokers: risk factors, pathogenesis, and implications for prevention and treatment. Lancet Respir Med. 2022;10(5):497\u0026ndash;511.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYew-Booth L, et al. JAK-STAT pathway activation in COPD. Eur Respir J. 2015;46(3):843\u0026ndash;5.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePurohit M, et al. Janus kinase/signal transducers and activator of transcription (JAK/STAT) and its role in Lung inflammatory disease. Chem Biol Interact. 2023;371:110334.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhao K, et al. Cigarette smoke-induced lung inflammation in COPD mediated via CCR1/JAK/STAT /NF-κB pathway. Aging. 2020;12(10):9125\u0026ndash;38.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHu X, et al. The JAK/STAT signaling pathway: from bench to clinic. Signal Transduct Target Ther. 2021;6(1):402.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGrange PA, et al. Nicotinamide inhibits Propionibacterium acnes-induced IL-8 production in keratinocytes through the NF-kappaB and MAPK pathways. J Dermatol Sci. 2009;56(2):106\u0026ndash;12.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXu CQ, et al. Icariin attenuates LPS-induced acute inflammatory responses: involvement of PI3K/Akt and NF-kappaB signaling pathway. Eur J Pharmacol. 2010;642(1\u0026ndash;3):146\u0026ndash;53.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi C, et al. Preventive effect of ursolic acid derivative on particulate matter 2.5-induced chronic obstructive pulmonary disease involves suppression of lung inflammation. IUBMB Life. 2020;72(4):632\u0026ndash;40.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGuo ZL et al. Crocetin: A Systematic Review. Front Pharmacol, 2021. 12: p. 745683.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDesai TJ, Brownfield DG, Krasnow MA. Alveolar progenitor and stem cells in lung development, renewal and cancer. Nature. 2014;507(7491):190\u0026ndash;4.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eImielinski M, Guo G, Meyerson M. Insertions and Deletions Target Lineage-Defining Genes in Human Cancers. Cell. 2017;168(3):460\u0026ndash;e47214.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSutherland KD, Berns A. Cell of origin of lung cancer. Mol Oncol. 2010;4(5):397\u0026ndash;403.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMcRitchie DI, et al. Production of tumour necrosis factor alpha by primary cultured rat alveolar epithelial cells. Cytokine. 2000;12(6):644\u0026ndash;54.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSharma AK, et al. Proinflammatory response of alveolar epithelial cells is enhanced by alveolar macrophage-produced TNF-alpha during pulmonary ischemia-reperfusion injury. Am J Physiol Lung Cell Mol Physiol. 2007;293(1):L105\u0026ndash;13.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWissel H, et al. Chlamydophila pneumoniae induces expression of toll-like receptor 4 and release of TNF-alpha and MIP-2 via an NF-kappaB pathway in rat type II pneumocytes. Respir Res. 2005;6(1):51.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Guben Zhike decoction, chronic obstructive pulmonary disease, respiratory injury repair, JAK-STAT signaling pathway, integrative pharmacology strategy","lastPublishedDoi":"10.21203/rs.3.rs-5271698/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-5271698/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eWe aimed to study the mechanisms of GuBenZhiKe decoction (GBZKD) in treating Chronic obstructive pulmonary disease (COPD). Components of GBZKD were analyzed using liquid chromatography-mass spectrometry. ICR mice were exposed to cigarette smoke and administered lipopolysaccharide to establish a COPD model, followed by treatment with GBZKD. Lung function test, hematoxylin and eosin staining, electron microscopic observation, and immunohistochemistry assays were performed. The expressions of genes were examined using an antibody array, qRT-PCR and western blot. GBZKD reduced structural failure and inflammatory response in airways, terminal bronchioles, and alveoli of COPD mice. GBZKD suppressed the levels of α-SMA, MMP-9, TIMP-1, and MMP-9/TIMP-1 ratio in COPD mice. GBZKD suppressed the mRNA levels of \u003cem\u003eJAK1\u003c/em\u003e and \u003cem\u003eSTAT3\u003c/em\u003e, and elevated \u003cem\u003eSOCS3\u003c/em\u003e mRNA expression. GBZKD treatment significantly suppressed the protein levels of p-JAK1 and p-STAT3, and significantly elevated the SOCS3 protein expression. GBZKD alleviated respiratory tract injury by regulating the JAK-STAT pathway.\u003c/p\u003e","manuscriptTitle":"Uncovering the pharmacological mechanisms of GuBenZhiKe decoction in treating chronic obstructive pulmonary disease by an integrative pharmacology strategy","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-11-04 17:15:13","doi":"10.21203/rs.3.rs-5271698/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"8c209cef-4c7e-4ed0-987b-687fb2bae607","owner":[],"postedDate":"November 4th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2025-03-28T15:23:37+00:00","versionOfRecord":[],"versionCreatedAt":"2024-11-04 17:15:13","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-5271698","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-5271698","identity":"rs-5271698","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}