Intestinal stem cell renewal controlled by capillary morphogenesis gene 2 following injury

Intestinal stem cell renewal controlled by capillary morphogenesis gene 2 following injury | bioRxiv /* */ /* */ <!-- <!-- /*! * yepnope1.5.4 * (c) WTFPL, GPLv2 */ (function(a,b,c){function d(a){return"[object Function]"==o.call(a)}function e(a){return"string"==typeof a}function f(){}function g(a){return!a||"loaded"==a||"complete"==a||"uninitialized"==a}function h(){var a=p.shift();q=1,a?a.t?m(function(){("c"==a.t?B.injectCss:B.injectJs)(a.s,0,a.a,a.x,a.e,1)},0):(a(),h()):q=0}function i(a,c,d,e,f,i,j){function k(b){if(!o&&g(l.readyState)&&(u.r=o=1,!q&&h(),l.onload=l.onreadystatechange=null,b)){"img"!=a&&m(function(){t.removeChild(l)},50);for(var d in y[c])y[c].hasOwnProperty(d)&&y[c][d].onload()}}var j=j||B.errorTimeout,l=b.createElement(a),o=0,r=0,u={t:d,s:c,e:f,a:i,x:j};1===y[c]&&(r=1,y[c]=[]),"object"==a?l.data=c:(l.src=c,l.type=a),l.width=l.height="0",l.onerror=l.onload=l.onreadystatechange=function(){k.call(this,r)},p.splice(e,0,u),"img"!=a&&(r||2===y[c]?(t.insertBefore(l,s?null:n),m(k,j)):y[c].push(l))}function j(a,b,c,d,f){return q=0,b=b||"j",e(a)?i("c"==b?v:u,a,b,this.i++,c,d,f):(p.splice(this.i++,0,a),1==p.length&&h()),this}function k(){var a=B;return a.loader={load:j,i:0},a}var l=b.documentElement,m=a.setTimeout,n=b.getElementsByTagName("script")[0],o={}.toString,p=[],q=0,r="MozAppearance"in l.style,s=r&&!!b.createRange().compareNode,t=s?l:n.parentNode,l=a.opera&&"[object Opera]"==o.call(a.opera),l=!!b.attachEvent&&!l,u=r?"object":l?"script":"img",v=l?"script":u,w=Array.isArray||function(a){return"[object Array]"==o.call(a)},x=[],y={},z={timeout:function(a,b){return b.length&&(a.timeout=b[0]),a}},A,B;B=function(a){function b(a){var a=a.split("!"),b=x.length,c=a.pop(),d=a.length,c={url:c,origUrl:c,prefixes:a},e,f,g;for(f=0;f<d;f++)g=a[f].split("="),(e=z[g.shift()])&&(c=e(c,g));for(f=0;f<b;f++)c=x[f](c);return c}function g(a,e,f,g,h){var i=b(a),j=i.autoCallback;i.url.split(".").pop().split("?").shift(),i.bypass||(e&&(e=d(e)?e:e[a]||e[g]||e[a.split("/").pop().split("?")[0]]),i.instead?i.instead(a,e,f,g,h):(y[i.url]?i.noexec=!0:y[i.url]=1,f.load(i.url,i.forceCSS||!i.forceJS&&"css"==i.url.split(".").pop().split("?").shift()?"c":c,i.noexec,i.attrs,i.timeout),(d(e)||d(j))&&f.load(function(){k(),e&&e(i.origUrl,h,g),j&&j(i.origUrl,h,g),y[i.url]=2})))}function h(a,b){function c(a,c){if(a){if(e(a))c||(j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}),g(a,j,b,0,h);else if(Object(a)===a)for(n in m=function(){var b=0,c;for(c in a)a.hasOwnProperty(c)&&b++;return b}(),a)a.hasOwnProperty(n)&&(!c&&!--m&&(d(j)?j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}:j[n]=function(a){return function(){var b=[].slice.call(arguments);a&&a.apply(this,b),l()}}(k[n])),g(a[n],j,b,n,h))}else!c&&l()}var h=!!a.test,i=a.load||a.both,j=a.callback||f,k=j,l=a.complete||f,m,n;c(h?a.yep:a.nope,!!i),i&&c(i)}var i,j,l=this.yepnope.loader;if(e(a))g(a,0,l,0);else if(w(a))for(i=0;i (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0];var j=d.createElement(s);var dl=l!='dataLayer'?'&l='+l:'';j.src='//www.googletagmanager.com/gtm.js?id='+i+dl;j.type='text/javascript';j.async=true;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-M677548'); Skip to main content Home About Submit ALERTS / RSS Search for this keyword Advanced Search New Results Intestinal stem cell renewal controlled by capillary morphogenesis gene 2 following injury Lucie Bracq , Audrey Chuat , Béatrice Kunz , Olivier Burri , Romain Guiet , View ORCID Profile F. Gisou van der Goot doi: https://doi.org/10.1101/2025.01.07.631493 Lucie Bracq 1 Global Health Institute, School of Life Sciences , EPFL, Lausanne Switzerland Find this author on Google Scholar Find this author on PubMed Search for this author on this site For correspondence: gisou.vandergoot{at}epfl.ch lucie.bracq{at}epfl.ch Audrey Chuat 1 Global Health Institute, School of Life Sciences , EPFL, Lausanne Switzerland Find this author on Google Scholar Find this author on PubMed Search for this author on this site Béatrice Kunz 1 Global Health Institute, School of Life Sciences , EPFL, Lausanne Switzerland Find this author on Google Scholar Find this author on PubMed Search for this author on this site Olivier Burri 2 BioImaging and Optics Core Facility, School of Life Science , EPFL, Lausanne Switzerland Find this author on Google Scholar Find this author on PubMed Search for this author on this site Romain Guiet 2 BioImaging and Optics Core Facility, School of Life Science , EPFL, Lausanne Switzerland Find this author on Google Scholar Find this author on PubMed Search for this author on this site F. Gisou van der Goot 1 Global Health Institute, School of Life Sciences , EPFL, Lausanne Switzerland Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for F. Gisou van der Goot For correspondence: gisou.vandergoot{at}epfl.ch lucie.bracq{at}epfl.ch Abstract Full Text Info/History Metrics Preview PDF SUMMARY Patients with the rare genetic disorder Hyaline Fibromatosis Syndrome (HFS) often succumb before 18 months of age due to severe diarrhea and protein-losing enteropathy. As HFS is caused by loss-of-function mutations in the gene encoding capillary morphogenesis gene 2 (CMG2), also known as Anthrax Toxin Receptor 2, these symptoms highlight a critical yet unclear role for CMG2 in the gut. Here, we demonstrate that CMG2 knockout mice exhibit normal colon morphology and no signs of inflammation until the chemical induction of colitis. In these conditions, the colons of knockout mice do not regenerate despite previously experiencing similarly severe colitis, due to an inability to replenish their intestinal stem cell pool. Specifically, CMG2 knockout impairs the transition from fetal-like to Lgr5+ adult stem cells, which is associated with a defect in ß-catenin nuclear translocation. Our findings suggest that CMG2 functions as a context-specific modulator of Wnt signaling, essential for replenishing the pool of intestinal stem cells following injury. This study provides new insights into the molecular mechanisms underlying protein-losing enteropathy in HFS and offers a broader understanding of fetal-like regenerative responses. Download figure Open in new tab INTRODUCTION Hyaline Fibromatosis Syndrome (HFS; OMIM #228600) is a rare autosomal disorder that, in its most severe form, leads to death before 18 months of age due to intractable diarrhea or recurrent pulmonary infections 1 . Despite the critical nature of these symptoms, there are currently no effective interventions, primarily because the underlying molecular mechanisms remain poorly understood. The defining feature of HFS is however the abnormal accumulation of hyaline material, particularly collagen VI 2 , in the skin, which results in large subcutaneous nodules, gingival hypertrophy, and painful joint contractures 3 – 9 . HFS is caused by mutations in the Capillary Morphogenesis Gene 2 (CMG2), with evidence showing that CMG2 regulates extracellular collagen VI levels 2 . However, the severe diarrheal symptoms and associated intestinal lymphangiectasia, often culminating in fatal protein-losing enteropathy¹, suggest that CMG2 may play a distinct and crucial role in intestinal physiology that has not yet been characterized. This study aims to address this critical gap by elucidating the role of CMG2 in the gut and uncovering the mechanisms responsible for the devastating intestinal symptoms observed in severe HFS patients. CMG2, also known as ANTXR2, controls the turnover of collagen VI by mediating its intracellular uptake and degradation in lysosomes 2 . CMG2, a type I membrane protein featuring an extracellular von Willebrand A (vWA) domain, can indeed bind extracellular matrix components, including laminin and types IV and VI collagen 10 , as well the actin cytoskeleton and actin modulators intracellularly 11 . Upon CMG2 loss of function, multi systemic-deposition of collagens, in particular Collagen VI, occurs in HFS patients 2 , 11 – 13 . CMG2 may have roles other than controlling the abundance of the ECM. In particular, while the intestine of two infants with severe HFS showed accumulation of ECM and in particular collagen VI, no primary defect in the function of the intestinal epithelium was observed based on in vitro culture of patient cells either as gut organoids or intestinal epithelial layers 13 . We therefore speculate that CMG2 does not act directly on intestinal epithelial cells but plays a role in crucial processes such as homeostatic cellular turnover and intestinal regeneration. The YAP and Wnt signaling pathways are central to these processes 14 – 16 , and several studies have suggested links between CMG2 and these pathways 2 , 17 – 21 . The normal rapid cellular turnover of the intestinal epithelium is controlled by the interplay between Wnt, Notch, and YAP/Taz signaling pathways 22 . After intestinal injury, intestinal stem cells (ISCs) are depleted 23 – 29 , triggering a regenerative response to restore tissue integrity 14 , 22 , 30 – 32 . Recent research indicates that this regeneration involves dedifferentiation and a fetal-like regenerative response 14 , 23 , 25 , 26 , 31 – 42 , a process highly dependent on YAP and Wnt signaling interactions 25 , 43 , 44 . However, the precise mechanisms governing this regenerative response remain incompletely understood. In this study, we utilized a knockout mouse model to investigate the role of CMG2 in the colon under both normal and regenerative conditions. While no abnormalities were observed in the intestinal architecture or function under homeostatic conditions, the scenario changed following chemically-induced colitis 45 , 46 . Cmg2 knockout ( Cmg2 KO ) mice failed to restore intestinal integrity, underscoring a critical role for CMG2 in regeneration. Our analysis showed that CMG2 is not involved in the initial fetal-like reversion phase, but is essential to replenish the Lgr5+ intestinal stem cell (ISC) pool— an important Wnt-dependent step for epithelial proliferation and barrier restoration. These findings highlight CMG2’s vital role in Wnt-driven ISC replenishment during intestinal regeneration, providing new insights into the transition from fetal-like to adult ISC states, and provide molecular understanding for the chronic diarrhea seen in severe HFS patients. RESULTS Gut in Cmg2 KO mice is normal under basal conditions but fails to recover from DSS-induced colitis To explore the role of CMG2 in intestinal homeostasis, we used our previously described Cmg2 KO mice 2 . Using this model, we found no obvious symptoms associated with intestinal dysfunction (Fig. S1a), nor abnormalities in crypt architecture detectable by histological examination (Fig. S1b-d) in Cmg2 KO mice. We then specifically measured collagen VI, as it has been observed to accumulate over time in both HFS patient nodules and Cmg2 KO mouse tissues 2 , due to impaired CMG2-mediated turnover. However, the colon of 8-week-old Cmg2 KO mice had normal levels of collagen VI as measured by Western blot analysis of protein extracts (Fig. S1e-f), histological examination (Fig. S1b), immunofluorescence (Fig. S1g-h), and qPCR (Fig. S1i). Additionally, the loss of CMG2 did not affect the number of ISCs and actively proliferating cells, both essential for maintaining epithelial integrity under homeostatic conditions 47 – 49 . Markers for ISCs, including Lgr5 mRNA (Fig. S1j-l), and indicators of cell proliferation (Fig. S1m-o) also showed no significant differences between Cmg2 KO and Cmg2 WT mice, suggesting normal cellular turnover. Furthermore, Cmg2 KO mice exhibited no signs of inflammation (Fig. S1p). Overall, these findings indicate that the loss of CMG2 does not significantly impact the architecture or function of the mouse colon under homeostatic conditions. To explore this seeming discrepancy between the healthy colons in Cmg2 KO mice versus the recurrent, non-infectious diarrhea seen in HFS patients, we examined whether differences between control and KO mice would emerge under stress conditions. Using the well-established dextran sodium sulfate (DSS)-induced colitis model ( Fig. 1a-b ), both Cmg2 KO mice and their wild-type littermates received 3% DSS in their drinking water for 7 days, consuming similar amounts ( Fig. 1c ). In both groups, the treatment led to established effects of DSS-induced colitis 45 , 46 , 50 , 51 , including body weight loss ( Fig. 1d ), diarrhea, and rectal bleeding ( Fig. 1e ). To evaluate potential differences in colitis severity, we monitored the disease activity index (DAI) 45 , 46 , 50 daily throughout the experiment ( Fig. 1d-f ). Until the end of the 7-day DSS treatment, both groups showed a similar, progressive increase in DAI ( Fig. 1f ) alongside a sharp rise in the intestinal inflammation marker lipocalin-2 ( Fig. 1g ), confirming the successful induction of colitis in our model. Histological examination immediately after the DSS challenge revealed significant colon alterations in both Cmg2 WT and Cmg2 KO mice, including loss of crypt architecture (Fig. S2a), depletion of epithelial cells (Fig. S2a,b), and reduced cell proliferation (Fig. S2a,c). DSS treatment also led to the loss of Lgr5 + stem cells (Fig. S2a,d-e), a common feature of intestinal damage, with similar levels of inflammation observed in both groups (Fig. S2f-i). Overall, these results indicate that CMG2 does not affect the severity of DSS-induced colitis. Download figure Open in new tab Figure 1: Cmg2 KO mice fail to recover from DSS-induced colitis. 8-week-old Cmg2 WT or Cmg2 KO males were given 3% Dextran-Sulfate-Sodium (DSS) in their drinking water for 7 days, then switched to regular drinking water for 3 days to recover. (a) Experimental scheme of DSS-induced colitis. (b) Disease activity index (DAI) scoring and (c) water consumption was measured daily during the 10-day experiment. In (c), results are mean ± SEM. Each dot represents the mean of n = 2 or 3 different cages. P values were obtained using a two-way ANOVA Tukey’s multiple comparisons test. (d) Body weight loss, (f) the aspect of the feces and presence of occult blood were monitored and used for the (e) DAI. Results are mean ± SEM. Each dot represents the mean of n = 12 mice per genotype. P values were obtained by two-way ANOVA Šídák’s multiple comparisons test. In (e), presence of blood in feces was detected using a urine strip test from collected feces. Each row corresponds to a single mouse and each column to a different timepoint. Feces were collected daily, and (g) fecal lipocalin-2 was quantified by ELISA. Results are mean ± SEM. Each dot represents the mean of n = 12 mice per genotype. P values were obtained using a two-way ANOVA Šídák’s multiple comparisons test. Excessive body weight loss (>25%) required animal euthanasia as shown in (h) probability of survival. On day10, mice were euthanatized, organ collected and (i-j) colon length were measured. Representative images of n = 8 mice per genotype for untreated mice and n = 12 mice per genotype for DSS-treated mice. Scale bar, 1 cm. In (J), Results are mean ± SEM. Each symbol represents a single measurement. P values were obtained using an unpaired T-test. After the 7-day DSS treatment, mice were switched to normal drinking water for 3 days, a period known to allow intestinal regeneration in control mice 45 , 46 , 50 ( Fig. 1a ). During this phase, Cmg2 WT mice showed typical signs of recovery, including a stabilization of body weight ( Fig. 1d ), cessation of rectal bleeding ( Fig. 1e ), reduction in DAI ( Fig. 1f ), and reduced levels of lipocalin-2 in feces ( Fig. 1g ). In contrast, Cmg2 KO mice continued to lose weight ( Fig. 1d ), ultimately reaching the legal euthanasia limit (>25% body weight loss), which led to a sudden increase in apparent mortality ( Fig. 1h ). Moreover, both occult blood and elevated lipocalin-2 levels persisted in the feces of Cmg2 KO mice ( Fig. 1e ). Additionally, colons from Cmg2 KO mice euthanized on day 10 were significantly shorter than those of their wild-type counterparts ( Fig. 1i-j ). Together, these findings indicate that while CMG2 does not affect the initial severity of DSS-induced colitis, it plays a crucial role in promoting intestinal recovery after injury, as evidenced by the impaired regeneration observed in Cmg2 KO mice. Injury-induced colon regeneration is impaired in Cmg2 KO mice To investigate the underlying cellular mechanisms, we performed a detailed analysis of mouse colons after 3 days of DSS withdrawal. In control mice, the crypts were elongated and hypertrophic, a hallmark of the regenerative phase following colitis ( Fig. 2a-c ) 25 , 52 , 53 . In stark contrast, Cmg2 KO mice displayed shorter, fewer crypts, and the tissue showed severe alterations. The atrophic crypts in Cmg2 KO mice had a squamous morphology, differing from the typical columnar shape of epithelial cells seen under normal conditions or during regeneration in Cmg2 WT mice ( Fig. 2a ). Additionally, the histological inflammation score was significantly higher in Cmg2 KO colons during the DSS withdrawal period compared to control mice ( Fig. 2d-e ). Download figure Open in new tab Figure 2: Injury-induced gut regeneration is impaired in Cmg2 KO mice. 8-week-old Cmg2 WT or Cmg2 KO males were given 3% Dextran-Sulfate-Sodium (DSS) in their drinking water for 7 days, then switched to regular drinking water for 3 days to recover. On day10, mice were euthanatized, and their colons were collected. (a) Colon tissues were stained for Hematoxylin/Eosin. Representative images of at least n=11 mice per genotype. Scale bar,100µm. (b) Number of crypts per field, (c) crypt length and (d-e) histological score were quantified. Results are mean ± SEM. Each dot represents a single measurement, and each triangle represent the mean per mice. Dotted line represents homeostatic levels of Cmg2 WT mice. At least n=10 mice per genotype were quantified. P values obtained by Two-tailed unpaired t test. (f) Colonic sections were stained with anti-ki67, anti-VE-cadherin, and DAPI. Representative images of at least n=10 mice per genotype. Scale bar, 100µm. (g) % of E-cadherin+, and (h) % of E-cadherin+/Ki67+ cells at homeostasis (-), after 7 days of DSS (7) or 3 days after DSS withdrawal (7+3) were quantified. Results are mean ± SEM. Each dot represents a single measurement and each triangle represent the mean per mice. At least n=4 mice per genotype were quantified. P values obtained by Two-way ANOVA Šídák’s multiple comparisons test. (i) Immunostaining of neutrophil was performed on colonic section using S100A9 antibody and number of neutrophils per mm2 quantified. Results are mean ± SEM. Each dot represents a single measurement and each triangle represent the mean per mouse. At least n=11 mice per genotype was quantified. P values obtained by Two-tailed unpaired t test. In (j) qPCR analysis of colonic tissues from Cmg2 WT and Cmg2 KO for the intestinal inflammation marker Lipocalin-2. Results are mean ± SEM. n=12 mice per genotype were quantified. P values obtained by Two-tailed unpaired t test. To further examine the damage-induced regeneration process, we assessed epithelial cell proliferation by co-staining for E-cadherin and Ki67 ( Fig. 2f ). In Cmg2 WT mice, colons showed elongated crypts with a higher percentage of E-cadherin+/Ki67+ cells compared to the active disease phase (Day 7), returning to levels similar to those seen under control conditions (Day 0) ( Fig. 2f, h ). In contrast, Cmg2 KO mice exhibited persistently low levels of proliferating epithelial cells from day 7 to 10, with crypts that remained atrophic. Damage in Cmg2 KO colons appeared to worsen even after DSS removal, as indicated by a further reduction in epithelial cell numbers ( Fig. 2g ). Additionally, these colons had more infiltrating neutrophils than those of WT mice ( Fig. 2i ) and showed increased expression of the inflammation marker lipocalin-2 ( Fig. 2j ). Collectively, these findings indicate that Cmg2 KO mice fail to transition from the active disease phase to the regenerative phase after DSS withdrawal, leading to increased damage and impaired repair. CMG2 Is Dispensable for YAP/TAZ-Mediated Reprogramming to Fetal-Like Stem Cells Since Cmg2 KO mice fail to regenerate their gut upon DSS challenge, we next examined which key steps of the fetal-like regenerative response 25 , 26 , 33 might be affected by Cmg2 depletion. First, we tested whether the expression of Ly6a, a marker of fetal-like stem cells, was influenced by CMG2 in DSS-injured colons. As expected, Ly6a mRNA levels were low under homeostatic conditions and increased significantly 3 days after DSS withdrawal in control mice. ( Fig. 3a ). Interestingly, this same pattern was also observed in Cmg2 KO mice ( Fig. 3a ). Immunofluorescence staining further confirmed the emergence of a fetal-like stem cell population in the colons of both control and Cmg2 KO mice during regeneration ( Fig. 3b-c ). Given that this switch to fetal-like stem cells is heavily dependent on YAP/TAZ signaling pathways 25 , 43 , we investigated whether CMG2 loss affected YAP/TAZ signaling during intestinal regeneration. We measured the mRNA levels of two additional YAP target genes, Cyr61 and CTGF ( Fig. 3d-e ), both of which were significantly upregulated in the colons of Cmg2 KO mice after DSS withdrawal ( Fig. 3e-f ). These findings suggest that CMG2 loss does not impair YAP/TAZ-dependent reprogramming of intestinal cells into fetal-like stem cells. Download figure Open in new tab Figure 3: CMG2 is dispensable for YAP/TAZ-dependent reprogramming into fetal-like stem cells but essential for the replenishment of the Lgr5 + ISC pool. (a) qPCR analysis of colonic tissues from Cmg2 WT and Cmg2 KO during homeostasis (-) or 3 days after DSS withdrawal (7+3) for Ly6a. Results are mean ± SEM. Each symbol represents the mean per mouse. At least n=10 mice per genotype were quantified. P values obtained by two-way ANOVA Šídák’s multiple comparisons test. (b- left and middle panel ) Colonic sections were stained with anti-Ly6a, and DAPI and ( b -right panel ) coarse-grain analysis was performed. (c) Results are presented as Ly6a mean intensity. Representative images of n=4 mice per genotype. Scale bar, 100µm. Results are mean ± SEM. Dotted line represents homeostatic levels of Cmg2 WT . P values obtained by two-tailed unpaired t test. (d-e) qPCR analysis of colonic tissues from Cmg2 WT and Cmg2 KO 3 days after DSS withdrawal for YAP target genes (d) Cyr61 and (e) CTGF. Results are mean ± SEM. At least n=11 mice per genotype were quantified. P values obtained by two-tailed unpaired t test. (f-g) Colonic sections were stained for RNAscope in situ hybridization against Lgr5. Representative images of at least n=4 mice. Scale bar, 100µm. In (g) Lgr5 mRNA spots per µm 2 at homeostasis (-), after 7 days of DSS (7) or 3 days after DSS withdrawal (7+3) were quantified. Results are mean ± SEM. At least n=4 mice per genotype were quantified. P values obtained by two-way ANOVA test. (h) qPCR analysis of colonic tissues from Cmg2 WT and Cmg2 KO 3 days after DSS withdrawal for ISC genes Lgr5, Ascl2, Axin2 and Cyclin D1. Results are mean ± SEM. At least n=12 mice per genotype were quantified. P values obtained by two-tailed unpaired t test. (i) Colonic sections were stained with anti-β-catenin and DAPI. Representative images of n=4 mice per genotype. Scale bar, 100µm. (j) Colon lysates were western blotted against β-catenin and Actin. ( k ) Full-length (95 kDa) or (l) low–molecular-weight (LMW) β-catenin/loading control ratio were quantified and normalized to the mean of Cmg2 WT . Results are mean ± SEM, and n=4 mice per genotype were quantified. P values obtained by two-way ANOVA Tukey’s multiple comparisons test. CMG2 Is Critical for Restoring the Lgr5+ Intestinal Stem Cell Pool We then investigated whether the fetal-like stem cells observed in both Cmg2 WT and Cmg2 KO mice could successfully transition into adult Lgr5+ ISCs for the replenishment of Lgr5+ stem cells, which is crucial to drive epithelial repair 25 , 26 , 33 . After 3 days of DSS withdrawal, Lgr5 expression, monitored by RNAscope, returned to homeostatic levels in the colons of Cmg2 WT mice, as expected ( Fig. 3f-g ). In marked contrast, Lgr5 expression remained extremely low in Cmg2 KO mice, comparable to levels seen during the active disease phase (7 days of DSS treatment) ( Fig. 3f-g ). qPCR analysis reinforced these findings, showing significantly reduced levels of Lgr5 and three other ISC marker genes (Axin2, Ascl2, and Cyclin D1), all of which are Wnt targets, in Cmg2 KO mice compared to their wild-type littermates ( Fig. 3h ). These results indicate that, despite the presence of Ly6a+ fetal-like stem cells, the conversion into Lgr5+ ISCs failed to occur without CMG2. Following the discovery of the reduced levels of so many Wnt targets, we next investigated the role of CMG2 in modulating Wnt signaling following intestinal damage. Stemness in the intestinal epithelium relies on Wnt signaling 14 , 54 , which is tightly regulated by various signaling pathways 15 , 26 , 44 , 55 – 57 , and crucial for effective injury-induced intestinal repair 16 . Initially, we quantified the expression of key molecular components involved in Wnt signaling using qPCR. The mRNA levels of the Frizzled co-receptor LRP6, β-catenin (Fig. S3a-b), and Wnt ligands (Wnt5a, 5b, and 2b) were comparable between the colons of Cmg2 WT and Cmg2 KO mice (Fig. S3c), suggesting that CMG2 does not significantly influence the abundance of these major Wnt signaling players. Next, we analyzed β-catenin activation. Strikingly, while β-catenin was prominently detected in the nuclei of hypertrophic crypts in Cmg2 WT mice through immunostaining, the nuclei of cells in the atrophic crypts of Cmg2 KO mice were remarkably devoid of β-catenin ( Fig. 3i ). Western blot analysis revealed that β-catenin underwent cleavage in the colon of Cmg2 WT mice 3 days after DSS withdrawal ( Fig. 3j-l ), a hallmark of enhanced transcriptional activation 58 . In contrast, Cmg2 KO mice exhibited extremely low levels of both full-length and cleaved β-catenin during DSS treatment ( Fig. 3j-l ), despite displaying normal levels under basal conditions (Fig. S3d-e). Collectively, these findings demonstrate that CMG2 is essential for the reactivation of Wnt signaling, facilitating the transition from fetal-like to adult ISCs necessary for effective intestinal repair. DISCUSSION The present study underscores a critical and previously unknown role of CMG2 in gut function. The most severe form of HFS is often fatal due to intractable diarrhea. Our results show that Cmg2 KO mice exhibited no abnormalities in the colon under normal conditions, correlating with normal function of enterocytes derived from HFS patient cells 13 . Differences became apparent when the mice were subjected to chemical induced colitis. While both control and Cmg2 KO mice showed similar disease severity, the knockout mice failed to regenerate their colons after DSS withdrawal, resulting in persistent bloody diarrhea and significant weight loss—symptoms that closely mirror those seen in HFS patients. Our work demonstrates the implication of CMG2 in intestinal regeneration after damage, a process that is thought to occur in at least two phases. CMG2 was found to be non-essential during the initial de-differentiation phase, characterized by high YAP activation, with repression of Wnt signaling and ISC gene expression 44 , 55 , 56 , since we observed that fetal-like stem cells were present in the damaged colon of both Cmg2 WT and Cmg2 KO mice. Our data show that CMG2 is crucial for the second phase of Wnt- and Ascl2-dependent reacquisition of Lgr5+ stemness 59 , thereby enabling the restoration of intestinal homeostasis after injury. The fact that CMG2 is not required for basal gut homeostasis but is essential for replenishing the ISC pool aligns with the idea that Lgr5+ cells are dispensable for maintaining normal epithelial function 24 , 60 . During intestinal regeneration, the transition of these fetal-like stem cells to adult ISCs, require the downregulation of YAP and reactivation of Wnt signaling 61 – 66 , suggesting a major role of Cmg2 in tunning these signaling pathways. Our findings expand the growing network of connections between CMG2 and Wnt signaling pathways, as well as the connection to stem cells. Previous work on CMG2 identified it as an interactor of Wnt signaling co-receptor LRP6 through studies on anthrax toxin receptors 62 . We confirmed this interaction, demonstrating that LRP6 and CMG2 co-internalize during toxin entry 18 . CMG2 have also been shown to modulate LRP6 levels in a concentration-dependent manner, where both low and high levels of CMG2 reduce LRP6 abundance in cultured cells 18 . In mouse 3T3-L1 cells, downregulation of CMG2 consistently impaired Wnt-induced β-catenin stabilization 18 . CMG2 not only connects to canonical LPR6-dependent Wnt signaling. We indeed found that during zebrafish embryonic development, CMG2 is necessary for the non-canonical Wnt-dependent oriented cell division of epiblast cells, necessary for embryo extension 17 , 21 , a process that still involved LRP6. Recent studies in cancer biology extended the connection of CMG2-Wnt to stem cells 20 . CMG2 levels correlated with increased expression of stemness-related genes, such as Lgr5, as well as enhanced self-renewal and metastatic potential 20 . Manipulating CMG2 levels through over-expression or silencing altered nuclear β-catenin, consistent with previous observations in 3T3-L1 cells and our current findings that Cmg2 deficiency impaired β-catenin activation and Lgr5+ ISC in the damaged. Noteworthily, the absence of CMG2 does not result in the same effects as LRP6 or Wnt deficiencies, which can cause early lethality or milder phenotypes 67 . This indicates that CMG2 modulates Wnt signaling in a context-specific manner within the gut. In conclusion, our study demonstrates that CMG2 is a key player in gut regeneration, specifically impacting the Wnt-mediated replenishment of the Lgr5+ stem cell pool following injury. Combined with its established role in gastric stem cells, this work suggests a broader function for CMG2 in stem cell biology, particularly in tissue regeneration involving fetal-like reversion, as also seen in the stomach 66 , 68 , 69 . From a clinical perspective, our findings provide a molecular basis for the persistent diarrhea seen in HFS patients. In HFS infants, a diarrheal event may lead to failure in replenishing the stem cell pool, thus preventing reestablishment of epithelial barrier. These insights suggest that HFS patients might benefit from therapeutic approaches currently used for chronic diarrhea conditions, such as inflammatory bowel diseases (IBD). MATERIAL AND METHODS Animals CMG2 knockout mice were generated by targeted deletion of the gene exon 3 as described previously 2 . Cmg2 mutant mice were generated and backcrossed for at least 10 generations onto the C57Bl6/J genetic background (Charles River Laboratories). Cmg2 HET mice were kept in a specific pathogen free (SPF) environment with 12 h light and 12 h dark cycle with ad libitum access to food and water. Experiments were performed using littermate from the different genotypes and animals housed depending on their genotype. During the conduct of DSS experiment and during all data analysis, mice genotype was blinded. Characteristics of animals used in this study as well as animal care and monitoring during DSS experiment are described in Supplementary information. For animal experimentation, all procedures were performed according to protocols approved by the Veterinary Authorities of the Canton Vaud and according to the Swiss Law (License VD 3497, EPFL) and were in accordance with the ARRIVE guidelines and 3R principle (Reduction, Replacement, Refinement) for laboratory animals. DSS Induced colitis Eight-weeks Cmg2 WT or Cmg2 KO males were given 3% Dextran Sulfate Sodium (MP Biomedicals:160110) in the drinking water for 7 days, then switched to regular drinking water for 3 days and allowed to recover. Control Eight-weeks Cmg2 WT or Cmg2 KO males were given drinking water that did not contain DSS. Water consumption was similar in DSS-treated or control mice. During DSS treatment and recovery, mice were weighed, scored daily and euthanized if they developed severe disease based on the scoring criteria described in Supplementary information (weight loss, coat appearance, eyes/nose discharge, breathing, activity and posture). Mice were housed in individual cage for 30-60min daily in order to collect mice feces. Feces were either stored at -20° for further analyses or diluted at 100mg/ml in PBS 0,1% Tween-20 and used to evaluate the presence of occult blood using urine test strip (Multistix 8SG). Daily evaluation of Disease activity Index (DAI) (described in Supplementary information) was performed and based on stool consistency, presence of occult blood and body weight loss. On day 10, mice were euthanized with injection of pentobarbital. Colon was collected, measured and weighted. Tissues were divided in two, the first part being store at -80° for RNA and protein extraction and the second part fixed in 4% paraformaldehyde for histological studies. Histological studies Tissues collected after euthanasia were fixed in 4% paraformaldehyde overnight at 4°, embedded in paraffin and sectioned at 4µm thickness. Sections were deparaffinized with xylene and rehydrated with distilled water through a series of graded alcohol. Tissues were stained with hematoxylin & eosin (H&E), Sirius Red or Alcian blue, using standard protocols. Each colon was scored by a pathologist who assigned four scores based on severity and spread of inflammation, crypt damage and percent involvement. For immunohistochemistry, de-waxed samples were subjected to antigen retrieval by boiling in citrate buffer (10 mM, pH 6.0) for 20 min, except for Sca1/Ly6a immunostaining which was subjected to antigen retrieval by treating Proteinase K (20ug/ml) for 10min at room temperature. Non-specific antigenic sites were blocked with 1% bovine serum albumin (BSA) and samples were hybridized with primary antibody (Listed in the antibody section) in a humidity chamber at 4 °C overnight. After washing, samples were incubated with secondary antibodies (Listed in antibody section) for 1h at room temperature. After washing, tissues were counterstained with DAPI (1/5000 dilution) and mounted with Prolong Gold Antifade Mounting medium (Thermo Fisher, P36930). Antibodies Actin (Millipore: MAB1501: RRID: AB_2223041; mouse: 1:4000 dilution). Collagen-VI (Abcam: ab6588: RRID:AB_305585; rabbit: 1:1000 dilution) E-cadherin (Abcam: ab76055: RRID:AB_1310159; mouse: 1:500 dilution) Ki-67 (Abcam: ab16667: RRID:AB_302459; rabbit: 1:1000 dilution) S100A9 (neutrophil) (Novus Biological: NB110-89726: rabbit: 1:200 dilution) B-catenin (For IF: Sigma: C2206: RRID:AB_476831: Rabbit: 1/200 dilution) B-catenin (For WB: BD biosciences: 610154: RRID:AB_397555: Rabbit: 1/1000 dilution) Sca1/Ly6a (Abcam: ab51317: RRID_AB1640946: Rat: 1/200 dilution) Mouse-HRP (GE Healthcare: NA931V; RRID: AB_772210; mouse: 1: 3000 dilution). Rabbit-HRP (GE Healthcare: NA934V; RRID: AB_772206; rabbit: 1: 3000 dilution). Mouse-Alexa488 (ThermoFisher Scientific: A-11029; RRID: AB_2534088; 1:1000 dilution). Mouse-Alexa568 (ThermoFisher Scientific: A-11037; RRID: AB_2534013; 1:1000 dilution). Mouse-Alexa647 (ThermoFisher Scientific: A-31571; RRID: AB_162542; 1:1000 dilution). Rabbit-Alexa488 (ThermoFisher Scientific: A-21206; RRID: AB_2535792; 1:1000 dilution). Rabbit-Alexa568 (ThermoFisher Scientific: A-11042; RRID: AB_2534017; 1:1000 dilution). Rabbit-Alexa647 (ThermoFisher Scientific: A-31573; RRID: AB_253183; 1:800 dilution). Rat-Alexa568 (ThermoFisher Scientific: A-11077; RRID: AB_2534121; 1:1000 dilution). DAPI (ThermoFisher Scientific: D1306; RRID: AB_2629482; 1:5000 dilution). Hoechst (Sigma: 94403; 1:5000 dilution). RNAscope RNAscope Multiplex Fluorescent V2 assay (Bio-techne, Cat. No. 323110) was performed according to manufacturer’s protocol on 4 um paraffin sections with 15 minutes target retrieval at 95°C and Protease III 30 minutes at 40°C, hybridized with the probes Mm-Lgr5-C3 (Bio-techne, Cat. No. 312171-C3), Mm-Ppib-C1 (Bio-techne, Cat. No. 313911) as positive control and DapB-C1 (Bio-techne, Cat. No. 310043) as negative control at 40°C for 2 hours and revealed with TSA Opal570 (Akoya Biosciences, Cat. No. FP1488001KT). Tissues were counterstained with DAPI and mounted with Prolong Gold Antifade Mounting medium (Thermo Fisher, P36930). Image acquisition and analyze Brightfield and fluorescent images were acquired on an Olympus VS200 whole slide scanner using OlyVIA software and 20x air objective or 40x air objective. Detailed information about technical specifications in Supplementary information. For all analysis, annotations areas were selecting manually using DAPI channel exclusively (Supplementary Fig. 3a-b). During all analysis, mice genotype and channel of interest were blinded. Analysis and quantification of images was performed using the QuPath software 70 . Analysis workflows are available in Supplementary figure 3. Briefly, the percentage of Collagen VI area per tissue section was quantified using pixel classifier/thresholder for the Col6 channel (Supplementary Fig. 3c). The number of Lgr5 RNAscope spots per area was quantify using the RNAscope code detailed in Supplementary Fig. 3d). The percentage of positive cells positive to different marker (E-cadherin, Ki67 or S100A9), was quantified using the STARDIST Qupath extension for cell detection ( https://github.com/stardist/stardist ) and specific classifiers were created for each marker (Supplementary Fig. 3e). To determine Ly6a intensity, a coarse grain analysis of Ly6a immunostaining was performed (Supplementary Fig. 3f). Quantification of fecal and serum lipocalin-2 by ELISA Frozen fecal samples collected at day 0, 4, 7 and 9 during DSS induced colitis experiment, were reconstituted in PBS containing 0.1% Tween-20 (100mg/ml), vortexed at 4° for 20min and centrifuged 10min at 12,000rpm at 4°. Clear supernatants were collected and stored at -20° until analysis. Fecal lipocaline-2 was quantified using the Duoset murine Lcn-2 ELISA kit (R&D Systems) accordingly to manufacture instructions. qRT-PCR Mice tissues were disrupted using Lysing Matrix tube (MP Biomedicals) and homogenized in a tissue lyser (Qiagen) 2 x 2min, followed by RNA extraction using RNA easy mini extraction kit (Qiagen). RNA concentration was measured by spectrometry and 1mg of total RNA was used for reverse transcription. We then used a 1/10 dilution of the cDNA to perform quantitative real-time PCR using SYBR MasterMix (Life Technology) on a Quantstudio 6 Real-Time PCR System (Applied Biosystem). mRNA level in triplicate was normalized using Ribosomal protein S9 (RSP9) and Eukaryotic Translation Elongation Factor 1 Alpha 1 (EEF1A1) and Results were expressed as 2^(-DDCt)*100%. Primers (all 5’ to 3’) used are listed below: Mouse Col6a1 : F: TGCCCTGTGGATCTATTCTTCG; R: CTGTCTCTCAGGTTGTCAATG Mouse Axin2 : FOR: TGACTCTCCTTCCAGATCCCA; R: TGCCCACACTAGGCTGACA Mouse Lgr5 : F: AGGGTGGACTGCTCCGACCTG; R: AAGACGTAACTCCTCCAGGAAGCGG Mouse CyclinD1 : F: TCAAGTGTGACCCGGACTG; R: ACTCCAGAAGGGCTTCAATCT Mouse Ascl2 : F: TTTCCTGTGCCGCACCAGAACT; R: CAGCGACTCCAGACGAGGTGG Mouse Tnfα : F: TCCACTTGGTGGTTTGCTACG; R: ATGAGCACAGAAAGCATGATC Mouse Ifnγ : F: GCCACGGCACAGTCATTGA; R: TGCTGATGGCCTGATTGTCTT Mouse IL10 : F: CTTACTGACTGGCATGAGGATCA; R: GCAGCTCTAGGAGCATGTGG Mouse IL1β : F: CAACCAACAAGTGATATTCTCCATG; R: GATCCACACTCTCCAGCTGCA Mouse IL6 : F: CTGCAAGAGACTTCCATCCAG; R: AGTGGTATAGACAGGTCTGTTGG Mouse IL4 : F: GGTCTCAACCCCCAGCTAGT; R: GCCGATGATCTCTCTCAAGTGAT Mouse Tgfβ : F: CACCGGAGAGCCCTGGATA; R: TGTACAGCTGCCGCACACA Mouse Lipocalin- 2: F: AAGGCAGCTTTACGATGTACAGC R: CTTGCACATTGTAGCTGTGTACC Mouse Ly6a : F: CCTACCCTGATGGAGTCTGTGT; R: CACGTTGACCTTAGTACCCAGG Mouse Ctgf : F: CTGCGCTAAACAACTCAACGA; R: GCAGATCCCTTTCAGAGCGG Mouse Lrp6 : F: GGATGCCCTGCCCACTACTC; R: CAGAAGAGCGCCATCAACCGC Mouse β -catenin : F: CTGGCCGTATCCACCAGAGT; R: GAAGCGGCTTTCAGTCGAGC Mouse Wnt5a : F: TGTCTTCGCACCTTCTCCAATG; R: CTCCTTCGCCCAGGTTGTTATAG Mouse Wnt5b : F: TCCTGGTGGTCACTAGCTCTG; R: TGCTCCTGATACAACTGACACA Mouse Wnt2b : F: CGTTCGTCTATGCTATCTCGTCAG; R: ACACCGTAATGGATGTTGTCACTAC Mouse Rsp9 : F: GACCAGGAGCTAAAGTTGATTGGA; R: TCTTGGCCAGGGTAAACTTGA Mouse Cox6a1 : F: CTCTTCCACAACCCTCATGTGA; R: GAGGCCAGGTTCTCTTTACTCATC Mouse Eef1a1 : F: TCCACTTGGTCGCTTTGCT; R: CTTCTTGTCCACAGCTTTGATGA Western blot Mice tissues were lysed 30 min at 4°C on rotating wheel in IP buffer (0.5% NP40; 500mMtris-HCl, pH=7.4; 20mM EDTA; 2mM benzamidine; 10mM NaF and a cocktail of protease inhibitors). The suspended tissues were then put in a Lysing Matrix tube (MP Biomedicals) and homogenized in a tissue lyser (Qiagen) 2 x 2min at 20Hz. Homogenates were then pelleted at 5,000 r.p.m. for 3 min at 4 °C. Supernatants were subjected to preclearing with G sepharose beads and protein amount was quantified by BCA assay (Pierce). After protein concentration normalization, samples were boiled in Laemmli buffer for 5 min before analysis by SDS–PAGE using 4–20% Bis-Tris gradient gels under reducing condition and western blotting with rabbit anti-collagenVI antibody and mouse anti-Actin antibody. Quantification and statistical analysis Unless otherwise stated, each data point corresponds to a single measurement and each triangle correspond to the mean per mice. Statistical analysis was carried out using Prism software. Data representations and statistical details can be found in the description of the Figures. For ANOVA analysis, P values were obtained by post hoc tests to compare every mean and pair of means (Tukey’s & Sidak’s). Data and Code availability All details regarding codes used for immunofluorescence analysis are available in GitHub ( https://github.com/upvdg ) and will be deposited at Zenodo and publicly available as of the date of publication. AUTHOR CONTRIBUTIONS LB, AC, and BK, conducted the experiments, acquired and analyzed the data. OB and RG developed codes used for immunofluorescence analysis. LB and GG conceptualized the study and wrote the manuscript. AC and BK critically reviewed the manuscript. DECLARATION OF INTERESTS The authors declare no competing interests. DECLARATION OF GENERATIVE AI AND AI-ASSISTED TECHNOLOGIES IN THE WRITING PROCESS During the preparation of this work the author(s) used ChatGPT in order to improve the English of the text. After using this tool/service, the author(s) reviewed and edited the content as needed and take(s) full responsibility for the content of the publication. Download figure Open in new tab Figure S1: Cmg2 KO mice have normal guts under basal conditions (a) Body weight of Cmg2 WT and Cmg2 KO over a 30weeks period. Results are mean ± SEM. Each dot represents the mean of at least n=8 mice per genotype. ( b ) Colon tissues under basal conditions, from 8-weeks-old Cmg2 WT and Cmg2 KO mice were stained for Hematoxylin/Eosin, Sirius Red and Alcian Blue. Representative images of at least n=8 mice per genotype. Scale bar, 20µm. ( c ) Number of crypts per field, ( d ) crypt length were quantified and showed as superplot. Results are mean ± SEM. Each dot represents a single measurement and each triangle represent the mean per mouse. At least n=5 mice per genotype were quantified. P values obtained by unpaired two-tailed t test. ( e ) Colon lysates were analyzed by SDS–PAGE using 4–12% Bis-Tris gradient gels under reducing condition and western blotted against all the collagen VI. Migration of the molecular weight markers (in kDa) are indicated on the left. ( f ) CollagenVI/loading control ratio were quantified and normalized to the mean of Cmg2 WT . Results are mean ± SEM, and n=12 mice per genotype were quantified. P values obtained by unpaired two-tailed t test. ( g ) Colon tissues were immunostained with anti-collagenVI and DAPI. Representative image of n=6 mice per genotype. Scale bar, 20µm. (h) % of Collagen VI area per tissue section was quantified on n=6 mice per genotype. Results are mean ± SEM. Each dot represents a single measurement and each triangle represent the mean per mouse. P values obtained by unpaired two-tailed t test. q PCR analysis of colonic tissues for ( i ) Col6a1, and ( j ) ISC markers Lgr5, Ascl2, Axin2 and CyclinD1 genes were performed on n=8 mice per genotype. P values obtained by unpaired two-tailed t test in (i) and by two-way ANOVA Šídák’s multiple comparisons test in (j). ( k ) Colonic tissues were stained for RNAscope in situ hybridization against Lgr5 and (l) number of Lgr5 mRNA spots per µm 2 were quantified. ( m ) Colonic sections were stained anti-ki67, anti-E-cadherin and DAPI. ( n ) % of E-cadherin+ epithelial cells, and ( o) % of E-cadherin+/Ki67+ epithelial cells, were quantified on n=8 mice per genotype. P values obtained by unpaired two-tailed t test. ( p ) qPCR analysis of colonic tissues for inflammatory cytokines genes genes were performed on n=8 mice per genotype. P values obtained by two-way ANOVA Šídák’s multiple comparisons test. Download figure Open in new tab Figure S2: CMG2 loss does not enhance the severity of DSS-induced colitis. 8-week-old Cmg2 WT or Cmg2 KO males were given 3% Dextran-Sulfate-Sodium (DSS) in their drinking water for 7 days. On day7, mice were euthanatized and colon collected. ( a ) Colon tissues were stained for Hematoxylin/Eosin (left panel), stained with anti-ki67, anti-VE-cadherin and DAPI (middle panel) or stained for RNAscope in situ hybridization against Lgr5 (right panel). Representative images of at least n=4 mice per genotype. Scale bar,100µm for main image and 10um for magnification. (b) % of E-cadherin+ cells, (c) % of E-cadherin+/Ki67+ cells, and (d) number of Lgr5 mRNA spots per µm 2 , were quantified. Results are mean ± SEM. Each dot represents a single measurement and each triangle represent the mean per mouse. At least n=4 mice per genotype were quantified. P values obtained by two-way ANOVA Šídák’s multiple comparisons test. (e-i) Quantitative real-time PCR analysis of colonic tissues from Cmg2 WT and Cmg2 KO for (e) Lgr5, (f) Lipocalin-2 and (g-i) inflammatory cytokines genes. Results are mean ± SEM. Each symbol represents a single measurement. At least n=3 mice per genotype were quantified. P values obtained by two-way ANOVA Šídák’s multiple comparisons test. Download figure Open in new tab Figure S3: CMG2 does not affect Wnt ligand secretion or expression of LRP6 and B-catenin. (a-c) qPCR analysis of colonic tissues from Cmg2 WT and Cmg2 KO mice 3 days after DSS withdrawal (day10) for (a) LRP6, (b) β-catenin and (c) Wnt ligand, Results are mean ± SEM. Each symbol represents the mean per mouse. dotted line represents the mean of homeostatic Cmg2 WT mice. n=12 mice per genotype was quantified. P values obtained by two-tailed unpaired t test in (a-b) or by Two-way ANOVA Šídák’s multiple comparisons test in (c). (d) Colon lysates were western blotted against β-catenin. (e) β-catenin/loading control ratio were quantified and normalized to the mean of Cmg2 WT . Results are mean ± SEM, and n=12 mice per genotype were quantified. Each triangle represents the mean per mouse. P values obtained by unpaired two-tailed t test. Download figure Open in new tab Figure S4: Microscopy workflow: (a) Microscopy workflow follow three different steps including annotation, segmentation and analysis. (b) Annotation of region of interest is performed on blinded samples (blind genotype and mice id). During this step, channels of interest are turned off and annotations are drawn manually using the DAPI channels. 6 to 20 annotations per sample are drawn along the whole tissue section. (c) To quantify the percentage of Col6a1+ tissue area, annotations are drawn as described and Qupath pixel classifier is performed. Threshold is set by visual inspection and applied to all samples. (d) For RNAscope spot detection, annotations are drawn and script RNAscope_Count has been used to quantify the number of spots per annotation area. Prominence is set by visual inspection and apply to all samples. (e) To quantify the percentage of E-Cadherin+ and Ki67+ cells, annotations were drawn and cells detected using DAPI channel and Qupath STARDIST. Pixel classifiers were then used to classify cells accordingly to E-cadherin and Ki67 staining. (f) To analyze Ly6a in colon section, annotations were divided in multiple circular subregions of 20um diameter. The mean fluorescence intensity of Ly6a in each subregion was then quantify and shown using Qupath display. Supplementary information Animal’s characteristics Animals involve in DSS experiments: View this table: View inline View popup Download powerpoint Other mice used in this study: View this table: View inline View popup Download powerpoint Animal care and monitoring During DSS experiment, animals care and welfare was monitored accordingly to the following scoresheet validated by the approved by the Veterinary Authorities of the Canton Vaud and according to the Swiss Law (License VD 3497, EPFL). View this table: View inline View popup Download powerpoint Microscope technical specifications View this table: View inline View popup Download powerpoint ACKNOWLEDGEMENTS We would like to thank the EPFL Facilities (BioImaging & Optics Core Facility, Center of PhenoGenomics and Histology Core Facility) and all the members of the F.G.v.d.G. lab for discussions and suggestions. This work was supported by the Swiss National Science Foundation, by the Gelù Foundation and by the Foundation Les Mûrons. REFERENCES 1. ↵ Casas-Alba , D. , Martínez-Monseny , A. , Pino-Ramírez , R.M. , Alsina , L. , Castejón , E. , Navarro-Vilarrubí , S. , Pérez-Dueñas , B. , Serrano , M. , Palau , F. , and García-Alix , A . ( 2018 ). Hyaline fibromatosis syndrome: Clinical update and phenotype-genotype correlations . Hum. Mutat . 39 , 1752 – 1763 . doi: 10.1002/humu.23638 . OpenUrl CrossRef PubMed 2. ↵ Bürgi , J. , Kunz , B. , Abrami , L. , Deuquet , J. , Piersigilli , A. , Scholl-Bürgi , S. , Lausch , E. , Unger , S. , Superti-Furga , A. , Bonaldo , P. , et al. ( 2017 ). CMG2/ANTXR2 regulates extracellular collagen VI which accumulates in hyaline fibromatosis syndrome . Nature Communications 8 , 15861 . doi: 10.1038/ncomms15861 . OpenUrl CrossRef PubMed 3. ↵ Deuquet , J. , Lausch , E. , Guex , N. , Abrami , L. , Salvi , S. , Lakkaraju , A. , Ramirez , M.C.M. , Martignetti , J.A. , Rokicki , D. , Bonafe , L. , et al. ( 2011 ). Hyaline fibromatosis syndrome inducing mutations in the ectodomain of anthrax toxin receptor 2 can be rescued by proteasome inhibitors . EMBO Mol Med 3 , 208 – 221 . doi: 10.1002/emmm.201100124 . OpenUrl FREE Full Text 4. Denadai , R. , Raposo-Amaral , C.E. , Bertola , D. , Kim , C. , Alonso , N. , Hart , T. , Han , S. , Stelini , R.F. , Buzzo , C.L. , Raposo-Amaral , C.A. , et al. ( 2012 ). Identification of 2 Novel ANTXR2 Mutations in Patients With Hyaline Fibromatosis Syndrome and Proposal of a Modified Grading System . Am J Med Genet A 0 , 732 – 742 . doi: 10.1002/ajmg.a.35228 . OpenUrl CrossRef 5. Urbina , F. , Sazunic , I. , and Murray , G . ( 2004 ). Infantile systemic hyalinosis or juvenile hyaline fibromatosis? Pediatr Dermatol 21 , 154 – 159 . doi: 10.1111/j.0736-8046.2004.21214.x . OpenUrl CrossRef PubMed 6. Slimani , S. , Haddouche , A. , Haid , S. , and Ladjouze-Rezig , A . ( 2011 ). Juvenile hyaline fibromatosis: focus on radiographic features in adulthood . Rheumatol Int 31 , 273 – 276 . doi: 10.1007/s00296-010-1583-2 . OpenUrl CrossRef PubMed 7. Cozma , C. , Hovakimyan , M. , Iurașcu , M.-I. , Makhseed , N. , Selim , L.A. , Alhashem , A.M. , Ben-Omran , T. , Mahmoud , I.G. , Al Menabawy , N.M. , Al-Mureikhi , M. , et al. ( 2019 ). Genetic, clinical and biochemical characterization of a large cohort of patients with hyaline fibromatosis syndrome . Orphanet J Rare Dis 14 , 209 . doi: 10.1186/s13023-019-1183-5 . OpenUrl CrossRef PubMed 8. Hanks , S. , Adams , S. , Douglas , J. , Arbour , L. , Atherton , D.J. , Balci , S. , Bode , H. , Campbell , M.E. , Feingold , M. , Keser , G. , et al. ( 2003 ). Mutations in the Gene Encoding Capillary Morphogenesis Protein 2 Cause Juvenile Hyaline Fibromatosis and Infantile Systemic Hyalinosis . Am J Hum Genet 73 , 791 – 800 . OpenUrl CrossRef PubMed Web of Science 9. ↵ Dowling , O. , Difeo , A. , Ramirez , M.C. , Tukel , T. , Narla , G. , Bonafe , L. , Kayserili , H. , Yuksel-Apak , M. , Paller , A.S. , Norton , K. , et al. ( 2003 ). Mutations in Capillary Morphogenesis Gene-2 Result in the Allelic Disorders Juvenile Hyaline Fibromatosis and Infantile Systemic Hyalinosis . The American Journal of Human Genetics 73 , 957 – 966 . doi: 10.1086/378781 . OpenUrl CrossRef PubMed Web of Science 10. ↵ Bell , S.E. , Mavila , A. , Salazar , R. , Bayless , K.J. , Kanagala , S. , Maxwell , S.A. , and Davis , G.E . ( 2001 ). Differential gene expression during capillary morphogenesis in 3D collagen matrices: regulated expression of genes involved in basement membrane matrix assembly, cell cycle progression, cellular differentiation and G-protein signaling . J. Cell. Sci . 114 , 2755 – 2773 . OpenUrl Abstract / FREE Full Text 11. ↵ Bürgi , J. , Abrami , L. , Castanon , I. , Abriata , L.A. , Kunz , B. , Yan , S.E. , Lera , M. , Unger , S. , Superti-Furga , A. , Peraro , M.D. , et al. ( 2020 ). Ligand Binding to the Collagen VI Receptor Triggers a Talin-to-RhoA Switch that Regulates Receptor Endocytosis . Developmental Cell 53 , 418 – 430 .e4. doi: 10.1016/j.devcel.2020.04.015 . OpenUrl CrossRef PubMed 12. Reeves , C.V. , Wang , X. , Charles-Horvath , P.C. , Vink , J.Y. , Borisenko , V.Y. , Young , J.A.T. , and Kitajewski , J.K . ( 2012 ). Anthrax toxin receptor 2 functions in ECM homeostasis of the murine reproductive tract and promotes MMP activity . PLoS ONE 7 , e34862 . doi: 10.1371/journal.pone.0034862 . OpenUrl CrossRef PubMed 13. ↵ van Rijn , J.M. , Werner , L. , Aydemir , Y. , Spronck , J.M.A. , Pode-Shakked , B. , van Hoesel , M. , Shimshoni , E. , Polak-Charcon , S. , Talmi , L. , Eren , M. , et al. ( 2020 ). Enhanced Collagen Deposition in the Duodenum of Patients with Hyaline Fibromatosis Syndrome and Protein Losing Enteropathy . IJMS 21 , 8200 . doi: 10.3390/ijms21218200 . OpenUrl CrossRef PubMed 14. ↵ Meyer , A.R. , Brown , M.E. , McGrath , P.S. , and Dempsey , P.J . ( 2022 ). Injury-Induced Cellular Plasticity Drives Intestinal Regeneration . Cellular and Molecular Gastroenterology and Hepatology 13 , 843 – 856 . doi: 10.1016/j.jcmgh.2021.12.005 . OpenUrl CrossRef PubMed 15. ↵ Deng , F. , Peng , L. , Li , Z. , Tan , G. , Liang , E. , Chen , S. , Zhao , X. , and Zhi , F . ( 2018 ). YAP triggers the Wnt/β-catenin signalling pathway and promotes enterocyte self-renewal, regeneration and tumorigenesis after DSS-induced injury . Cell Death Dis 9 , 1 – 16 . doi: 10.1038/s41419-017-0244-8 . OpenUrl CrossRef 16. ↵ Guillermin , O. , Angelis , N. , Sidor , C.M. , Ridgway , R. , Baulies , A. , Kucharska , A. , Antas , P. , Rose , M.R. , Cordero , J. , Sansom , O. , et al. ( 2021 ). Wnt and Src signals converge on YAP-TEAD to drive intestinal regeneration . EMBO J 40 , e105770 . doi: 10.15252/embj.2020105770 . OpenUrl CrossRef PubMed 17. ↵ Castanon , I. , Hannich , J.T. , Abrami , L. , Huber , F. , Dubois , M. , Müller , M. , van der Goot , F.G. , and Gonzalez-Gaitan , M. ( 2020 ). Wnt-controlled sphingolipids modulate Anthrax Toxin Receptor palmitoylation to regulate oriented mitosis in zebrafish . Nat Commun 11 , 3317 . doi: 10.1038/s41467-020-17196-3 . OpenUrl CrossRef PubMed 18. ↵ Abrami , L. , Kunz , B. , Deuquet , J. , Bafico , A. , Davidson , G. , and van der Goot , F.G. ( 2008 ). Functional interactions between anthrax toxin receptors and the WNT signalling protein LRP6 . Cell. Microbiol . 10 , 2509 – 2519 . doi: 10.1111/j.1462-5822.2008.01226.x . OpenUrl CrossRef PubMed Web of Science 19. Liu , Y. , Xie , C. , Li , T. , Lu , C. , Fan , L. , Zhang , Z. , Peng , S. , Lv , N. , and Lu , D . ( 2023 ). PCGEM1 promotes cell proliferation and migration in endometriosis by targeting miR-124-3p-mediated ANTXR2 expression . BMC Women’s Health 23 . doi: 10.1186/s12905-023-02250-1 . OpenUrl CrossRef 20. ↵ Ji , C. , Yang , L. , Yi , W. , Xiang , D. , Wang , Y. , Zhou , Z. , Qian , F. , Ren , Y. , Cui , W. , Zhang , X. , et al. ( 2018 ). Capillary morphogenesis gene 2 maintains gastric cancer stem-like cell phenotype by activating a Wnt/β-catenin pathway . Oncogene 37 , 3953 – 3966 . doi: 10.1038/s41388-018-0226-z . OpenUrl CrossRef PubMed 21. ↵ Castanon , I. , Abrami , L. , Holtzer , L. , Heisenberg , C.P. , van der Goot , F.G. , and González-Gaitán , M. ( 2013 ). Anthrax toxin receptor 2a controls mitotic spindle positioning . Nat Cell Biol 15 , 28 – 39 . doi: 10.1038/ncb2632 . OpenUrl CrossRef PubMed Web of Science 22. ↵ Hageman , J.H. , Heinz , M.C. , Kretzschmar , K. , van der Vaart , J. , Clevers , H. , and Snippert , H.J.G. ( 2020 ). Intestinal Regeneration: Regulation by the Microenvironment . Dev Cell 54 , 435 – 446 . doi: 10.1016/j.devcel.2020.07.009 . OpenUrl CrossRef PubMed 23. ↵ Tetteh , P.W . ( 2016 ). Replacement of lost Lgr5-positive stem cells through plasticity of their enterocyte-lineage daughters . Cell Stem Cell 18 . doi: 10.1016/j.stem.2016.01.001 . OpenUrl CrossRef PubMed 24. ↵ Tian , H . ( 2011 ). A reserve stem cell population in small intestine renders Lgr5-positive cells dispensable . Nature 478 . doi: 10.1038/nature10408 . OpenUrl CrossRef PubMed Web of Science 25. ↵ Yui , S . ( 2018 ). YAP/TAZ-dependent reprogramming of colonic epithelium links ECM remodeling to tissue regeneration . Cell Stem Cell 22 . doi: 10.1016/j.stem.2017.11.001 . OpenUrl CrossRef PubMed 26. ↵ Murata , K. , Jadhav , U. , Madha , S. , van Es , J. , Dean , J. , Cavazza , A. , Wucherpfennig , K. , Michor , F. , Clevers , H. , and Shivdasani , R.A. ( 2020 ). Ascl2-Dependent Cell Dedifferentiation Drives Regeneration of Ablated Intestinal Stem Cells . Cell Stem Cell 26 , 377 – 390 .e6. doi: 10.1016/j.stem.2019.12.011 . OpenUrl CrossRef PubMed 27. Ayyaz , A. , Kumar , S. , Sangiorgi , B. , Ghoshal , B. , Gosio , J. , Ouladan , S. , Fink , M. , Barutcu , S. , Trcka , D. , Shen , J. , et al. ( 2019 ). Single-cell transcriptomes of the regenerating intestine reveal a revival stem cell . Nature 569 , 121 – 125 . doi: 10.1038/s41586-019-1154-y . OpenUrl CrossRef PubMed 28. Harnack , C. , Berger , H. , Antanaviciute , A. , Vidal , R. , Sauer , S. , Simmons , A. , Meyer , T.F. , and Sigal , M . ( 2019 ). R-spondin 3 promotes stem cell recovery and epithelial regeneration in the colon . Nat Commun 10 , 4368 . doi: 10.1038/s41467-019-12349-5 . OpenUrl CrossRef PubMed 29. ↵ Metcalfe , C. , Kljavin , N.M. , Ybarra , R. , and de Sauvage , F.J. ( 2014 ). Lgr5+ stem cells are indispensable for radiation-induced intestinal regeneration . Cell Stem Cell 14 , 149 – 159 . doi: 10.1016/j.stem.2013.11.008 . OpenUrl CrossRef PubMed Web of Science 30. ↵ Barker , N . ( 2014 ). Adult intestinal stem cells: critical drivers of epithelial homeostasis and regeneration . Nat Rev Mol Cell Biol 15 , 19 – 33 . doi: 10.1038/nrm3721 . OpenUrl CrossRef PubMed 31. ↵ Rees , W.D. , Tandun , R. , Yau , E. , Zachos , N.C. , and Steiner , T.S . ( 2020 ). Regenerative Intestinal Stem Cells Induced by Acute and Chronic Injury: The Saving Grace of the Epithelium? Front Cell Dev Biol 8 , 583919 . doi: 10.3389/fcell.2020.583919 . OpenUrl CrossRef 32. ↵ de Sousa E Melo , F. , and de Sauvage , F.J. ( 2019 ). Cellular Plasticity in Intestinal Homeostasis and Disease . Cell Stem Cell 24 , 54 – 64 . doi: 10.1016/j.stem.2018.11.019 . OpenUrl CrossRef PubMed 33. ↵ Nusse , Y.M. , Savage , A.K. , Marangoni , P. , Rosendahl-Huber , A.K.M. , Landman , T.A. , De Sauvage , F.J. , Locksley , R.M. , and Klein , O.D. ( 2018 ). Parasitic helminths induce fetal-like reversion in the intestinal stem cell niche . Nature 559 , 109 – 113 . doi: 10.1038/s41586-018-0257-1 . OpenUrl CrossRef PubMed 34. Higa , T. , Okita , Y. , Matsumoto , A. , Nakayama , S. , Oka , T. , Sugahara , O. , Koga , D. , Takeishi , S. , Nakatsumi , H. , Hosen , N. , et al. ( 2022 ). Spatiotemporal reprogramming of differentiated cells underlies regeneration and neoplasia in the intestinal epithelium . Nat Commun 13 , 1500 . doi: 10.1038/s41467-022-29165-z . OpenUrl CrossRef PubMed 35. van Es , J.H. , Sato , T. , van de Wetering , M. , Lyubimova , A. , Yee Nee , A.N. , Gregorieff , A. , Sasaki , N. , Zeinstra , L. , van den Born , M ., Korving , J ., et al. ( 2012 ). Dll1+ secretory progenitor cells revert to stem cells upon crypt damage . Nat Cell Biol 14 , 1099 – 1104 . doi: 10.1038/ncb2581 . OpenUrl CrossRef PubMed Web of Science 36. Jadhav , U. , Saxena , M. , O’Neill , N.K. , Saadatpour , A. , Yuan , G.-C. , Herbert , Z. , Murata , K. , and Shivdasani , R.A . ( 2017 ). Dynamic Reorganization of Chromatin Accessibility Signatures during Dedifferentiation of Secretory Precursors into Lgr5+ Intestinal Stem Cells . Cell Stem Cell 21 , 65 – 77 .e5. doi: 10.1016/j.stem.2017.05.001 . OpenUrl CrossRef PubMed 37. Castillo-Azofeifa , D. , Fazio , E.N. , Nattiv , R. , Good , H.J. , Wald , T. , Pest , M.A. , de Sauvage , F.J. , Klein , O.D. , and Asfaha , S. ( 2019 ). Atoh1+ secretory progenitors possess renewal capacity independent of Lgr5+ cells during colonic regeneration . The EMBO Journal 38 , e99984 . doi: 10.15252/embj.201899984 . OpenUrl Abstract / FREE Full Text 38. Ishibashi , F. , Shimizu , H. , Nakata , T. , Fujii , S. , Suzuki , K. , Kawamoto , A. , Anzai , S. , Kuno , R. , Nagata , S. , Ito , G. , et al. ( 2018 ). Contribution of ATOH1+ Cells to the Homeostasis, Repair, and Tumorigenesis of the Colonic Epithelium . Stem Cell Reports 10 , 27 – 42 . doi: 10.1016/j.stemcr.2017.11.006 . OpenUrl CrossRef PubMed 39. Yan , K.S . ( 2017 ). intestinal enteroendocrine lineage cells possess homeostatic and injury-inducible stem cell activity . Cell Stem Cell 21 . doi: 10.1016/j.stem.2017.06.014 . OpenUrl CrossRef PubMed 40. Buczacki , S.J.A. , Zecchini , H.I. , Nicholson , A.M. , Russell , R. , Vermeulen , L. , Kemp , R. , and Winton , D.J . ( 2013 ). Intestinal label-retaining cells are secretory precursors expressing Lgr5 . Nature 495 , 65 – 69 . doi: 10.1038/nature11965 . OpenUrl CrossRef PubMed Web of Science 41. Yu , S. , Tong , K. , Zhao , Y. , Balasubramanian , I. , Yap , G.S. , Ferraris , R.P. , Bonder , E.M. , Verzi , M.P. , and Gao , N . ( 2018 ). Paneth Cell Multipotency Induced by Notch Activation following Injury . Cell Stem Cell 23 , 46 – 59 .e5. doi: 10.1016/j.stem.2018.05.002 . OpenUrl CrossRef PubMed 42. ↵ Jones , J.C. , Brindley , C.D. , Elder , N.H. , Myers , M.G. , Rajala , M.W. , Dekaney , C.M. , McNamee , E.N. , Frey , M.R. , Shroyer , N.F. , and Dempsey , P.J . ( 2019 ). Cellular Plasticity of Defa4Cre-Expressing Paneth Cells in Response to Notch Activation and Intestinal Injury . Cell Mol Gastroenterol Hepatol 7 , 533 – 554 . doi: 10.1016/j.jcmgh.2018.11.004 . OpenUrl CrossRef PubMed 43. ↵ Sprangers , J. , Zaalberg , I.C. , and Maurice , M.M . ( 2021 ). Organoid-based modeling of intestinal development, regeneration, and repair . Cell Death Differ 28 , 95 – 107 . doi: 10.1038/s41418-020-00665-z . OpenUrl CrossRef PubMed 44. ↵ Gregorieff , A. , Liu , Y. , Inanlou , M.R. , Khomchuk , Y. , and Wrana , J.L . ( 2015 ). Yap-dependent reprogramming of Lgr5+ stem cells drives intestinal regeneration and cancer . Nature 526 . doi: 10.1038/nature15382 . OpenUrl CrossRef PubMed 45. ↵ Yang , C. , and Merlin , D . ( 2024 ). Unveiling Colitis: A Journey through the Dextran Sodium Sulfate-induced Model . Inflammatory Bowel Diseases 30 , 844 – 853 . doi: 10.1093/ibd/izad312 . OpenUrl CrossRef PubMed 46. ↵ Chassaing , B. , Aitken , J.D. , Malleshappa , M. , and Vijay-Kumar , M . ( 2014 ). Dextran sulfate sodium (DSS)-induced colitis in mice . Curr Protoc Immunol 104 , 15.25.1 – 15.25.14 . doi: 10.1002/0471142735.im1525s104 . OpenUrl CrossRef PubMed 47. ↵ Sato , T . ( 2009 ). Single Lgr5 stem cells build crypt-villus structures in vitro without a mesenchymal niche . Nature 459 . doi: 10.1038/nature07935 . OpenUrl CrossRef PubMed Web of Science 48. Barker , N. , and Clevers , H . ( 2010 ). Leucine-rich repeat-containing G-protein-coupled receptors as markers of adult stem cells . Gastroenterology 138 , 1681 – 1696 . doi: 10.1053/j.gastro.2010.03.002 . OpenUrl CrossRef PubMed Web of Science 49. ↵ Barker , N. , van Es , J.H. , Kuipers , J. , Kujala , P. , van den Born , M ., Cozijnsen , M. , Haegebarth , A. , Korving , J. , Begthel , H. , Peters , P.J. , et al. ( 2007 ). Identification of stem cells in small intestine and colon by marker gene Lgr5 . Nature 449 , 1003 – 1007 . doi: 10.1038/nature06196 . OpenUrl CrossRef PubMed Web of Science 50. ↵ Eichele , D.D. , and Kharbanda , K.K . ( 2017 ). Dextran sodium sulfate colitis murine model: An indispensable tool for advancing our understanding of inflammatory bowel diseases pathogenesis . World J Gastroenterol 23 , 6016 – 6029 . doi: 10.3748/wjg.v23.i33.6016 . OpenUrl CrossRef PubMed 51. ↵ Kiesler , P. , Fuss , I.J. , and Strober , W . ( 2015 ). Experimental Models of Inflammatory Bowel Diseases . Cellular and Molecular Gastroenterology and Hepatology 1 , 154 – 170 . doi: 10.1016/j.jcmgh.2015.01.006 . OpenUrl CrossRef PubMed 52. ↵ Wang , Y. , Chiang , I.-L. , Ohara , T.E. , Fujii , S. , Cheng , J. , Muegge , B.D. , Ver Heul , A. , Han , N.D. , Lu , Q. , Xiong , S. , et al. ( 2019 ). Long-Term Culture Captures Injury-Repair Cycles of Colonic Stem Cells . Cell 179 , 1144 – 1159 .e15. doi: 10.1016/j.cell.2019.10.015 . OpenUrl CrossRef PubMed 53. ↵ Erben , U. , Loddenkemper , C. , Doerfel , K. , Spieckermann , S. , Haller , D. , Heimesaat , M.M. , Zeitz , M. , Siegmund , B. , and Kühl , A.A . ( 2014 ). A guide to histomorphological evaluation of intestinal inflammation in mouse models . Int J Clin Exp Pathol 7 , 4557 – 4576 . OpenUrl PubMed 54. ↵ Gehart , H. , and Clevers , H . ( 2019 ). Tales from the crypt: new insights into intestinal stem cells . Nat Rev Gastroenterol Hepatol 16 , 19 – 34 . doi: 10.1038/s41575-018-0081-y . OpenUrl CrossRef PubMed 55. ↵ Barry , E.R . ( 2013 ). Restriction of intestinal stem cell expansion and the regenerative response by YAP . Nature 493 . doi: 10.1038/nature11693 . OpenUrl CrossRef PubMed Web of Science 56. ↵ Cai , J. , Zhang , N. , Zheng , Y. , Wilde , R.F. de , Maitra , A ., and Pan , D . ( 2010 ). The Hippo signaling pathway restricts the oncogenic potential of an intestinal regeneration program . Genes Dev . 24 , 2383 – 2388 . doi: 10.1101/gad.1978810 . OpenUrl Abstract / FREE Full Text 57. ↵ Walter , R.J. , Sonnentag , S.J. , Munoz-Sagredo , L. , Merkel , M. , Richert , L. , Bunert , F. , Heneka , Y.M. , Loustau , T. , Hodder , M. , Ridgway , R.A. , et al. ( 2022 ). Wnt signaling is boosted during intestinal regeneration by a CD44-positive feedback loop . Cell Death Dis 13 , 1 – 16 . doi: 10.1038/s41419-022-04607-0 . OpenUrl CrossRef 58. ↵ Goretsky , T. , Bradford , E.M. , Ye , Q. , Lamping , O.F. , Vanagunas , T. , Moyer , M.P. , Keller , P.C. , Sinh , P. , Llovet , J.M. , Gao , T. , et al. ( 2018 ). Beta-catenin cleavage enhances transcriptional activation . Sci Rep 8 , 671 . doi: 10.1038/s41598-017-18421-8 . OpenUrl CrossRef 59. ↵ Ouladan , S. , and Gregorieff , A . ( 2021 ). Taking a Step Back: Insights into the Mechanisms Regulating Gut Epithelial Dedifferentiation . Int J Mol Sci 22 , 7043 . doi: 10.3390/ijms22137043 . OpenUrl CrossRef PubMed 60. ↵ Asfaha , S. , Hayakawa , Y. , Muley , A. , Stokes , S. , Graham , T.A. , Ericksen , R.E. , Westphalen , C.B. , von Burstin , J. , Mastracci , T.L. , Worthley , D.L. , et al. ( 2015 ). Krt19(+)/Lgr5(-) Cells Are Radioresistant Cancer-Initiating Stem Cells in the Colon and Intestine . Cell Stem Cell 16 , 627 – 638 . doi: 10.1016/j.stem.2015.04.013 . OpenUrl CrossRef PubMed 61. ↵ Schuijers , J. , Junker , J.P. , Mokry , M. , Hatzis , P. , Koo , B.-K. , Sasselli , V. , van der Flier , L.G. , Cuppen , E. , van Oudenaarden , A. , and Clevers , H. ( 2015 ). Ascl2 acts as an R-spondin/Wnt-responsive switch to control stemness in intestinal crypts . Cell Stem Cell 16 , 158 – 170 . doi: 10.1016/j.stem.2014.12.006 . OpenUrl CrossRef PubMed 62. ↵ Lustig , B. , Jerchow , B. , Sachs , M. , Weiler , S. , Pietsch , T. , Karsten , U. , Van De Wetering , M. , Clevers , H. , Schlag , P.M. , Birchmeier , W. , et al. ( 2002 ). Negative feedback loop of Wnt signaling through upregulation of conductin/axin2 in colorectal and liver tumors . Molecular and Cellular Biology 22 , 1184 – 1193 . doi: 10.1128/MCB.22.4.1184-1193.2002 . OpenUrl Abstract / FREE Full Text 63. Carmon , K.S. , Gong , X. , Lin , Q. , Thomas , A. , and Liu , Q . ( 2011 ). R-spondins function as ligands of the orphan receptors LGR4 and LGR5 to regulate Wnt/β-catenin signaling . Proceedings of the National Academy of Sciences 108 , 11452 – 11457 . doi: 10.1073/pnas.1106083108 . OpenUrl Abstract / FREE Full Text 64. de Lau , W. , Barker , N. , Low , T.Y. , Koo , B.-K. , Li , V.S.W. , Teunissen , H. , Kujala , P. , Haegebarth , A. , Peters , P.J. , van de Wetering , M. , et al. ( 2011 ). Lgr5 homologues associate with Wnt receptors and mediate R-spondin signalling . Nature 476 , 293 – 297 . doi: 10.1038/nature10337 . OpenUrl CrossRef PubMed Web of Science 65. Oost , K.C. , Kahnwald , M. , Barbiero , S. , Medeiros , G. de , Suppinger , S ., Kalck , V ., Meylan , L.C. , Smallwood , S.A. , Stadler , M.B. , and Liberali , P. ( 2023 ). Dynamics and plasticity of stem cells in the regenerating human colonic epithelium . Preprint at bioRxiv , doi: 10.1101/2023.12.18.572103 https://doi.org/10.1101/2023.12.18.572103. OpenUrl Abstract / FREE Full Text 66. ↵ Viragova , S. , Li , D. , and Klein , O.D . ( 2024 ). Activation of fetal-like molecular programs during regeneration in the intestine and beyond . Cell Stem Cell 31 , 949 – 960 . doi: 10.1016/j.stem.2024.05.009 . OpenUrl CrossRef PubMed 67. ↵ Vanamerongen , R. , and Berns , A . ( 2006 ). Knockout mouse models to study Wnt signal transduction . Trends in Genetics 22 , 678 – 689 . doi: 10.1016/j.tig.2006.10.001 . OpenUrl CrossRef PubMed Web of Science 68. ↵ Willet , S.G. , Lewis , M.A. , Miao , Z.-F. , Liu , D. , Radyk , M.D. , Cunningham , R.L. , Burclaff , J. , Sibbel , G. , Lo , H.-Y.G. , Blanc , V. , et al. ( 2018 ). Regenerative proliferation of differentiated cells by mTORC1-dependent paligenosis . EMBO J 37 , e98311 . doi: 10.15252/embj.201798311 . OpenUrl CrossRef PubMed 69. ↵ Brown , J.W. , Cho , C.J. , and Mills , J.C . ( 2022 ). Paligenosis: Cellular Remodeling During Tissue Repair . Annu Rev Physiol 84 , 461 – 483 . doi: 10.1146/annurev-physiol-061121-035954 . OpenUrl CrossRef PubMed 70. ↵ Bankhead , P. , Loughrey , M.B. , Fernández , J.A. , Dombrowski , Y. , McArt , D.G. , Dunne , P.D. , McQuaid , S. , Gray , R.T. , Murray , L.J. , Coleman , H.G. , et al. ( 2017 ). QuPath: Open source software for digital pathology image analysis . Sci Rep 7 , 16878 . doi: 10.1038/s41598-017-17204-5 . OpenUrl CrossRef PubMed View the discussion thread. Back to top Previous Next Posted January 08, 2025. Download PDF Email Thank you for your interest in spreading the word about bioRxiv. NOTE: Your email address is requested solely to identify you as the sender of this article. Your Email * Your Name * Send To * Enter multiple addresses on separate lines or separate them with commas. You are going to email the following Intestinal stem cell renewal controlled by capillary morphogenesis gene 2 following injury Message Subject (Your Name) has forwarded a page to you from bioRxiv Message Body (Your Name) thought you would like to see this page from the bioRxiv website. Your Personal Message CAPTCHA This question is for testing whether or not you are a human visitor and to prevent automated spam submissions. Share Intestinal stem cell renewal controlled by capillary morphogenesis gene 2 following injury Lucie Bracq , Audrey Chuat , Béatrice Kunz , Olivier Burri , Romain Guiet , F. Gisou van der Goot bioRxiv 2025.01.07.631493; doi: https://doi.org/10.1101/2025.01.07.631493 Share This Article: Copy Citation Tools Intestinal stem cell renewal controlled by capillary morphogenesis gene 2 following injury Lucie Bracq , Audrey Chuat , Béatrice Kunz , Olivier Burri , Romain Guiet , F. Gisou van der Goot bioRxiv 2025.01.07.631493; doi: https://doi.org/10.1101/2025.01.07.631493 Citation Manager Formats BibTeX Bookends EasyBib EndNote (tagged) EndNote 8 (xml) Medlars Mendeley Papers RefWorks Tagged Ref Manager RIS Zotero Tweet Widget Facebook Like Google Plus One Subject Area Cell Biology Subject Areas All Articles Animal Behavior and Cognition (7625) Biochemistry (17652) Bioengineering (13874) Bioinformatics (41890) Biophysics (21429) Cancer Biology (18567) Cell Biology (25467) Clinical Trials (138) Developmental Biology (13365) Ecology (19874) Epidemiology (2067) Evolutionary Biology (24294) Genetics (15591) Genomics (22478) Immunology (17717) Microbiology (40331) Molecular Biology (17153) Neuroscience (88496) Paleontology (666) Pathology (2828) Pharmacology and Toxicology (4817) Physiology (7635) Plant Biology (15114) Scientific Communication and Education (2044) Synthetic Biology (4286) Systems Biology (9817) Zoology (2268)