Therapeutic targeting of SETD2-deficient cancer cells with the small-molecule compound RITA | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Therapeutic targeting of SETD2-deficient cancer cells with the small-molecule compound RITA Timothy Humphrey, Kirsten Lopez, Deborah Sneddon, Sovan Sarkar, and 14 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-8849233/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract The histone methyltransferase SETD2 and its associated histone mark H3 lysine 36 trimethylation (H3K36me3) are frequently lost in cancer, identifying SETD2 tumour suppressor loss as an important therapeutic target. Here we show that SETD2-deficient cancer cells are profoundly sensitive to RITA (2,5-bis[5-hydroxymethyl-2-thienyl] furan; NSC652287). Exposure of SETD2-deficient cancer cells to RITA results in significant p53 induction and apoptosis. However, TP53-deficient cells also exhibit RITA sensitivity suggesting p53 induction is an effect rather than a cause of RITA sensitivity. We find that RITA sensitivity is dependent on the phenol sulfotransferase SULT1A1, which is highly upregulated in SETD2-deficient cells. Accordingly, structural modifications of RITA, predicted to compromise its sulfation, ablated its activity. Further, SETD2-deficient cells can be targeted with YC-1, another SULT1A1-dependent anti-cancer agent. RITA sensitivity was associated with defects in DNA replication, leading to delays in S-phase progression, increased recruitment of replication stress markers, and reduced replication fork progression. Consistent with this, global target deconvolution using thermal profiling (2D-TPP) identified a broad range of RITA target proteins, including many involved in DNA replication stress. Together, these findings support the exploitation of SULT1A1 expression as a novel therapeutic strategy to target SETD2-deficient cancers. Biological sciences/Molecular biology/DNA damage and repair Biological sciences/Cancer/Cancer genetics Biological sciences/Drug discovery/Medicinal chemistry/Drug discovery and development Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 INTRODUCTION A key challenge in the treatment of cancer is achieving sufficient anti-tumour activity while limiting any negative impact on normal tissues. Maximising a drug’s therapeutic index, defined as the ratio between the dose that induces toxicity and the dose needed for therapeutic efficacy ( 1 ). This limitation has driven efforts to identify tumour-specific therapies that can complement or replace conventional chemotherapies, which often cause severe side effects ( 2 ). One promising strategy is synthetic lethality, a genetic interaction in which simultaneous disruption of two genes results in cell death, see while loss of either gene alone is tolerated. Such interactions typically arise when parallel or overlapping pathways regulate essential cellular processes ( 3 ). Synthetic lethality is now being actively exploited to selectively target cancer cells while sparing normal tissues ( 4 ). Histone modifications play a central role in regulating gene expression, chromatin organisation, and genome stability. Dysregulation of the histone code is a hallmark of tumourigenesis, and histone-modifying enzymes are among the most frequently mutated genes in cancer ( 5 – 9 ). In mammalian cells, SETD2 is the sole enzyme responsible for trimethylation of histone H3 lysine 36 (H3K36me3) in somatic cells ( 10 ). SETD2 functions co-transcriptionally through interaction with the phosphorylated C-terminal domain of RNA polymerase II ( 11 – 14 ). H3K36me3 is associated with active transcription ( 15 ), and its loss leads to cryptic intragenic transcription and aberrant chromatin remodelling ( 16 ). Beyond transcription, H3K36me3 contributes to genome stability through roles in mismatch repair ( 17 ), DNA double-strand break repair ( 18 , 19 ), and replication stress responses ( 20 – 22 ), as reviewed in ( 23 ). SETD2 also methylates non-histone substrates such as microtubules, preventing mitotic defects and chromosomal missegregation ( 24 ). Consistent with these functions, SETD2 acts as a tumour suppressor and is frequently altered in cancer. SETD2 mutations or deletions occur in a substantial proportion of clear cell renal cell carcinoma (ccRCC) tumours and cell lines ( 25 , 26 ). Its location on chromosome 3p makes it a common target of loss of heterozygosity in ccRCC ( 27 ). SETD2 mutations correlate with reduced cancer-specific survival in renal cell carcinoma ( 28 ), and H3K36me3 levels progressively decline from primary tumours to metastases ( 29 ). SETD2 mutations have also been reported in high-grade gliomas ( 30 ) and breast cancer ( 31 ). Our group previously identified a conserved synthetic lethal interaction between loss of SETD2 and inhibition of the cell cycle regulator WEE1 in both fission yeast and human cells ( 32 , 33 ). Building on this work, we performed a high-throughput synthetic lethality screen of over 2,000 compounds using SETD2-deficient and isogenic parental U2OS cells. The most potent and selective compound identified was RITA ( R eactivation of p53 and I nduction of T umour cell A poptosis), a small molecule initially discovered for its anti-tumour activity in the NCI Anticancer Drug Screen ( 34 ), and reported to reactivate p53 by disrupting its interaction with MDM2 ( 35 ). Here, we demonstrate that RITA selectively targets SETD2-deficient cancer cells, inducing apoptosis through p53 activation, DNA damage response signalling, and disruption of DNA replication. Further, we define the molecular and structural basis of this synthetic lethal targeting. MATERIALS AND METHODS Cell Lines The U2OS cell line (human osteosarcoma) was obtained from the American Type Culture Collection (ATCC, Manassas, VA, USA; HTB-96). The U2OS SETD2-deleted cell line (SETD2 -/- ) was generated by our group using CRISPR–Cas9 technology as described previously (33). The 786-O, A498 and LB996 cell lines were derived from human clear cell renal cell carcinomas and confirmed by STR profiling. 786-O was obtained from Dr Valentine Macaulay (Department of Oncology, University of Oxford, UK). A498 was obtained from ATCC (Manassas, VA, USA; HTB-44). LB996 was obtained from Prof. Benoit van den Eynde (Oxford Ludwig Institute, UK). MCF7 p53 wild-type and p53-CRISPR cell lines were obtained from Prof. Ross Chapman (Wellcome Centre for Human Genetics, Oxford, UK). Cell Culture All cell lines except LB996 were maintained in Dulbecco’s modified minimal essential medium (DMEM; Life Technologies, Paisley, UK) supplemented with 10% foetal bovine serum (FBS; Sigma-Aldrich, Gillingham, UK), 100 U ml⁻¹ penicillin and 0.1 mg ml⁻¹ streptomycin (Sigma-Aldrich, Gillingham, UK). LB996 cells were cultured in Iscove’s Modified Dulbecco’s Medium (IMDM; Life Technologies, Paisley, UK) supplemented with 10% FBS, penicillin/streptomycin and G5 supplement (Life Technologies, Paisley, UK). Cells were grown at 37 °C in a humidified incubator with 5% CO₂ and were subcultured every 3–4 days by PBS wash, trypsinisation, centrifugation (300 × g, 3 minutes) and replating at the appropriate dilution. High-throughput Compound Screening Parental and SETD2-deleted U2OS cells were seeded into 384-well plates (750 cells in 75 µl per well) using a Janus Liquid Handling Workstation (PerkinElmer, Seer Green, UK) and incubated overnight. Compound libraries (TDI Expanded Oncology Drug Set and SelleckChem Bioactive Compound Library; 10 mM in DMSO) were thawed at room temperature and serially diluted in complete DMEM containing dimethyl sulfoxide (DMSO) using an Echo Acoustic Liquid Handler (Labcyte). Diluted compounds (or DMSO as negative control) were added to cells (75 µl per well) using the Janus workstation and incubated for 24 hours. The WEE1 inhibitor AZD1775 was added using the same procedure and incubated for a further 72 hours as a positive control (33). Cell viability was then measured using the resazurin assay. Statistical Analysis Statistical analysis of compound screening data was performed using HTScape software developed in-house at the University of Oxford by Dr Francesca Buffa’s group. Raw resazurin output files and compound annotation files were uploaded, Z-scores calculated, and differential Z-scores used to compute permutation-based false-positive discovery rates (PFP). Hits with PFP < 0.05 were considered statistically significant. Statistical analysis of other experimental data was performed using GraphPad Prism 8 (GraphPad Software, San Diego, CA, USA). Validation of Positive Hits Cells were seeded into 96-well plates (2,000 cells per well) overnight. Compounds were added as two-fold serial dilutions (maximum concentration 20 µM) in existing medium. After 48 hours, cell viability was measured using the resazurin assay. Drugs and Inhibitors RITA (NSC 652287) and 2,6-dichloro-4-nitrophenol (DCNP) were obtained from Selleck Chemicals (Houston, TX, USA). Compounds were dissolved in DMSO and stored at −80 °C. Resazurin Assay for Cell Viability At the indicated time point, culture medium was replaced with 100 µl fresh complete medium without phenol red containing 20 µg ml⁻¹ resazurin (Sigma-Aldrich, Gillingham, UK). After 2 hours at 37 °C, fluorescence was measured using a plate reader (BMG Labtech, Ortenberg, Germany). IC₅₀ was defined as the concentration reducing viability by 50%. Clonogenic Survival Assay Cells were seeded into 6-well plates at low density and incubated overnight. Medium was replaced with DMSO- or drug-containing medium and cells were incubated for 10 days. Wells were washed with PBS and stained with Brilliant Blue R Concentrate (Sigma-Aldrich, Gillingham, UK) for 1 hour. Plating efficiency and surviving fraction were calculated as described previously (36). Apoptosis Detection Assay Apoptotic cell death was measured using the RealTime-Glo™ Annexin V Apoptosis and Necrosis Assay (Promega, Southampton, UK) according to the manufacturer’s instructions. Cells were seeded at 3,000 cells per well in 96-well plates overnight and treated the following day. Detection reagent was added at 2× concentration and luminescence measured after 30 hours using a plate reader (BMG Labtech, Ortenberg, Germany). siRNA Transfection siRNAs (10–20 nM final concentration) were delivered using Lipofectamine RNAiMAX (Life Technologies, Paisley, UK) by reverse transfection in complete medium without penicillin and streptomycin. Medium was replaced after 16 hours and cells were analysed ≥48 hours post-transfection. Knockdown efficiency was assessed by western blotting. siSETD2 (pooled; Dharmacon, Cambridge, UK): GAAACCGUCUCCAGUCUGU; UAAAGGAGGUAUAUCGAAU siSULT1A1 (pooled; Life Technologies, Paisley, UK): ACCAAGCGGCUCAAGAAUAAA; GAGAAGUUCAUGGUCGGAGAA Quantitative RT-PCR Total RNA was purified using the RNeasy kit (Qiagen, Hilden, Germany) and cDNA prepared using the SuperScript RT-PCR system (Invitrogen, Paisley, UK). Quantitative RT-PCR was performed using SYBR™ Green PCR Master Mix (Applied Biosystems, Warrington, UK) on a 7500 Fast Real-Time PCR System (Applied Biosystems, Warrington, UK). Reactions were run in triplicate and analysed using the comparative CT method. Expression was normalised to GAPDH and expressed relative to control conditions. Primers used were: CDKN1A Fwd 5’-TGTCCGTCAGAACCCATGC-3’ CDKN1A Rev 5’-AAAGTCGAAGTTCCATCGCTC-3’ MDM2 Fwd 5’-TCGACCTAAAAATGGTTGCAT-3’ MDM2 Rev 5’- GGCAGGGCTTATTCCTTTTC-3’ PPM1D Fwd 5’-GGGAGTGATGGACTTTGGAA-3’ PPM1D Rev 5’-CAAGATTGTCCATGCTCACC-3’ PUMA Fwd 5’- TCTCGGTGCTCCTTCACTCT-3’ PUMA Rev 5’- ACGTTTGGCTCATTTGCTCT-3’ TP53 Fwd 5’- CAGCACATGACGGAGGTTGT-3’ TP53 Rev 5’- TCATCCAAATACTCCACACGC-3’ SULT1A1 Fwd 5’-CGGCACTACCTGGGTAAGC-3’ SULT1A1 Rev 5’- CACCCGCATGAAGATGGGAG-3’ GAPDH Fwd 5’-AGCCACATCGCTCAGACAC-3’ GAPDH Rev 5’-GCCCAATACGACCAAATCC-3’ Histone Extraction This protocol was adapted with modifications from Dr. Junjie Chen’s laboratory (37) by Dr. Raul Mostoslavsky’s group. Cells were lysed in buffer containing 10 mM HEPES (pH 7.4), 10 mM KCl and 0.05% NP-40 supplemented with protease and phosphatase inhibitors, followed by centrifugation (17,000 g, 10 minutes, 4 °C). Nuclear pellets were washed once, resuspended in 0.2 M HCl (20 minutes on ice), and centrifuged again. The supernatant containing histones was collected and protein concentration determined by Bradford assay. Western Blotting Whole-cell lysates were prepared in Tris/NaCl/Triton X-100 lysis buffer containing protease and phosphatase inhibitors, clarified by centrifugation (17,000 g, 10 minutes, 4 °C), and quantified by Bradford assay. Samples (25 µg) were denatured in NuPAGE LDS loading buffer with dithiothreitol (Life Technologies, Paisley, UK), resolved by SDS–PAGE and transferred according to the manufacturer’s instructions. Membranes were blocked, incubated with primary antibodies overnight at 4 °C, followed by HRP-conjugated secondary antibodies and chemiluminescent detection (Thermo Scientific, Loughborough, UK). Primary antibodies are listed here: H3K36me3 and histone H3 (Abcam, Cambridge, UK); RRM2 and p53 (Santa Cruz Biotechnology, Heidelberg, Germany); phospho-p53 (Ser15), phospho-CHK1 (Ser317), CHK1, phospho-CHK2 (Thr68), CHK2 and p21 (Cell Signaling Technology, Leiden, The Netherlands); caspase-3 (Abcam, Cambridge, UK); SULT1A1 (R&D Systems, Abingdon, UK); and GAPDH (Novus Biologicals, Abingdon, UK). Cell Cycle Analysis by BrdU Incorporation 10 5 cells/well in 2 mL of complete DMEM were seeded in 6-well plates and pulse-labelled with 20 µM bromodeoxyuridine (BrdU; Sigma-Aldrich, Gillingham, UK) for 30 minutes. Cells were harvested, fixed in 70% ethanol, denatured in 2 M HCl, and stained with anti-BrdU monoclonal antibody (BD Biosciences, Oxford, UK) followed by Alexa Fluor 488-conjugated secondary antibody (Life Technologies, Paisley, UK). DNA content was assessed using propidium iodide (Sigma-Aldrich, Gillingham, UK), and samples were analysed using a FACSCalibur flow cytometer (Becton Dickinson, Oxford, UK). Immunofluorescence Staining of Foci 10 5 cells/well in 2 mL of complete DMEM were seeded onto glass coverslips placed in 6-well plates overnight. At the desired time point after treatment, pre-extraction buffer (10 mM PIPES pH 6.8, 300 mM sucrose, 100 mM NaCl, 1.5 mM MgCl 2, and 0.5% Triton X-100) was added for 2 minutes on ice. Cells were fixed in 4% paraformaldehyde, blocked, and incubated with primary antibodies overnight at 4 °C. Following incubation with fluorescent secondary antibodies, nuclei were counterstained with Hoechst 33342 (Molecular Probes, Paisley, UK). Coverslips were mounted using VECTASHIELD® Antifade Mounting Medium (Vector Laboratories, Peterborough, UK) and imaged using a Zeiss 710 confocal microscope (Carl Zeiss, Cambridge, UK). Primary antibodies used were phospho-RPA (Ser33) (Bethyl Laboratories, Montgomery, TX, USA), 53BP1 (GeneTex, Irvine, CA, USA) and γH2AX (Novus Biologicals, Abingdon, UK). DNA Fibre Assay Cells were seeded to approximately 20% confluency and sequentially labelled with 30 µM CldU and 250 µM IdU (Sigma-Aldrich, Gillingham, UK). RITA (150 nM) or DMSO was present during the IdU pulse. DNA fibre spreads were prepared on glass slides, denatured, blocked, and stained with rat anti-BrdU (CldU-specific; Abcam, Cambridge, UK) and mouse anti-BrdU (IdU-specific; BD Biosciences, Oxford, UK), followed by Alexa Fluor 488- and Cy3-conjugated secondary antibodies (Molecular Probes, Paisley, UK; Jackson ImmunoResearch, Ely, UK). Slides were mounted using ProLong® Gold Antifade Mountant (Life Technologies, Paisley, UK) and imaged using a Nikon Ni-E microscope (Nikon Instruments Europe, Amsterdam, The Netherlands). Fibre lengths were quantified using Fiji software, with ≥200 fibres analysed per condition. Modified Single-Cell Gel Electrophoresis (Comet) Assay A modified alkaline comet assay was performed to assess DNA crosslinking activity as described (38). Cells were seeded overnight and treated with DMSO, RITA or mitomycin C, harvested, and stored at −80 °C in freezing medium. Samples were thawed, irradiated with 5 Gy (Xstrahl RS320 X-Ray Irradiator system) where indicated, embedded in low-melting-point agarose, lysed, electrophoresed under alkaline conditions, and stained with propidium iodide. Comet tails were visualised using an Olympus BH-2-RFL-T2 fluorescence microscope (Olympus, Southend-on-Sea, UK) and analysed using Komet software (Andor Technology, Belfast, UK). Synthesis of RITA Structural Variants Synthesis and characterisation of RITA structural variants are described in the Supplementary Information. 2D Thermal Profiling (2D-TPP) 2D thermal proteome profiling was performed as described previously (39, 40). SETD2 -/- U2OS cells were treated with RITA (10–500 nM) or vehicle for 30 minutes, heated at fixed temperatures (42–64 °C), and soluble fractions analysed by LC–MS/MS. Data were processed using Proteome Discoverer (Thermo Scientific, Loughborough, UK) and analysed using TP-MAP (41). Gene ontology analysis was performed using PAN-GO Human Functionome (https://functionome.geneontology.org/) (42). RESULTS SETD2-deficient cancer cells are hypersensitive to RITA To identify therapeutic vulnerabilities associated with loss of H3K36me3, we performed a high-throughput synthetic lethality screen using >2,000 small molecules in CRISPR/Cas9 SETD2-deleted U2OS osteosarcoma cells and isogenic parental controls (33) (Table S1). As reported previously, inhibitors of WEE1 and CHK1 showed selective toxicity in SETD2-deficient cells (33). However, ranking compounds by Z-score revealed RITA (NSC 652287) as the most potent and selective hit. Dose–response analyses demonstrated a marked difference in RITA sensitivity between parental and SETD2-CRISPR cells (Fig. S1), which persisted at nanomolar concentrations, yielding an IC50 of ~12 nM in SETD2-deficient U2OS cells (Fig. 1A). RITA was originally identified in the NCI Anticancer Drug Screen, where it showed selective activity against renal carcinoma cell lines, including A498 (34). Consistent with this, SETD2-mutant renal carcinoma cell lines A498 and LB996 displayed pronounced RITA sensitivity (IC50 7.45 nM and 0.63 nM, respectively), whereas the SETD2-wild-type 786-O line was comparatively resistant (Fig. 1B). Clonogenic survival assays confirmed the exquisite sensitivity of SETD2-deficient cells to RITA (Fig. 1C). Together, these data indicate that SETD2 loss confers strong and selective sensitivity to RITA across multiple tumour contexts. RITA induces p53 activation and apoptosis preferentially in SETD2-deficient cells RITA has been reported to stabilise p53 by disrupting its interaction with MDM2 (35). Given that SETD2 can regulate p53 target gene expression (43), we examined p53 responses following RITA treatment. RITA induced marked accumulation of total and Ser15-phosphorylated p53 in SETD2-CRISPR U2OS and SETD2-mutant A498 cells, but not in SETD2-proficient controls (Fig. 2A). Consistent with p53 activation, RITA treatment triggered apoptotic cell death selectively in SETD2-deficient cells. Cleaved caspase-3 was strongly induced in SETD2-CRISPR U2OS and A498 cells, but not in their SETD2-wild-type counterparts (Fig. 2B). Annexin V luminescence assays confirmed significantly elevated apoptosis in SETD2-deficient U2OS cells following RITA treatment (Fig. 2C). Quantitative RT-PCR analysis revealed increased expression of canonical p53 target genes, including CDKN1A, MDM2, PPM1D, and PUMA, with greater induction observed in SETD2-deficient cells (Fig. 2D). Notably, CDKN1A expression was already elevated following SETD2 deletion and remained higher after RITA treatment (Fig. 2E). In contrast, TP53 mRNA levels were unchanged (Fig. S2), indicating post-translational stabilisation of p53. Despite early reports proposing p53 reactivation as the primary mechanism of RITA cytotoxicity (35), accumulating evidence suggests p53-independent effects (44). Consistent with this, TP53-CRISPR deletion reduced but did not abolish RITA sensitivity (Fig. 2F). Importantly, siRNA-mediated SETD2 depletion enhanced RITA toxicity regardless of p53 status (Fig. 2G,H), indicating that p53 activation contributes to but does not drive RITA sensitivity. RITA induces replication stress and DNA damage signalling in SETD2-deficient cells To investigate the basis of RITA selectivity, we examined cell-cycle progression following treatment. RITA caused dose-dependent accumulation of non-replicating S-phase cells and G2/M arrest in SETD2-CRISPR U2OS and SETD2-mutant A498 cells (Fig. 3A; Fig. S3), suggesting impaired DNA synthesis and checkpoint activation. This phenotype resembled that observed following WEE1 inhibition in SETD2-deficient cells, which is mediated by depletion of the RNR subunit RRM2 (33). However, exogenous nucleoside supplementation failed to rescue RITA toxicity (Fig. S4A), and RITA did not alter RRM2 protein levels (Fig. S4B), indicating a distinct mechanism. Consistent with replication stress, RITA induced robust activation of the ATR–CHK1 pathway, increased γH2AX, and elevated p21 levels, with markedly stronger responses in SETD2-CRISPR cells (Fig. 3B). γH2AX foci were selectively induced in SETD2-deficient cells (Fig. 3C,D). Notably, CHK2 phosphorylation was absent, suggesting replication-associated DNA damage rather than frank double-strand breaks. Given SETD2’s role in homologous recombination (18), we assessed whether HR deficiency underlies RITA sensitivity. However, siRNA depletion of RAD51 or BRCA1 failed to sensitise SETD2-proficient cells to RITA (Fig. S4C), indicating that defective HR is not the primary determinant of sensitivity. Immunofluorescence analysis revealed pronounced accumulation of phospho-RPA (Ser33) and 53BP1 foci in SETD2-CRISPR cells following RITA treatment (Fig. 4A,B). DNA fibre assays demonstrated a rapid and selective reduction in replication fork velocity in SETD2-deficient cells within 30 minutes of exposure (Fig. 4C,D). These findings establish that RITA rapidly induces replication stress specifically in the absence of SETD2. Although RITA has been proposed to act as a DNA crosslinker (45), modified comet assays revealed no evidence of crosslink formation, in contrast to mitomycin C (Fig. S5A). SETD2-CRISPR cells were also not hypersensitive to mitomycin C (Fig. S5B), consistent with the lack of HR dependence. RITA sensitivity is mediated by SULT1A1 activity in SETD2-deficient cells Previous studies identified a correlation between RITA sensitivity and expression of the phenol sulfotransferase SULT1A1 (46). siRNA-mediated depletion of SULT1A1 significantly reduced RITA sensitivity in SETD2-CRISPR U2OS cells (Fig. 5A). Both SULT1A1 protein and mRNA were markedly upregulated in SETD2-deficient cells (Fig. 5B; Fig. S6A), suggesting that SETD2 represses SULT1A1 expression. Pharmacological inhibition of sulfotransferase activity using DCNP (47) strongly rescued RITA toxicity in SETD2-CRISPR cells, restoring viability and clonogenic survival to near-control levels (Fig. 5C,D). DCNP also reversed RITA-induced p53 stabilisation, caspase-3 cleavage, cell-cycle arrest, and replication stress marker accumulation (Fig. 5E–I). These data demonstrate that SULT1A1 activity is required for RITA-induced replication stress, DNA damage signalling, and apoptosis. Structural determinants of RITA activity in SETD2-deficient cells RITA has been proposed to act as a SULT1A1-activated prodrug that generates a reactive electrophile following sulfation and elimination (48). To define structure–activity relationships, we synthesised RITA variants modifying its terminal hydroxymethyl groups and central furan ring (Fig. 6A). A dialdehyde variant (RV-6) retained selective activity against SETD2-deficient cells, albeit with reduced potency (Fig. 6B). In contrast, methyl ester derivatives lacking free hydroxymethyl groups (RV-11, RV-12) were inactive (Fig. S10), consistent with impaired sulfation. Removal of the central furan ring (RV-14) reduced but did not abolish activity (Fig. 6C), whereas corresponding dialdehyde variants were further attenuated (Fig. S10D). Intermediates lacking key functional groups showed non-selective toxicity (Fig. S14). These results identify the terminal hydroxymethyl groups and overall ring architecture as critical for selective activity. YC-1, a SULT1A1-activated electrophilic compound (49), was also selectively toxic to SETD2-deficient U2OS cells, though less potent than RITA (Fig. 6D). This suggests that SETD2 loss sensitises cells to a broader class of SULT1A1-dependent alkylating agents. Identification of RITA targets by thermal profiling To identify proteins targeted by activated RITA, we performed 2D thermal proteome profiling in SETD2-CRISPR KO U2OS cells treated with RITA. Across 7,744 detected proteins (Fig. 7A; Table S2), RITA induced widespread changes in protein thermal stability. Enriched GO terms included cell-cycle regulation, mRNA splicing, and replication stress. Notably, a total of 153 replication stress-associated proteins exhibited altered stability (Table S2). These findings indicate that activated RITA engages multiple essential proteins rather than a single dominant target, providing a mechanistic basis for the rapid replication collapse observed in SETD2-deficient cells. DISCUSSION A central aim of personalised cancer medicine is to exploit tumour-specific genetic vulnerabilities. Large-scale cancer genome sequencing efforts have identified frequent inactivation of the histone H3 lysine 36 methyltransferase and tumour suppressor SETD2, particularly in renal cell carcinomas, highlighting SETD2 loss as a potential therapeutic target ( 28 ). In this study, we uncover a previously unrecognised vulnerability of SETD2-deficient cells and show that loss of SETD2 leads to upregulation of the sulfotransferase SULT1A1, thereby conferring selective sensitivity to the SULT1A1-activated prodrug RITA. Using an unbiased synthetic lethality screen of approximately 2,000 compounds, we identified RITA as a potent and selective inhibitor of SETD2-deficient cells at nanomolar concentrations. Mechanistic analyses support a model in which RITA is converted into a cytotoxic species through SULT1A1 activity, resulting in DNA replication stalling, accumulation of DNA damage, and apoptotic cell death. Thus, SETD2 deficiency renders cells uniquely susceptible to an otherwise relatively inert compound. RITA (2,5-bis[5-hydroxymethyl-2-thienyl] furan; NSC652287) was originally identified in the NCI Anticancer Drug Screen, where it exhibited notable selectivity for renal carcinoma cell lines, including A498 ( 34 ). Despite this early promise, its mechanism of action has remained controversial. Proposed models have included DNA/protein crosslinking ( 45 ), modulation of HIF1 signalling ( 50 ), and disruption of the TP53–MDM2 interaction leading to p53 reactivation ( 35 , 51 , 52 ). However, multiple observations—including our own—suggest that p53 reactivation alone cannot account for RITA-induced cytotoxicity, and instead point to replication stress and DNA damage as central features of its activity ( 34 , 44 , 45 ). Consistent with this, RITA treatment of SETD2-deficient cells caused rapid replication fork slowing, increased numbers of non-replicating S-phase cells, and induction of replication stress and DNA damage markers, including phospho-RPA, 53BP1, phospho-CHK1, p21, and γH2AX. This was accompanied by p53 stabilisation and caspase-3–dependent apoptosis. Although p53 loss partially reduced RITA sensitivity, SETD2 depletion enhanced RITA toxicity independently of p53 status, indicating that p53 activation is a downstream consequence rather than the primary driver of cell death. Structural and functional analyses further support this conclusion: a truncated RITA analogue predicted to disrupt p53 binding retained substantial biological activity, and thermal profiling revealed that activated RITA alters the stability of multiple proteins involved in DNA replication and stress responses. Together with prior predictions of promiscuous target engagement ( 48 ), these findings suggest that activated RITA functions as a broadly reactive electrophile rather than a selective p53 modulator. Crucially, our data identify SULT1A1 as the key determinant of RITA activity in SETD2-deficient cells. Recent work has proposed that RITA acts as a SULT1A1-activated prodrug ( 48 ), and our findings strongly support this model. SETD2 loss resulted in increased SULT1A1 expression, while genetic or pharmacological inhibition of SULT1A1 attenuated RITA cytotoxicity. Moreover, structural modifications that blocked sulfation abrogated activity, whereas sulfatable variants retained selective toxicity. In line with this, the SULT1A1-activated compound YC-1 also selectively targeted SETD2-deficient cells ( 49 ). Together, these observations demonstrate that SULT1A1-dependent activation underlies the selective cytotoxicity of RITA and related compounds. Importantly, our findings provide a mechanistic explanation for the original observation that RITA preferentially targeted renal carcinoma cell lines ( 45 ). SETD2-deficient renal cancer cells, including A498, express SULT1A1 and exhibit marked RITA sensitivity, whereas SETD2-proficient cells do not ( 46 ). Although the precise mechanism by which SETD2 represses SULT1A1 remains unclear, this is consistent with evidence linking Set2/H3K36 methylation to transcriptional repression ( 53 ). Given the high frequency of SETD2 mutations in renal cell carcinoma ( 29 ), these findings suggest that SETD2-deficient tumours may be broadly susceptible to SULT1A1-activated prodrugs. While RITA itself failed clinically due to pulmonary toxicity ( 48 ), our work establishes SETD2 loss–induced SULT1A1 expression as a mechanistic basis for selective prodrug sensitivity, revealing a promising strategy for targeting SETD2-deficient cancers. Declarations AUTHOR CONTRIBUTIONS K.A.L. designed the experiments, except the high-throughput compound screen, which was designed by E.S. and D.E. K.A.L., S.S., and E.S. conducted the compound screen. C.T. and F.B. contributed to the statistical analysis of the screen results. K.A.L. and S.S. validated the screen hits. The RITA variants were synthesized by D.S, and supervised by B.S and S.J.C., and tested by K.A.L. K.A.L. F.O and T.C.H. wrote the manuscript. Supplementary data written by D.S. Work was supervised by G.D.J., F.B., D.E., K.V.M.H. and T.C.H. All main figures were performed by K.A.L. O.B contributed to Fig. 6. Fig. S1 was performed by K.A.L. and S.S. Fig. S2 -4 were performed by K.A.L. Fig. S5 was performed by C.C., M.C., and K.A.L. Fig. S6 and Fig. S1 0 were performed by K.A.L. Figure 7.A 2D-TPP analysis was performed by J.A.W, F.F., and K.V.M.H., with Volcano plot by O.B. Figure 7.B Model by D.S. and T.C.H. ACKNOWLEDGMENTS We would like to thank Valentine Macaulay, Benoit Van den Eynde, and Ross Chapman for generously providing cancer cell lines, Peter McHugh, B. Kessler, S. Bonham and R. Fischer from the TDI Discovery Proteomics Facility, Oxford University for useful discussions, and John Spencer for critically reading the manuscript. This research was supported by the Medical Research Council (grants MC_UU_00001/4; MR/X006778/1), Cancer Research UK, and the Oxford-based charity UCARE (Urology Cancer Research and Education). The Bruker Avance NEO 600 MHz NMR spectrometer was funded by the John Fell Oxford University Press Research Fund and an EPSRC Strategic Equipment Grant (EP/T019190/1). J.A.W, F.F, and K.V.M.H. are grateful for funding by Myeloma UK and the Joyce and Norman Freed Trust. References Kaelin WG, Jr. The concept of synthetic lethality in the context of anticancer therapy. Nat Rev Cancer. 2005;5(9):689-98. Druker BJ. Perspectives on the development of a molecularly targeted agent. Cancer Cell. 2002;1(1):31-6. Hartman JLt, Garvik B, Hartwell L. Principles for the buffering of genetic variation. Science. 2001;291(5506):1001-4. Peng S, Long M, Chen Q, Yin Z, Zeng C, Zhang W, et al. Perspectives on cancer therapy-synthetic lethal precision medicine strategies, molecular mechanisms, therapeutic targets and current technical challenges. Cell Death Discov. 2025;11(1):179. Campbell JD, Alexandrov A, Kim J, Wala J, Berger AH, Pedamallu CS, et al. Distinct patterns of somatic genome alterations in lung adenocarcinomas and squamous cell carcinomas. Nat Genet. 2016;48(6):607-16. Fraga MF, Ballestar E, Villar-Garea A, Boix-Chornet M, Espada J, Schotta G, et al. Loss of acetylation at Lys16 and trimethylation at Lys20 of histone H4 is a common hallmark of human cancer. Nat Genet. 2005;37(4):391-400. Gao YB, Chen ZL, Li JG, Hu XD, Shi XJ, Sun ZM, et al. Genetic landscape of esophageal squamous cell carcinoma. Nat Genet. 2014;46(10):1097-102. Gui Y, Guo G, Huang Y, Hu X, Tang A, Gao S, et al. Frequent mutations of chromatin remodeling genes in transitional cell carcinoma of the bladder. Nat Genet. 2011;43(9):875-8. Huether R, Dong L, Chen X, Wu G, Parker M, Wei L, et al. The landscape of somatic mutations in epigenetic regulators across 1,000 paediatric cancer genomes. Nat Commun. 2014;5:3630. Edmunds JW, Mahadevan LC, Clayton AL. Dynamic histone H3 methylation during gene induction: HYPB/Setd2 mediates all H3K36 trimethylation. EMBO J. 2008;27(2):406-20. Gerber M, Shilatifard A. Transcriptional elongation by RNA polymerase II and histone methylation. J Biol Chem. 2003;278(29):26303-6. Krogan NJ, Kim M, Tong A, Golshani A, Cagney G, Canadien V, et al. Methylation of histone H3 by Set2 in Saccharomyces cerevisiae is linked to transcriptional elongation by RNA polymerase II. Mol Cell Biol. 2003;23(12):4207-18. Li J, Moazed D, Gygi SP. Association of the histone methyltransferase Set2 with RNA polymerase II plays a role in transcription elongation. J Biol Chem. 2002;277(51):49383-8. Yoh SM, Lucas JS, Jones KA. The Iws1:Spt6:CTD complex controls cotranscriptional mRNA biosynthesis and HYPB/Setd2-mediated histone H3K36 methylation. Genes Dev. 2008;22(24):3422-34. Luco RF, Pan Q, Tominaga K, Blencowe BJ, Pereira-Smith OM, Misteli T. Regulation of alternative splicing by histone modifications. Science. 2010;327(5968):996-1000. Carvalho S, Raposo AC, Martins FB, Grosso AR, Sridhara SC, Rino J, et al. Histone methyltransferase SETD2 coordinates FACT recruitment with nucleosome dynamics during transcription. Nucleic Acids Res. 2013;41(5):2881-93. Li F, Mao G, Tong D, Huang J, Gu L, Yang W, et al. The histone mark H3K36me3 regulates human DNA mismatch repair through its interaction with MutSalpha. Cell. 2013;153(3):590-600. Pfister SX, Ahrabi S, Zalmas LP, Sarkar S, Aymard F, Bachrati CZ, et al. SETD2-dependent histone H3K36 trimethylation is required for homologous recombination repair and genome stability. Cell Rep. 2014;7(6):2006-18. Carvalho S, Vitor AC, Sridhara SC, Martins FB, Raposo AC, Desterro JM, et al. SETD2 is required for DNA double-strand break repair and activation of the p53-mediated checkpoint. Elife. 2014;3:e02482. Kanu N, Gronroos E, Martinez P, Burrell RA, Yi Goh X, Bartkova J, et al. SETD2 loss-of-function promotes renal cancer branched evolution through replication stress and impaired DNA repair. Oncogene. 2015;34(46):5699-708. Bleuyard JY, Fournier M, Nakato R, Couturier AM, Katou Y, Ralf C, et al. MRG15-mediated tethering of PALB2 to unperturbed chromatin protects active genes from genotoxic stress. Proc Natl Acad Sci U S A. 2017;114(29):7671-6. Pai CC, Kishkevich A, Deegan RS, Keszthelyi A, Folkes L, Kearsey SE, et al. Set2 Methyltransferase Facilitates DNA Replication and Promotes Genotoxic Stress Responses through MBF-Dependent Transcription. Cell Rep. 2017;20(11):2693-705. Sharda A, Humphrey TC. The role of histone H3K36me3 writers, readers and erasers in maintaining genome stability. DNA Repair (Amst). 2022;119:103407. Park IY, Powell RT, Tripathi DN, Dere R, Ho TH, Blasius TL, et al. Dual Chromatin and Cytoskeletal Remodeling by SETD2. Cell. 2016;166(4):950-62. Dalgliesh GL, Furge K, Greenman C, Chen L, Bignell G, Butler A, et al. Systematic sequencing of renal carcinoma reveals inactivation of histone modifying genes. Nature. 2010;463(7279):360-3. Duns G, Hofstra RM, Sietzema JG, Hollema H, van Duivenbode I, Kuik A, et al. Targeted exome sequencing in clear cell renal cell carcinoma tumors suggests aberrant chromatin regulation as a crucial step in ccRCC development. Hum Mutat. 2012;33(7):1059-62. Zbar B, Brauch H, Talmadge C, Linehan M. Loss of alleles of loci on the short arm of chromosome 3 in renal cell carcinoma. Nature. 1987;327(6124):721-4. Hakimi AA, Ostrovnaya I, Reva B, Schultz N, Chen YB, Gonen M, et al. Adverse outcomes in clear cell renal cell carcinoma with mutations of 3p21 epigenetic regulators BAP1 and SETD2: a report by MSKCC and the KIRC TCGA research network. Clin Cancer Res. 2013;19(12):3259-67. Ho TH, Park IY, Zhao H, Tong P, Champion MD, Yan H, et al. High-resolution profiling of histone h3 lysine 36 trimethylation in metastatic renal cell carcinoma. Oncogene. 2016;35(12):1565-74. Fontebasso AM, Schwartzentruber J, Khuong-Quang DA, Liu XY, Sturm D, Korshunov A, et al. Mutations in SETD2 and genes affecting histone H3K36 methylation target hemispheric high-grade gliomas. Acta Neuropathol. 2013;125(5):659-69. Newbold RF, Mokbel K. Evidence for a tumour suppressor function of SETD2 in human breast cancer: a new hypothesis. Anticancer Res. 2010;30(9):3309-11. Pai CC, Hsu KF, Durley SC, Keszthelyi A, Kearsey SE, Rallis C, et al. An essential role for dNTP homeostasis following CDK-induced replication stress. J Cell Sci. 2019;132(6). Pfister Sophia X, Markkanen E, Jiang Y, Sarkar S, Woodcock M, Orlando G, et al. Inhibiting WEE1 Selectively Kills Histone H3K36me3-Deficient Cancers by dNTP Starvation. Cancer Cell. 2015;28(5):557-68. Rivera MI, Stinson SF, Vistica DT, Jorden JL, Kenney S, Sausville EA. Selective toxicity of the tricyclic thiophene NSC 652287 in renal carcinoma cell lines: differential accumulation and metabolism. Biochem Pharmacol. 1999;57(11):1283-95. Issaeva N, Bozko P, Enge M, Protopopova M, Verhoef LG, Masucci M, et al. Small molecule RITA binds to p53, blocks p53-HDM-2 interaction and activates p53 function in tumors. Nat Med. 2004;10(12):1321-8. Franken NA, Rodermond HM, Stap J, Haveman J, van Bree C. Clonogenic assay of cells in vitro. Nat Protoc. 2006;1(5):2315-9. Huang J, Huen MS, Kim H, Leung CC, Glover JN, Yu X, et al. RAD18 transmits DNA damage signalling to elicit homologous recombination repair. Nat Cell Biol. 2009;11(5):592-603. Spanswick VJ, Hartley JM, Hartley JA. Measurement of DNA interstrand crosslinking in individual cells using the Single Cell Gel Electrophoresis (Comet) assay. Methods Mol Biol. 2010;613:267-82. Becher I, Werner T, Doce C, Zaal EA, Togel I, Khan CA, et al. Thermal profiling reveals phenylalanine hydroxylase as an off-target of panobinostat. Nat Chem Biol. 2016;12(11):908-10. Huber KV, Olek KM, Muller AC, Tan CS, Bennett KL, Colinge J, et al. Proteome-wide drug and metabolite interaction mapping by thermal-stability profiling. Nat Methods. 2015;12(11):1055-7. Feyertag FH, K.V.M. TP-MAP - an Integrated Software Package for the Analysis of 1D and 2D Thermal Profiling Data. bioRxiv. 2021. Feuermann M, Mi H, Gaudet P, Muruganujan A, Lewis SE, Ebert D, et al. A compendium of human gene functions derived from evolutionary modelling. Nature. 2025;640(8057):146-54. Xie P, Tian C, An L, Nie J, Lu K, Xing G, et al. Histone methyltransferase protein SETD2 interacts with p53 and selectively regulates its downstream genes. Cell Signal. 2008;20(9):1671-8. Wanzel M, Vischedyk JB, Gittler MP, Gremke N, Seiz JR, Hefter M, et al. CRISPR-Cas9-based target validation for p53-reactivating model compounds. Nat Chem Biol. 2016;12(1):22-8. Nieves-Neira W, Rivera MI, Kohlhagen G, Hursey ML, Pourquier P, Sausville EA, et al. DNA protein cross-links produced by NSC 652287, a novel thiophene derivative active against human renal cancer cells. Mol Pharmacol. 1999;56(3):478-84. Rees MG, Seashore-Ludlow B, Cheah JH, Adams DJ, Price EV, Gill S, et al. Correlating chemical sensitivity and basal gene expression reveals mechanism of action. Nat Chem Biol. 2016;12(2):109-16. Seah VM, Wong KP. 2,6-Dichloro-4-nitrophenol (DCNP), an alternate-substrate inhibitor of phenolsulfotransferase. Biochem Pharmacol. 1994;47(10):1743-9. Peyser BD, Hermone A, Salamoun JM, Burnett JC, Hollingshead MG, McGrath CF, et al. Specific RITA Modification Produces Hyperselective Cytotoxicity While Maintaining In Vivo Antitumor Efficacy. Mol Cancer Ther. 2019;18(10):1765-74. Shi L, Shen W, Davis MI, Kong K, Vu P, Saha SK, et al. SULT1A1-dependent sulfonation of alkylators is a lineage-dependent vulnerability of liver cancers. Nat Cancer. 2023;4(3):365-81. Lou JJ, Chua YL, Chew EH, Gao J, Bushell M, Hagen T. Inhibition of hypoxia-inducible factor-1alpha (HIF-1alpha) protein synthesis by DNA damage inducing agents. PLoS One. 2010;5(5):e10522. Doggrell SA. RITA--a small-molecule anticancer drug that targets p53. Expert Opin Investig Drugs. 2005;14(6):739-42. Grinkevich VV, Vema A, Fawkner K, Issaeva N, Andreotti V, Dickinson ER, et al. Novel Allosteric Mechanism of Dual p53/MDM2 and p53/MDM4 Inhibition by a Small Molecule. Front Mol Biosci. 2022;9:823195. Strahl BD, Grant PA, Briggs SD, Sun ZW, Bone JR, Caldwell JA, et al. Set2 is a nucleosomal histone H3-selective methyltransferase that mediates transcriptional repression. Mol Cell Biol. 2002;22(5):1298-306. Additional Declarations There is NO conflict of interest to disclose. Supplementary Files LopezetalTableS1compoundlibrariescopy.xlsx Supplememental Table 1 LopezetalsupplementalfiguresFINAL.pdf Supplemental Figures LopezetalSupplementalRVsynthesisdetailsFINAL.pdf Supplemental materials LopezetalTableS22DTPPanalysiscopy.xlsx Supplemental Table 2 Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-8849233","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":592687074,"identity":"0ae5bbb4-f6aa-494f-9fd2-a271cfcc27bf","order_by":0,"name":"Timothy Humphrey","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABH0lEQVRIiWNgGAWjYDACZiBmbGBgMICyGfiRZUEy6IAHpOwgshbJBkJaGNC1GBwgoMWenTvx8ccdhxnMJbLTHhfusUncfP6M8ccfFYcZ+NsPsEnOwOYw3s0GB88cZrCckbvdeMaztMRtN3LMpHnOpDFInElgk9yAVcs2iYNthxkMbuRuk+Y5cBiohceMmbHNhoHhBgOb5APCWv4nbu4HOuznPwkGeSK1HEjcwJBjIMHbYAMUYcDusMNAv5xtS+cxOPN2uzHPgWTjGTfSyqR5jqXxGJ5JbLbE4n32/rMbH1S2WcsZHM/d9pjngJ1sf//hzR9/1ByWkzt++ODNHkwtUNAMih82EMuxAWY/9liBgzoGmBZ7PKpGwSgYBaNghAIARNZr4tJ9Am0AAAAASUVORK5CYII=","orcid":"","institution":"University of Sussex","correspondingAuthor":true,"prefix":"","firstName":"Timothy","middleName":"","lastName":"Humphrey","suffix":""},{"id":592687075,"identity":"0e159267-9572-499b-83ef-1a397e665ce7","order_by":1,"name":"Kirsten Lopez","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Kirsten","middleName":"","lastName":"Lopez","suffix":""},{"id":592687076,"identity":"5c85b9bf-b986-4084-ac9c-3fd2462fd7a7","order_by":2,"name":"Deborah Sneddon","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Deborah","middleName":"","lastName":"Sneddon","suffix":""},{"id":592687077,"identity":"b0db24c6-be56-4af4-ae8a-ac2c4aa3929b","order_by":3,"name":"Sovan Sarkar","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Sovan","middleName":"","lastName":"Sarkar","suffix":""},{"id":592687078,"identity":"2ca24a13-b687-4859-8334-d969419eaa93","order_by":4,"name":"Oliver Busby","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Oliver","middleName":"","lastName":"Busby","suffix":""},{"id":592687079,"identity":"a0092341-47ba-4065-909d-f0aa5e6515e6","order_by":5,"name":"Elena Seraia","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Elena","middleName":"","lastName":"Seraia","suffix":""},{"id":592687080,"identity":"1eda6337-f77e-4f7c-b6ea-f2634f228c21","order_by":6,"name":"Chiara Toffanin","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Chiara","middleName":"","lastName":"Toffanin","suffix":""},{"id":592687081,"identity":"af14f844-38ef-47cd-9bee-8e493ff30c80","order_by":7,"name":"Christian Cooper","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Christian","middleName":"","lastName":"Cooper","suffix":""},{"id":592687082,"identity":"516187eb-f293-4a06-9813-080e453d69af","order_by":8,"name":"Michalis Challoumas","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Michalis","middleName":"","lastName":"Challoumas","suffix":""},{"id":592687083,"identity":"3087a9ca-92c5-430f-a12d-93eeb3d2461d","order_by":9,"name":"Fiona Okonjo","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Fiona","middleName":"","lastName":"Okonjo","suffix":""},{"id":592687084,"identity":"801fd1ad-b361-4bc5-88ea-4d1358acc6cb","order_by":10,"name":"George Jones","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"George","middleName":"","lastName":"Jones","suffix":""},{"id":592687085,"identity":"70a16c1c-b2d6-4076-9f67-48bd9b68c443","order_by":11,"name":"Francesca Buffa","email":"","orcid":"https://orcid.org/0000-0003-0409-406X","institution":"University of Oxford","correspondingAuthor":false,"prefix":"","firstName":"Francesca","middleName":"","lastName":"Buffa","suffix":""},{"id":592687086,"identity":"da47a9a9-ccb7-4936-92f7-39f18318b3e4","order_by":12,"name":"Daniel Ebner","email":"","orcid":"https://orcid.org/0000-0002-6495-7026","institution":"University of Oxford","correspondingAuthor":false,"prefix":"","firstName":"Daniel","middleName":"","lastName":"Ebner","suffix":""},{"id":592687087,"identity":"d3349482-1138-4e9d-885a-a60e65cd81ab","order_by":13,"name":"Jennifer Ward","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Jennifer","middleName":"","lastName":"Ward","suffix":""},{"id":592687088,"identity":"cd0845b6-93e3-4b54-a087-11af8cde738d","order_by":14,"name":"Felix Feyertag","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Felix","middleName":"","lastName":"Feyertag","suffix":""},{"id":592687089,"identity":"e5b5106d-6cba-4020-b716-3a2270a4ba95","order_by":15,"name":"Kilian Huber","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Kilian","middleName":"","lastName":"Huber","suffix":""},{"id":592687090,"identity":"4dac5dd4-2aee-4278-8dc3-1b7a60c50f50","order_by":16,"name":"Bart Cornelissen","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Bart","middleName":"","lastName":"Cornelissen","suffix":""},{"id":592687091,"identity":"eaa9a092-7b31-43a2-bed8-596b60bdffa9","order_by":17,"name":"Stuart Conway","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Stuart","middleName":"","lastName":"Conway","suffix":""}],"badges":[],"createdAt":"2026-02-11 08:42:04","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-8849233/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-8849233/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":103249656,"identity":"cb1a272c-ccbc-431d-bc67-01fbbe6883c8","added_by":"auto","created_at":"2026-02-23 15:43:08","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":346772,"visible":true,"origin":"","legend":"\u003cp\u003eSETD2-deficient cells are hypersensitive to RITA. \u003cstrong\u003e(A-B)\u003c/strong\u003e Dose response viability curves for \u003cstrong\u003e(A)\u003c/strong\u003eU2OS cells and \u003cstrong\u003e(B)\u003c/strong\u003e renal cell carcinoma cell lines with wild-type (786-O) or mutant (A498 and LB996) SETD2 treated with RITA. Data are shown as mean ± SD. \u003cstrong\u003e(C)\u003c/strong\u003e Clonogenic survival assay for parental and SETD2-CRISPR KO U2OS treated with RITA. Data are shown as mean ± SD.\u003c/p\u003e","description":"","filename":"LopezetalfiguresFINAL1.png","url":"https://assets-eu.researchsquare.com/files/rs-8849233/v1/f88d00239f88af95269b9f82.png"},{"id":103249657,"identity":"025d6179-f4dd-4426-abf6-9b92831103c7","added_by":"auto","created_at":"2026-02-23 15:43:08","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":667563,"visible":true,"origin":"","legend":"\u003cp\u003eRITA stabilizes and activates p53 and induces apoptosis in SETD2-deficient cancer cells. \u003cstrong\u003e(A) \u003c/strong\u003eWestern blot of total and phospho-p53 (Ser15) in parental and SETD2-CRISPR U2OS and RCC cell lines treated with the indicated doses of RITA for 48 hours. \u003cstrong\u003e(B) \u003c/strong\u003eWestern blot of procaspase 3 and cleaved caspase 3 in SETD2-CRISPR and parental U2OS and RCC cell lines after RITA treatment for 48 hours. \u003cstrong\u003e(C) \u003c/strong\u003eAnnexin V levels in SETD2-CRISPR KO and parental U2OS cells after RITA treatment for 30 hours. Luminescence readings were normalised to untreated controls. Data are shown as mean ± SD.\u003cstrong\u003e \u003c/strong\u003eP-values were calculated using the two-tailed Student’s t-test. **p \u0026lt; 0.01. \u003cstrong\u003e(D) \u003c/strong\u003eQuantitative RT-PCR analysis of p53 target gene expression after RITA treatment. Samples were normalised to the housekeeping gene \u003cem\u003eGAPDH\u003c/em\u003e. Fold change was calculated relative to untreated controls. Data are shown as mean ± SD.\u003cstrong\u003e (E) \u003c/strong\u003eQuantitative RT-PCR analysis of \u003cem\u003eTP53\u003c/em\u003e and its target genes in untreated SETD2-CRISPR KO U2OS. Fold change was calculated relative to untreated parental U2OS. \u003cstrong\u003e(F) \u003c/strong\u003eDose-response viability curves for RITA in MCF7 cells. Data are shown as mean ± _SD (n = 3). IC\u003csub\u003e50\u003c/sub\u003e values were calculated via nonlinear regression (4- parameter curve fitting). (\u003cstrong\u003eG) \u003c/strong\u003eCell viability assay after RITA treatment combined with siRNA depletion of SETD2 in MCF7 cells. Viability was calculated relative to cells incubated with non-targeting siRNA. Data are shown as mean ± SD (n = 3). P-values were calculated using the Student’s two-tailed t-test (* p \u0026lt; 0.05, ** p \u0026lt; 0.01). (\u003cstrong\u003eH\u003c/strong\u003e) Efficiency of SETD2 knockdown determined by Western blotting for H3K36me3 with histone H3 as a control.\u003c/p\u003e","description":"","filename":"LopezetalfiguresFINAL2.png","url":"https://assets-eu.researchsquare.com/files/rs-8849233/v1/0cd871176014163c7d91ae6b.png"},{"id":103505495,"identity":"7b47f24e-f2bd-401e-88d9-9dd291003337","added_by":"auto","created_at":"2026-02-26 13:31:29","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":694258,"visible":true,"origin":"","legend":"\u003cp\u003eRITA induces cell cycle arrest and activates the DNA damage response in SETD2-deficient cancer cells. \u003cstrong\u003e(A) \u003c/strong\u003eCell cycle profiles of parental and SETD2-CRISPR KO U2OS and RCC cell lines after RITA treatment. Data shown as mean ± SD. \u003cstrong\u003e(B)\u003c/strong\u003eWestern blot of total and phospho-CHK1 (Ser317), total and phospho-CHK2 (Thr68), p21, and γH2AX in parental and SETD2-CRISPR KO U2OS after RITA treatment. \u003cstrong\u003e(C)\u003c/strong\u003e Confocal microscopy of γH2AX foci (red) in parental and SETD2-CRISPR KO U2OS cells after RITA treatment. Representative images from 3 independent experiments are shown (n = 3). \u003cstrong\u003e(D)\u003c/strong\u003eQuantification of γH2AX foci per nucleus from \u003cstrong\u003e(C)\u003c/strong\u003e.\u003cstrong\u003e \u003c/strong\u003eAt least 100 nuclei per biological replicate (n = 3) were counted for statistical analysis. Data shown as median + interquartile range. P-values were calculated using the two-tailed Student’s t-test.\u003c/p\u003e","description":"","filename":"LopezetalfiguresFINAL3.png","url":"https://assets-eu.researchsquare.com/files/rs-8849233/v1/5e17a106157d5d8a673f8e4a.png"},{"id":103249659,"identity":"9999e85d-5bc4-4921-a45e-ff4ffaa2a8d8","added_by":"auto","created_at":"2026-02-23 15:43:08","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":1063845,"visible":true,"origin":"","legend":"\u003cp\u003eRITA induces replication stress in SETD2-deficient cancer cells. \u003cstrong\u003e(A) \u003c/strong\u003eConfocal microscopy of phospho-RPA Ser33 (red) and 53BP1 (green) foci in U2OS cells after RITA treatment. Representative images from 3 independent experiments are shown. \u003cstrong\u003e(B)\u003c/strong\u003e Quantification of the average number of foci per nucleus from \u003cstrong\u003e(A)\u003c/strong\u003e.\u003cstrong\u003e \u003c/strong\u003eAt least 70 nuclei per biological replicate (n = 3) were counted for statistical analysis. Data shown as mean ± SD. P-values were calculated using the two-tailed Student’s t-test. *p \u0026lt; 0.05, **p \u0026lt; 0.01. RITA induces replication stress in SETD2-deficient cancer cells. \u003cstrong\u003e(C) \u003c/strong\u003eDNA fibre assay of parental and SETD2-CRISPR KO U2OS. Cells were treated as indicated. Representative images from 2 independent experiments are shown. \u003cstrong\u003e(D) \u003c/strong\u003eQuantification of replication fork velocity from \u003cstrong\u003e(C)\u003c/strong\u003e.\u003cstrong\u003e \u003c/strong\u003eAt least 200 fibres per biological replicate (n = 3) were measured for statistical analysis. Data shown as median + interquartile range. P-values were calculated using the two-tailed Student’s t-test. N.S. = non-significant, ****p \u0026lt; 0.000001.\u003c/p\u003e","description":"","filename":"LopezetalfiguresFINAL4.png","url":"https://assets-eu.researchsquare.com/files/rs-8849233/v1/86c6a9bdc6939163b234b0c1.png"},{"id":103249667,"identity":"c5f2e8ee-6978-4427-a6a2-141b407a2ea3","added_by":"auto","created_at":"2026-02-23 15:43:08","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":703545,"visible":true,"origin":"","legend":"\u003cp\u003eLoss or inhibition of the phenol sulphotransferase SULT1A1 abolishes RITA-induced phenotypes. \u003cstrong\u003e(A)\u003c/strong\u003e Dose response viability curves for SETD2-CRISPR KO U2OS cells treated with RITA after the addition of non-targeting control (siNT) or SULT1A1 siRNA (siSULT1A1). Data are shown as mean ± SD. \u003cstrong\u003e(B)\u003c/strong\u003e Western blot of SULT1A1 in U2OS cells in the presence of non-targeting control (siNT) or SULT1A1 siRNA (siSULT). \u003cstrong\u003e(C)\u003c/strong\u003e Dose response viability curves for U2OS cells treated with RITA in the presence or absence of DCNP. Data are shown as mean ± SD. \u003cstrong\u003e(D)\u003c/strong\u003e Clonogenic survival assay for U2OS cells in the presence of the indicated compounds. Data are shown as mean ± SD. P-values were calculated using the two-tailed Student’s t-test. **p \u0026lt; 0.01, ****p \u0026lt; 0.0001. \u003cstrong\u003e(E)\u003c/strong\u003e Western blot of total p53, phospho-p53 (Ser15), and γH2AX in U2OS cells after the indicated treatments. \u003cstrong\u003e(F) \u003c/strong\u003eWestern blot of procaspase 3 and cleaved caspase 3 in U2OS cells after the indicated treatments. \u003cstrong\u003e(G)\u003c/strong\u003e Cell cycle profiles of U2OS cells in the presence of the indicated compounds. Data shown as mean ± SD. \u003cstrong\u003e(H) \u003c/strong\u003eConfocal microscopy of phospho-RPA Ser33 (red) and 53BP1 (green) foci in U2OS cells after the indicated treatments. Representative images from 3 independent experiments are shown (n = 3). \u003cstrong\u003e(I) \u003c/strong\u003eQuantification of the average number of foci per nucleus from \u003cstrong\u003e(I)\u003c/strong\u003e.\u003cstrong\u003e \u003c/strong\u003eAt least 80 nuclei per biological replicate (n = 3) were counted for statistical analysis. Data shown as mean ± SD. P-values were calculated using the two-tailed Student’s t-test. *p \u0026lt; 0.05.\u003c/p\u003e","description":"","filename":"LopezetalfiguresFINAL5.png","url":"https://assets-eu.researchsquare.com/files/rs-8849233/v1/7e4dd0fa3bc348c414aaa9d9.png"},{"id":103249662,"identity":"b252ec40-0fd7-44f0-987b-f2fa1b0959e8","added_by":"auto","created_at":"2026-02-23 15:43:08","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":245322,"visible":true,"origin":"","legend":"\u003cp\u003eAnalysis of\u003cstrong\u003e \u003c/strong\u003eSETD2-proficient and deficient cell sensitivity to RITA variants and YC1.\u003cstrong\u003e (A)\u003c/strong\u003e \u0026nbsp;Structure of RITA and variants synthesised and analysed. Dose-response viability curves for parental and SETD2-CRISPR U2OS cells treated with RV-6 \u003cstrong\u003e(B), \u003c/strong\u003eRV-14\u003cstrong\u003e (C) \u003c/strong\u003eand YC-1\u003cstrong\u003e (D). \u003c/strong\u003eData are shown as mean ± SD (n = 3). IC\u003csub\u003e50\u003c/sub\u003e values were calculated via nonlinear regression (4-parameter curve fitting). The structures of each variant are displayed to the right of each graph. Analysis of other RITA variants are shown in Figures S11, S14). For synthesis details for RITA variants see Supplementary Data.\u003c/p\u003e","description":"","filename":"LopezetalfiguresFINAL6.png","url":"https://assets-eu.researchsquare.com/files/rs-8849233/v1/92f9550c7d22794c2c66d069.png"},{"id":103249663,"identity":"6dd31c3a-90f0-4f04-9e6d-d23142b8ad5d","added_by":"auto","created_at":"2026-02-23 15:43:08","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":110849,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003e(A)\u003c/strong\u003e\u0026nbsp;Volcano plot representing results from 2D thermal profiling (2D-TPP) of 7,744 proteins detected by LC-MS/MS following RITA treatment of SETD2-deficient U2OS cells. For each protein, a 2D fold change (FC) heatmap was calculated (Table S2)\u0026nbsp;upon 30-minutes DMSO or 500, 100, 50, 10 nM RITA treatment subsequently subjected to 12 fixed temperatures between 42-64\u0026nbsp;℃\u0026nbsp;for 3 minutes. Top-3 mean Log2FC denotes the log2-transformed mean fold change in protein stability for the top 3 cells of the heatmap (for proteins with a stabilisation signal) or bottom 3 cells (for proteins with a destabilisation signal); this was plotted against -log10(p), highlighting proteins with p\u0026lt;0.05 and \u0026gt;2-fold effect.\u0026nbsp;The p-value was calculated by bootstrap analysis of the topology of the FC heatmap (Table S2).\u0026nbsp;Proteins affected by solubility-driven effects (effects observed at baseline/low temperature) are excluded from the plot. \u003cstrong\u003e(B) \u003c/strong\u003eModel by which RITA targets SETD2-deficient cancer cells. SULT1A1 is expressed in the absence of SETD2. Subsequent RITA treatment of SETD2-deficient cancer cells results in its sulfation at its terminal hydroxymethyl groups via SUL1TA1 and 3′-phosphoadenosine 5′-phosphosulfate (PAPS) and 3′-phosphoadenosine 5′-phosphosphate (PAP) cofactor (only one terminus illustrated). RITA sulfation leads to widespread electrophilic alkylation and covalent protein binding and possible cross-linking. Disruption of a subset of these proteins causes DNA replication stress and cell death in SETD2\u003csup\u003e-/-\u003c/sup\u003e cells. \u0026nbsp;Adapted from mechanisms proposed in (\u003ca href=\"#_ENREF_46\" title=\"Rees, 2016 #43\"\u003e46\u003c/a\u003e, \u003ca href=\"#_ENREF_48\" title=\"Peyser, 2019 #49\"\u003e48\u003c/a\u003e).\u003c/p\u003e","description":"","filename":"LopezetalfiguresFINAL7.png","url":"https://assets-eu.researchsquare.com/files/rs-8849233/v1/d5170a657e4f075d2a3fd77e.png"},{"id":107705038,"identity":"c4bf56e6-cf9e-43fa-b0bd-103a7b6864a9","added_by":"auto","created_at":"2026-04-24 09:06:54","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":4077789,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8849233/v1/361626ae-01da-4712-af95-3798314d56dc.pdf"},{"id":103249661,"identity":"4ae65c71-314d-43b5-89c4-627933e108f8","added_by":"auto","created_at":"2026-02-23 15:43:08","extension":"xlsx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":499507,"visible":true,"origin":"","legend":"Supplememental Table 1","description":"","filename":"LopezetalTableS1compoundlibrariescopy.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-8849233/v1/0a9eb5a00aa6dfe7816205f7.xlsx"},{"id":103506341,"identity":"6107d986-4489-4b73-9eb4-85afaf3f88c7","added_by":"auto","created_at":"2026-02-26 13:35:25","extension":"pdf","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":1891409,"visible":true,"origin":"","legend":"Supplemental Figures","description":"","filename":"LopezetalsupplementalfiguresFINAL.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8849233/v1/3902735d01f3a6c4c8e64355.pdf"},{"id":103249666,"identity":"28f5a488-5699-46df-baf1-13fc83d889ca","added_by":"auto","created_at":"2026-02-23 15:43:08","extension":"pdf","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":14894869,"visible":true,"origin":"","legend":"Supplemental materials","description":"","filename":"LopezetalSupplementalRVsynthesisdetailsFINAL.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8849233/v1/8c9255f4a1ec593ceae36c9d.pdf"},{"id":103249664,"identity":"3a475703-a2bd-4eb5-a302-edb1498ed771","added_by":"auto","created_at":"2026-02-23 15:43:08","extension":"xlsx","order_by":4,"title":"","display":"","copyAsset":false,"role":"supplement","size":12800725,"visible":true,"origin":"","legend":"Supplemental Table 2","description":"","filename":"LopezetalTableS22DTPPanalysiscopy.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-8849233/v1/68b33a6fc86c24ed79c5a02d.xlsx"}],"financialInterests":"There is \u003cb\u003eNO\u003c/b\u003e conflict of interest to disclose.","formattedTitle":"Therapeutic targeting of SETD2-deficient cancer cells with the small-molecule compound RITA","fulltext":[{"header":"INTRODUCTION","content":"\u003cp\u003eA key challenge in the treatment of cancer is achieving sufficient anti-tumour activity while limiting any negative impact on normal tissues. Maximising a drug\u0026rsquo;s therapeutic index, defined as the ratio between the dose that induces toxicity and the dose needed for therapeutic efficacy (\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e). This limitation has driven efforts to identify tumour-specific therapies that can complement or replace conventional chemotherapies, which often cause severe side effects (\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e). One promising strategy is synthetic lethality, a genetic interaction in which simultaneous disruption of two genes results in cell death, see while loss of either gene alone is tolerated. Such interactions typically arise when parallel or overlapping pathways regulate essential cellular processes (\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e). Synthetic lethality is now being actively exploited to selectively target cancer cells while sparing normal tissues (\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eHistone modifications play a central role in regulating gene expression, chromatin organisation, and genome stability. Dysregulation of the histone code is a hallmark of tumourigenesis, and histone-modifying enzymes are among the most frequently mutated genes in cancer (\u003cspan additionalcitationids=\"CR6 CR7 CR8\" citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e). In mammalian cells, SETD2 is the sole enzyme responsible for trimethylation of histone H3 lysine 36 (H3K36me3) in somatic cells (\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e). SETD2 functions co-transcriptionally through interaction with the phosphorylated C-terminal domain of RNA polymerase II (\u003cspan additionalcitationids=\"CR12 CR13\" citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e). H3K36me3 is associated with active transcription (\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e), and its loss leads to cryptic intragenic transcription and aberrant chromatin remodelling (\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e). Beyond transcription, H3K36me3 contributes to genome stability through roles in mismatch repair (\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e), DNA double-strand break repair (\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e, \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e), and replication stress responses (\u003cspan additionalcitationids=\"CR21\" citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e), as reviewed in (\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e). SETD2 also methylates non-histone substrates such as microtubules, preventing mitotic defects and chromosomal missegregation (\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eConsistent with these functions, SETD2 acts as a tumour suppressor and is frequently altered in cancer. SETD2 mutations or deletions occur in a substantial proportion of clear cell renal cell carcinoma (ccRCC) tumours and cell lines (\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e, \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e). Its location on chromosome 3p makes it a common target of loss of heterozygosity in ccRCC (\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e). SETD2 mutations correlate with reduced cancer-specific survival in renal cell carcinoma (\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e), and H3K36me3 levels progressively decline from primary tumours to metastases (\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e). SETD2 mutations have also been reported in high-grade gliomas (\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e) and breast cancer (\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eOur group previously identified a conserved synthetic lethal interaction between loss of SETD2 and inhibition of the cell cycle regulator WEE1 in both fission yeast and human cells (\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e, \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e). Building on this work, we performed a high-throughput synthetic lethality screen of over 2,000 compounds using SETD2-deficient and isogenic parental U2OS cells. The most potent and selective compound identified was RITA (\u003cb\u003eR\u003c/b\u003eeactivation of p53 and \u003cb\u003eI\u003c/b\u003enduction of \u003cb\u003eT\u003c/b\u003eumour cell \u003cb\u003eA\u003c/b\u003epoptosis), a small molecule initially discovered for its anti-tumour activity in the NCI Anticancer Drug Screen (\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e), and reported to reactivate p53 by disrupting its interaction with MDM2 (\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e). Here, we demonstrate that RITA selectively targets SETD2-deficient cancer cells, inducing apoptosis through p53 activation, DNA damage response signalling, and disruption of DNA replication. Further, we define the molecular and structural basis of this synthetic lethal targeting.\u003c/p\u003e"},{"header":"MATERIALS AND METHODS","content":"\u003cp\u003e\u003cstrong\u003eCell Lines\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe U2OS cell line (human osteosarcoma) was obtained from the American Type Culture Collection (ATCC, Manassas, VA, USA; HTB-96). The U2OS SETD2-deleted cell line (SETD2\u003csup\u003e-/-\u003c/sup\u003e) was generated by our group using CRISPR\u0026ndash;Cas9 technology as described previously (33). The 786-O, A498 and LB996 cell lines were derived from human clear cell renal cell carcinomas and confirmed by STR profiling. 786-O was obtained from Dr Valentine Macaulay (Department of Oncology, University of Oxford, UK). A498 was obtained from ATCC (Manassas, VA, USA; HTB-44). LB996 was obtained from Prof. Benoit van den Eynde (Oxford Ludwig Institute, UK). MCF7 p53 wild-type and p53-CRISPR cell lines were obtained from Prof. Ross Chapman (Wellcome Centre for Human Genetics, Oxford, UK).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCell Culture\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll cell lines except LB996 were maintained in Dulbecco\u0026rsquo;s modified minimal essential medium (DMEM; Life Technologies, Paisley, UK) supplemented with 10% foetal bovine serum (FBS; Sigma-Aldrich, Gillingham, UK), 100 U ml⁻\u0026sup1; penicillin and 0.1 mg ml⁻\u0026sup1; streptomycin (Sigma-Aldrich, Gillingham, UK). LB996 cells were cultured in Iscove\u0026rsquo;s Modified Dulbecco\u0026rsquo;s Medium (IMDM; Life Technologies, Paisley, UK) supplemented with 10% FBS, penicillin/streptomycin and G5 supplement (Life Technologies, Paisley, UK).\u003cbr\u003e Cells were grown at 37\u0026thinsp;\u0026deg;C in a humidified incubator with 5% CO₂ and were subcultured every 3\u0026ndash;4 days by PBS wash, trypsinisation, centrifugation (300 \u0026times; g, 3 minutes) and replating at the appropriate dilution.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eHigh-throughput Compound Screening\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eParental and SETD2-deleted U2OS cells were seeded into 384-well plates (750 cells in 75 \u0026micro;l per well) using a Janus Liquid Handling Workstation (PerkinElmer, Seer Green, UK) and incubated overnight. Compound libraries (TDI Expanded Oncology Drug Set and SelleckChem Bioactive Compound Library; 10 mM in DMSO) were thawed at room temperature and serially diluted in complete DMEM containing dimethyl sulfoxide (DMSO) using an Echo Acoustic Liquid Handler (Labcyte). Diluted compounds (or DMSO as negative control) were added to cells (75 \u0026micro;l per well) using the Janus workstation and incubated for 24 hours. The WEE1 inhibitor AZD1775 was added using the same procedure and incubated for a further 72 hours as a positive control (33). Cell viability was then measured using the resazurin assay.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eStatistical Analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eStatistical analysis of compound screening data was performed using HTScape software developed in-house at the University of Oxford by Dr Francesca Buffa\u0026rsquo;s group. Raw resazurin output files and compound annotation files were uploaded, Z-scores calculated, and differential Z-scores used to compute permutation-based false-positive discovery rates (PFP). Hits with PFP\u0026thinsp;\u0026lt;\u0026thinsp;0.05 were considered statistically significant.\u003cbr\u003e Statistical analysis of other experimental data was performed using GraphPad Prism 8 (GraphPad Software, San Diego, CA, USA).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eValidation of Positive Hits\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCells were seeded into 96-well plates (2,000 cells per well) overnight. Compounds were added as two-fold serial dilutions (maximum concentration 20 \u0026micro;M) in existing medium. After 48 hours, cell viability was measured using the resazurin assay.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDrugs and Inhibitors\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eRITA (NSC 652287) and 2,6-dichloro-4-nitrophenol (DCNP) were obtained from Selleck Chemicals (Houston, TX, USA). Compounds were dissolved in DMSO and stored at \u0026minus;80\u0026thinsp;\u0026deg;C.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eResazurin Assay for Cell Viability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAt the indicated time point, culture medium was replaced with 100 \u0026micro;l fresh complete medium without phenol red containing 20 \u0026micro;g ml⁻\u0026sup1; resazurin (Sigma-Aldrich, Gillingham, UK). After 2 hours at 37\u0026thinsp;\u0026deg;C, fluorescence was measured using a plate reader (BMG Labtech, Ortenberg, Germany). IC₅₀ was defined as the concentration reducing viability by 50%.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eClonogenic Survival Assay\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCells were seeded into 6-well plates at low density and incubated overnight. Medium was replaced with DMSO- or drug-containing medium and cells were incubated for 10 days. Wells were washed with PBS and stained with Brilliant Blue R Concentrate (Sigma-Aldrich, Gillingham, UK) for 1 hour. Plating efficiency and surviving fraction were calculated as described previously (36).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eApoptosis Detection Assay\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eApoptotic cell death was measured using the RealTime-Glo\u0026trade; Annexin V Apoptosis and Necrosis Assay (Promega, Southampton, UK) according to the manufacturer\u0026rsquo;s instructions. Cells were seeded at 3,000 cells per well in 96-well plates overnight and treated the following day. Detection reagent was added at 2\u0026times; concentration and luminescence measured after 30 hours using a plate reader (BMG Labtech, Ortenberg, Germany).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003esiRNA Transfection\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003esiRNAs (10\u0026ndash;20 nM final concentration) were delivered using Lipofectamine RNAiMAX (Life Technologies, Paisley, UK) by reverse transfection in complete medium without penicillin and streptomycin. Medium was replaced after 16 hours and cells were analysed \u0026ge;48 hours post-transfection. Knockdown efficiency was assessed by western blotting.\u003cbr\u003e siSETD2 (pooled; Dharmacon, Cambridge, UK): GAAACCGUCUCCAGUCUGU; UAAAGGAGGUAUAUCGAAU\u003cbr\u003e siSULT1A1 (pooled; Life Technologies, Paisley, UK): ACCAAGCGGCUCAAGAAUAAA; GAGAAGUUCAUGGUCGGAGAA\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eQuantitative RT-PCR\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTotal RNA was purified using the RNeasy kit (Qiagen, Hilden, Germany) and cDNA prepared using the SuperScript RT-PCR system (Invitrogen, Paisley, UK). Quantitative RT-PCR was performed using SYBR\u0026trade; Green PCR Master Mix (Applied Biosystems, Warrington, UK) on a 7500 Fast Real-Time PCR System (Applied Biosystems, Warrington, UK). Reactions were run in triplicate and analysed using the comparative CT method. Expression was normalised to GAPDH and expressed relative to control conditions.\u003cbr\u003e Primers used were:\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 31.9915%;\"\u003e\n \u003cp\u003eCDKN1A Fwd\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 68.0085%;\"\u003e\n \u003cp\u003e5\u0026rsquo;-TGTCCGTCAGAACCCATGC-3\u0026rsquo;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 31.9915%;\"\u003e\n \u003cp\u003eCDKN1A Rev\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 68.0085%;\"\u003e\n \u003cp\u003e5\u0026rsquo;-AAAGTCGAAGTTCCATCGCTC-3\u0026rsquo;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 31.9915%;\"\u003e\n \u003cp\u003eMDM2 Fwd\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 68.0085%;\"\u003e\n \u003cp\u003e5\u0026rsquo;-TCGACCTAAAAATGGTTGCAT-3\u0026rsquo;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 31.9915%;\"\u003e\n \u003cp\u003eMDM2 Rev\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 68.0085%;\"\u003e\n \u003cp\u003e5\u0026rsquo;- GGCAGGGCTTATTCCTTTTC-3\u0026rsquo;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 31.9915%;\"\u003e\n \u003cp\u003ePPM1D Fwd\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 68.0085%;\"\u003e\n \u003cp\u003e5\u0026rsquo;-GGGAGTGATGGACTTTGGAA-3\u0026rsquo;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 31.9915%;\"\u003e\n \u003cp\u003ePPM1D Rev\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 68.0085%;\"\u003e\n \u003cp\u003e5\u0026rsquo;-CAAGATTGTCCATGCTCACC-3\u0026rsquo;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 31.9915%;\"\u003e\n \u003cp\u003ePUMA Fwd\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 68.0085%;\"\u003e\n \u003cp\u003e5\u0026rsquo;- TCTCGGTGCTCCTTCACTCT-3\u0026rsquo;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 31.9915%;\"\u003e\n \u003cp\u003ePUMA Rev\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 68.0085%;\"\u003e\n \u003cp\u003e5\u0026rsquo;- ACGTTTGGCTCATTTGCTCT-3\u0026rsquo;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 31.9915%;\"\u003e\n \u003cp\u003eTP53 Fwd\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 68.0085%;\"\u003e\n \u003cp\u003e5\u0026rsquo;- CAGCACATGACGGAGGTTGT-3\u0026rsquo;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 31.9915%;\"\u003e\n \u003cp\u003eTP53 Rev\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 68.0085%;\"\u003e\n \u003cp\u003e5\u0026rsquo;- TCATCCAAATACTCCACACGC-3\u0026rsquo;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 31.9915%;\"\u003e\n \u003cp\u003eSULT1A1 Fwd\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 68.0085%;\"\u003e\n \u003cp\u003e5\u0026rsquo;-CGGCACTACCTGGGTAAGC-3\u0026rsquo;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 31.9915%;\"\u003e\n \u003cp\u003eSULT1A1 Rev\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 68.0085%;\"\u003e\n \u003cp\u003e5\u0026rsquo;- CACCCGCATGAAGATGGGAG-3\u0026rsquo;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 31.9915%;\"\u003e\n \u003cp\u003eGAPDH Fwd\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 68.0085%;\"\u003e\n \u003cp\u003e5\u0026rsquo;-AGCCACATCGCTCAGACAC-3\u0026rsquo;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 31.9915%;\"\u003e\n \u003cp\u003eGAPDH Rev\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 68.0085%;\"\u003e\n \u003cp\u003e5\u0026rsquo;-GCCCAATACGACCAAATCC-3\u0026rsquo;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003cstrong\u003eHistone Extraction\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis protocol was adapted with modifications from Dr. Junjie Chen\u0026rsquo;s laboratory (37) by Dr. Raul Mostoslavsky\u0026rsquo;s group. Cells were lysed in buffer containing 10 mM HEPES (pH 7.4), 10 mM KCl and 0.05% NP-40 supplemented with protease and phosphatase inhibitors, followed by centrifugation (17,000 g, 10 minutes, 4\u0026thinsp;\u0026deg;C). Nuclear pellets were washed once, resuspended in 0.2 M HCl (20 minutes on ice), and centrifuged again. The supernatant containing histones was collected and protein concentration determined by Bradford assay.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eWestern Blotting\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWhole-cell lysates were prepared in Tris/NaCl/Triton X-100 lysis buffer containing protease and phosphatase inhibitors, clarified by centrifugation (17,000 g, 10 minutes, 4\u0026thinsp;\u0026deg;C), and quantified by Bradford assay. Samples (25 \u0026micro;g) were denatured in NuPAGE LDS loading buffer with dithiothreitol (Life Technologies, Paisley, UK), resolved by SDS\u0026ndash;PAGE and transferred according to the manufacturer\u0026rsquo;s instructions. Membranes were blocked, incubated with primary antibodies overnight at 4\u0026thinsp;\u0026deg;C, followed by HRP-conjugated secondary antibodies and chemiluminescent detection (Thermo Scientific, Loughborough, UK). Primary antibodies are listed here: H3K36me3 and histone H3 (Abcam, Cambridge, UK); RRM2 and p53 (Santa Cruz Biotechnology, Heidelberg, Germany); phospho-p53 (Ser15), phospho-CHK1 (Ser317), CHK1, phospho-CHK2 (Thr68), CHK2 and p21 (Cell Signaling Technology, Leiden, The Netherlands); caspase-3 (Abcam, Cambridge, UK); SULT1A1 (R\u0026amp;D Systems, Abingdon, UK); and GAPDH (Novus Biologicals, Abingdon, UK).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCell Cycle Analysis by BrdU Incorporation\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e10\u003csup\u003e5\u003c/sup\u003e cells/well in 2 mL of complete DMEM were seeded in 6-well plates and pulse-labelled with 20 \u0026micro;M bromodeoxyuridine (BrdU; Sigma-Aldrich, Gillingham, UK) for 30 minutes. Cells were harvested, fixed in 70% ethanol, denatured in 2 M HCl, and stained with anti-BrdU monoclonal antibody (BD Biosciences, Oxford, UK) followed by Alexa Fluor 488-conjugated secondary antibody (Life Technologies, Paisley, UK). DNA content was assessed using propidium iodide (Sigma-Aldrich, Gillingham, UK), and samples were analysed using a FACSCalibur flow cytometer (Becton Dickinson, Oxford, UK).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eImmunofluorescence Staining of Foci\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e10\u003csup\u003e5\u003c/sup\u003e cells/well in 2 mL of complete DMEM were seeded onto glass coverslips placed in 6-well plates overnight. At the desired time point after treatment, pre-extraction buffer (10 mM PIPES pH 6.8, 300 mM sucrose, 100 mM NaCl, 1.5 mM MgCl\u003csub\u003e2,\u003c/sub\u003e and 0.5% Triton X-100) was added for 2 minutes on ice. Cells were fixed in 4% paraformaldehyde, blocked, and incubated with primary antibodies overnight at 4\u0026thinsp;\u0026deg;C. Following incubation with fluorescent secondary antibodies, nuclei were counterstained with Hoechst 33342 (Molecular Probes, Paisley, UK). Coverslips were mounted using VECTASHIELD\u0026reg; Antifade Mounting Medium (Vector Laboratories, Peterborough, UK) and imaged using a Zeiss 710 confocal microscope (Carl Zeiss, Cambridge, UK). Primary antibodies used were phospho-RPA (Ser33) (Bethyl Laboratories, Montgomery, TX, USA), 53BP1 (GeneTex, Irvine, CA, USA) and \u0026gamma;H2AX (Novus Biologicals, Abingdon, UK).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDNA Fibre Assay\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCells were seeded to approximately 20% confluency and sequentially labelled with 30 \u0026micro;M CldU and 250 \u0026micro;M IdU (Sigma-Aldrich, Gillingham, UK). RITA (150 nM) or DMSO was present during the IdU pulse. DNA fibre spreads were prepared on glass slides, denatured, blocked, and stained with rat anti-BrdU (CldU-specific; Abcam, Cambridge, UK) and mouse anti-BrdU (IdU-specific; BD Biosciences, Oxford, UK), followed by Alexa Fluor 488- and Cy3-conjugated secondary antibodies (Molecular Probes, Paisley, UK; Jackson ImmunoResearch, Ely, UK). Slides were mounted using ProLong\u0026reg; Gold Antifade Mountant (Life Technologies, Paisley, UK) and imaged using a Nikon Ni-E microscope (Nikon Instruments Europe, Amsterdam, The Netherlands). Fibre lengths were quantified using Fiji software, with \u0026ge;200 fibres analysed per condition.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eModified Single-Cell Gel Electrophoresis (Comet) Assay\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eA modified alkaline comet assay was performed to assess DNA crosslinking activity as described (38). Cells were seeded overnight and treated with DMSO, RITA or mitomycin C, harvested, and stored at \u0026minus;80\u0026thinsp;\u0026deg;C in freezing medium. Samples were thawed, irradiated with 5 Gy (Xstrahl RS320 X-Ray Irradiator system) where indicated, embedded in low-melting-point agarose, lysed, electrophoresed under alkaline conditions, and stained with propidium iodide. Comet tails were visualised using an Olympus BH-2-RFL-T2 fluorescence microscope (Olympus, Southend-on-Sea, UK) and analysed using Komet software (Andor Technology, Belfast, UK).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eSynthesis of RITA Structural Variants\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSynthesis and characterisation of RITA structural variants are described in the Supplementary Information.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2D Thermal Profiling (2D-TPP)\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e2D thermal proteome profiling was performed as described previously (39, 40). SETD2\u003csup\u003e-/-\u003c/sup\u003e U2OS cells were treated with RITA (10\u0026ndash;500 nM) or vehicle for 30 minutes, heated at fixed temperatures (42\u0026ndash;64\u0026thinsp;\u0026deg;C), and soluble fractions analysed by LC\u0026ndash;MS/MS. Data were processed using Proteome Discoverer (Thermo Scientific, Loughborough, UK) and analysed using TP-MAP (41). Gene ontology analysis was performed using PAN-GO Human Functionome (https://functionome.geneontology.org/) (42).\u003c/p\u003e"},{"header":"RESULTS","content":"\u003cp\u003e\u003cstrong\u003eSETD2-deficient cancer cells are hypersensitive to RITA\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo identify therapeutic vulnerabilities associated with loss of H3K36me3, we performed a high-throughput synthetic lethality screen using \u0026gt;2,000 small molecules in CRISPR/Cas9 SETD2-deleted U2OS osteosarcoma cells and isogenic parental controls (33) (Table S1). As reported previously, inhibitors of WEE1 and CHK1 showed selective toxicity in SETD2-deficient cells (33). However, ranking compounds by Z-score revealed RITA (NSC 652287) as the most potent and selective hit.\u003c/p\u003e\n\u003cp\u003eDose\u0026ndash;response analyses demonstrated a marked difference in RITA sensitivity between parental and SETD2-CRISPR cells (Fig. S1), which persisted at nanomolar concentrations, yielding an IC50 of ~12 nM in SETD2-deficient U2OS cells (Fig. 1A). RITA was originally identified in the NCI Anticancer Drug Screen, where it showed selective activity against renal carcinoma cell lines, including A498 (34). Consistent with this, SETD2-mutant renal carcinoma cell lines A498 and LB996 displayed pronounced RITA sensitivity (IC50 7.45 nM and 0.63 nM, respectively), whereas the SETD2-wild-type 786-O line was comparatively resistant (Fig. 1B). Clonogenic survival assays confirmed the exquisite sensitivity of SETD2-deficient cells to RITA (Fig. 1C). Together, these data indicate that SETD2 loss confers strong and selective sensitivity to RITA across multiple tumour contexts.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eRITA induces p53 activation and apoptosis preferentially in SETD2-deficient cells\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eRITA has been reported to stabilise p53 by disrupting its interaction with MDM2 (35). Given that SETD2 can regulate p53 target gene expression (43), we examined p53 responses following RITA treatment. RITA induced marked accumulation of total and Ser15-phosphorylated p53 in SETD2-CRISPR U2OS and SETD2-mutant A498 cells, but not in SETD2-proficient controls (Fig. 2A).\u003c/p\u003e\n\u003cp\u003eConsistent with p53 activation, RITA treatment triggered apoptotic cell death selectively in SETD2-deficient cells. Cleaved caspase-3 was strongly induced in SETD2-CRISPR U2OS and A498 cells, but not in their SETD2-wild-type counterparts (Fig. 2B). Annexin V luminescence assays confirmed significantly elevated apoptosis in SETD2-deficient U2OS cells following RITA treatment (Fig. 2C). Quantitative RT-PCR analysis revealed increased expression of canonical p53 target genes, including CDKN1A, MDM2, PPM1D, and PUMA, with greater induction observed in SETD2-deficient cells (Fig. 2D). Notably, CDKN1A expression was already elevated following SETD2 deletion and remained higher after RITA treatment (Fig. 2E). In contrast, TP53 mRNA levels were unchanged (Fig. S2), indicating post-translational stabilisation of p53.\u003c/p\u003e\n\u003cp\u003eDespite early reports proposing p53 reactivation as the primary mechanism of RITA cytotoxicity (35), accumulating evidence suggests p53-independent effects (44). Consistent with this, TP53-CRISPR deletion reduced but did not abolish RITA sensitivity (Fig. 2F). Importantly, siRNA-mediated SETD2 depletion enhanced RITA toxicity regardless of p53 status (Fig. 2G,H), indicating that p53 activation contributes to but does not drive RITA sensitivity.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eRITA induces replication stress and DNA damage signalling in SETD2-deficient cells\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo investigate the basis of RITA selectivity, we examined cell-cycle progression following treatment. RITA caused dose-dependent accumulation of non-replicating S-phase cells and G2/M arrest in SETD2-CRISPR U2OS and SETD2-mutant A498 cells (Fig. 3A; Fig. S3), suggesting impaired DNA synthesis and checkpoint activation. This phenotype resembled that observed following WEE1 inhibition in SETD2-deficient cells, which is mediated by depletion of the RNR subunit RRM2 (33). However, exogenous nucleoside supplementation failed to rescue RITA toxicity (Fig. S4A), and RITA did not alter RRM2 protein levels (Fig. S4B), indicating a distinct mechanism.\u003c/p\u003e\n\u003cp\u003eConsistent with replication stress, RITA induced robust activation of the ATR\u0026ndash;CHK1 pathway, increased \u0026gamma;H2AX, and elevated p21 levels, with markedly stronger responses in SETD2-CRISPR cells (Fig. 3B). \u0026gamma;H2AX foci were selectively induced in SETD2-deficient cells (Fig. 3C,D). Notably, CHK2 phosphorylation was absent, suggesting replication-associated DNA damage rather than frank double-strand breaks. Given SETD2\u0026rsquo;s role in homologous recombination (18), we assessed whether HR deficiency underlies RITA sensitivity. However, siRNA depletion of RAD51 or BRCA1 failed to sensitise SETD2-proficient cells to RITA (Fig. S4C), indicating that defective HR is not the primary determinant of sensitivity.\u003c/p\u003e\n\u003cp\u003eImmunofluorescence analysis revealed pronounced accumulation of phospho-RPA (Ser33) and 53BP1 foci in SETD2-CRISPR cells following RITA treatment (Fig. 4A,B). DNA fibre assays demonstrated a rapid and selective reduction in replication fork velocity in SETD2-deficient cells within 30 minutes of exposure (Fig. 4C,D). These findings establish that RITA rapidly induces replication stress specifically in the absence of SETD2. Although RITA has been proposed to act as a DNA crosslinker (45), modified comet assays revealed no evidence of crosslink formation, in contrast to mitomycin C (Fig. S5A). SETD2-CRISPR cells were also not hypersensitive to mitomycin C (Fig. S5B), consistent with the lack of HR dependence.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eRITA sensitivity is mediated by SULT1A1 activity in SETD2-deficient cells\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003ePrevious studies identified a correlation between RITA sensitivity and expression of the phenol sulfotransferase SULT1A1 (46). siRNA-mediated depletion of SULT1A1 significantly reduced RITA sensitivity in SETD2-CRISPR U2OS cells (Fig. 5A). Both SULT1A1 protein and mRNA were markedly upregulated in SETD2-deficient cells (Fig. 5B; Fig. S6A), suggesting that SETD2 represses SULT1A1 expression.\u003c/p\u003e\n\u003cp\u003ePharmacological inhibition of sulfotransferase activity using DCNP (47) strongly rescued RITA toxicity in SETD2-CRISPR cells, restoring viability and clonogenic survival to near-control levels (Fig. 5C,D). DCNP also reversed RITA-induced p53 stabilisation, caspase-3 cleavage, cell-cycle arrest, and replication stress marker accumulation (Fig. 5E\u0026ndash;I). These data demonstrate that SULT1A1 activity is required for RITA-induced replication stress, DNA damage signalling, and apoptosis.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eStructural determinants of RITA activity in SETD2-deficient cells\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eRITA has been proposed to act as a SULT1A1-activated prodrug that generates a reactive electrophile following sulfation and elimination (48). To define structure\u0026ndash;activity relationships, we synthesised RITA variants modifying its terminal hydroxymethyl groups and central furan ring (Fig. 6A). A dialdehyde variant (RV-6) retained selective activity against SETD2-deficient cells, albeit with reduced potency (Fig. 6B). In contrast, methyl ester derivatives lacking free hydroxymethyl groups (RV-11, RV-12) were inactive (Fig. S10), consistent with impaired sulfation. Removal of the central furan ring (RV-14) reduced but did not abolish activity (Fig. 6C), whereas corresponding dialdehyde variants were further attenuated (Fig. S10D). Intermediates lacking key functional groups showed non-selective toxicity (Fig. S14). These results identify the terminal hydroxymethyl groups and overall ring architecture as critical for selective activity.\u003c/p\u003e\n\u003cp\u003eYC-1, a SULT1A1-activated electrophilic compound (49), was also selectively toxic to SETD2-deficient U2OS cells, though less potent than RITA (Fig. 6D). This suggests that SETD2 loss sensitises cells to a broader class of SULT1A1-dependent alkylating agents.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eIdentification of RITA targets by thermal profiling\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo identify proteins targeted by activated RITA, we performed 2D thermal proteome profiling in SETD2-CRISPR KO U2OS cells treated with RITA. Across 7,744 detected proteins (Fig. 7A; Table S2), RITA induced widespread changes in protein thermal stability. Enriched GO terms included cell-cycle regulation, mRNA splicing, and replication stress. Notably, a total of 153 replication stress-associated proteins exhibited altered stability (Table S2). These findings indicate that activated RITA engages multiple essential proteins rather than a single dominant target, providing a mechanistic basis for the rapid replication collapse observed in SETD2-deficient cells.\u003c/p\u003e"},{"header":"DISCUSSION","content":"\u003cp\u003eA central aim of personalised cancer medicine is to exploit tumour-specific genetic vulnerabilities. Large-scale cancer genome sequencing efforts have identified frequent inactivation of the histone H3 lysine 36 methyltransferase and tumour suppressor SETD2, particularly in renal cell carcinomas, highlighting SETD2 loss as a potential therapeutic target (\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e). In this study, we uncover a previously unrecognised vulnerability of SETD2-deficient cells and show that loss of SETD2 leads to upregulation of the sulfotransferase SULT1A1, thereby conferring selective sensitivity to the SULT1A1-activated prodrug RITA.\u003c/p\u003e \u003cp\u003eUsing an unbiased synthetic lethality screen of approximately 2,000 compounds, we identified RITA as a potent and selective inhibitor of SETD2-deficient cells at nanomolar concentrations. Mechanistic analyses support a model in which RITA is converted into a cytotoxic species through SULT1A1 activity, resulting in DNA replication stalling, accumulation of DNA damage, and apoptotic cell death. Thus, SETD2 deficiency renders cells uniquely susceptible to an otherwise relatively inert compound.\u003c/p\u003e \u003cp\u003eRITA (2,5-bis[5-hydroxymethyl-2-thienyl] furan; NSC652287) was originally identified in the NCI Anticancer Drug Screen, where it exhibited notable selectivity for renal carcinoma cell lines, including A498 (\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e). Despite this early promise, its mechanism of action has remained controversial. Proposed models have included DNA/protein crosslinking (\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e), modulation of HIF1 signalling (\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e), and disruption of the TP53\u0026ndash;MDM2 interaction leading to p53 reactivation (\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e, \u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e, \u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e). However, multiple observations\u0026mdash;including our own\u0026mdash;suggest that p53 reactivation alone cannot account for RITA-induced cytotoxicity, and instead point to replication stress and DNA damage as central features of its activity (\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e, \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e, \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eConsistent with this, RITA treatment of SETD2-deficient cells caused rapid replication fork slowing, increased numbers of non-replicating S-phase cells, and induction of replication stress and DNA damage markers, including phospho-RPA, 53BP1, phospho-CHK1, p21, and γH2AX. This was accompanied by p53 stabilisation and caspase-3\u0026ndash;dependent apoptosis. Although p53 loss partially reduced RITA sensitivity, SETD2 depletion enhanced RITA toxicity independently of p53 status, indicating that p53 activation is a downstream consequence rather than the primary driver of cell death. Structural and functional analyses further support this conclusion: a truncated RITA analogue predicted to disrupt p53 binding retained substantial biological activity, and thermal profiling revealed that activated RITA alters the stability of multiple proteins involved in DNA replication and stress responses. Together with prior predictions of promiscuous target engagement (\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e), these findings suggest that activated RITA functions as a broadly reactive electrophile rather than a selective p53 modulator.\u003c/p\u003e \u003cp\u003eCrucially, our data identify SULT1A1 as the key determinant of RITA activity in SETD2-deficient cells. Recent work has proposed that RITA acts as a SULT1A1-activated prodrug (\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e), and our findings strongly support this model. SETD2 loss resulted in increased SULT1A1 expression, while genetic or pharmacological inhibition of SULT1A1 attenuated RITA cytotoxicity. Moreover, structural modifications that blocked sulfation abrogated activity, whereas sulfatable variants retained selective toxicity. In line with this, the SULT1A1-activated compound YC-1 also selectively targeted SETD2-deficient cells (\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e). Together, these observations demonstrate that SULT1A1-dependent activation underlies the selective cytotoxicity of RITA and related compounds.\u003c/p\u003e \u003cp\u003eImportantly, our findings provide a mechanistic explanation for the original observation that RITA preferentially targeted renal carcinoma cell lines (\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e). SETD2-deficient renal cancer cells, including A498, express SULT1A1 and exhibit marked RITA sensitivity, whereas SETD2-proficient cells do not (\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e). Although the precise mechanism by which SETD2 represses SULT1A1 remains unclear, this is consistent with evidence linking Set2/H3K36 methylation to transcriptional repression (\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e). Given the high frequency of SETD2 mutations in renal cell carcinoma (\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e), these findings suggest that SETD2-deficient tumours may be broadly susceptible to SULT1A1-activated prodrugs. While RITA itself failed clinically due to pulmonary toxicity (\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e), our work establishes SETD2 loss\u0026ndash;induced SULT1A1 expression as a mechanistic basis for selective prodrug sensitivity, revealing a promising strategy for targeting SETD2-deficient cancers.\u003c/p\u003e"},{"header":"Declarations","content":"\u003ch2\u003eAUTHOR CONTRIBUTIONS\u003c/h2\u003e \u003cp\u003eK.A.L. designed the experiments, except the high-throughput compound screen, which was designed by E.S. and D.E. K.A.L., S.S., and E.S. conducted the compound screen. C.T. and F.B. contributed to the statistical analysis of the screen results. K.A.L. and S.S. validated the screen hits. The RITA variants were synthesized by D.S, and supervised by B.S and S.J.C., and tested by K.A.L. K.A.L. F.O and T.C.H. wrote the manuscript. Supplementary data written by D.S. Work was supervised by G.D.J., F.B., D.E., K.V.M.H. and T.C.H. All main figures were performed by K.A.L. O.B contributed to Fig.\u0026nbsp;6. Fig. \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e was performed by K.A.L. and S.S. Fig. \u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003eS2\u003c/span\u003e-4 were performed by K.A.L. Fig. S5 was performed by C.C., M.C., and K.A.L. Fig. S6 and Fig. \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e0 were performed by K.A.L. Figure\u0026nbsp;7.A 2D-TPP analysis was performed by J.A.W, F.F., and K.V.M.H., with Volcano plot by O.B. Figure\u0026nbsp;7.B Model by D.S. and T.C.H.\u003c/p\u003e\u003ch2\u003eACKNOWLEDGMENTS\u003c/h2\u003e \u003cp\u003eWe would like to thank Valentine Macaulay, Benoit Van den Eynde, and Ross Chapman for generously providing cancer cell lines, Peter McHugh, B. Kessler, S. Bonham and R. Fischer from the TDI Discovery Proteomics Facility, Oxford University for useful discussions, and John Spencer for critically reading the manuscript. This research was supported by the Medical Research Council (grants MC_UU_00001/4; MR/X006778/1), Cancer Research UK, and the Oxford-based charity UCARE (Urology Cancer Research and Education). The Bruker Avance NEO 600 MHz NMR spectrometer was funded by the John Fell Oxford University Press Research Fund and an EPSRC Strategic Equipment Grant (EP/T019190/1). J.A.W, F.F, and K.V.M.H. are grateful for funding by Myeloma UK and the Joyce and Norman Freed Trust.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eKaelin WG, Jr. The concept of synthetic lethality in the context of anticancer therapy. Nat Rev Cancer. 2005;5(9):689-98.\u003c/li\u003e\n\u003cli\u003eDruker BJ. Perspectives on the development of a molecularly targeted agent. Cancer Cell. 2002;1(1):31-6.\u003c/li\u003e\n\u003cli\u003eHartman JLt, Garvik B, Hartwell L. Principles for the buffering of genetic variation. Science. 2001;291(5506):1001-4.\u003c/li\u003e\n\u003cli\u003ePeng S, Long M, Chen Q, Yin Z, Zeng C, Zhang W, et al. Perspectives on cancer therapy-synthetic lethal precision medicine strategies, molecular mechanisms, therapeutic targets and current technical challenges. Cell Death Discov. 2025;11(1):179.\u003c/li\u003e\n\u003cli\u003eCampbell JD, Alexandrov A, Kim J, Wala J, Berger AH, Pedamallu CS, et al. Distinct patterns of somatic genome alterations in lung adenocarcinomas and squamous cell carcinomas. Nat Genet. 2016;48(6):607-16.\u003c/li\u003e\n\u003cli\u003eFraga MF, Ballestar E, Villar-Garea A, Boix-Chornet M, Espada J, Schotta G, et al. Loss of acetylation at Lys16 and trimethylation at Lys20 of histone H4 is a common hallmark of human cancer. Nat Genet. 2005;37(4):391-400.\u003c/li\u003e\n\u003cli\u003eGao YB, Chen ZL, Li JG, Hu XD, Shi XJ, Sun ZM, et al. Genetic landscape of esophageal squamous cell carcinoma. Nat Genet. 2014;46(10):1097-102.\u003c/li\u003e\n\u003cli\u003eGui Y, Guo G, Huang Y, Hu X, Tang A, Gao S, et al. Frequent mutations of chromatin remodeling genes in transitional cell carcinoma of the bladder. Nat Genet. 2011;43(9):875-8.\u003c/li\u003e\n\u003cli\u003eHuether R, Dong L, Chen X, Wu G, Parker M, Wei L, et al. The landscape of somatic mutations in epigenetic regulators across 1,000 paediatric cancer genomes. Nat Commun. 2014;5:3630.\u003c/li\u003e\n\u003cli\u003eEdmunds JW, Mahadevan LC, Clayton AL. Dynamic histone H3 methylation during gene induction: HYPB/Setd2 mediates all H3K36 trimethylation. EMBO J. 2008;27(2):406-20.\u003c/li\u003e\n\u003cli\u003eGerber M, Shilatifard A. Transcriptional elongation by RNA polymerase II and histone methylation. J Biol Chem. 2003;278(29):26303-6.\u003c/li\u003e\n\u003cli\u003eKrogan NJ, Kim M, Tong A, Golshani A, Cagney G, Canadien V, et al. Methylation of histone H3 by Set2 in Saccharomyces cerevisiae is linked to transcriptional elongation by RNA polymerase II. Mol Cell Biol. 2003;23(12):4207-18.\u003c/li\u003e\n\u003cli\u003eLi J, Moazed D, Gygi SP. Association of the histone methyltransferase Set2 with RNA polymerase II plays a role in transcription elongation. J Biol Chem. 2002;277(51):49383-8.\u003c/li\u003e\n\u003cli\u003eYoh SM, Lucas JS, Jones KA. The Iws1:Spt6:CTD complex controls cotranscriptional mRNA biosynthesis and HYPB/Setd2-mediated histone H3K36 methylation. Genes Dev. 2008;22(24):3422-34.\u003c/li\u003e\n\u003cli\u003eLuco RF, Pan Q, Tominaga K, Blencowe BJ, Pereira-Smith OM, Misteli T. Regulation of alternative splicing by histone modifications. Science. 2010;327(5968):996-1000.\u003c/li\u003e\n\u003cli\u003eCarvalho S, Raposo AC, Martins FB, Grosso AR, Sridhara SC, Rino J, et al. Histone methyltransferase SETD2 coordinates FACT recruitment with nucleosome dynamics during transcription. Nucleic Acids Res. 2013;41(5):2881-93.\u003c/li\u003e\n\u003cli\u003eLi F, Mao G, Tong D, Huang J, Gu L, Yang W, et al. The histone mark H3K36me3 regulates human DNA mismatch repair through its interaction with MutSalpha. Cell. 2013;153(3):590-600.\u003c/li\u003e\n\u003cli\u003ePfister SX, Ahrabi S, Zalmas LP, Sarkar S, Aymard F, Bachrati CZ, et al. SETD2-dependent histone H3K36 trimethylation is required for homologous recombination repair and genome stability. Cell Rep. 2014;7(6):2006-18.\u003c/li\u003e\n\u003cli\u003eCarvalho S, Vitor AC, Sridhara SC, Martins FB, Raposo AC, Desterro JM, et al. SETD2 is required for DNA double-strand break repair and activation of the p53-mediated checkpoint. Elife. 2014;3:e02482.\u003c/li\u003e\n\u003cli\u003eKanu N, Gronroos E, Martinez P, Burrell RA, Yi Goh X, Bartkova J, et al. SETD2 loss-of-function promotes renal cancer branched evolution through replication stress and impaired DNA repair. Oncogene. 2015;34(46):5699-708.\u003c/li\u003e\n\u003cli\u003eBleuyard JY, Fournier M, Nakato R, Couturier AM, Katou Y, Ralf C, et al. MRG15-mediated tethering of PALB2 to unperturbed chromatin protects active genes from genotoxic stress. Proc Natl Acad Sci U S A. 2017;114(29):7671-6.\u003c/li\u003e\n\u003cli\u003ePai CC, Kishkevich A, Deegan RS, Keszthelyi A, Folkes L, Kearsey SE, et al. Set2 Methyltransferase Facilitates DNA Replication and Promotes Genotoxic Stress Responses through MBF-Dependent Transcription. Cell Rep. 2017;20(11):2693-705.\u003c/li\u003e\n\u003cli\u003eSharda A, Humphrey TC. The role of histone H3K36me3 writers, readers and erasers in maintaining genome stability. DNA Repair (Amst). 2022;119:103407.\u003c/li\u003e\n\u003cli\u003ePark IY, Powell RT, Tripathi DN, Dere R, Ho TH, Blasius TL, et al. Dual Chromatin and Cytoskeletal Remodeling by SETD2. Cell. 2016;166(4):950-62.\u003c/li\u003e\n\u003cli\u003eDalgliesh GL, Furge K, Greenman C, Chen L, Bignell G, Butler A, et al. Systematic sequencing of renal carcinoma reveals inactivation of histone modifying genes. Nature. 2010;463(7279):360-3.\u003c/li\u003e\n\u003cli\u003eDuns G, Hofstra RM, Sietzema JG, Hollema H, van Duivenbode I, Kuik A, et al. Targeted exome sequencing in clear cell renal cell carcinoma tumors suggests aberrant chromatin regulation as a crucial step in ccRCC development. Hum Mutat. 2012;33(7):1059-62.\u003c/li\u003e\n\u003cli\u003eZbar B, Brauch H, Talmadge C, Linehan M. Loss of alleles of loci on the short arm of chromosome 3 in renal cell carcinoma. Nature. 1987;327(6124):721-4.\u003c/li\u003e\n\u003cli\u003eHakimi AA, Ostrovnaya I, Reva B, Schultz N, Chen YB, Gonen M, et al. Adverse outcomes in clear cell renal cell carcinoma with mutations of 3p21 epigenetic regulators BAP1 and SETD2: a report by MSKCC and the KIRC TCGA research network. Clin Cancer Res. 2013;19(12):3259-67.\u003c/li\u003e\n\u003cli\u003eHo TH, Park IY, Zhao H, Tong P, Champion MD, Yan H, et al. High-resolution profiling of histone h3 lysine 36 trimethylation in metastatic renal cell carcinoma. Oncogene. 2016;35(12):1565-74.\u003c/li\u003e\n\u003cli\u003eFontebasso AM, Schwartzentruber J, Khuong-Quang DA, Liu XY, Sturm D, Korshunov A, et al. Mutations in SETD2 and genes affecting histone H3K36 methylation target hemispheric high-grade gliomas. Acta Neuropathol. 2013;125(5):659-69.\u003c/li\u003e\n\u003cli\u003eNewbold RF, Mokbel K. Evidence for a tumour suppressor function of SETD2 in human breast cancer: a new hypothesis. Anticancer Res. 2010;30(9):3309-11.\u003c/li\u003e\n\u003cli\u003ePai CC, Hsu KF, Durley SC, Keszthelyi A, Kearsey SE, Rallis C, et al. An essential role for dNTP homeostasis following CDK-induced replication stress. J Cell Sci. 2019;132(6).\u003c/li\u003e\n\u003cli\u003ePfister Sophia X, Markkanen E, Jiang Y, Sarkar S, Woodcock M, Orlando G, et al. Inhibiting WEE1 Selectively Kills Histone H3K36me3-Deficient Cancers by dNTP Starvation. Cancer Cell. 2015;28(5):557-68.\u003c/li\u003e\n\u003cli\u003eRivera MI, Stinson SF, Vistica DT, Jorden JL, Kenney S, Sausville EA. Selective toxicity of the tricyclic thiophene NSC 652287 in renal carcinoma cell lines: differential accumulation and metabolism. Biochem Pharmacol. 1999;57(11):1283-95.\u003c/li\u003e\n\u003cli\u003eIssaeva N, Bozko P, Enge M, Protopopova M, Verhoef LG, Masucci M, et al. Small molecule RITA binds to p53, blocks p53-HDM-2 interaction and activates p53 function in tumors. Nat Med. 2004;10(12):1321-8.\u003c/li\u003e\n\u003cli\u003eFranken NA, Rodermond HM, Stap J, Haveman J, van Bree C. Clonogenic assay of cells in vitro. Nat Protoc. 2006;1(5):2315-9.\u003c/li\u003e\n\u003cli\u003eHuang J, Huen MS, Kim H, Leung CC, Glover JN, Yu X, et al. RAD18 transmits DNA damage signalling to elicit homologous recombination repair. Nat Cell Biol. 2009;11(5):592-603.\u003c/li\u003e\n\u003cli\u003eSpanswick VJ, Hartley JM, Hartley JA. Measurement of DNA interstrand crosslinking in individual cells using the Single Cell Gel Electrophoresis (Comet) assay. Methods Mol Biol. 2010;613:267-82.\u003c/li\u003e\n\u003cli\u003eBecher I, Werner T, Doce C, Zaal EA, Togel I, Khan CA, et al. Thermal profiling reveals phenylalanine hydroxylase as an off-target of panobinostat. Nat Chem Biol. 2016;12(11):908-10.\u003c/li\u003e\n\u003cli\u003eHuber KV, Olek KM, Muller AC, Tan CS, Bennett KL, Colinge J, et al. Proteome-wide drug and metabolite interaction mapping by thermal-stability profiling. Nat Methods. 2015;12(11):1055-7.\u003c/li\u003e\n\u003cli\u003eFeyertag FH, K.V.M. TP-MAP - an Integrated Software Package for the Analysis of 1D and 2D Thermal Profiling Data. bioRxiv. 2021.\u003c/li\u003e\n\u003cli\u003eFeuermann M, Mi H, Gaudet P, Muruganujan A, Lewis SE, Ebert D, et al. A compendium of human gene functions derived from evolutionary modelling. Nature. 2025;640(8057):146-54.\u003c/li\u003e\n\u003cli\u003eXie P, Tian C, An L, Nie J, Lu K, Xing G, et al. Histone methyltransferase protein SETD2 interacts with p53 and selectively regulates its downstream genes. Cell Signal. 2008;20(9):1671-8.\u003c/li\u003e\n\u003cli\u003eWanzel M, Vischedyk JB, Gittler MP, Gremke N, Seiz JR, Hefter M, et al. CRISPR-Cas9-based target validation for p53-reactivating model compounds. Nat Chem Biol. 2016;12(1):22-8.\u003c/li\u003e\n\u003cli\u003eNieves-Neira W, Rivera MI, Kohlhagen G, Hursey ML, Pourquier P, Sausville EA, et al. DNA protein cross-links produced by NSC 652287, a novel thiophene derivative active against human renal cancer cells. Mol Pharmacol. 1999;56(3):478-84.\u003c/li\u003e\n\u003cli\u003eRees MG, Seashore-Ludlow B, Cheah JH, Adams DJ, Price EV, Gill S, et al. Correlating chemical sensitivity and basal gene expression reveals mechanism of action. Nat Chem Biol. 2016;12(2):109-16.\u003c/li\u003e\n\u003cli\u003eSeah VM, Wong KP. 2,6-Dichloro-4-nitrophenol (DCNP), an alternate-substrate inhibitor of phenolsulfotransferase. Biochem Pharmacol. 1994;47(10):1743-9.\u003c/li\u003e\n\u003cli\u003ePeyser BD, Hermone A, Salamoun JM, Burnett JC, Hollingshead MG, McGrath CF, et al. Specific RITA Modification Produces Hyperselective Cytotoxicity While Maintaining In Vivo Antitumor Efficacy. Mol Cancer Ther. 2019;18(10):1765-74.\u003c/li\u003e\n\u003cli\u003eShi L, Shen W, Davis MI, Kong K, Vu P, Saha SK, et al. SULT1A1-dependent sulfonation of alkylators is a lineage-dependent vulnerability of liver cancers. Nat Cancer. 2023;4(3):365-81.\u003c/li\u003e\n\u003cli\u003eLou JJ, Chua YL, Chew EH, Gao J, Bushell M, Hagen T. Inhibition of hypoxia-inducible factor-1alpha (HIF-1alpha) protein synthesis by DNA damage inducing agents. PLoS One. 2010;5(5):e10522.\u003c/li\u003e\n\u003cli\u003eDoggrell SA. RITA--a small-molecule anticancer drug that targets p53. Expert Opin Investig Drugs. 2005;14(6):739-42.\u003c/li\u003e\n\u003cli\u003eGrinkevich VV, Vema A, Fawkner K, Issaeva N, Andreotti V, Dickinson ER, et al. Novel Allosteric Mechanism of Dual p53/MDM2 and p53/MDM4 Inhibition by a Small Molecule. Front Mol Biosci. 2022;9:823195.\u003c/li\u003e\n\u003cli\u003eStrahl BD, Grant PA, Briggs SD, Sun ZW, Bone JR, Caldwell JA, et al. Set2 is a nucleosomal histone H3-selective methyltransferase that mediates transcriptional repression. Mol Cell Biol. 2002;22(5):1298-306.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"","lastPublishedDoi":"10.21203/rs.3.rs-8849233/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-8849233/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eThe histone methyltransferase SETD2 and its associated histone mark H3 lysine 36 trimethylation (H3K36me3) are frequently lost in cancer, identifying SETD2 tumour suppressor loss as an important therapeutic target. Here we show that SETD2-deficient cancer cells are profoundly sensitive to RITA (2,5-bis[5-hydroxymethyl-2-thienyl] furan; NSC652287). Exposure of SETD2-deficient cancer cells to RITA results in significant p53 induction and apoptosis. However, TP53-deficient cells also exhibit RITA sensitivity suggesting p53 induction is an effect rather than a cause of RITA sensitivity. We find that RITA sensitivity is dependent on the phenol sulfotransferase SULT1A1, which is highly upregulated in SETD2-deficient cells. Accordingly, structural modifications of RITA, predicted to compromise its sulfation, ablated its activity. Further, SETD2-deficient cells can be targeted with YC-1, another SULT1A1-dependent anti-cancer agent. RITA sensitivity was associated with defects in DNA replication, leading to delays in S-phase progression, increased recruitment of replication stress markers, and reduced replication fork progression. Consistent with this, global target deconvolution using thermal profiling (2D-TPP) identified a broad range of RITA target proteins, including many involved in DNA replication stress. Together, these findings support the exploitation of SULT1A1 expression as a novel therapeutic strategy to target SETD2-deficient cancers.\u003c/p\u003e","manuscriptTitle":"Therapeutic targeting of SETD2-deficient cancer cells with the small-molecule compound RITA","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2026-02-23 15:43:03","doi":"10.21203/rs.3.rs-8849233/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"5814aba2-048c-4fde-bc3f-b1cac1fc8b60","owner":[],"postedDate":"February 23rd, 2026","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":63065343,"name":"Biological sciences/Molecular biology/DNA damage and repair"},{"id":63065344,"name":"Biological sciences/Cancer/Cancer genetics"},{"id":63065345,"name":"Biological sciences/Drug discovery/Medicinal chemistry/Drug discovery and development"}],"tags":[],"updatedAt":"2026-04-17T11:58:12+00:00","versionOfRecord":[],"versionCreatedAt":"2026-02-23 15:43:03","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-8849233","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-8849233","identity":"rs-8849233","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.