Characterization of the metabolic pathways and hepatic macrophage subsets in mouse models of MASH

preprint OA: closed CC-BY-4.0
📄 Open PDF Full text JSON View at publisher

Abstract

Abstract Background Metabolic dysfunction-associated steatohepatitis (MASH), a more severe subtype of Metabolic dysfunction-associated steatotic liver disease (MASLD), can lead to cirrhosis and hepatocellular carcinoma. Monocyte-derived macrophages (MDMs) play a central role in NASH. Single-cell and spatial transcriptomic technologies have revealed that MDMs react to niche-specific and inflammatory signals to differentiate into Monocyte-derived Kupffer cells (MoKCs) or hepatic lipid-associated macrophages (LAMs)/CCR2+ lipid-associated macrophages (C-LAMs). However, we still lack further descriptions of specific subsets of hepatic macrophages in different MASH models. Methods Two MASH models were established by either giving a methionine-choline-deficient (MCD) diet for 4 weeks or a high-fat‒fructose‒cholesterol (HFFC) diet for 16 weeks. Liver tissues were collected for pathological analyses with hematoxylin and eosin, Oil Red O and F4/80 staining. The expression of lipid metabolism enzymes and inflammatory cytokines were detected using quantitative reverse transcription-polymerase chain reaction (RT‒qPCR). Flow cytometry was utilized to analyze the composition of isolated hepatic macrophages. Results Our study revealed that after a HFFC diet or MCD diet feeding, two MASH models presented opposite changes in the FFA synthesis pathway. The MCD and HFFC diets induce the same alternation in the composition of hepatic macrophages characterized by a decrease in Embryo-derived Kupffer cells (EmKCs) and a concomitant increase in MDMs. However, the composition of the KC pool differed between MCD- and HFFC-fed mice. The MCD diet induced a greater loss of EmKCs, accompanied by more recruited monocytes. HFFC-fed mice contain more MoKCs than MCD-fed mice, whereas MCD-fed mice have more C-LAMs and LAMs than HFFC-fed mice. Conclusions MCD- and HFFC-fed mice have a different composition of KC pool
Full text 107,273 characters · extracted from preprint-html · click to expand
Characterization of the metabolic pathways and hepatic macrophage subsets in mouse models of MASH | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Characterization of the metabolic pathways and hepatic macrophage subsets in mouse models of MASH Erzhuo Xia, Miao Zhang, Chongxiao Li, Bo Li, Shuoyi Ma, Qingling Fan, and 8 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-5395060/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background Metabolic dysfunction-associated steatohepatitis (MASH), a more severe subtype of Metabolic dysfunction-associated steatotic liver disease (MASLD), can lead to cirrhosis and hepatocellular carcinoma. Monocyte-derived macrophages (MDMs) play a central role in NASH. Single-cell and spatial transcriptomic technologies have revealed that MDMs react to niche-specific and inflammatory signals to differentiate into Monocyte-derived Kupffer cells (MoKCs) or hepatic lipid-associated macrophages (LAMs)/CCR2 + lipid-associated macrophages (C-LAMs). However, we still lack further descriptions of specific subsets of hepatic macrophages in different MASH models. Methods Two MASH models were established by either giving a methionine-choline-deficient (MCD) diet for 4 weeks or a high-fat‒fructose‒cholesterol (HFFC) diet for 16 weeks. Liver tissues were collected for pathological analyses with hematoxylin and eosin, Oil Red O and F4/80 staining. The expression of lipid metabolism enzymes and inflammatory cytokines were detected using quantitative reverse transcription-polymerase chain reaction (RT‒qPCR). Flow cytometry was utilized to analyze the composition of isolated hepatic macrophages. Results Our study revealed that after a HFFC diet or MCD diet feeding, two MASH models presented opposite changes in the FFA synthesis pathway. The MCD and HFFC diets induce the same alternation in the composition of hepatic macrophages characterized by a decrease in Embryo-derived Kupffer cells (EmKCs) and a concomitant increase in MDMs. However, the composition of the KC pool differed between MCD- and HFFC-fed mice. The MCD diet induced a greater loss of EmKCs, accompanied by more recruited monocytes. HFFC-fed mice contain more MoKCs than MCD-fed mice, whereas MCD-fed mice have more C-LAMs and LAMs than HFFC-fed mice. Conclusions MCD- and HFFC-fed mice have a different composition of KC pool macrophage MASH models metabolic pathway C-LAMs MoKCs LAMs Figures Figure 1 Figure 2 Figure 3 Figure 4 Introduction Metabolic dysfunction-associated steatotic liver disease (MASLD), is rapidly becoming the most common chronic liver disease globally, affecting 38% of the world population [ 1 ] . Metabolic dysfunction-associated steatohepatitis (MASH), a severe subtype of MAFLD, is represented by the manifestation of steatosis, lobular inflammation and hepatocyte ballooning and fibrosis [ 2 ] . Importantly, up to 12% of the MAFLD population develop into MASH and advanced fibrosis which can lead to progression to end-stage liver disease including cirrhosis and hepatocellular carcinoma [ 3 ] . The progression of MASH thus regards as a vital transitional step in the clinical progression of MAFLD. Therefore, investigating the mechanisms promoting its development will be crucial in formulating new therapeutic strategies in the future. Recent reports have indicated that macrophages, especially recruited monocytes, play important roles in the pathogenesis of MASH [ 4 ] . Importantly, single-cell and spatial transcriptomic technologies have revealed a distinct heterogeneity of hepatic macrophages in MASH [ 5 – 7 ] . Embryo-derived Kupffer cells (EmKCs) are impaired during MASH progression, and monocyte-derived macrophages (MDMs) enter the liver, where they react to niche-specific and inflammatory signals to differentiate into Monocyte-derived Kupffer cells (MoKCs) or hepatic lipid-associated macrophages(LAMs)/CCR2 + lipid-associated macrophages (C-LAMs) [ 5 , 7 – 9 ] . C-LAMs, also known as pre-MoKCs in other studies [ 5 ] , represent a transitional state of MDMs and are precursors for LAMs or MoKCs. LAM is considered to participate in early pro-inflammatory injury and late anti-inflammatory repair during the development of MASH . [ 10 ] . MoKCs display a similar pattern of gene expression like EmKCs and can ultimately fully adopt the identity and capabilities of EmKCs [ 4 ] . These subsets collaborate to enable liver functions [ 11 ] . However, we still lack further descriptions of specific subsets of hepatic macrophages in different MASH models. This study aimed to assess the differences in lipid metabolic pathways and elaborate specific subtypes of hepatic macrophages in the most common dietary animal models of MASH, HFFC- and MCD diet-fed animals. Because after feeding HFFC diet, mice would develop steatosis (4–8 weeks), steatohepatitis (16–24 weeks), and progressive fibrosis (after 16 weeks) in sequence [ 12 ] .The HFFC model can further recapitulates the features of human MASH than other dietary models, which demonstrates good clinical translatability compared with other dietary models [ 13 , 14 ] . Although the use of the MCD model is limited due to its inconsistencies with the metabolic characteristics of human MASH, MCD diet is still one of the very commonly used diets because it produces the most severe phenotype of MASH in the shortest time. [ 15 ] .Both the MCD and HFFC diets induce lipid accumulation in the liver, but the metabolic pathway of FFA synthesis is the opposite. Although the use of the MCD model is limited by its disparity with the metabolic parameters of human MASH [ 15 ] , our findings demonstrate that the dynamic shifts in the composition of resident and recruited macrophages in the MCD model are consistent with those in the HFFC model. With HFFC/MCD diet feeding, EmKCs decrease in number, and Ly6C hi and CCR2 + monocytes enter the liver to compensate for the loss of EmKCs. Furthermore, MDMs accumulate in the KC niche and consist of LAMs, C-LAMs and MoKCs. Our study revealed that the two MASH models had different compositions of the KC pool, highlighting the need to choose different MASH models when investigating different subsets of hepatic macrophages. Results Different NASH models induce contrary changes in the FFA synthesis pathway. To investigate the effects of different metabolic environments on hepatic macrophage subsets and to further characterize the composition of hepatic macrophages in different MASH models, we chose the MCD diet and HFFC diet to induce MASH in C57BL/6 mice. Although the use of the MCD model is limited due to its inconsistencies with the metabolic characteristics of human MASH, MCD diet is still one of the very commonly used diets because it produces the most severe manifestation of MASH in the shortest time [ 15 ] . The HFFC model better imitates human MASH that recapitulated the features of insulin resistance, steatosis, inflammation with hepatocellular ballooning and progressive fibrosis [ 14 ] . We first evaluated the progression of obesity, inflammation and liver steatosis in MCD and HFFC-fed mice. Liver weight was increased in HFFC-fed mice but significantly reduced in MCD-fed mice (Fig. 1 A). However, no difference was observed relative to body weight (Fig. 1 B). Hematoxylin and eosin (H&E) and oil red O staining of the liver demonstrated that both diets induced the MASH manifestations including hepatocyte ballooning, lobular inflammation and lipid droplets (Fig. 1 C). The differences in glucose metabolism between MCD-and HFFC-fed mice have been reported [ 14 ] Here, we focused on genes involved in inflammation and lipid homeostasis through quantitative PCR. Compared to ND-fed mice, we found that both MCD- and HFFC-fed mice presented an upregulation of Tnf, IL-6, and Cxcl5 mRNA levels and increased expression of the macrophage marker Adgre1 and the neutrophil marker Ly6G (Fig. 1 D), confirming the lobular inflammation that was histologically observed. The transcriptional analyses of lipid metabolism revealed that the severe hepatic lipid accumulation in MCD- and HFFC-fed mice were related to the increase of import of lipids (Cd36) and FFA elongation (Elovl7) (Fig. 1 E, F). Moreover, the upregulation of Lpl indicated the enhancement of triglyceride (TG) hydrolysis in the MCD- and HFFC-fed mice (Fig. 1 G). Notably, the MCD and HFFC diets induced opposite changes in the FFA synthesis pathway. The HFFC diet resulted in increased expression of the FFA synthesis genes Acly, Acaca, Fasn, and Srebf1. In contrast, the mRNA levels of Acaca, Fasn, and Srebf1 were decreased in the MCD-fed mice (Fig. 1 H). Taken together, these results confirmed that both the MCD and HFFC diets induced the features of MASH, including steatosis, hepatocyte ballooning, and lobular inflammation. However, HFFC-fed mice enhanced the synthesis of FFAs while MCD-fed mice suppress the synthesis of FFAs. MDMs compensated for the loss of EmKCs in both MASH models A recent study suggested that the metabolic environment could shape the immune response in the liver [ 16 ] . Changes in the tissue microenvironment can lead to macrophage reprogramming, resulting in a new functional phenotype [ 17 ] . Importantly, hepatic macrophages not only display substantial heterogeneity but also play critical roles in MASH [ 18 ] . Therefore, we investigated whether different changes in metabolic pathways affect the composition of hepatic macrophages. F4/80 staining demonstrated that the livers of the MCD-fed HFFC-fed mice contained more macrophages than ND-fed mice (Fig. 2 A). To evaluate the changes in macrophage composition in the liver, we analyzed isolated hepatic macrophages via flow cytometry. Since KCs are impaired and initiate inflammation, triggering the recruitment of MDMs during MASH [ 19 ] , we first focused on changes in KCs. Hepatic macrophages can be identified by F4/80 hi and CD11b int (Fig. 2 B). Compared to ND-fed mice, the number of hepatic macrophages in MCD-fed mice was lower. However, there was no significant change in the number of hepatic macrophages in HFFC-fed mice (Fig. 2 C). We suspected that this phenomenon was a consequence of the compensation of MDMs. To verify this phenomenon, we used TIM4 to distinguish EmKCs from MDMs because TIM4 is a specific marker of mature KCs [ 8 ] , whereas TIM4 expression is delayed in MDMs [ 20 ] . In ND-fed mice, almost all hepatic macrophages highly expressed TIM4, whereas EmKCs decreased in number in both MCD- and HFFC-fed mice (Fig. 2 D). The proportion of EmKCs among hepatic macrophages was significantly lower in HFFC-fed mice (73.74%±7.961%) and MCD-fed mice (39.93%±9.031%) than in ND-fed mice (95.14%±1.090%) (Fig. 2 E). These results demonstrated the loss of EmKCs during MASH. Next, we focused on the TIM4 lo macrophages in this gate, which represented recruited MDMs. Our results revealed a dramatic increase in MDMs in this gate in both MASH models (Fig. 2 F). The proportion of MDMs among hepatic macrophages was also greater in HFFC-fed mice (19.26%±6.940%) and MCD-fed mice (52.38%±8.376%) compared to ND-fed mice (2.46%±0.527%) (Fig. 2 G). Moreover, we compared the differences between MCD- and HFFC-fed mice and found that the MCD-fed mice lost more EmKCs HFFC-fed mice and there was no difference in the number of MDMs between the two MASH models (Fig. 2 H). And compared to HFFC-fed mice, EmKCs occupied a lower proportion of hepatic macrophages while MDMs occupied a higher proportion of hepatic macrophages in the MCD-fed mice (Fig. 2 I). Overall, our analysis of hepatic macrophages revealed that both the MCD and HFFC diets can lead to the loss of EmKCs and the entry of MDMs into the KC niche. MCD-fed mice lost more EmKCs than HFFC-fed mice. MCD-fed mice recruited more monocytes than HFFC-fed mice Previously, we demonstrated the contribution of MDMs to the KC pool; next, we focused on the composition of monocytes in the whole liver. MDMs can be identified by CD11b hi and F4/80 int (Fig. 3 A). The number of CD11b hi F4/80 int cells increased in both the MCD- and HFFC-fed mice (Fig. 3 B). Under pathological conditions, Kupffer cell self-renewal is impaired, and monocytes are recruited to the MASH liver in a CCR2-dependent manner, contributing to the KC pool [ 21 ] . Liver monocytes can be found within CD11b hi F4/80 int cells and can be identified by gating for Ly6C hi , MHCII lo . Our results revealed that the number of Ly6C hi monocytes increased in these two MASH models (Fig. 3 C). The proportion of Ly6C hi monocytes was also greater in HFFC-fed mice (58.26%±6.154%) and MCD-fed mice (44.41%±6.688%) than in ND-fed mice (19.19%±3.643%) (Fig. 3 D). As CCR2 is predominantly localized to monocytes, not KCs [ 22 ] , thus Ly6C hi and CCR2 + can be used to identify classical monocytes (CMs) [ 23 ] .We further analyzed CCR2 expression in Ly6C hi monocytes. CMs were rare in ND-fed mice liver, whereas they accumulated in MCD- and HFFC-fed mice (Fig. 3 E) and were present in a greater proportion of Ly6C hi monocytes in MCD-fed mice (32.49%±4.420%) and HFFC-fed mice (27.86%±5.930%) than ND-fed mice (7.88%±2.411%) (Fig. 3 F). In addition, the numbers of Ly6C hi monocytes and CMs in the MCD-fed mice were greater than HFFC-fed mice (Fig. 3 G). The proportion of Ly6C hi monocytes among CD11b hi F4/80 int cells were also higher in in the MCD-fed mice than HFFC-fed mice (Fig. 3 H). In conclusion, our results revealed that the recruitment of blood-derived monocytes occurred in two MASH models. There were more recruited proinflammatory Ly6C hi monocytes and CMs within MDMs in two MASH model mice than in ND-fed mice. Moreover, compared with HFFC-fed mice, MCD-fed mice recruited more monocytes. The composition of the KC pool differed between MCD- and HFFC-fed mice Although the MCD and HFFC diets result in different metabolic alterations in the liver, both lead to the loss of EmKCs and the entry of MDMs during MASH progression. The collective reports demonstrated that KCs can be divided into 4 subsets, except for EmKCs, there are 3 subsets of recruited MDMs: MoKCs, C-LAMs, and LAMs, which cooperate to maintain liver homeostasis [ 6 ] . Therefore, we wondered whether different metabolic states affect the composition of the KC pool. We previously analyzed the changes in EmKCs and MDMs. Next, we focused on subsets of MDMs. VSIG4 and CCR2 can be used to further subdivide MDMs because the MoKCs are VSIG4 hi while LAMs have low expression of VSIG4. In addition, C-LAMs are CCR2 + and VSIG4 lo [ 23 ] . C-LAMs represent early MDMs that have increased proinflammatory and profibrotic abilities. Moreover, C-LAMs receive signals from the KC niche that drive the expression of KC markers or respond to inflammatory/lipid stimuli that induce LAM gene expression [ 11 ] . Compared to ND-fed mice, C-LAMs were increased in both MCD- and HFFC-fed mice (Fig. 4 A, B). Moreover, there were more C-LAMs in the MCD-fed mice than in the HFFC-fed mice (Fig. 4 G), which was consistent with the analysis of recruited MDMs. The proportion of C-LAMs increased in the MCD-fed mice (34.71%±6.314%) than in the HFFC-fed mice (11.07%±2.737%) (Fig. 4 H). The recruitment of LAMs is the biggest distinction in MASH macrophages because their pattern of gene expression is different from C-LAMs, MoKCs and EmKCs. [ 5 ] . LAMs appear to be involved in both early proinflammatory damage and late anti-inflammatory repair during MASH development [ 10 ] . There were more LAMs in number in MCD- and HFFC-fed mice (Fig. 4 D), indicating the lipid overload environment of MASH. Although the of LAMs showed no significant difference between MCD- (26.74%±8.108%) and HFFC-fed mice (22.50%±5.499%) (Fig. 4 H), the MCD-fed mice contained more LAMs than the HFFC-fed mice (Fig. 4 G). MoKCs largely resemble EmKCs, they show a similar gene expression pattern with EmKCs. [ 5 ] and can ultimately acquire many of the hallmarks of EmKCs, such as TIM4. Compared to ND-fed mice, there was a significant increase in the number of MoKCs in the two MASH models (Fig. 4 F). Interestingly, HFFC-fed mice had many more mo-KCs than MCD-fed mice (Fig. 4 G). MoKCs also accounted for a greater proportion of MDMs in HFFC-fed mice (63.05%±5.566%) than in MCD-fed mice (21.93%±2.181%) (Fig. 4 H). Overall, our study revealed that the composition of the KC pool differed between MCD- and HFFC-fed mice. Among the MDMs subsets, HFFC-fed mice contain more MoKCs than MCD-fed mice, whereas MCD-fed mice have more C-LAMs and LAMs than HFFC-fed mice. Discussion The collective reports of Single-cell and spatial transcriptomic analysis demonstrated that the hepatic macrophages in MASH are of distinct heterogeneous character [ 5 – 7 ] . However, we still lack further descriptions of specific subsets of hepatic macrophages in different MASH models. Therefore, we investigated the composition of hepatic macrophage in different MASH animal models. We found that the MCD and HFFC diets led to different metabolic changes in FFA synthesis in the liver. Both the MCD and HFFC diets induce the same alteration in the composition of hepatic macrophages characterized by a decrease in EmKCs and a concomitant increase in MDMs. Importantly, the composition of the KC pool differed between MCD- and HFFC-fed mice. The number of MoKCs was greater in the MDMs subset in HFFC-fed mice, whereas the number of C-LAMs and LAMs was greater in MCD-fed mice than in HFFC-fed mice. To explore the composition of hepatic macrophages in MASH, we used two classical MCD and HFFC diets to induce MASH models. A previous study showed that after feeding HFFC diet, mice would develop steatosis (4–8 weeks), steatohepatitis (16–24 weeks), and progressive fibrosis (after 16 weeks) in sequence [ 12 ] .The HFFC model can further recapitulates the features of human MASH than other dietary models, including obesity, insulin resistance, dyslipidemia and, subsequently, fatty liver and then steatohepatitis, followed by fibrosis, which demonstrates good clinical translatability compared with other dietary models [ 13 , 14 ] . Although the use of the MCD model is limited due to its inconsistencies with the metabolic characteristics of human MASH, MCD diet is still one of the very commonly used diets because it produces the most severe phenotype of MASH in the shortest time. [ 15 ] . Therefore, assessing the altered metabolic pathways caused by different diets provides valuable information regarding the molecular mechanisms of MASH. A recent study suggested that the MCD diet impaired the lipid export which led to the accumulation of hepatic lipid [ 24 ] . Our results suggested that MCD-fed mice might decrease de novo lipogenesis to maintain the balance of liver lipids. In contrast, the HFFC diet induced an increase in de novo lipogenesis (Fasn, Srebf1, Acly, Acaca) to address the continuous alimentary supply. In summary, the MCD and HFFC diets induce different metabolic changes in FFA synthesis. Single-cell and spatial genomics demonstrated that the liver harbors multiple populations of macrophages in MASH [ 6 , 7 ] . A recent study also suggested that the metabolic environment could shape the immune response in the liver [ 16 ] . However, we still lack further descriptions of specific subsets of hepatic macrophages in different MASH models. In our study, although the MCD and HFFC diets induced different metabolic changes, they both led to the loss of EmKCs and the entry of MdMs. MCD-fed mice lost more EmKCs than HFFC-fed mice. Correspondingly, more MDMs accumulated in the MCD-fed mice than in the HFFC-fed mice, indicating that the MCD-fed mice were in a more severe state of MASH. Importantly, we observed that the composition of the KC pool differed between MCD-fed mice and HFFC-fed mice. In addition, KCs can be divided into 4 subsets, except for EmKCs, there are 3 subsets of recruited MDMs: MoKCs, C-LAMs, and LAMs, which cooperate to Maintain liver homeostasis [ 25 ] . C-LAMs, also known as in other studies [ 5 ] , presented an intermediate phenotype between MoKCs and LAMs. They represent MDMs that have more recently entered the KC niche. Therefore, consistent with our analysis of MDMs, we found that MCD-fed mice contained more C-LAMs than HFFC-fed mice. Unlike the transition state of C-LAMs, in terms of the transcriptome, localization, and function of hepatic LAMs and MoKCs, they represent distinct fates for monocytes recruited to the liver in MASH [ 5 ] . LAMs appear to be involved in both early pro-inflammatory damage and late anti-inflammatory repair during MASH development [ 10 ] . TREM2 and SPP1 are specific markers of hepatic LAMs, and the expression of TREM2 and SPP1 is positively correlated with the severity of MASH. However, myeloid-specific knockout of TREM2 or SPP1 accelerates progression to MASH [ 26 , 27 ] . We still lack studies that are performed with LAM-specific tools. Our research demonstrated that there were more LAMs in MCD-fed mice than in HFFC-fed mice, suggesting that the MCD diet induced more severe MASH. In addition, MCD-fed mice may be more suitable MASH models for investigating the function of LAMs because we can obtain more LAMs in a shorter time. Compared to EmKCs, MoKCs are less efficient in fat storage, but they show a similar gene expression pattern of lipid metabolism [ 4 ] . Nevertheless, MoKCs contain more lipids than LAMs/C-LAMs, and the depletion of MoKCs leads to decreased hepatic TG storage [ 7 ] . In a chronic disease as MASH, persisting MoKCs may eventually fully adopt the identity and lipid storage capabilities of EmKCs [ 4 ] . In our study, the number of MoKCs was greater in HFFC-fed mice than in MCD-fed mice, and MoKCs were the predominant subset of MDMs in HFFC-fed mice. The metabolic environment of HFFC-fed mice may promote the differentiation of MDMs to MoKCs more effectively. HFFC-fed mice may be a preferable MASH model for studying MoKCs. In conclusion, our research demonstrated that the HFFC diet and MCD diet induced different metabolic states and provided a fuller description of hepatic macrophage composition in different MASH models. Our research highlights the need to choose different MASH models when investigating different subsets of hepatic macrophages. Materials and Methods Animals The Ethics Committee of the Air Force Medical University approved the animal experiments (IACOC-20200757). The 8–10 weeks old Male mice were raised under a 12-h light/dark cycle with food and water available ad libitum. Two MASH models were employed for the experiments, we used the methionine-choline-deficient (MCD) (Dyets, Bethlehem, PA, high sucrose (40%) and 10% fat, but deficient in methionine and choline) diet to feed mice for 4 weeks or the high-fat-fructose-cholesterol (HFFC) (Research Diets, D09100310, 40% fat, 20% fructose and 2% cholesterol) diet to feed mice for 16 weeks. The control mice fed the normal diet. Methods details H&E and oil red O staining H&E staining of mouse liver sections was performed after they were dehydrated, embedded in paraffin, and cut into 4–5 m thick sections. Concerning oil red O staining, a fresh working solution of oil red O was prepared and applied to frozen sections of liver tissue after fixation with 4% paraformaldehyde for 15 min. Finally, Case Viewer was used to scan the slides. Immunohistochemistry After dewaxing with dimethylbenzene (I and II), mouse liver samples were dehydrated on paraffin-embedded slides using a gradient of alcohol concentrations (100%, 95%, 85% and 75%). Then antigen retrieval was conducted using a high-temperature and high-pressure antigen-repairing method. Next, we used normal goat serum to block the tissues for 30 min and incubated them with primary antibody overnight at 4 °C. Furthermore, we washed slides and incubated them with horseradish peroxidase-conjugated secondary antibody at room temperature for 1 h. We used 3,3'-diaminobenzidine tetrahydrochloride substrate (ZSGB-BIO, Beijing, China) to identify the bound antibodies, and we counterstained the sections with haematoxylin, dehydrated and mounted them. Macrophage isolation To isolate hepatic macrophages, we initially employed liver perfusion to clear red cells and use collagenase A to digest liver tissues. Next, hepatocytes were removed from murine liver nonparenchymal cells by centrifuging at 50 g. In addition, hepatic macrophages were isolated from the nonparenchymal cell population by differential centrifugation using 25% Percoll and 50% Percoll gradient at 1800 g for 15 min. Cells were washed with DMEM (Gibco). The resuspended cells were plated in DMEM, 10% FBS (Gibco) and 1% penicillin/streptomycin. The non-adherent cells were removed after 1 h and washed with phosphate-buffered saline. In flowcytometry studies, the nonparenchymal cells blocked by CD16/32 antibody (Biolegend) were incubated with the following primary antibodies from Biolegend [CD45-AF750 (#109824), Zoombie-BV510 (#423101), F4/80-PE (#123110) ,Ly6C-Percp-Cy5.5(#128012),MHCII-APC(#107614),Ly6G-PE-Cy7(#127618),TIM4-PE-Cy7(#130010),MHCII-Percp-Cy5.5(#107626),CCR2-BV421(#150605) and CD11b-FITC (#101206)]. The VSIG4-APC (#2731759) is from eBioscience. Hepatic macrophages cells are identified as F4/80 hi , CD11b int , the hepatic macrophages are composed of embryonic Kupffer cells (EmKCs), which can be identified by high expression of TIM4 and recruited monocyte-derived macrophages (MDMs) which are almost exclusively TIM4 lo . MDMs are further subdivided into the monocyte-derived Kupffer cells (MoKCs) which are TIM4 lo , VSIG4 hi , and lipid-associated macrophages (LAMs), which are TIM4 lo , VSIG4 lo . The C-LAMS are defined by Ccr2 + LAMS. Liver Ly6C hi monocytes can be found within the CD11b hi , F4/80 int population and are identified by gating for Ly6C hi , MHCII lo . The classical monocytes(CMs)are identified as Ly6C hi , CCR2 + . The analysis was performed using a BD FACSCantoTM II Flow Cytometer. Quantitative reverse transcription polymerase chain reaction (RT-qPCR) RNA from the samples was isolated using Trizol (Invitrogen). Using a high-capacity cDNA reverse transcription kit (Takara), we performed RT-qPCR on 1 μg of RNA in a Bio-Rad CFX96TM system (The primers in Supplementary Table 1 were synthesized from Qingke company). We employed β-actin mRNA as an internal control to standardize mRNA expression. Primary antibodies Primer sequence used in this study Gene Primer Acaca(mus)- Forward Primer ATGGGCGGAATGGTCTCTTTC Acaca(mus)- Reverse Primer TGGGGACCTTGTCTTCATCAT β-actin(mus)- Forward Primer CGGTTCCGATGCCCTGAGGCTCTT β-actin(mus)- Reverse Primer CGTCACACTTCATGATGGAATTGA Acly(mus)- Forward Primer GTGGGGTGATATAGAGTTCCCT Acly(mus)- Reverse Primer GCTTGCTCCACTTTTGGCATC Acox1(mus)- Forward Primer TAACTTCCTCACTCGAAGCCA Acox1(mus)- Reverse Primer AGTTCCATGACCCATCTCTGTC Adgre1(mus)- Forward Primer CTCAGTCTGCACCAATATCCTG Adgre1(mus)- Reverse Primer CCACAGAGTTAGAGCAGTTGGAA Cd36(mus)-Forward Primer AGATGACGTGGCAAAGAACAG Cd36(mus)- Reverse Primer Cpt1a(mus) -Forward Primer Cpt1a(mus)- Reverse Primer Cxcl5(mus) -Forward Primer Cxcl5(mus)- Reverse Primer Cxcl10(mus) -Forward Primer Cxcl10(mus)- Reverse Primer CCTTGGCTAGATAACGAACTCTG CTATGCGCTACTCGCTGAAGG GGCTTTCGACCCGAGAAGA TGCCCTACGGTGGAAGTCATA TGCATTCCGCTTAGCTTTCTTT CCAAGTGCTGCCGTCATTTTC GGCTCGCAGGGATGATTTCAA Dgat2(mus) -Forward Primer GCGCTACTTCCGAGACTACTT Dgat2(mus) - Reverse Primer GGGCCTTATGCCAGGAAACT Elovl1(mus) -Forward Primer TTGGCTGAGTACCTACACCTG Elovl1 (mus) - Reverse Primer CTCGAACCATCCGAAGTGCTT Elovl5 (mus) -Forward Primer ATGGAACATTTCGATGCGTCA Elovl5 (mus) - Reverse Primer GTCCCAGCCATACAATGAGTAAG Elovl7 (mus) -Forward Primer CATCGAGGACTGTGCGTTTTT Elovl7(mus) - Reverse Prime GCCCAGGATGATGGTTTGTG Fasn(mus) -Forward Primer AGGTGGTGATAGCCGGTATGT Fasn(mus) - Reverse Primer TGGGTAATCCATAGAGCCCAG Il-1β(mus) -Forward Primer TTCAGGCAGGCAGTATCACTC Il-1β(mus) - Reverse Primer GAAGGTCCACGGGAAAGACAC Il-6(mus) -Forward Primer TAGTCCTTCCTACCCCAATTTCC Il-6(mus) - Reverse Primer TTGGTCCTTAGCCACTCCTTC Lipe(mus) -Forward Primer GATTTACGCACGATGACACAGT Lipe(mus) - Reverse Primer ACCTGCAAAGACATTAGACAGC Lpl(mus) -Forward Primer GGGAGTTTGGCTCCAGAGTTT Lpl (mus) - Reverse Primer TGTGTCTTCAGGGGTCCTTAG Srebf1 (mus) - Reverse Primer TGACCCGGCTATTCCGTGA Srebf1 (mus) -Forward Primer CTGGGCTGAGCAATACAGTTC Statistical analysis Statistical analysis was performed via GraphPad Prism 7 software. All the data are reported as the means±SE. Comparisons of the data between different groups were conducted via Student’s t test or one-way analysis of variance. A P value <0.05 was considered as statistically significant. Abbreviations Acaca, Acetyl-CoA Carboxylase Alpha; Acly, ATP-citrate lyase; Acox1, Acyl-CoA Oxidase 1; Cxcl5/10, C-X-C motif chemokine ligand5/7; Cpt1a, Carnitine Palmitoyl transferase 1A; Dgat2, Diacylglycerol O-Acyltransferase 2; Elovl1/5/7, elongation of long chain fatty acids1/5/7; Fasn, Fatty Acid Synthase; Il-1b/6, interleukin -1β/6; Lipe, Lipase E; Lpl, Lipoprotein Lipase. Srebf1, Sterol Regulatory Element Binding Transcription Factor 1; Tnf, Tumor Necrosis Factor. LAM, lipid-associated macrophage; HFFC, high-fat-fructose-cholesterol; MCD, methionine–choline deficient; EmKC, embryonic Kupffer cell; MDM, monocyte-derived macrophage; LAM, lipid-associated macrophage; MoKC, monocyte-derived Kupffer cell; Metabolic dysfunction-associated steatotic liver disease, MASLD; Metabolic dysfunction-associated steatohepatitis, MASH; RT-qPCR, real time quantitative PCR. Declarations Authors' contributions Jingbo Wang and Ying Han designed the research and edited the manuscript. Erzhuo Xia, Miao Zhang, and Chongxiao Li performed the experiments and wrote the manuscript. Bo Li, Shuoyi Ma, Yinan Hu, Siyuan Tian, Xia Zhou, Gang Ma, Xiaohong Zheng, and Rui Su analyzed the data. Competing interests The authors have declared that no competing interest exists . Funding The study was funded by National Key Research and Development Program of China, (No.2023ZD0508501), the National Natural Science Foundation of China (No. 82300672). Acknowledgements Not applicable Ethics approval not applicable Consent to participate not applicable Consent to Publish not applicable SUPPORTING INFORMATION Additional supporting information may be found online in the Supporting Information section. References YOUNOSSI Z M, GOLABI P, PAIK J M, et al. The global epidemiology of nonalcoholic fatty liver disease (NAFLD) and nonalcoholic steatohepatitis (NASH): a systematic review [J]. Hepatology, 2023, 77(4): 1335-47. LOOMBA R, FRIEDMAN S L, SHULMAN G I. Mechanisms and disease consequences of nonalcoholic fatty liver disease [J]. Cell, 2021, 184(10): 2537-64. ANSTEE Q M, REEVES H L, KOTSILITI E, et al. From NASH to HCC: current concepts and future challenges [J]. Nat Rev Gastroenterol Hepatol, 2019, 16(7): 411-28. ZIGMOND E, VAROL C. Two Roads Diverge in the Sick Liver, Monocytes Travel Both [J]. Immunity, 2020, 53(3): 479-81. REMMERIE A, MARTENS L, THONé T, et al. Osteopontin Expression Identifies a Subset of Recruited Macrophages Distinct from Kupffer Cells in the Fatty Liver [J]. Immunity, 2020, 53(3): 641-+. GUILLIAMS M, BONNARDEL J, HAEST B, et al. Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches [J]. Cell, 2022, 185(2): 379-+. TRAN S, BABA I, POUPEL L, et al. Impaired Kupffer Cell Self-Renewal Alters the Liver Response to Lipid Overload during Non-alcoholic Steatohepatitis [J]. Immunity, 2020, 53(3): 627-+. BEATTIE L, SAWTELL A, MANN J, et al. Bone marrow-derived and resident liver macrophages display unique transcriptomic signatures but similar biological functions [J]. J Hepatol, 2016, 65(4): 758-68. VAN DE LAAR L, SAELENS W, DE PRIJCK S, et al. Yolk Sac Macrophages, Fetal Liver, and Adult Monocytes Can Colonize an Empty Niche and Develop into Functional Tissue-Resident Macrophages [J]. Immunity, 2016, 44(4): 755-68. XU R, VUJIC N, BIANCO V, et al. Lipid-associated macrophages between aggravation and alleviation of metabolic diseases [J]. Trends in endocrinology and metabolism: TEM, 2024. GUILLIAMS M, SCOTT C L. Liver macrophages in health and disease [J]. Immunity, 2022, 55(9): 1515-29. ASGHARPOUR A, CAZANAVE S C, PACANA T, et al. A diet-induced animal model of non-alcoholic fatty liver disease and hepatocellular cancer [J]. J Hepatol, 2016, 65(3): 579-88. HANSEN H H, ÆGIDIUS H M, ORó D, et al. Human translatability of the GAN diet-induced obese mouse model of non-alcoholic steatohepatitis [J]. BMC Gastroenterol, 2020, 20(1): 12. SANTHEKADUR P K, KUMAR D P, SANYAL A J. Preclinical models of non-alcoholic fatty liver disease [J]. J Hepatol, 2018, 68(2): 230-7. PIERCE A A, PICKENS M K, SIAO K, et al. Differential hepatotoxicity of dietary and DNL-derived palmitate in the methionine-choline-deficient model of steatohepatitis [J]. BMC Gastroenterol, 2015, 15: 9. LI X, RAMADORI P, PFISTER D, et al. The immunological and metabolic landscape in primary and metastatic liver cancer [J]. Nat Rev Cancer, 2021, 21(9): 541-57. LAVIN Y, WINTER D, BLECHER-GONEN R, et al. Tissue-Resident Macrophage Enhancer Landscapes Are Shaped by the Local Microenvironment [J]. Cell, 2014, 159(6): 1312-26. KRENKEL O, HUNDERTMARK J, ABDALLAH A T, et al. Myeloid cells in liver and bone marrow acquire a functionally distinct inflammatory phenotype during obesity-related steatohepatitis [J]. Gut, 2020, 69(3): 551-63. KAZANKOV K, JORGENSEN S M D, THOMSEN K L, et al. The role of macrophages in nonalcoholic fatty liver disease and nonalcoholic steatohepatitis [J]. Nat Rev Gastroenterol Hepatol, 2019, 16(3): 145-59. SAKAI M, TROUTMAN T D, SEIDMAN J S, et al. Liver-Derived Signals Sequentially Reprogram Myeloid Enhancers to Initiate and Maintain Kupffer Cell Identity [J]. Immunity, 2019, 51(4): 655-+. BONNARDEL J, T'JONCK W, GAUBLOMME D, et al. Stellate Cells, Hepatocytes, and Endothelial Cells Imprint the Kupffer Cell Identity on Monocytes Colonizing the Liver Macrophage Niche [J]. Immunity, 2019, 51(4): 638-54. KRENKEL O, PUENGEL T, GOVAERE O, et al. Therapeutic inhibition of inflammatory monocyte recruitment reduces steatohepatitis and liver fibrosis [J]. Hepatology, 2018, 67(4): 1270-83. DAEMEN S, CHAN M M, SCHILLING J D. Comprehensive analysis of liver macrophage composition by flow cytometry and immunofluorescence in murine NASH [J]. STAR protocols, 2021, 2(2): 100511. MONTANDON S A, SOMM E, LOIZIDES-MANGOLD U, et al. Multi-technique comparison of atherogenic and MCD NASH models highlights changes in sphingolipid metabolism [J]. Sci Rep, 2019, 9: 14. DAEMEN S, GAINULLINA A, KALUGOTLA G, et al. Dynamic Shifts in the Composition of Resident and Recruited Macrophages Influence Tissue Remodeling in NASH (vol 34, 108626, 2021) [J]. Cell Reports, 2022, 41(7): 1. HAN H, GE X D, KOMAKULA S S B, et al. Macrophage-derived Osteopontin (SPP1) Protects From Nonalcoholic Steatohepatitis [J]. Gastroenterology, 2023, 165(1): 201-17. WANG X C, HE Q F, ZHOU C L, et al. Prolonged hypernutrition impairs TREM2-dependent efferocytosis to license chronic liver inflammation and NASH development [J]. Immunity, 2023, 56(1): 58-+. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-5395060","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":375452367,"identity":"5a5c9cd0-943f-4eb3-85c2-7c830d3db502","order_by":0,"name":"Erzhuo Xia","email":"","orcid":"","institution":"Xijing Hospital","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Erzhuo","middleName":"","lastName":"Xia","suffix":""},{"id":375452368,"identity":"3f04f7c1-6dc0-4e37-9396-ad839cf93951","order_by":1,"name":"Miao Zhang","email":"","orcid":"","institution":"Xijing Hospital","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Miao","middleName":"","lastName":"Zhang","suffix":""},{"id":375452369,"identity":"1f4d37c0-c437-48e4-b3c4-d52fb7174df7","order_by":2,"name":"Chongxiao Li","email":"","orcid":"","institution":"Xijing Hospital","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Chongxiao","middleName":"","lastName":"Li","suffix":""},{"id":375452370,"identity":"67c7eaf3-e503-430b-bb5f-8a4dff91117e","order_by":3,"name":"Bo Li","email":"","orcid":"","institution":"Xijing Hospital","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Bo","middleName":"","lastName":"Li","suffix":""},{"id":375452371,"identity":"07c3ee7f-807a-42f7-a3d0-bbf02a669858","order_by":4,"name":"Shuoyi Ma","email":"","orcid":"","institution":"Xijing Hospital","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Shuoyi","middleName":"","lastName":"Ma","suffix":""},{"id":375452372,"identity":"afbd8fe5-0607-49c4-9a71-809daf0b0081","order_by":5,"name":"Qingling Fan","email":"","orcid":"","institution":"Xijing Hospital","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Qingling","middleName":"","lastName":"Fan","suffix":""},{"id":375452373,"identity":"41e8b9e9-890b-4beb-b90f-97e28f3eb8c0","order_by":6,"name":"Yinan Hu","email":"","orcid":"","institution":"Xijing Hospital","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Yinan","middleName":"","lastName":"Hu","suffix":""},{"id":375452374,"identity":"aa1df60e-3b1e-4bf5-99ac-5b58e9c5c988","order_by":7,"name":"Siyuan Tian","email":"","orcid":"","institution":"Xijing Hospital","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Siyuan","middleName":"","lastName":"Tian","suffix":""},{"id":375452375,"identity":"b77fdbc1-5e6e-465b-8dd0-4d7c5dba5209","order_by":8,"name":"Xia Zhou","email":"","orcid":"","institution":"Xijing Hospital","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Xia","middleName":"","lastName":"Zhou","suffix":""},{"id":375452376,"identity":"60a1a0ac-2d41-40cb-b180-b30f84162fa2","order_by":9,"name":"Rui Su","email":"","orcid":"","institution":"Xijing Hospital","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Rui","middleName":"","lastName":"Su","suffix":""},{"id":375452378,"identity":"5e3f0924-eaf2-4855-92b7-1f60ba374cc5","order_by":10,"name":"Gang Ma","email":"","orcid":"","institution":"Xijing Hospital","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Gang","middleName":"","lastName":"Ma","suffix":""},{"id":375452379,"identity":"6994604d-0383-4517-ae44-557bd986a218","order_by":11,"name":"Xiaohong Zheng","email":"","orcid":"","institution":"Xijing Hospital","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Xiaohong","middleName":"","lastName":"Zheng","suffix":""},{"id":375452381,"identity":"f9565de3-cff7-4167-9e45-ebfb3feba1ad","order_by":12,"name":"Ying Han","email":"","orcid":"","institution":"Xijing Hospital","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Ying","middleName":"","lastName":"Han","suffix":""},{"id":375452388,"identity":"ef6172c7-19fb-461f-910a-3fcae8930a25","order_by":13,"name":"Jingbo Wang","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAqklEQVRIiWNgGAWjYBACxmYGNhAtx8befoA0LcZ8PGcSiLYIrCVxnoSDAXHqmdu50x583HM4vU2CIYHhR8U2YhzGu91wxrPDuW3SjQcYe87cJkrLNmmeA7dz22QOJDAzthGr5c+B2+lsEgkGJGhhOHA7gSQt2w17Dvw3bAMG8kGi/GLYf3bbgx8H0uTl29sPPvhRQYyWBiTOAcLqgUCeKFWjYBSMglEwsgEA/hU80K2qj0gAAAAASUVORK5CYII=","orcid":"","institution":"Air Force Medical University","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"Jingbo","middleName":"","lastName":"Wang","suffix":""}],"badges":[],"createdAt":"2024-11-05 11:38:32","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-5395060/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-5395060/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":69681355,"identity":"f204d4d7-abea-42a4-8430-27b29a7764f9","added_by":"auto","created_at":"2024-11-23 06:48:48","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":6130858,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe MCD and HFFC diets induce contrary changes in the FFA synthesis pathway.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A) Body weight gain of the mice fed with the ND, MCD or HFFC diet. (B) Theratio of the liver weight to the body weight of the mice fed with the ND, MCD or HFFC diet. (C) Representative hematoxylin and eosin (H\u0026amp;E) staining and oil red O staining of liver sections from the mice fed the ND, MCD or HFFC diet; scale bar=50 μm\u003cdel\u003e \u003c/del\u003e. (D) Relative mRNA expression of inflammatory factors in total livers from mice fed with the ND, MCD diet or HFFC diet. (E) Relative mRNA expression of FFA-oxidizing enzymes and transportation genes in total livers from mice fed with the ND, MCD diet or HFFC diet. (F) Relative mRNA expression of FFA elongation enzymes in total livers from mice fed with the ND, MCD diet or HFFC diet. (G) Relative mRNA expression of TG hydrolysis enzymes in total livers from mice fed with the ND, MCD diet or HFFC diet. (H) Relative mRNA expression of FFA synthesis enzymes in total livers from mice fed with the ND, MCD diet or HFFC diet. (n=8 mice/ND group, n=8 mice/MCD group, n=8 mice/HFFC group). Data are mean±standard deviation (SD). *p\u0026lt;0.05, **p\u0026lt;0.01 and ***p\u0026lt;0.001.\u003c/p\u003e","description":"","filename":"figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-5395060/v1/cd52ace034049e5bcd90faff.png"},{"id":69681303,"identity":"a5fb547a-61bd-4d82-85f9-572b1adee871","added_by":"auto","created_at":"2024-11-23 06:40:48","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":5074042,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eMDMs compensated for the loss of EmKCs in both MASH models\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A) F4/80 immunohistochemical staining of liver sections from mice fed with the ND, MCD or HFFC diet; scale bar=50 μm.(B) Representative gating strategy used to identify hepatic macrophages, EmKCs and MDMs from livers of mice fed with ND, MCD or HFFC diet. (C) Absolute number of hepatic macrophages per gram of liver in mice fed with ND, MCD or HFFC diet. (D) Absolute number of EmKCs per gram of liver in mice fed with ND, MCD or HFFC diet. (E)Proportion of EmKCs among hepatic macrophages in mice fed with ND, MCD or HFFC diet. (F) Absolute number of MDMs per gram of liver in mice fed with ND, MCD or HFFC diet. (G) Proportion of MDMs among hepatic macrophages in mice fed with ND, MCD or HFFC diet. (H) Absolute number of hepatic macrophages, EmKCs and MDMs per gram of liver in mice fed with MCD or HFFC diet. (G)Proportion of EmKCs, MDMs among hepatic macrophages in mice fed with MCD or HFFC diet.\u003c/p\u003e\n\u003cp\u003e(n=8 mice/ND group, n=8 mice/MCD group, n=8 mice/HFFC group) Data are mean±standard deviation (SD). *p\u0026lt;0.05, **p\u0026lt;0.01 and ***p\u0026lt;0.001.\u003c/p\u003e","description":"","filename":"figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-5395060/v1/19fc587c4401fefc5b77a73b.png"},{"id":69681354,"identity":"a6a27b8a-03c4-4f4b-b5db-c9ea96538a2a","added_by":"auto","created_at":"2024-11-23 06:48:48","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":1745753,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eMCD-fed mice recruited more monocytes than HFFC-fed mice\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eA) Representative gating strategy used to identify CD11\u003csup\u003ehi\u003c/sup\u003e F4/80\u003csup\u003eint\u003c/sup\u003e cells, Ly6C\u003csup\u003ehi\u003c/sup\u003e monocytes and classical monocytes from livers of mice fed with ND, MCD or HFFC diet. (B) Absolute number of CD11\u003csup\u003ehi\u003c/sup\u003e F4/80\u003csup\u003eint\u003c/sup\u003e cells per gram of liver in mice fed with ND, MCD or HFFC diet. (C) Absolute number of Ly6C\u003csup\u003ehi\u003c/sup\u003e monocytes per gram of liver in mice fed with ND, MCD or HFFC diet(D)Proportion of Ly6C\u003csup\u003ehi\u003c/sup\u003e monocytes among CD11\u003csup\u003ehi\u003c/sup\u003e F4/80\u003csup\u003eint\u003c/sup\u003e cells in mice fed with ND, MCD or HFFC diet.(E) Absolute number of classical monocytes per gram of liver in mice fed with ND, MCD or HFFC diet (F)Proportion of classical monocytes among Ly6C\u003csup\u003ehi\u003c/sup\u003e monocytes in mice fed with MCD or HFFC diet. (G) Absolute number of Ly6C\u003csup\u003ehi\u003c/sup\u003e monocytes and classical monocytes per gram of liver in mice fed with MCD or HFFC diet (I)Proportion of Ly6C\u003csup\u003ehi\u003c/sup\u003e monocytes and classical monocytes among CD11\u003csup\u003ehi\u003c/sup\u003e F4/80\u003csup\u003eint\u003c/sup\u003e cells in the liver from mice fed with MCD or HFFC diet. (n=8 mice/ND group, n=8 mice/MCD group, n=8 mice/HFFC group). Data are mean±standard deviation (SD). *p\u0026lt;0.05 and ***p\u0026lt;0.001.\u003c/p\u003e","description":"","filename":"figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-5395060/v1/d23108369509c6a75e50a672.png"},{"id":69681301,"identity":"793447d2-d687-4a9d-8395-a55c2d88f107","added_by":"auto","created_at":"2024-11-23 06:40:48","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":1237623,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe composition of the KC pool differed between MCD- and HFFC-fed mice\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A)Representative liver C-LAM gate. (B) Absolute number of C-LAMs per gram of liver in the mice fed with ND, MCD or HFFC diet. (C) Representativeliver LAMs. (D) Absolute number of LAMs per gram of liver in the mice fed with ND, MCD or HFFC diet. (E) Representative liver MoKC gate. (F) Absolute number of MoKCs per gram of liver in the mice fed with ND, MCD or HFFC diet. (G) Absolute number of C-LAMs, LAMs and MoKCs per gram of liver in mice fed with MCD or HFFC diet. (H) Proportionof C-LAMs, LAMs and MoKCs among MDMs in the liver from mice fed with MCD or HFFC diet. (n=8 mice/ND group, n=8 mice/MCD group, n=8 mice/HFFC group)\u003cstrong\u003e. \u003c/strong\u003eData are mean±standard deviation (SD). *p\u0026lt;0.05, **p\u0026lt;0.01 and ***p\u0026lt;0.001.\u003c/p\u003e","description":"","filename":"figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-5395060/v1/880546fc9f9d76d3e1a19857.png"},{"id":72905616,"identity":"b52dc5e5-524b-42b5-97dd-e3ff64efa0f8","added_by":"auto","created_at":"2025-01-03 13:47:17","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":17861307,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-5395060/v1/b7d1f77e-9a9e-45a6-98db-5f9f866d3381.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Characterization of the metabolic pathways and hepatic macrophage subsets in mouse models of MASH","fulltext":[{"header":"Introduction","content":"\u003cp\u003eMetabolic dysfunction-associated steatotic liver disease (MASLD), is rapidly becoming the most common chronic liver disease globally, affecting 38% of the world population\u003csup\u003e[\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]\u003c/sup\u003e. Metabolic dysfunction-associated steatohepatitis (MASH), a severe subtype of MAFLD, is represented by the manifestation of steatosis, lobular inflammation and hepatocyte ballooning and fibrosis\u003csup\u003e[\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]\u003c/sup\u003e. Importantly, up to 12% of the MAFLD population develop into MASH and advanced fibrosis which can lead to progression to end-stage liver disease including cirrhosis and hepatocellular carcinoma\u003csup\u003e[\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]\u003c/sup\u003e. The progression of MASH thus regards as a vital transitional step in the clinical progression of MAFLD. Therefore, investigating the mechanisms promoting its development will be crucial in formulating new therapeutic strategies in the future.\u003c/p\u003e \u003cp\u003eRecent reports have indicated that macrophages, especially recruited monocytes, play important roles in the pathogenesis of MASH\u003csup\u003e[\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]\u003c/sup\u003e. Importantly, single-cell and spatial transcriptomic technologies have revealed a distinct heterogeneity of hepatic macrophages in MASH\u003csup\u003e[\u003cspan additionalcitationids=\"CR6\" citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e–\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]\u003c/sup\u003e. Embryo-derived Kupffer cells (EmKCs) are impaired during MASH progression, and monocyte-derived macrophages (MDMs) enter the liver, where they react to niche-specific and inflammatory signals to differentiate into Monocyte-derived Kupffer cells (MoKCs) or hepatic lipid-associated macrophages(LAMs)/CCR2\u003csup\u003e+\u003c/sup\u003e lipid-associated macrophages (C-LAMs) \u003csup\u003e[\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e, \u003cspan additionalcitationids=\"CR8\" citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e–\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]\u003c/sup\u003e. C-LAMs, also known as pre-MoKCs in other studies\u003csup\u003e[\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]\u003c/sup\u003e, represent a transitional state of MDMs and are precursors for LAMs or MoKCs. LAM is considered to participate in early pro-inflammatory injury and late anti-inflammatory repair during the development of MASH .\u003csup\u003e[\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]\u003c/sup\u003e. MoKCs display a similar pattern of gene expression like EmKCs and can ultimately fully adopt the identity and capabilities of EmKCs\u003csup\u003e[\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]\u003c/sup\u003e. These subsets collaborate to enable liver functions\u003csup\u003e[\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]\u003c/sup\u003e. However, we still lack further descriptions of specific subsets of hepatic macrophages in different MASH models.\u003c/p\u003e \u003cp\u003eThis study aimed to assess the differences in lipid metabolic pathways and elaborate specific subtypes of hepatic macrophages in the most common dietary animal models of MASH, HFFC- and MCD diet-fed animals. Because after feeding HFFC diet, mice would develop steatosis (4–8 weeks), steatohepatitis (16–24 weeks), and progressive fibrosis (after 16 weeks) in sequence \u003csup\u003e[\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]\u003c/sup\u003e.The HFFC model can further recapitulates the features of human MASH than other dietary models, which demonstrates good clinical translatability compared with other dietary models \u003csup\u003e[\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]\u003c/sup\u003e. Although the use of the MCD model is limited due to its inconsistencies with the metabolic characteristics of human MASH, MCD diet is still one of the very commonly used diets because it produces the most severe phenotype of MASH in the shortest time. \u003csup\u003e[\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]\u003c/sup\u003e.Both the MCD and HFFC diets induce lipid accumulation in the liver, but the metabolic pathway of FFA synthesis is the opposite. Although the use of the MCD model is limited by its disparity with the metabolic parameters of human MASH\u003csup\u003e[\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]\u003c/sup\u003e, our findings demonstrate that the dynamic shifts in the composition of resident and recruited macrophages in the MCD model are consistent with those in the HFFC model. With HFFC/MCD diet feeding, EmKCs decrease in number, and Ly6C\u003csup\u003ehi\u003c/sup\u003e and CCR2\u003csup\u003e+\u003c/sup\u003e monocytes enter the liver to compensate for the loss of EmKCs. Furthermore, MDMs accumulate in the KC niche and consist of LAMs, C-LAMs and MoKCs. Our study revealed that the two MASH models had different compositions of the KC pool, highlighting the need to choose different MASH models when investigating different subsets of hepatic macrophages.\u003c/p\u003e "},{"header":"Results","content":"\u003cp\u003e \u003cb\u003eDifferent NASH models induce contrary changes in the FFA synthesis pathway.\u003c/b\u003e \u003c/p\u003e\u003cp\u003eTo investigate the effects of different metabolic environments on hepatic macrophage subsets and to further characterize the composition of hepatic macrophages in different MASH models, we chose the MCD diet and HFFC diet to induce MASH in C57BL/6 mice. Although the use of the MCD model is limited due to its inconsistencies with the metabolic characteristics of human MASH, MCD diet is still one of the very commonly used diets because it produces the most severe manifestation of MASH in the shortest time \u003csup\u003e[\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]\u003c/sup\u003e. The HFFC model better imitates human MASH that recapitulated the features of insulin resistance, steatosis, inflammation with hepatocellular ballooning and progressive fibrosis\u003csup\u003e[\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]\u003c/sup\u003e.\u003c/p\u003e\u003cp\u003eWe first evaluated the progression of obesity, inflammation and liver steatosis in MCD and HFFC-fed mice. Liver weight was increased in HFFC-fed mice but significantly reduced in MCD-fed mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). However, no difference was observed relative to body weight (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB). Hematoxylin and eosin (H\u0026amp;E) and oil red O staining of the liver demonstrated that both diets induced the MASH manifestations including hepatocyte ballooning, lobular inflammation and lipid droplets (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC).\u003c/p\u003e\u003cp\u003eThe differences in glucose metabolism between MCD-and HFFC-fed mice have been reported\u003csup\u003e[\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]\u003c/sup\u003e Here, we focused on genes involved in inflammation and lipid homeostasis through quantitative PCR. Compared to ND-fed mice, we found that both MCD- and HFFC-fed mice presented an upregulation of Tnf, IL-6, and Cxcl5 mRNA levels and increased expression of the macrophage marker Adgre1 and the neutrophil marker Ly6G (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD), confirming the lobular inflammation that was histologically observed. The transcriptional analyses of lipid metabolism revealed that the severe hepatic lipid accumulation in MCD- and HFFC-fed mice were related to the increase of import of lipids (Cd36) and FFA elongation (Elovl7) (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eE, F). Moreover, the upregulation of Lpl indicated the enhancement of triglyceride (TG) hydrolysis in the MCD- and HFFC-fed mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eG). Notably, the MCD and HFFC diets induced opposite changes in the FFA synthesis pathway. The HFFC diet resulted in increased expression of the FFA synthesis genes Acly, Acaca, Fasn, and Srebf1. In contrast, the mRNA levels of Acaca, Fasn, and Srebf1 were decreased in the MCD-fed mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eH).\u003c/p\u003e\u003cp\u003eTaken together, these results confirmed that both the MCD and HFFC diets induced the features of MASH, including steatosis, hepatocyte ballooning, and lobular inflammation. However, HFFC-fed mice enhanced the synthesis of FFAs while MCD-fed mice suppress the synthesis of FFAs.\u003c/p\u003e\u003cp\u003e \u003cb\u003eMDMs compensated for the loss of EmKCs in both MASH models\u003c/b\u003e \u003c/p\u003e\u003cp\u003eA recent study suggested that the metabolic environment could shape the immune response in the liver\u003csup\u003e[\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]\u003c/sup\u003e. Changes in the tissue microenvironment can lead to macrophage reprogramming, resulting in a new functional phenotype\u003csup\u003e[\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]\u003c/sup\u003e. Importantly, hepatic macrophages not only display substantial heterogeneity but also play critical roles in MASH\u003csup\u003e[\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]\u003c/sup\u003e. Therefore, we investigated whether different changes in metabolic pathways affect the composition of hepatic macrophages. F4/80 staining demonstrated that the livers of the MCD-fed HFFC-fed mice contained more macrophages than ND-fed mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). To evaluate the changes in macrophage composition in the liver, we analyzed isolated hepatic macrophages via flow cytometry. Since KCs are impaired and initiate inflammation, triggering the recruitment of MDMs during MASH\u003csup\u003e[\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]\u003c/sup\u003e, we first focused on changes in KCs. Hepatic macrophages can be identified by F4/80\u003csup\u003ehi\u003c/sup\u003e and CD11b\u003csup\u003eint\u003c/sup\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB). Compared to ND-fed mice, the number of hepatic macrophages in MCD-fed mice was lower. However, there was no significant change in the number of hepatic macrophages in HFFC-fed mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC). We suspected that this phenomenon was a consequence of the compensation of MDMs. To verify this phenomenon, we used TIM4 to distinguish EmKCs from MDMs because TIM4 is a specific marker of mature KCs\u003csup\u003e[\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]\u003c/sup\u003e, whereas TIM4 expression is delayed in MDMs\u003csup\u003e[\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]\u003c/sup\u003e. In ND-fed mice, almost all hepatic macrophages highly expressed TIM4, whereas EmKCs decreased in number in both MCD- and HFFC-fed mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD). The proportion of EmKCs among hepatic macrophages was significantly lower in HFFC-fed mice (73.74%±7.961%) and MCD-fed mice (39.93%±9.031%) than in ND-fed mice (95.14%±1.090%) (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eE). These results demonstrated the loss of EmKCs during MASH. Next, we focused on the TIM4\u003csup\u003elo\u003c/sup\u003e macrophages in this gate, which represented recruited MDMs. Our results revealed a dramatic increase in MDMs in this gate in both MASH models (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eF). The proportion of MDMs among hepatic macrophages was also greater in HFFC-fed mice (19.26%±6.940%) and MCD-fed mice (52.38%±8.376%) compared to ND-fed mice (2.46%±0.527%) (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eG). Moreover, we compared the differences between MCD- and HFFC-fed mice and found that the MCD-fed mice lost more EmKCs HFFC-fed mice and there was no difference in the number of MDMs between the two MASH models (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eH). And compared to HFFC-fed mice, EmKCs occupied a lower proportion of hepatic macrophages while MDMs occupied a higher proportion of hepatic macrophages in the MCD-fed mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eI).\u003c/p\u003e\u003cp\u003eOverall, our analysis of hepatic macrophages revealed that both the MCD and HFFC diets can lead to the loss of EmKCs and the entry of MDMs into the KC niche. MCD-fed mice lost more EmKCs than HFFC-fed mice.\u003c/p\u003e\u003cp\u003e \u003cb\u003eMCD-fed mice recruited more monocytes than HFFC-fed mice\u003c/b\u003e \u003c/p\u003e\u003cp\u003ePreviously, we demonstrated the contribution of MDMs to the KC pool; next, we focused on the composition of monocytes in the whole liver. MDMs can be identified by CD11b\u003csup\u003ehi\u003c/sup\u003e and F4/80\u003csup\u003eint\u003c/sup\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA). The number of CD11b\u003csup\u003ehi\u003c/sup\u003e F4/80\u003csup\u003eint\u003c/sup\u003e cells increased in both the MCD- and HFFC-fed mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB). Under pathological conditions, Kupffer cell self-renewal is impaired, and monocytes are recruited to the MASH liver in a CCR2-dependent manner, contributing to the KC pool\u003csup\u003e[\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]\u003c/sup\u003e. Liver monocytes can be found within CD11b\u003csup\u003ehi\u003c/sup\u003e F4/80\u003csup\u003eint\u003c/sup\u003e cells and can be identified by gating for Ly6C\u003csup\u003ehi\u003c/sup\u003e, MHCII\u003csup\u003elo\u003c/sup\u003e. Our results revealed that the number of Ly6C\u003csup\u003ehi\u003c/sup\u003e monocytes increased in these two MASH models (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC). The proportion of Ly6C\u003csup\u003ehi\u003c/sup\u003e monocytes was also greater in HFFC-fed mice (58.26%±6.154%) and MCD-fed mice (44.41%±6.688%) than in ND-fed mice (19.19%±3.643%) (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD). As CCR2 is predominantly localized to monocytes, not KCs\u003csup\u003e[\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]\u003c/sup\u003e, thus Ly6C\u003csup\u003ehi\u003c/sup\u003e and CCR2\u003csup\u003e+\u003c/sup\u003e can be used to identify classical monocytes (CMs) \u003csup\u003e[\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]\u003c/sup\u003e.We further analyzed CCR2 expression in Ly6C\u003csup\u003ehi\u003c/sup\u003e monocytes. CMs were rare in ND-fed mice liver, whereas they accumulated in MCD- and HFFC-fed mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eE) and were present in a greater proportion of Ly6C\u003csup\u003ehi\u003c/sup\u003e monocytes in MCD-fed mice (32.49%±4.420%) and HFFC-fed mice (27.86%±5.930%) than ND-fed mice (7.88%±2.411%) (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eF). In addition, the numbers of Ly6C\u003csup\u003ehi\u003c/sup\u003e monocytes and CMs in the MCD-fed mice were greater than HFFC-fed mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eG). The proportion of Ly6C\u003csup\u003ehi\u003c/sup\u003e monocytes among CD11b\u003csup\u003ehi\u003c/sup\u003e F4/80\u003csup\u003eint\u003c/sup\u003e cells were also higher in in the MCD-fed mice than HFFC-fed mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eH).\u003c/p\u003e\u003cp\u003eIn conclusion, our results revealed that the recruitment of blood-derived monocytes occurred in two MASH models. There were more recruited proinflammatory Ly6C\u003csup\u003ehi\u003c/sup\u003e monocytes and CMs within MDMs in two MASH model mice than in ND-fed mice. Moreover, compared with HFFC-fed mice, MCD-fed mice recruited more monocytes.\u003c/p\u003e\u003cp\u003e \u003cb\u003eThe composition of the KC pool differed between MCD- and HFFC-fed mice\u003c/b\u003e \u003c/p\u003e\u003cp\u003eAlthough the MCD and HFFC diets result in different metabolic alterations in the liver, both lead to the loss of EmKCs and the entry of MDMs during MASH progression. The collective reports demonstrated that KCs can be divided into 4 subsets, except for EmKCs, there are 3 subsets of recruited MDMs: MoKCs, C-LAMs, and LAMs, which cooperate to maintain liver homeostasis \u003csup\u003e[\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]\u003c/sup\u003e. Therefore, we wondered whether different metabolic states affect the composition of the KC pool. We previously analyzed the changes in EmKCs and MDMs. Next, we focused on subsets of MDMs. VSIG4 and CCR2 can be used to further subdivide MDMs because the MoKCs are VSIG4\u003csup\u003ehi\u003c/sup\u003e while LAMs have low expression of VSIG4. In addition, C-LAMs are CCR2\u003csup\u003e+\u003c/sup\u003e and VSIG4\u003csup\u003elo [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]\u003c/sup\u003e.\u003c/p\u003e\u003cp\u003eC-LAMs represent early MDMs that have increased proinflammatory and profibrotic abilities. Moreover, C-LAMs receive signals from the KC niche that drive the expression of KC markers or respond to inflammatory/lipid stimuli that induce LAM gene expression \u003csup\u003e[\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]\u003c/sup\u003e. Compared to ND-fed mice, C-LAMs were increased in both MCD- and HFFC-fed mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA, B). Moreover, there were more C-LAMs in the MCD-fed mice than in the HFFC-fed mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eG), which was consistent with the analysis of recruited MDMs. The proportion of C-LAMs increased in the MCD-fed mice (34.71%±6.314%) than in the HFFC-fed mice (11.07%±2.737%) (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eH).\u003c/p\u003e\u003cp\u003eThe recruitment of LAMs is the biggest distinction in MASH macrophages because their pattern of gene expression is different from C-LAMs, MoKCs and EmKCs.\u003csup\u003e[\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]\u003c/sup\u003e. LAMs appear to be involved in both early proinflammatory damage and late anti-inflammatory repair during MASH development\u003csup\u003e[\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]\u003c/sup\u003e. There were more LAMs in number in MCD- and HFFC-fed mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD), indicating the lipid overload environment of MASH. Although the of LAMs showed no significant difference between MCD- (26.74%±8.108%) and HFFC-fed mice (22.50%±5.499%) (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eH), the MCD-fed mice contained more LAMs than the HFFC-fed mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eG).\u003c/p\u003e\u003cp\u003eMoKCs largely resemble EmKCs, they show a similar gene expression pattern with EmKCs. \u003csup\u003e[\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]\u003c/sup\u003e and can ultimately acquire many of the hallmarks of EmKCs, such as TIM4. Compared to ND-fed mice, there was a significant increase in the number of MoKCs in the two MASH models (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eF). Interestingly, HFFC-fed mice had many more mo-KCs than MCD-fed mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eG). MoKCs also accounted for a greater proportion of MDMs in HFFC-fed mice (63.05%±5.566%) than in MCD-fed mice (21.93%±2.181%) (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eH).\u003c/p\u003e\u003cp\u003eOverall, our study revealed that the composition of the KC pool differed between MCD- and HFFC-fed mice. Among the MDMs subsets, HFFC-fed mice contain more MoKCs than MCD-fed mice, whereas MCD-fed mice have more C-LAMs and LAMs than HFFC-fed mice.\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eThe collective reports of Single-cell and spatial transcriptomic analysis demonstrated that the hepatic macrophages in MASH are of distinct heterogeneous character \u003csup\u003e[\u003cspan additionalcitationids=\"CR6\" citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e–\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]\u003c/sup\u003e. However, we still lack further descriptions of specific subsets of hepatic macrophages in different MASH models. Therefore, we investigated the composition of hepatic macrophage in different MASH animal models. We found that the MCD and HFFC diets led to different metabolic changes in FFA synthesis in the liver. Both the MCD and HFFC diets induce the same alteration in the composition of hepatic macrophages characterized by a decrease in EmKCs and a concomitant increase in MDMs. Importantly, the composition of the KC pool differed between MCD- and HFFC-fed mice. The number of MoKCs was greater in the MDMs subset in HFFC-fed mice, whereas the number of C-LAMs and LAMs was greater in MCD-fed mice than in HFFC-fed mice.\u003c/p\u003e\u003cp\u003eTo explore the composition of hepatic macrophages in MASH, we used two classical MCD and HFFC diets to induce MASH models. A previous study showed that after feeding HFFC diet, mice would develop steatosis (4–8 weeks), steatohepatitis (16–24 weeks), and progressive fibrosis (after 16 weeks) in sequence \u003csup\u003e[\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]\u003c/sup\u003e.The HFFC model can further recapitulates the features of human MASH than other dietary models, including obesity, insulin resistance, dyslipidemia and, subsequently, fatty liver and then steatohepatitis, followed by fibrosis, which demonstrates good clinical translatability compared with other dietary models \u003csup\u003e[\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]\u003c/sup\u003e. Although the use of the MCD model is limited due to its inconsistencies with the metabolic characteristics of human MASH, MCD diet is still one of the very commonly used diets because it produces the most severe phenotype of MASH in the shortest time. \u003csup\u003e[\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]\u003c/sup\u003e. Therefore, assessing the altered metabolic pathways caused by different diets provides valuable information regarding the molecular mechanisms of MASH. A recent study suggested that the MCD diet impaired the lipid export which led to the accumulation of hepatic lipid \u003csup\u003e[\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]\u003c/sup\u003e. Our results suggested that MCD-fed mice might decrease de novo lipogenesis to maintain the balance of liver lipids. In contrast, the HFFC diet induced an increase in de novo lipogenesis (Fasn, Srebf1, Acly, Acaca) to address the continuous alimentary supply. In summary, the MCD and HFFC diets induce different metabolic changes in FFA synthesis.\u003c/p\u003e\u003cp\u003eSingle-cell and spatial genomics demonstrated that the liver harbors multiple populations of macrophages in MASH\u003csup\u003e[\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e, \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]\u003c/sup\u003e. A recent study also suggested that the metabolic environment could shape the immune response in the liver\u003csup\u003e[\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]\u003c/sup\u003e. However, we still lack further descriptions of specific subsets of hepatic macrophages in different MASH models. In our study, although the MCD and HFFC diets induced different metabolic changes, they both led to the loss of EmKCs and the entry of MdMs. MCD-fed mice lost more EmKCs than HFFC-fed mice. Correspondingly, more MDMs accumulated in the MCD-fed mice than in the HFFC-fed mice, indicating that the MCD-fed mice were in a more severe state of MASH. Importantly, we observed that the composition of the KC pool differed between MCD-fed mice and HFFC-fed mice. In addition, KCs can be divided into 4 subsets, except for EmKCs, there are 3 subsets of recruited MDMs: MoKCs, C-LAMs, and LAMs, which cooperate to Maintain liver homeostasis \u003csup\u003e[\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]\u003c/sup\u003e.\u003c/p\u003e\u003cp\u003eC-LAMs, also known as in other studies\u003csup\u003e[\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]\u003c/sup\u003e, presented an intermediate phenotype between MoKCs and LAMs. They represent MDMs that have more recently entered the KC niche. Therefore, consistent with our analysis of MDMs, we found that MCD-fed mice contained more C-LAMs than HFFC-fed mice. Unlike the transition state of C-LAMs, in terms of the transcriptome, localization, and function of hepatic LAMs and MoKCs, they represent distinct fates for monocytes recruited to the liver in MASH \u003csup\u003e[\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]\u003c/sup\u003e.\u003c/p\u003e\u003cp\u003eLAMs appear to be involved in both early pro-inflammatory damage and late anti-inflammatory repair during MASH development\u003csup\u003e[\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]\u003c/sup\u003e. TREM2 and SPP1 are specific markers of hepatic LAMs, and the expression of TREM2 and SPP1 is positively correlated with the severity of MASH. However, myeloid-specific knockout of TREM2 or SPP1 accelerates progression to MASH\u003csup\u003e[\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e, \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]\u003c/sup\u003e. We still lack studies that are performed with LAM-specific tools. Our research demonstrated that there were more LAMs in MCD-fed mice than in HFFC-fed mice, suggesting that the MCD diet induced more severe MASH. In addition, MCD-fed mice may be more suitable MASH models for investigating the function of LAMs because we can obtain more LAMs in a shorter time.\u003c/p\u003e\u003cp\u003eCompared to EmKCs, MoKCs are less efficient in fat storage, but they show a similar gene expression pattern of lipid metabolism \u003csup\u003e[\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]\u003c/sup\u003e. Nevertheless, MoKCs contain more lipids than LAMs/C-LAMs, and the depletion of MoKCs leads to decreased hepatic TG storage\u003csup\u003e[\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]\u003c/sup\u003e. In a chronic disease as MASH, persisting MoKCs may eventually fully adopt the identity and lipid storage capabilities of EmKCs\u003csup\u003e[\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]\u003c/sup\u003e. In our study, the number of MoKCs was greater in HFFC-fed mice than in MCD-fed mice, and MoKCs were the predominant subset of MDMs in HFFC-fed mice. The metabolic environment of HFFC-fed mice may promote the differentiation of MDMs to MoKCs more effectively. HFFC-fed mice may be a preferable MASH model for studying MoKCs.\u003c/p\u003e\u003cp\u003eIn conclusion, our research demonstrated that the HFFC diet and MCD diet induced different metabolic states and provided a fuller description of hepatic macrophage composition in different MASH models. Our research highlights the need to choose different MASH models when investigating different subsets of hepatic macrophages.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cp\u003e\u003cstrong\u003eAnimals\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe Ethics Committee of the Air Force Medical\u0026nbsp;University approved the animal experiments (IACOC-20200757). The 8\u0026ndash;10 weeks old Male mice were raised under a 12-h light/dark cycle with food and water available ad libitum. Two MASH models were employed\u0026nbsp;for the experiments, we used the\u0026nbsp;methionine-choline-deficient (MCD) (Dyets, Bethlehem, PA, high sucrose (40%) and 10% fat, but deficient in methionine and choline) diet to feed mice for 4 weeks or the high-fat-fructose-cholesterol (HFFC) (Research Diets, D09100310, 40% fat, 20% fructose\u0026nbsp;and 2%\u0026nbsp;cholesterol) diet to feed mice for 16 weeks.\u0026nbsp;The control\u0026nbsp;mice fed the normal diet.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMethods details\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eH\u0026amp;E and oil red O staining\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eH\u0026amp;E staining of mouse liver sections was performed after they were dehydrated, embedded in paraffin, and cut into 4\u0026ndash;5 m thick sections. Concerning oil red O staining, a fresh working solution of oil red O was prepared and applied to frozen sections of liver tissue after fixation with 4% paraformaldehyde for 15 min. Finally, Case Viewer was used to scan the slides.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eImmunohistochemistry\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAfter dewaxing with dimethylbenzene (I and II), mouse liver samples were dehydrated on paraffin-embedded slides using a gradient of alcohol concentrations (100%, 95%, 85% and 75%). Then antigen retrieval was conducted using a high-temperature and high-pressure antigen-repairing method. Next, we used normal goat serum to block the tissues for 30 min and incubated them with primary antibody overnight at 4 \u0026deg;C. Furthermore, we washed slides and incubated them with horseradish peroxidase-conjugated secondary antibody at room temperature for 1 h. We used 3,3\u0026apos;-diaminobenzidine tetrahydrochloride substrate (ZSGB-BIO, Beijing, China) to identify the bound antibodies, and we counterstained the sections with haematoxylin, dehydrated and mounted them.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMacrophage isolation\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo isolate hepatic macrophages, we initially employed liver perfusion to clear red cells and use collagenase A to digest liver tissues. Next, hepatocytes were removed from murine liver nonparenchymal cells by centrifuging at 50 g. In addition, hepatic macrophages were isolated from the nonparenchymal cell population by differential centrifugation using 25% Percoll and 50% Percoll gradient at 1800 g for 15 min. Cells were washed with DMEM (Gibco). The resuspended cells were plated in DMEM, 10% FBS (Gibco) and 1% penicillin/streptomycin. The non-adherent cells were removed after 1 h and washed with phosphate-buffered saline.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eIn flowcytometry studies, the nonparenchymal cells blocked by CD16/32 antibody (Biolegend) were incubated with the following primary antibodies from Biolegend [CD45-AF750 (#109824), Zoombie-BV510 (#423101), F4/80-PE (#123110) ,Ly6C-Percp-Cy5.5(#128012),MHCII-APC(#107614),Ly6G-PE-Cy7(#127618),TIM4-PE-Cy7(#130010),MHCII-Percp-Cy5.5(#107626),CCR2-BV421(#150605)\u0026nbsp;and CD11b-FITC (#101206)]. The VSIG4-APC (#2731759) is from eBioscience. Hepatic macrophages cells are identified as F4/80\u003csup\u003ehi\u003c/sup\u003e, CD11b\u003csup\u003eint\u003c/sup\u003e, the hepatic macrophages are composed of embryonic Kupffer cells (EmKCs), which can be identified by high expression of TIM4 and recruited monocyte-derived macrophages (MDMs) which are almost exclusively TIM4\u003csup\u003elo\u003c/sup\u003e. MDMs are further subdivided into the monocyte-derived Kupffer cells (MoKCs) which are TIM4\u003csup\u003elo\u003c/sup\u003e, VSIG4\u003csup\u003ehi\u003c/sup\u003e, and lipid-associated macrophages (LAMs), which are TIM4\u003csup\u003elo\u003c/sup\u003e, VSIG4\u003csup\u003elo\u003c/sup\u003e. The C-LAMS are defined by Ccr2\u003csup\u003e+\u003c/sup\u003e LAMS. Liver Ly6C\u003csup\u003ehi\u003c/sup\u003e monocytes can be found within the CD11b\u003csup\u003ehi\u003c/sup\u003e, F4/80\u003csup\u003eint\u003c/sup\u003e population and are identified by gating for Ly6C\u003csup\u003ehi\u003c/sup\u003e, MHCII\u003csup\u003elo\u003c/sup\u003e. The classical monocytes(CMs)are identified as Ly6C\u003csup\u003ehi\u003c/sup\u003e, CCR2\u003csup\u003e+\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003eThe analysis was performed using a BD FACSCantoTM II Flow Cytometer.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eQuantitative reverse transcription polymerase chain reaction (RT-qPCR)\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eRNA from the samples was isolated using Trizol (Invitrogen). Using a high-capacity cDNA reverse transcription kit (Takara), we performed RT-qPCR on 1 \u0026mu;g of RNA in a Bio-Rad CFX96TM system (The primers in Supplementary Table 1 were synthesized from Qingke company). We employed \u0026beta;-actin mRNA as an internal control to standardize mRNA expression.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ePrimary antibodies\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ePrimer sequence used in this study\u003c/strong\u003e\u003c/p\u003e\n\u003ctable border=\"0\" cellspacing=\"0\" cellpadding=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eGene\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003ePrimer\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;Acaca(mus)- Forward Primer\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eATGGGCGGAATGGTCTCTTTC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;Acaca(mus)- Reverse Primer\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eTGGGGACCTTGTCTTCATCAT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u0026beta;-actin(mus)- Forward Primer\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eCGGTTCCGATGCCCTGAGGCTCTT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u0026beta;-actin(mus)- Reverse Primer\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eCGTCACACTTCATGATGGAATTGA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eAcly(mus)- Forward Primer\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eGTGGGGTGATATAGAGTTCCCT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eAcly(mus)- Reverse Primer\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eGCTTGCTCCACTTTTGGCATC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;Acox1(mus)- Forward Primer\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eTAACTTCCTCACTCGAAGCCA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;Acox1(mus)- Reverse Primer\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eAGTTCCATGACCCATCTCTGTC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eAdgre1(mus)- Forward Primer\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eCTCAGTCTGCACCAATATCCTG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eAdgre1(mus)- Reverse Primer\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eCCACAGAGTTAGAGCAGTTGGAA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;Cd36(mus)-Forward Primer\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eAGATGACGTGGCAAAGAACAG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;Cd36(mus)- Reverse Primer\u003c/p\u003e\n \u003cp\u003eCpt1a(mus) -Forward Primer\u003c/p\u003e\n \u003cp\u003eCpt1a(mus)- Reverse Primer\u003c/p\u003e\n \u003cp\u003eCxcl5(mus) -Forward Primer\u003c/p\u003e\n \u003cp\u003eCxcl5(mus)- Reverse Primer\u003c/p\u003e\n \u003cp\u003eCxcl10(mus) -Forward Primer\u003c/p\u003e\n \u003cp\u003eCxcl10(mus)- Reverse Primer\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eCCTTGGCTAGATAACGAACTCTG\u003c/p\u003e\n \u003cp\u003eCTATGCGCTACTCGCTGAAGG\u003c/p\u003e\n \u003cp\u003eGGCTTTCGACCCGAGAAGA\u003c/p\u003e\n \u003cp\u003eTGCCCTACGGTGGAAGTCATA\u003c/p\u003e\n \u003cp\u003eTGCATTCCGCTTAGCTTTCTTT\u003c/p\u003e\n \u003cp\u003eCCAAGTGCTGCCGTCATTTTC\u003c/p\u003e\n \u003cp\u003eGGCTCGCAGGGATGATTTCAA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eDgat2(mus) -Forward Primer\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eGCGCTACTTCCGAGACTACTT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eDgat2(mus) - Reverse Primer\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eGGGCCTTATGCCAGGAAACT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eElovl1(mus) -Forward Primer\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eTTGGCTGAGTACCTACACCTG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eElovl1 (mus) - Reverse Primer\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eCTCGAACCATCCGAAGTGCTT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eElovl5 (mus) -Forward Primer\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eATGGAACATTTCGATGCGTCA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eElovl5 (mus) - Reverse Primer\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eGTCCCAGCCATACAATGAGTAAG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eElovl7 (mus) -Forward Primer\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eCATCGAGGACTGTGCGTTTTT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eElovl7(mus) - Reverse Prime\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eGCCCAGGATGATGGTTTGTG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eFasn(mus) -Forward Primer\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eAGGTGGTGATAGCCGGTATGT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eFasn(mus) - Reverse Primer\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eTGGGTAATCCATAGAGCCCAG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eIl-1\u0026beta;(mus) -Forward Primer\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eTTCAGGCAGGCAGTATCACTC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eIl-1\u0026beta;(mus) - Reverse Primer\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eGAAGGTCCACGGGAAAGACAC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eIl-6(mus) -Forward Primer\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eTAGTCCTTCCTACCCCAATTTCC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eIl-6(mus) - Reverse Primer\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eTTGGTCCTTAGCCACTCCTTC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eLipe(mus) -Forward Primer\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eGATTTACGCACGATGACACAGT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eLipe(mus) - Reverse Primer\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eACCTGCAAAGACATTAGACAGC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eLpl(mus) -Forward Primer\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eGGGAGTTTGGCTCCAGAGTTT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eLpl (mus) - Reverse Primer\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eTGTGTCTTCAGGGGTCCTTAG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eSrebf1 (mus) - Reverse Primer\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eTGACCCGGCTATTCCGTGA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eSrebf1 (mus) -Forward Primer\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eCTGGGCTGAGCAATACAGTTC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003cstrong\u003eStatistical analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eStatistical analysis was performed via GraphPad Prism 7 software. All the data are reported as the means\u0026plusmn;SE. Comparisons of the data between different groups were conducted via Student\u0026rsquo;s t test or one-way analysis of variance. A P value \u0026lt;0.05 was considered as statistically significant.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cp\u003eAcaca, Acetyl-CoA Carboxylase Alpha; Acly, ATP-citrate lyase; Acox1, Acyl-CoA Oxidase 1;\u003c/p\u003e\n\u003cp\u003eCxcl5/10, C-X-C motif chemokine ligand5/7; Cpt1a, Carnitine Palmitoyl transferase 1A;\u003c/p\u003e\n\u003cp\u003eDgat2, Diacylglycerol O-Acyltransferase 2; Elovl1/5/7, elongation of long chain fatty acids1/5/7;\u003c/p\u003e\n\u003cp\u003eFasn, Fatty Acid Synthase; Il-1b/6, interleukin -1\u0026beta;/6; Lipe, Lipase E; Lpl, Lipoprotein Lipase.\u003c/p\u003e\n\u003cp\u003eSrebf1, Sterol Regulatory Element Binding Transcription Factor 1; Tnf, Tumor Necrosis Factor.\u003c/p\u003e\n\u003cp\u003eLAM, lipid-associated macrophage; HFFC, high-fat-fructose-cholesterol; MCD, methionine\u0026ndash;choline deficient; EmKC, embryonic\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003eKupffer cell; MDM, monocyte-derived macrophage; LAM, lipid-associated macrophage; MoKC, monocyte-derived Kupffer cell; Metabolic dysfunction-associated steatotic liver disease, MASLD; Metabolic dysfunction-associated steatohepatitis, MASH; RT-qPCR, real time quantitative PCR.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAuthors' contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eJingbo Wang\u0026nbsp;and\u0026nbsp;Ying Han designed the research and edited the manuscript. Erzhuo Xia, Miao Zhang,\u0026nbsp;and\u0026nbsp;Chongxiao Li performed the experiments and wrote the manuscript. Bo Li, Shuoyi Ma, Yinan Hu, Siyuan Tian, Xia Zhou, Gang Ma, Xiaohong Zheng,\u0026nbsp;and\u0026nbsp;Rui Su analyzed the data.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors have declared that no competing interest exists\u003cins cite=\"mailto:Editor%202\" datetime=\"2024-09-11T10:41\"\u003e.\u003c/ins\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe study was funded by National Key Research and Development Program of China, (No.2023ZD0508501),\u0026nbsp;the\u0026nbsp;National Natural Science Foundation of China (No. 82300672).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003enot applicable\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003enot applicable\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent to Publish\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003enot applicable\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eSUPPORTING INFORMATION\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAdditional supporting information may be found online in the Supporting Information section.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eYOUNOSSI Z M, GOLABI P, PAIK J M, et al. The global epidemiology of nonalcoholic fatty liver disease (NAFLD) and nonalcoholic steatohepatitis (NASH): a systematic review [J]. Hepatology, 2023, 77(4): 1335-47.\u003c/li\u003e\n\u003cli\u003eLOOMBA R, FRIEDMAN S L, SHULMAN G I. Mechanisms and disease consequences of nonalcoholic fatty liver disease [J]. Cell, 2021, 184(10): 2537-64.\u003c/li\u003e\n\u003cli\u003eANSTEE Q M, REEVES H L, KOTSILITI E, et al. From NASH to HCC: current concepts and future challenges [J]. Nat Rev Gastroenterol Hepatol, 2019, 16(7): 411-28.\u003c/li\u003e\n\u003cli\u003eZIGMOND E, VAROL C. Two Roads Diverge in the Sick Liver, Monocytes Travel Both [J]. Immunity, 2020, 53(3): 479-81.\u003c/li\u003e\n\u003cli\u003eREMMERIE A, MARTENS L, THON\u0026eacute; T, et al. Osteopontin Expression Identifies a Subset of Recruited Macrophages Distinct from Kupffer Cells in the Fatty Liver [J]. Immunity, 2020, 53(3): 641-+.\u003c/li\u003e\n\u003cli\u003eGUILLIAMS M, BONNARDEL J, HAEST B, et al. Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches [J]. Cell, 2022, 185(2): 379-+.\u003c/li\u003e\n\u003cli\u003eTRAN S, BABA I, POUPEL L, et al. Impaired Kupffer Cell Self-Renewal Alters the Liver Response to Lipid Overload during Non-alcoholic Steatohepatitis [J]. Immunity, 2020, 53(3): 627-+.\u003c/li\u003e\n\u003cli\u003eBEATTIE L, SAWTELL A, MANN J, et al. Bone marrow-derived and resident liver macrophages display unique transcriptomic signatures but similar biological functions [J]. J Hepatol, 2016, 65(4): 758-68.\u003c/li\u003e\n\u003cli\u003eVAN DE LAAR L, SAELENS W, DE PRIJCK S, et al. Yolk Sac Macrophages, Fetal Liver, and Adult Monocytes Can Colonize an Empty Niche and Develop into Functional Tissue-Resident Macrophages [J]. Immunity, 2016, 44(4): 755-68.\u003c/li\u003e\n\u003cli\u003eXU R, VUJIC N, BIANCO V, et al. Lipid-associated macrophages between aggravation and alleviation of metabolic diseases [J]. Trends in endocrinology and metabolism: TEM, 2024.\u003c/li\u003e\n\u003cli\u003eGUILLIAMS M, SCOTT C L. Liver macrophages in health and disease [J]. Immunity, 2022, 55(9): 1515-29.\u003c/li\u003e\n\u003cli\u003eASGHARPOUR A, CAZANAVE S C, PACANA T, et al. A diet-induced animal model of non-alcoholic fatty liver disease and hepatocellular cancer [J]. J Hepatol, 2016, 65(3): 579-88.\u003c/li\u003e\n\u003cli\u003eHANSEN H H, \u0026AElig;GIDIUS H M, OR\u0026oacute; D, et al. Human translatability of the GAN diet-induced obese mouse model of non-alcoholic steatohepatitis [J]. BMC Gastroenterol, 2020, 20(1): 12.\u003c/li\u003e\n\u003cli\u003eSANTHEKADUR P K, KUMAR D P, SANYAL A J. Preclinical models of non-alcoholic fatty liver disease [J]. J Hepatol, 2018, 68(2): 230-7.\u003c/li\u003e\n\u003cli\u003ePIERCE A A, PICKENS M K, SIAO K, et al. Differential hepatotoxicity of dietary and DNL-derived palmitate in the methionine-choline-deficient model of steatohepatitis [J]. BMC Gastroenterol, 2015, 15: 9.\u003c/li\u003e\n\u003cli\u003eLI X, RAMADORI P, PFISTER D, et al. The immunological and metabolic landscape in primary and metastatic liver cancer [J]. Nat Rev Cancer, 2021, 21(9): 541-57.\u003c/li\u003e\n\u003cli\u003eLAVIN Y, WINTER D, BLECHER-GONEN R, et al. Tissue-Resident Macrophage Enhancer Landscapes Are Shaped by the Local Microenvironment [J]. Cell, 2014, 159(6): 1312-26.\u003c/li\u003e\n\u003cli\u003eKRENKEL O, HUNDERTMARK J, ABDALLAH A T, et al. Myeloid cells in liver and bone marrow acquire a functionally distinct inflammatory phenotype during obesity-related steatohepatitis [J]. Gut, 2020, 69(3): 551-63.\u003c/li\u003e\n\u003cli\u003eKAZANKOV K, JORGENSEN S M D, THOMSEN K L, et al. The role of macrophages in nonalcoholic fatty liver disease and nonalcoholic steatohepatitis [J]. Nat Rev Gastroenterol Hepatol, 2019, 16(3): 145-59.\u003c/li\u003e\n\u003cli\u003eSAKAI M, TROUTMAN T D, SEIDMAN J S, et al. Liver-Derived Signals Sequentially Reprogram Myeloid Enhancers to Initiate and Maintain Kupffer Cell Identity [J]. Immunity, 2019, 51(4): 655-+.\u003c/li\u003e\n\u003cli\u003eBONNARDEL J, T\u0026apos;JONCK W, GAUBLOMME D, et al. Stellate Cells, Hepatocytes, and Endothelial Cells Imprint the Kupffer Cell Identity on Monocytes Colonizing the Liver Macrophage Niche [J]. Immunity, 2019, 51(4): 638-54.\u003c/li\u003e\n\u003cli\u003eKRENKEL O, PUENGEL T, GOVAERE O, et al. Therapeutic inhibition of inflammatory monocyte recruitment reduces steatohepatitis and liver fibrosis [J]. Hepatology, 2018, 67(4): 1270-83.\u003c/li\u003e\n\u003cli\u003eDAEMEN S, CHAN M M, SCHILLING J D. Comprehensive analysis of liver macrophage composition by flow cytometry and immunofluorescence in murine NASH [J]. STAR protocols, 2021, 2(2): 100511.\u003c/li\u003e\n\u003cli\u003eMONTANDON S A, SOMM E, LOIZIDES-MANGOLD U, et al. Multi-technique comparison of atherogenic and MCD NASH models highlights changes in sphingolipid metabolism [J]. Sci Rep, 2019, 9: 14.\u003c/li\u003e\n\u003cli\u003eDAEMEN S, GAINULLINA A, KALUGOTLA G, et al. Dynamic Shifts in the Composition of Resident and Recruited Macrophages Influence Tissue Remodeling in NASH (vol 34, 108626, 2021) [J]. Cell Reports, 2022, 41(7): 1.\u003c/li\u003e\n\u003cli\u003eHAN H, GE X D, KOMAKULA S S B, et al. Macrophage-derived Osteopontin\u0026lt;i\u0026gt; (SPP1)\u0026lt;/i\u0026gt; Protects From Nonalcoholic Steatohepatitis [J]. Gastroenterology, 2023, 165(1): 201-17.\u003c/li\u003e\n\u003cli\u003eWANG X C, HE Q F, ZHOU C L, et al. Prolonged hypernutrition impairs TREM2-dependent efferocytosis to license chronic liver inflammation and NASH development [J]. Immunity, 2023, 56(1): 58-+.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"macrophage, MASH models, metabolic pathway, C-LAMs, MoKCs, LAMs","lastPublishedDoi":"10.21203/rs.3.rs-5395060/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-5395060/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBackground\u003c/h2\u003e \u003cp\u003eMetabolic dysfunction-associated steatohepatitis (MASH), a more severe subtype of Metabolic dysfunction-associated steatotic liver disease (MASLD), can lead to cirrhosis and hepatocellular carcinoma. Monocyte-derived macrophages (MDMs) play a central role in NASH. Single-cell and spatial transcriptomic technologies have revealed that MDMs react to niche-specific and inflammatory signals to differentiate into Monocyte-derived Kupffer cells (MoKCs) or hepatic lipid-associated macrophages (LAMs)/CCR2\u003csup\u003e+\u003c/sup\u003e lipid-associated macrophages (C-LAMs). However, we still lack further descriptions of specific subsets of hepatic macrophages in different MASH models.\u003c/p\u003e\u003ch2\u003eMethods\u003c/h2\u003e \u003cp\u003eTwo MASH models were established by either giving a methionine-choline-deficient (MCD) diet for 4 weeks or a high-fat‒fructose‒cholesterol (HFFC) diet for 16 weeks. Liver tissues were collected for pathological analyses with hematoxylin and eosin, Oil Red O and F4/80 staining. The expression of lipid metabolism enzymes and inflammatory cytokines were detected using quantitative reverse transcription-polymerase chain reaction (RT‒qPCR). Flow cytometry was utilized to analyze the composition of isolated hepatic macrophages.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e \u003cp\u003eOur study revealed that after a HFFC diet or MCD diet feeding, two MASH models presented opposite changes in the FFA synthesis pathway. The MCD and HFFC diets induce the same alternation in the composition of hepatic macrophages characterized by a decrease in Embryo-derived Kupffer cells (EmKCs) and a concomitant increase in MDMs. However, the composition of the KC pool differed between MCD- and HFFC-fed mice. The MCD diet induced a greater loss of EmKCs, accompanied by more recruited monocytes. HFFC-fed mice contain more MoKCs than MCD-fed mice, whereas MCD-fed mice have more C-LAMs and LAMs than HFFC-fed mice.\u003c/p\u003e\u003ch2\u003eConclusions\u003c/h2\u003e \u003cp\u003eMCD- and HFFC-fed mice have a different composition of KC pool\u003c/p\u003e","manuscriptTitle":"Characterization of the metabolic pathways and hepatic macrophage subsets in mouse models of MASH","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-11-23 06:40:44","doi":"10.21203/rs.3.rs-5395060/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"c497a4d7-d216-4a9c-8ea8-9214cec7e105","owner":[],"postedDate":"November 23rd, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2025-01-03T13:39:00+00:00","versionOfRecord":[],"versionCreatedAt":"2024-11-23 06:40:44","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-5395060","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-5395060","identity":"rs-5395060","version":["v1"]},"buildId":"CiT4i_kKBbxQbnFL0ufpk","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2024) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00
unpaywall
last seen: 2026-05-23T02:00:01.238055+00:00
License: CC-BY-4.0