Skin swabbing protocol to collect DNA samples... | F1000Research "use strict";function _typeof(t){return(_typeof="function"==typeof Symbol&&"symbol"==typeof Symbol.iterator?function(t){return typeof t}:function(t){return t&&"function"==typeof Symbol&&t.constructor===Symbol&&t!==Symbol.prototype?"symbol":typeof t})(t)}!function(){var t=function(){var t,e,o=[],n=window,r=n;for(;r;){try{if(r.frames.__tcfapiLocator){t=r;break}}catch(t){}if(r===n.top)break;r=r.parent}t||(!function t(){var e=n.document,o=!!n.frames.__tcfapiLocator;if(!o)if(e.body){var r=e.createElement("iframe");r.style.cssText="display:none",r.name="__tcfapiLocator",e.body.appendChild(r)}else setTimeout(t,5);return!o}(),n.__tcfapi=function(){for(var t=arguments.length,n=new Array(t),r=0;r 3&&2===parseInt(n[1],10)&&"boolean"==typeof n[3]&&(e=n[3],"function"==typeof n[2]&&n[2]("set",!0)):"ping"===n[0]?"function"==typeof n[2]&&n[2]({gdprApplies:e,cmpLoaded:!1,cmpStatus:"stub"}):o.push(n)},n.addEventListener("message",(function(t){var e="string"==typeof t.data,o={};if(e)try{o=JSON.parse(t.data)}catch(t){}else o=t.data;var n="object"===_typeof(o)&&null!==o?o.__tcfapiCall:null;n&&window.__tcfapi(n.command,n.version,(function(o,r){var a={__tcfapiReturn:{returnValue:o,success:r,callId:n.callId}};t&&t.source&&t.source.postMessage&&t.source.postMessage(e?JSON.stringify(a):a,"*")}),n.parameter)}),!1))};"undefined"!=typeof module?module.exports=t:t()}(); dataLayer = dataLayer || []; // Standard GTM initialization - Google Consent Mode handles consent automatically (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start': new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0], j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src= 'https://www.googletagmanager.com/gtm.js?id='+i+dl+ '>m_auth=hzk0Vc3qFsQYhCrIoHz68A>m_preview=env-1>m_cookies_win=x';f.parentNode.insertBefore(j,f); })(window,document,'script','dataLayer','GTM-MWFK8L5J'); ;window.NREUM||(NREUM={});NREUM.init={distributed_tracing:{enabled:true},privacy:{cookies_enabled:true},ajax:{deny_list:["bam.nr-data.net"]}}; ;NREUM.loader_config={accountID:"438030",trustKey:"438030",agentID:"772317073",licenseKey:"97f8f67f26",applicationID:"772317073"} ;NREUM.info={beacon:"bam.nr-data.net",errorBeacon:"bam.nr-data.net",licenseKey:"97f8f67f26",applicationID:"772317073",sa:1} ;/*! For license information please see nr-loader-spa-1.236.0.min.js.LICENSE.txt */ (()=>{"use strict";var e,t,r={5763:(e,t,r)=>{r.d(t,{P_:()=>l,Mt:()=>g,C5:()=>s,DL:()=>v,OP:()=>T,lF:()=>D,Yu:()=>y,Dg:()=>h,CX:()=>c,GE:()=>b,sU:()=>_});var n=r(8632),i=r(9567);const o={beacon:n.ce.beacon,errorBeacon:n.ce.errorBeacon,licenseKey:void 0,applicationID:void 0,sa:void 0,queueTime:void 0,applicationTime:void 0,ttGuid:void 0,user:void 0,account:void 0,product:void 0,extra:void 0,jsAttributes:{},userAttributes:void 0,atts:void 0,transactionName:void 0,tNamePlain:void 0},a={};function s(e){if(!e)throw new Error("All info objects require an agent identifier!");if(!a[e])throw new Error("Info for ".concat(e," was never set"));return a[e]}function c(e,t){if(!e)throw new Error("All info objects require an agent identifier!");a[e]=(0,i.D)(t,o),(0,n.Qy)(e,a[e],"info")}var u=r(7056);const d=()=>{const e={blockSelector:"[data-nr-block]",maskInputOptions:{password:!0}};return{allow_bfcache:!0,privacy:{cookies_enabled:!0},ajax:{deny_list:void 0,enabled:!0,harvestTimeSeconds:10},distributed_tracing:{enabled:void 0,exclude_newrelic_header:void 0,cors_use_newrelic_header:void 0,cors_use_tracecontext_headers:void 0,allowed_origins:void 0},session:{domain:void 0,expiresMs:u.oD,inactiveMs:u.Hb},ssl:void 0,obfuscate:void 0,jserrors:{enabled:!0,harvestTimeSeconds:10},metrics:{enabled:!0},page_action:{enabled:!0,harvestTimeSeconds:30},page_view_event:{enabled:!0},page_view_timing:{enabled:!0,harvestTimeSeconds:30,long_task:!1},session_trace:{enabled:!0,harvestTimeSeconds:10},harvest:{tooManyRequestsDelay:60},session_replay:{enabled:!1,harvestTimeSeconds:60,sampleRate:.1,errorSampleRate:.1,maskTextSelector:"*",maskAllInputs:!0,get blockClass(){return"nr-block"},get ignoreClass(){return"nr-ignore"},get maskTextClass(){return"nr-mask"},get blockSelector(){return e.blockSelector},set blockSelector(t){e.blockSelector+=",".concat(t)},get maskInputOptions(){return e.maskInputOptions},set maskInputOptions(t){e.maskInputOptions={...t,password:!0}}},spa:{enabled:!0,harvestTimeSeconds:10}}},f={};function l(e){if(!e)throw new Error("All configuration objects require an agent identifier!");if(!f[e])throw new Error("Configuration for ".concat(e," was never set"));return f[e]}function h(e,t){if(!e)throw new Error("All configuration objects require an agent identifier!");f[e]=(0,i.D)(t,d()),(0,n.Qy)(e,f[e],"config")}function g(e,t){if(!e)throw new Error("All configuration objects require an agent identifier!");var r=l(e);if(r){for(var n=t.split("."),i=0;i {r.d(t,{D:()=>i});var n=r(50);function i(e,t){try{if(!e||"object"!=typeof e)return(0,n.Z)("Setting a Configurable requires an object as input");if(!t||"object"!=typeof t)return(0,n.Z)("Setting a Configurable requires a model to set its initial properties");const r=Object.create(Object.getPrototypeOf(t),Object.getOwnPropertyDescriptors(t)),o=0===Object.keys(r).length?e:r;for(let a in o)if(void 0!==e[a])try{"object"==typeof e[a]&&"object"==typeof t[a]?r[a]=i(e[a],t[a]):r[a]=e[a]}catch(e){(0,n.Z)("An error occurred while setting a property of a Configurable",e)}return r}catch(e){(0,n.Z)("An error occured while setting a Configurable",e)}}},6818:(e,t,r)=>{r.d(t,{Re:()=>i,gF:()=>o,q4:()=>n});const n="1.236.0",i="PROD",o="CDN"},385:(e,t,r)=>{r.d(t,{FN:()=>a,IF:()=>u,Nk:()=>f,Tt:()=>s,_A:()=>o,il:()=>n,pL:()=>c,v6:()=>i,w1:()=>d});const n="undefined"!=typeof window&&!!window.document,i="undefined"!=typeof WorkerGlobalScope&&("undefined"!=typeof self&&self instanceof WorkerGlobalScope&&self.navigator instanceof WorkerNavigator||"undefined"!=typeof globalThis&&globalThis instanceof WorkerGlobalScope&&globalThis.navigator instanceof WorkerNavigator),o=n?window:"undefined"!=typeof WorkerGlobalScope&&("undefined"!=typeof self&&self instanceof WorkerGlobalScope&&self||"undefined"!=typeof globalThis&&globalThis instanceof WorkerGlobalScope&&globalThis),a=""+o?.location,s=/iPad|iPhone|iPod/.test(navigator.userAgent),c=s&&"undefined"==typeof SharedWorker,u=(()=>{const e=navigator.userAgent.match(/Firefox[/\s](\d+\.\d+)/);return Array.isArray(e)&&e.length>=2?+e[1]:0})(),d=Boolean(n&&window.document.documentMode),f=!!navigator.sendBeacon},1117:(e,t,r)=>{r.d(t,{w:()=>o});var n=r(50);const i={agentIdentifier:"",ee:void 0};class o{constructor(e){try{if("object"!=typeof e)return(0,n.Z)("shared context requires an object as input");this.sharedContext={},Object.assign(this.sharedContext,i),Object.entries(e).forEach((e=>{let[t,r]=e;Object.keys(i).includes(t)&&(this.sharedContext[t]=r)}))}catch(e){(0,n.Z)("An error occured while setting SharedContext",e)}}}},8e3:(e,t,r)=>{r.d(t,{L:()=>d,R:()=>c});var n=r(2177),i=r(1284),o=r(4322),a=r(3325);const s={};function c(e,t){const r={staged:!1,priority:a.p[t]||0};u(e),s[e].get(t)||s[e].set(t,r)}function u(e){e&&(s[e]||(s[e]=new Map))}function d(){let e=arguments.length>0&&void 0!==arguments[0]?arguments[0]:"",t=arguments.length>1&&void 0!==arguments[1]?arguments[1]:"feature";if(u(e),!e||!s[e].get(t))return a(t);s[e].get(t).staged=!0;const r=[...s[e]];function a(t){const r=e?n.ee.get(e):n.ee,a=o.X.handlers;if(r.backlog&&a){var s=r.backlog[t],c=a[t];if(c){for(var u=0;s&&u {let[t,r]=e;return r.staged}))&&(r.sort(((e,t)=>e[1].priority-t[1].priority)),r.forEach((e=>{let[t]=e;a(t)})))}function f(e,t){var r=e[1];(0,i.D)(t[r],(function(t,r){var n=e[0];if(r[0]===n){var i=r[1],o=e[3],a=e[2];i.apply(o,a)}}))}},2177:(e,t,r)=>{r.d(t,{c:()=>f,ee:()=>u});var n=r(8632),i=r(2210),o=r(1284),a=r(5763),s="nr@context";let c=(0,n.fP)();var u;function d(){}function f(e){return(0,i.X)(e,s,l)}function l(){return new d}function h(){u.aborted=!0,u.backlog={}}c.ee?u=c.ee:(u=function e(t,r){var n={},c={},f={},g=!1;try{g=16===r.length&&(0,a.OP)(r).isolatedBacklog}catch(e){}var p={on:b,addEventListener:b,removeEventListener:y,emit:v,get:x,listeners:w,context:m,buffer:A,abort:h,aborted:!1,isBuffering:E,debugId:r,backlog:g?{}:t&&"object"==typeof t.backlog?t.backlog:{}};return p;function m(e){return e&&e instanceof d?e:e?(0,i.X)(e,s,l):l()}function v(e,r,n,i,o){if(!1!==o&&(o=!0),!u.aborted||i){t&&o&&t.emit(e,r,n);for(var a=m(n),s=w(e),d=s.length,f=0;fn,p:()=>i});var n=r(2177).ee.get("handle");function i(e,t,r,i,o){o?(o.buffer([e],i),o.emit(e,t,r)):(n.buffer([e],i),n.emit(e,t,r))}},4322:(e,t,r)=>{r.d(t,{X:()=>o});var n=r(5546);o.on=a;var i=o.handlers={};function o(e,t,r,o){a(o||n.E,i,e,t,r)}function a(e,t,r,i,o){o||(o="feature"),e||(e=n.E);var a=t[o]=t[o]||{};(a[r]=a[r]||[]).push([e,i])}},3239:(e,t,r)=>{r.d(t,{bP:()=>s,iz:()=>c,m$:()=>a});var n=r(385);let i=!1,o=!1;try{const e={get passive(){return i=!0,!1},get signal(){return o=!0,!1}};n._A.addEventListener("test",null,e),n._A.removeEventListener("test",null,e)}catch(e){}function a(e,t){return i||o?{capture:!!e,passive:i,signal:t}:!!e}function s(e,t){let r=arguments.length>2&&void 0!==arguments[2]&&arguments[2],n=arguments.length>3?arguments[3]:void 0;window.addEventListener(e,t,a(r,n))}function c(e,t){let r=arguments.length>2&&void 0!==arguments[2]&&arguments[2],n=arguments.length>3?arguments[3]:void 0;document.addEventListener(e,t,a(r,n))}},4402:(e,t,r)=>{r.d(t,{Ht:()=>u,M:()=>c,Rl:()=>a,ky:()=>s});var n=r(385);const i="xxxxxxxx-xxxx-4xxx-yxxx-xxxxxxxxxxxx";function o(e,t){return e?15&e[t]:16*Math.random()|0}function a(){const e=n._A?.crypto||n._A?.msCrypto;let t,r=0;return e&&e.getRandomValues&&(t=e.getRandomValues(new Uint8Array(31))),i.split("").map((e=>"x"===e?o(t,++r).toString(16):"y"===e?(3&o()|8).toString(16):e)).join("")}function s(e){const t=n._A?.crypto||n._A?.msCrypto;let r,i=0;t&&t.getRandomValues&&(r=t.getRandomValues(new Uint8Array(31)));const a=[];for(var s=0;s {r.d(t,{Bq:()=>n,Hb:()=>o,oD:()=>i});const n="NRBA",i=144e5,o=18e5},7894:(e,t,r)=>{function n(){return Math.round(performance.now())}r.d(t,{z:()=>n})},7243:(e,t,r)=>{r.d(t,{e:()=>o});var n=r(385),i={};function o(e){if(e in i)return i[e];if(0===(e||"").indexOf("data:"))return{protocol:"data"};let t;var r=n._A?.location,o={};if(n.il)t=document.createElement("a"),t.href=e;else try{t=new URL(e,r.href)}catch(e){return o}o.port=t.port;var a=t.href.split("://");!o.port&&a[1]&&(o.port=a[1].split("/")[0].split("@").pop().split(":")[1]),o.port&&"0"!==o.port||(o.port="https"===a[0]?"443":"80"),o.hostname=t.hostname||r.hostname,o.pathname=t.pathname,o.protocol=a[0],"/"!==o.pathname.charAt(0)&&(o.pathname="/"+o.pathname);var s=!t.protocol||":"===t.protocol||t.protocol===r.protocol,c=t.hostname===r.hostname&&t.port===r.port;return o.sameOrigin=s&&(!t.hostname||c),"/"===o.pathname&&(i[e]=o),o}},50:(e,t,r)=>{function n(e,t){"function"==typeof console.warn&&(console.warn("New Relic: ".concat(e)),t&&console.warn(t))}r.d(t,{Z:()=>n})},2587:(e,t,r)=>{r.d(t,{N:()=>c,T:()=>u});var n=r(2177),i=r(5546),o=r(8e3),a=r(3325);const s={stn:[a.D.sessionTrace],err:[a.D.jserrors,a.D.metrics],ins:[a.D.pageAction],spa:[a.D.spa],sr:[a.D.sessionReplay,a.D.sessionTrace]};function c(e,t){const r=n.ee.get(t);e&&"object"==typeof e&&(Object.entries(e).forEach((e=>{let[t,n]=e;void 0===u[t]&&(s[t]?s[t].forEach((e=>{n?(0,i.p)("feat-"+t,[],void 0,e,r):(0,i.p)("block-"+t,[],void 0,e,r),(0,i.p)("rumresp-"+t,[Boolean(n)],void 0,e,r)})):n&&(0,i.p)("feat-"+t,[],void 0,void 0,r),u[t]=Boolean(n))})),Object.keys(s).forEach((e=>{void 0===u[e]&&(s[e]?.forEach((t=>(0,i.p)("rumresp-"+e,[!1],void 0,t,r))),u[e]=!1)})),(0,o.L)(t,a.D.pageViewEvent))}const u={}},2210:(e,t,r)=>{r.d(t,{X:()=>i});var n=Object.prototype.hasOwnProperty;function i(e,t,r){if(n.call(e,t))return e[t];var i=r();if(Object.defineProperty&&Object.keys)try{return Object.defineProperty(e,t,{value:i,writable:!0,enumerable:!1}),i}catch(e){}return e[t]=i,i}},1284:(e,t,r)=>{r.d(t,{D:()=>n});const n=(e,t)=>Object.entries(e||{}).map((e=>{let[r,n]=e;return t(r,n)}))},4351:(e,t,r)=>{r.d(t,{P:()=>o});var n=r(2177);const i=()=>{const e=new WeakSet;return(t,r)=>{if("object"==typeof r&&null!==r){if(e.has(r))return;e.add(r)}return r}};function o(e){try{return JSON.stringify(e,i())}catch(e){try{n.ee.emit("internal-error",[e])}catch(e){}}}},3960:(e,t,r)=>{r.d(t,{K:()=>a,b:()=>o});var n=r(3239);function i(){return"undefined"==typeof document||"complete"===document.readyState}function o(e,t){if(i())return e();(0,n.bP)("load",e,t)}function a(e){if(i())return e();(0,n.iz)("DOMContentLoaded",e)}},8632:(e,t,r)=>{r.d(t,{EZ:()=>u,Qy:()=>c,ce:()=>o,fP:()=>a,gG:()=>d,mF:()=>s});var n=r(7894),i=r(385);const o={beacon:"bam.nr-data.net",errorBeacon:"bam.nr-data.net"};function a(){return i._A.NREUM||(i._A.NREUM={}),void 0===i._A.newrelic&&(i._A.newrelic=i._A.NREUM),i._A.NREUM}function s(){let e=a();return e.o||(e.o={ST:i._A.setTimeout,SI:i._A.setImmediate,CT:i._A.clearTimeout,XHR:i._A.XMLHttpRequest,REQ:i._A.Request,EV:i._A.Event,PR:i._A.Promise,MO:i._A.MutationObserver,FETCH:i._A.fetch}),e}function c(e,t,r){let i=a();const o=i.initializedAgents||{},s=o[e]||{};return Object.keys(s).length||(s.initializedAt={ms:(0,n.z)(),date:new Date}),i.initializedAgents={...o,[e]:{...s,[r]:t}},i}function u(e,t){a()[e]=t}function d(){return function(){let e=a();const t=e.info||{};e.info={beacon:o.beacon,errorBeacon:o.errorBeacon,...t}}(),function(){let e=a();const t=e.init||{};e.init={...t}}(),s(),function(){let e=a();const t=e.loader_config||{};e.loader_config={...t}}(),a()}},7956:(e,t,r)=>{r.d(t,{N:()=>i});var n=r(3239);function i(e){let t=arguments.length>1&&void 0!==arguments[1]&&arguments[1],r=arguments.length>2?arguments[2]:void 0,i=arguments.length>3?arguments[3]:void 0;return void(0,n.iz)("visibilitychange",(function(){if(t)return void("hidden"==document.visibilityState&&e());e(document.visibilityState)}),r,i)}},1214:(e,t,r)=>{r.d(t,{em:()=>v,u5:()=>N,QU:()=>S,_L:()=>I,Gm:()=>L,Lg:()=>M,gy:()=>U,BV:()=>Q,Kf:()=>ee});var n=r(2177);const i="nr@original";var o=Object.prototype.hasOwnProperty,a=!1;function s(e,t){return e||(e=n.ee),r.inPlace=function(e,t,n,i,o){n||(n="");var a,s,c,u="-"===n.charAt(0);for(c=0;c 2?n-2:0),o=2;o {r(A[T],e,w),r(E[T],e,w)})),r(l._A,"fetch",y),t.on(y+"end",(function(e,r){var n=this;if(r){var i=r.headers.get("content-length");null!==i&&(n.rxSize=i),t.emit(y+"done",[null,r],n)}else t.emit(y+"done",[e],n)})),t}const O={},j=["pushState","replaceState"];function S(e){const t=function(e){return(e||n.ee).get("history")}(e);return!l.il||O[t.debugId]++||(O[t.debugId]=1,s(t).inPlace(window.history,j,"-")),t}var P=r(3239);const C={},R=["appendChild","insertBefore","replaceChild"];function I(e){const t=function(e){return(e||n.ee).get("jsonp")}(e);if(!l.il||C[t.debugId])return t;C[t.debugId]=!0;var r=s(t),i=/[?&](?:callback|cb)=([^&#]+)/,o=/(.*)\.([^.]+)/,a=/^(\w+)(\.|$)(.*)$/;function c(e,t){var r=e.match(a),n=r[1],i=r[3];return i?c(i,t[n]):t[n]}return r.inPlace(Node.prototype,R,"dom-"),t.on("dom-start",(function(e){!function(e){if(!e||"string"!=typeof e.nodeName||"script"!==e.nodeName.toLowerCase())return;if("function"!=typeof e.addEventListener)return;var n=(a=e.src,s=a.match(i),s?s[1]:null);var a,s;if(!n)return;var u=function(e){var t=e.match(o);if(t&&t.length>=3)return{key:t[2],parent:c(t[1],window)};return{key:e,parent:window}}(n);if("function"!=typeof u.parent[u.key])return;var d={};function f(){t.emit("jsonp-end",[],d),e.removeEventListener("load",f,(0,P.m$)(!1)),e.removeEventListener("error",l,(0,P.m$)(!1))}function l(){t.emit("jsonp-error",[],d),t.emit("jsonp-end",[],d),e.removeEventListener("load",f,(0,P.m$)(!1)),e.removeEventListener("error",l,(0,P.m$)(!1))}r.inPlace(u.parent,[u.key],"cb-",d),e.addEventListener("load",f,(0,P.m$)(!1)),e.addEventListener("error",l,(0,P.m$)(!1)),t.emit("new-jsonp",[e.src],d)}(e[0])})),t}var k=r(5763);const H={};function L(e){const t=function(e){return(e||n.ee).get("mutation")}(e);if(!l.il||H[t.debugId])return t;H[t.debugId]=!0;var r=s(t),i=k.Yu.MO;return i&&(window.MutationObserver=function(e){return this instanceof i?new i(r(e,"fn-")):i.apply(this,arguments)},MutationObserver.prototype=i.prototype),t}const z={};function M(e){const t=function(e){return(e||n.ee).get("promise")}(e);if(z[t.debugId])return t;z[t.debugId]=!0;var r=n.c,o=s(t),a=k.Yu.PR;return a&&function(){function e(r){var n=t.context(),i=o(r,"executor-",n,null,!1);const s=Reflect.construct(a,[i],e);return t.context(s).getCtx=function(){return n},s}l._A.Promise=e,Object.defineProperty(e,"name",{value:"Promise"}),e.toString=function(){return a.toString()},Object.setPrototypeOf(e,a),["all","race"].forEach((function(r){const n=a[r];e[r]=function(e){let i=!1;[...e||[]].forEach((e=>{this.resolve(e).then(a("all"===r),a(!1))}));const o=n.apply(this,arguments);return o;function a(e){return function(){t.emit("propagate",[null,!i],o,!1,!1),i=i||!e}}}})),["resolve","reject"].forEach((function(r){const n=a[r];e[r]=function(e){const r=n.apply(this,arguments);return e!==r&&t.emit("propagate",[e,!0],r,!1,!1),r}})),e.prototype=a.prototype;const n=a.prototype.then;a.prototype.then=function(){var e=this,i=r(e);i.promise=e;for(var a=arguments.length,s=new Array(a),c=0;c e())),t};function m(e,t){i.inPlace(t,["onreadystatechange"],"fn-",E)}function b(){var e=this,t=r.context(e);e.readyState>3&&!t.resolved&&(t.resolved=!0,r.emit("xhr-resolved",[],e)),i.inPlace(e,f,"fn-",E)}if(function(e,t){for(var r in e)t[r]=e[r]}(o,p),p.prototype=o.prototype,i.inPlace(p.prototype,J,"-xhr-",E),r.on("send-xhr-start",(function(e,t){m(e,t),function(e){h.push(e),a&&(y?y.then(A):u?u(A):(w=-w,x.data=w))}(t)})),r.on("open-xhr-start",m),a){var y=c&&c.resolve();if(!u&&!c){var w=1,x=document.createTextNode(w);new a(A).observe(x,{characterData:!0})}}else t.on("fn-end",(function(e){e[0]&&e[0].type===d||A()}));function A(){for(var e=0;e {r.d(t,{t:()=>n});const n=r(3325).D.ajax},6660:(e,t,r)=>{r.d(t,{A:()=>i,t:()=>n});const n=r(3325).D.jserrors,i="nr@seenError"},3081:(e,t,r)=>{r.d(t,{gF:()=>o,mY:()=>i,t9:()=>n,vz:()=>s,xS:()=>a});const n=r(3325).D.metrics,i="sm",o="cm",a="storeSupportabilityMetrics",s="storeEventMetrics"},4649:(e,t,r)=>{r.d(t,{t:()=>n});const n=r(3325).D.pageAction},7633:(e,t,r)=>{r.d(t,{Dz:()=>i,OJ:()=>a,qw:()=>o,t9:()=>n});const n=r(3325).D.pageViewEvent,i="firstbyte",o="domcontent",a="windowload"},9251:(e,t,r)=>{r.d(t,{t:()=>n});const n=r(3325).D.pageViewTiming},3614:(e,t,r)=>{r.d(t,{BST_RESOURCE:()=>i,END:()=>s,FEATURE_NAME:()=>n,FN_END:()=>u,FN_START:()=>c,PUSH_STATE:()=>d,RESOURCE:()=>o,START:()=>a});const n=r(3325).D.sessionTrace,i="bstResource",o="resource",a="-start",s="-end",c="fn"+a,u="fn"+s,d="pushState"},7836:(e,t,r)=>{r.d(t,{BODY:()=>A,CB_END:()=>E,CB_START:()=>u,END:()=>x,FEATURE_NAME:()=>i,FETCH:()=>_,FETCH_BODY:()=>v,FETCH_DONE:()=>m,FETCH_START:()=>p,FN_END:()=>c,FN_START:()=>s,INTERACTION:()=>l,INTERACTION_API:()=>d,INTERACTION_EVENTS:()=>o,JSONP_END:()=>b,JSONP_NODE:()=>g,JS_TIME:()=>T,MAX_TIMER_BUDGET:()=>a,REMAINING:()=>f,SPA_NODE:()=>h,START:()=>w,originalSetTimeout:()=>y});var n=r(5763);const i=r(3325).D.spa,o=["click","submit","keypress","keydown","keyup","change"],a=999,s="fn-start",c="fn-end",u="cb-start",d="api-ixn-",f="remaining",l="interaction",h="spaNode",g="jsonpNode",p="fetch-start",m="fetch-done",v="fetch-body-",b="jsonp-end",y=n.Yu.ST,w="-start",x="-end",A="-body",E="cb"+x,T="jsTime",_="fetch"},5938:(e,t,r)=>{r.d(t,{W:()=>o});var n=r(5763),i=r(2177);class o{constructor(e,t,r){this.agentIdentifier=e,this.aggregator=t,this.ee=i.ee.get(e,(0,n.OP)(this.agentIdentifier).isolatedBacklog),this.featureName=r,this.blocked=!1}}},9144:(e,t,r)=>{r.d(t,{j:()=>m});var n=r(3325),i=r(5763),o=r(5546),a=r(2177),s=r(7894),c=r(8e3),u=r(3960),d=r(385),f=r(50),l=r(3081),h=r(8632);function g(){const e=(0,h.gG)();["setErrorHandler","finished","addToTrace","inlineHit","addRelease","addPageAction","setCurrentRouteName","setPageViewName","setCustomAttribute","interaction","noticeError","setUserId"].forEach((t=>{e[t]=function(){for(var r=arguments.length,n=new Array(r),i=0;i 1?r-1:0),i=1;i {e.exposed&&e.api[t]&&o.push(e.api[t](...n))})),o.length>1?o:o[0]}(t,...n)}}))}var p=r(2587);function m(e){let t=arguments.length>1&&void 0!==arguments[1]?arguments[1]:{},m=arguments.length>2?arguments[2]:void 0,v=arguments.length>3?arguments[3]:void 0,{init:b,info:y,loader_config:w,runtime:x={loaderType:m},exposed:A=!0}=t;const E=(0,h.gG)();y||(b=E.init,y=E.info,w=E.loader_config),(0,i.Dg)(e,b||{}),(0,i.GE)(e,w||{}),(0,i.sU)(e,x),y.jsAttributes??={},d.v6&&(y.jsAttributes.isWorker=!0),(0,i.CX)(e,y),g();const T=function(e,t){t||(0,c.R)(e,"api");const h={};var g=a.ee.get(e),p=g.get("tracer"),m="api-",v=m+"ixn-";function b(t,r,n,o){const a=(0,i.C5)(e);return null===r?delete a.jsAttributes[t]:(0,i.CX)(e,{...a,jsAttributes:{...a.jsAttributes,[t]:r}}),x(m,n,!0,o||null===r?"session":void 0)(t,r)}function y(){}["setErrorHandler","finished","addToTrace","inlineHit","addRelease"].forEach((e=>h[e]=x(m,e,!0,"api"))),h.addPageAction=x(m,"addPageAction",!0,n.D.pageAction),h.setCurrentRouteName=x(m,"routeName",!0,n.D.spa),h.setPageViewName=function(t,r){if("string"==typeof t)return"/"!==t.charAt(0)&&(t="/"+t),(0,i.OP)(e).customTransaction=(r||"http://custom.transaction")+t,x(m,"setPageViewName",!0)()},h.setCustomAttribute=function(e,t){let r=arguments.length>2&&void 0!==arguments[2]&&arguments[2];if("string"==typeof e){if(["string","number"].includes(typeof t)||null===t)return b(e,t,"setCustomAttribute",r);(0,f.Z)("Failed to execute setCustomAttribute.\nNon-null value must be a string or number type, but a type of was provided."))}else(0,f.Z)("Failed to execute setCustomAttribute.\nName must be a string type, but a type of was provided."))},h.setUserId=function(e){if("string"==typeof e||null===e)return b("enduser.id",e,"setUserId",!0);(0,f.Z)("Failed to execute setUserId.\nNon-null value must be a string type, but a type of was provided."))},h.interaction=function(){return(new y).get()};var w=y.prototype={createTracer:function(e,t){var r={},i=this,a="function"==typeof t;return(0,o.p)(v+"tracer",[(0,s.z)(),e,r],i,n.D.spa,g),function(){if(p.emit((a?"":"no-")+"fn-start",[(0,s.z)(),i,a],r),a)try{return t.apply(this,arguments)}catch(e){throw p.emit("fn-err",[arguments,this,"string"==typeof e?new Error(e):e],r),e}finally{p.emit("fn-end",[(0,s.z)()],r)}}}};function x(e,t,r,i){return function(){return(0,o.p)(l.xS,["API/"+t+"/called"],void 0,n.D.metrics,g),i&&(0,o.p)(e+t,[(0,s.z)(),...arguments],r?null:this,i,g),r?void 0:this}}function A(){r.e(439).then(r.bind(r,7438)).then((t=>{let{setAPI:r}=t;r(e),(0,c.L)(e,"api")})).catch((()=>(0,f.Z)("Downloading runtime APIs failed...")))}return["actionText","setName","setAttribute","save","ignore","onEnd","getContext","end","get"].forEach((e=>{w[e]=x(v,e,void 0,n.D.spa)})),h.noticeError=function(e,t){"string"==typeof e&&(e=new Error(e)),(0,o.p)(l.xS,["API/noticeError/called"],void 0,n.D.metrics,g),(0,o.p)("err",[e,(0,s.z)(),!1,t],void 0,n.D.jserrors,g)},d.il?(0,u.b)((()=>A()),!0):A(),h}(e,v);return(0,h.Qy)(e,T,"api"),(0,h.Qy)(e,A,"exposed"),(0,h.EZ)("activatedFeatures",p.T),T}},3325:(e,t,r)=>{r.d(t,{D:()=>n,p:()=>i});const n={ajax:"ajax",jserrors:"jserrors",metrics:"metrics",pageAction:"page_action",pageViewEvent:"page_view_event",pageViewTiming:"page_view_timing",sessionReplay:"session_replay",sessionTrace:"session_trace",spa:"spa"},i={[n.pageViewEvent]:1,[n.pageViewTiming]:2,[n.metrics]:3,[n.jserrors]:4,[n.ajax]:5,[n.sessionTrace]:6,[n.pageAction]:7,[n.spa]:8,[n.sessionReplay]:9}}},n={};function i(e){var t=n[e];if(void 0!==t)return t.exports;var o=n[e]={exports:{}};return r[e](o,o.exports,i),o.exports}i.m=r,i.d=(e,t)=>{for(var r in t)i.o(t,r)&&!i.o(e,r)&&Object.defineProperty(e,r,{enumerable:!0,get:t[r]})},i.f={},i.e=e=>Promise.all(Object.keys(i.f).reduce(((t,r)=>(i.f[r](e,t),t)),[])),i.u=e=>(({78:"page_action-aggregate",147:"metrics-aggregate",242:"session-manager",317:"jserrors-aggregate",348:"page_view_timing-aggregate",412:"lazy-feature-loader",439:"async-api",538:"recorder",590:"session_replay-aggregate",675:"compressor",733:"session_trace-aggregate",786:"page_view_event-aggregate",873:"spa-aggregate",898:"ajax-aggregate"}[e]||e)+"."+{78:"ac76d497",147:"3dc53903",148:"1a20d5fe",242:"2a64278a",317:"49e41428",348:"bd6de33a",412:"2f55ce66",439:"30bd804e",538:"1b18459f",590:"cf0efb30",675:"ae9f91a8",733:"83105561",786:"06482edd",860:"03a8b7a5",873:"e6b09d52",898:"998ef92b"}[e]+"-1.236.0.min.js"),i.o=(e,t)=>Object.prototype.hasOwnProperty.call(e,t),e={},t="NRBA:",i.l=(r,n,o,a)=>{if(e[r])e[r].push(n);else{var s,c;if(void 0!==o)for(var u=document.getElementsByTagName("script"),d=0;d {s.onerror=s.onload=null,clearTimeout(h);var i=e[r];if(delete e[r],s.parentNode&&s.parentNode.removeChild(s),i&&i.forEach((e=>e(n))),t)return t(n)},h=setTimeout(l.bind(null,void 0,{type:"timeout",target:s}),12e4);s.onerror=l.bind(null,s.onerror),s.onload=l.bind(null,s.onload),c&&document.head.appendChild(s)}},i.r=e=>{"undefined"!=typeof Symbol&&Symbol.toStringTag&&Object.defineProperty(e,Symbol.toStringTag,{value:"Module"}),Object.defineProperty(e,"__esModule",{value:!0})},i.j=364,i.p="https://js-agent.newrelic.com/",(()=>{var e={364:0,953:0};i.f.j=(t,r)=>{var n=i.o(e,t)?e[t]:void 0;if(0!==n)if(n)r.push(n[2]);else{var o=new Promise(((r,i)=>n=e[t]=[r,i]));r.push(n[2]=o);var a=i.p+i.u(t),s=new Error;i.l(a,(r=>{if(i.o(e,t)&&(0!==(n=e[t])&&(e[t]=void 0),n)){var o=r&&("load"===r.type?"missing":r.type),a=r&&r.target&&r.target.src;s.message="Loading chunk "+t+" failed.\n("+o+": "+a+")",s.name="ChunkLoadError",s.type=o,s.request=a,n[1](s)}}),"chunk-"+t,t)}};var t=(t,r)=>{var n,o,[a,s,c]=r,u=0;if(a.some((t=>0!==e[t]))){for(n in s)i.o(s,n)&&(i.m[n]=s[n]);if(c)c(i)}for(t&&t(r);u {i.r(o);var e=i(3325),t=i(5763);const r=Object.values(e.D);function n(e){const n={};return r.forEach((r=>{n[r]=function(e,r){return!1!==(0,t.Mt)(r,"".concat(e,".enabled"))}(r,e)})),n}var a=i(9144);var s=i(5546),c=i(385),u=i(8e3),d=i(5938),f=i(3960),l=i(50);class h extends d.W{constructor(e,t,r){let n=!(arguments.length>3&&void 0!==arguments[3])||arguments[3];super(e,t,r),this.auto=n,this.abortHandler,this.featAggregate,this.onAggregateImported,n&&(0,u.R)(e,r)}importAggregator(){let e=arguments.length>0&&void 0!==arguments[0]?arguments[0]:{};if(this.featAggregate||!this.auto)return;const r=c.il&&!0===(0,t.Mt)(this.agentIdentifier,"privacy.cookies_enabled");let n;this.onAggregateImported=new Promise((e=>{n=e}));const o=async()=>{let t;try{if(r){const{setupAgentSession:e}=await Promise.all([i.e(860),i.e(242)]).then(i.bind(i,3228));t=e(this.agentIdentifier)}}catch(e){(0,l.Z)("A problem occurred when starting up session manager. This page will not start or extend any session.",e)}try{if(!this.shouldImportAgg(this.featureName,t))return void(0,u.L)(this.agentIdentifier,this.featureName);const{lazyFeatureLoader:r}=await i.e(412).then(i.bind(i,8582)),{Aggregate:o}=await r(this.featureName,"aggregate");this.featAggregate=new o(this.agentIdentifier,this.aggregator,e),n(!0)}catch(e){(0,l.Z)("Downloading and initializing ".concat(this.featureName," failed..."),e),this.abortHandler?.(),n(!1)}};c.il?(0,f.b)((()=>o()),!0):o()}shouldImportAgg(r,n){return r!==e.D.sessionReplay||!1!==(0,t.Mt)(this.agentIdentifier,"session_trace.enabled")&&(!!n?.isNew||!!n?.state.sessionReplay)}}var g=i(7633),p=i(7894);class m extends h{static featureName=g.t9;constructor(r,n){let i=!(arguments.length>2&&void 0!==arguments[2])||arguments[2];if(super(r,n,g.t9,i),("undefined"==typeof PerformanceNavigationTiming||c.Tt)&&"undefined"!=typeof PerformanceTiming){const n=(0,t.OP)(r);n[g.Dz]=Math.max(Date.now()-n.offset,0),(0,f.K)((()=>n[g.qw]=Math.max((0,p.z)()-n[g.Dz],0))),(0,f.b)((()=>{const t=(0,p.z)();n[g.OJ]=Math.max(t-n[g.Dz],0),(0,s.p)("timing",["load",t],void 0,e.D.pageViewTiming,this.ee)}))}this.importAggregator()}}var v=i(1117),b=i(1284);class y extends v.w{constructor(e){super(e),this.aggregatedData={}}store(e,t,r,n,i){var o=this.getBucket(e,t,r,i);return o.metrics=function(e,t){t||(t={count:0});return t.count+=1,(0,b.D)(e,(function(e,r){t[e]=w(r,t[e])})),t}(n,o.metrics),o}merge(e,t,r,n,i){var o=this.getBucket(e,t,n,i);if(o.metrics){var a=o.metrics;a.count+=r.count,(0,b.D)(r,(function(e,t){if("count"!==e){var n=a[e],i=r[e];i&&!i.c?a[e]=w(i.t,n):a[e]=function(e,t){if(!t)return e;t.c||(t=x(t.t));return t.min=Math.min(e.min,t.min),t.max=Math.max(e.max,t.max),t.t+=e.t,t.sos+=e.sos,t.c+=e.c,t}(i,a[e])}}))}else o.metrics=r}storeMetric(e,t,r,n){var i=this.getBucket(e,t,r);return i.stats=w(n,i.stats),i}getBucket(e,t,r,n){this.aggregatedData[e]||(this.aggregatedData[e]={});var i=this.aggregatedData[e][t];return i||(i=this.aggregatedData[e][t]={params:r||{}},n&&(i.custom=n)),i}get(e,t){return t?this.aggregatedData[e]&&this.aggregatedData[e][t]:this.aggregatedData[e]}take(e){for(var t={},r="",n=!1,i=0;i t.max&&(t.max=e),e 2&&void 0!==arguments[2])||arguments[2];super(e,r,j.t,n),c.il&&((0,t.OP)(e).initHidden=Boolean("hidden"===document.visibilityState),(0,N.N)((()=>(0,s.p)("docHidden",[(0,p.z)()],void 0,j.t,this.ee)),!0),(0,O.bP)("pagehide",(()=>(0,s.p)("winPagehide",[(0,p.z)()],void 0,j.t,this.ee))),this.importAggregator())}}var P=i(3081);class C extends h{static featureName=P.t9;constructor(e,t){let r=!(arguments.length>2&&void 0!==arguments[2])||arguments[2];super(e,t,P.t9,r),this.importAggregator()}}var R,I=i(2210),k=i(1214),H=i(2177),L={};try{R=localStorage.getItem("__nr_flags").split(","),console&&"function"==typeof console.log&&(L.console=!0,-1!==R.indexOf("dev")&&(L.dev=!0),-1!==R.indexOf("nr_dev")&&(L.nrDev=!0))}catch(e){}function z(e){try{L.console&&z(e)}catch(e){}}L.nrDev&&H.ee.on("internal-error",(function(e){z(e.stack)})),L.dev&&H.ee.on("fn-err",(function(e,t,r){z(r.stack)})),L.dev&&(z("NR AGENT IN DEVELOPMENT MODE"),z("flags: "+(0,b.D)(L,(function(e,t){return e})).join(", ")));var M=i(6660);class B extends h{static featureName=M.t;constructor(r,n){let i=!(arguments.length>2&&void 0!==arguments[2])||arguments[2];super(r,n,M.t,i),this.skipNext=0;try{this.removeOnAbort=new AbortController}catch(e){}const o=this;o.ee.on("fn-start",(function(e,t,r){o.abortHandler&&(o.skipNext+=1)})),o.ee.on("fn-err",(function(t,r,n){o.abortHandler&&!n[M.A]&&((0,I.X)(n,M.A,(function(){return!0})),this.thrown=!0,(0,s.p)("err",[n,(0,p.z)()],void 0,e.D.jserrors,o.ee))})),o.ee.on("fn-end",(function(){o.abortHandler&&!this.thrown&&o.skipNext>0&&(o.skipNext-=1)})),o.ee.on("internal-error",(function(t){(0,s.p)("ierr",[t,(0,p.z)(),!0],void 0,e.D.jserrors,o.ee)})),this.origOnerror=c._A.onerror,c._A.onerror=this.onerrorHandler.bind(this),c._A.addEventListener("unhandledrejection",(t=>{const r=function(e){let t="Unhandled Promise Rejection: ";if(e instanceof Error)try{return e.message=t+e.message,e}catch(t){return e}if(void 0===e)return new Error(t);try{return new Error(t+(0,D.P)(e))}catch(e){return new Error(t)}}(t.reason);(0,s.p)("err",[r,(0,p.z)(),!1,{unhandledPromiseRejection:1}],void 0,e.D.jserrors,this.ee)}),(0,O.m$)(!1,this.removeOnAbort?.signal)),(0,k.gy)(this.ee),(0,k.BV)(this.ee),(0,k.em)(this.ee),(0,t.OP)(r).xhrWrappable&&(0,k.Kf)(this.ee),this.abortHandler=this.#e,this.importAggregator()}#e(){this.removeOnAbort?.abort(),this.abortHandler=void 0}onerrorHandler(t,r,n,i,o){"function"==typeof this.origOnerror&&this.origOnerror(...arguments);try{this.skipNext?this.skipNext-=1:(0,s.p)("err",[o||new F(t,r,n),(0,p.z)()],void 0,e.D.jserrors,this.ee)}catch(t){try{(0,s.p)("ierr",[t,(0,p.z)(),!0],void 0,e.D.jserrors,this.ee)}catch(e){}}return!1}}function F(e,t,r){this.message=e||"Uncaught error with no additional information",this.sourceURL=t,this.line=r}let U=1;const q="nr@id";function G(e){const t=typeof e;return!e||"object"!==t&&"function"!==t?-1:e===c._A?0:(0,I.X)(e,q,(function(){return U++}))}function V(e){if("string"==typeof e&&e.length)return e.length;if("object"==typeof e){if("undefined"!=typeof ArrayBuffer&&e instanceof ArrayBuffer&&e.byteLength)return e.byteLength;if("undefined"!=typeof Blob&&e instanceof Blob&&e.size)return e.size;if(!("undefined"!=typeof FormData&&e instanceof FormData))try{return(0,D.P)(e).length}catch(e){return}}}var X=i(7243);class W{constructor(e){this.agentIdentifier=e,this.generateTracePayload=this.generateTracePayload.bind(this),this.shouldGenerateTrace=this.shouldGenerateTrace.bind(this)}generateTracePayload(e){if(!this.shouldGenerateTrace(e))return null;var r=(0,t.DL)(this.agentIdentifier);if(!r)return null;var n=(r.accountID||"").toString()||null,i=(r.agentID||"").toString()||null,o=(r.trustKey||"").toString()||null;if(!n||!i)return null;var a=(0,_.M)(),s=(0,_.Ht)(),c=Date.now(),u={spanId:a,traceId:s,timestamp:c};return(e.sameOrigin||this.isAllowedOrigin(e)&&this.useTraceContextHeadersForCors())&&(u.traceContextParentHeader=this.generateTraceContextParentHeader(a,s),u.traceContextStateHeader=this.generateTraceContextStateHeader(a,c,n,i,o)),(e.sameOrigin&&!this.excludeNewrelicHeader()||!e.sameOrigin&&this.isAllowedOrigin(e)&&this.useNewrelicHeaderForCors())&&(u.newrelicHeader=this.generateTraceHeader(a,s,c,n,i,o)),u}generateTraceContextParentHeader(e,t){return"00-"+t+"-"+e+"-01"}generateTraceContextStateHeader(e,t,r,n,i){return i+"@nr=0-1-"+r+"-"+n+"-"+e+"----"+t}generateTraceHeader(e,t,r,n,i,o){if(!("function"==typeof c._A?.btoa))return null;var a={v:[0,1],d:{ty:"Browser",ac:n,ap:i,id:e,tr:t,ti:r}};return o&&n!==o&&(a.d.tk=o),btoa((0,D.P)(a))}shouldGenerateTrace(e){return this.isDtEnabled()&&this.isAllowedOrigin(e)}isAllowedOrigin(e){var r=!1,n={};if((0,t.Mt)(this.agentIdentifier,"distributed_tracing")&&(n=(0,t.P_)(this.agentIdentifier).distributed_tracing),e.sameOrigin)r=!0;else if(n.allowed_origins instanceof Array)for(var i=0;i 2&&void 0!==arguments[2])||arguments[2];super(r,n,Z.t,i),(0,t.OP)(r).xhrWrappable&&(this.dt=new W(r),this.handler=(e,t,r,n)=>(0,s.p)(e,t,r,n,this.ee),(0,k.u5)(this.ee),(0,k.Kf)(this.ee),function(r,n,i,o){function a(e){var t=this;t.totalCbs=0,t.called=0,t.cbTime=0,t.end=E,t.ended=!1,t.xhrGuids={},t.lastSize=null,t.loadCaptureCalled=!1,t.params=this.params||{},t.metrics=this.metrics||{},e.addEventListener("load",(function(r){_(t,e)}),(0,O.m$)(!1)),c.IF||e.addEventListener("progress",(function(e){t.lastSize=e.loaded}),(0,O.m$)(!1))}function s(e){this.params={method:e[0]},T(this,e[1]),this.metrics={}}function u(e,n){var i=(0,t.DL)(r);i.xpid&&this.sameOrigin&&n.setRequestHeader("X-NewRelic-ID",i.xpid);var a=o.generateTracePayload(this.parsedOrigin);if(a){var s=!1;a.newrelicHeader&&(n.setRequestHeader("newrelic",a.newrelicHeader),s=!0),a.traceContextParentHeader&&(n.setRequestHeader("traceparent",a.traceContextParentHeader),a.traceContextStateHeader&&n.setRequestHeader("tracestate",a.traceContextStateHeader),s=!0),s&&(this.dt=a)}}function d(e,t){var r=this.metrics,i=e[0],o=this;if(r&&i){var a=V(i);a&&(r.txSize=a)}this.startTime=(0,p.z)(),this.listener=function(e){try{"abort"!==e.type||o.loadCaptureCalled||(o.params.aborted=!0),("load"!==e.type||o.called===o.totalCbs&&(o.onloadCalled||"function"!=typeof t.onload)&&"function"==typeof o.end)&&o.end(t)}catch(e){try{n.emit("internal-error",[e])}catch(e){}}};for(var s=0;s 1?e[1]=i:e.push(i)}else e[0]&&e[0].headers&&s(e[0].headers,n)&&(this.dt=n);function s(e,t){var r=!1;return t.newrelicHeader&&(e.set("newrelic",t.newrelicHeader),r=!0),t.traceContextParentHeader&&(e.set("traceparent",t.traceContextParentHeader),t.traceContextStateHeader&&e.set("tracestate",t.traceContextStateHeader),r=!0),r}}function x(e,t){this.params={},this.metrics={},this.startTime=(0,p.z)(),this.dt=t,e.length>=1&&(this.target=e[0]),e.length>=2&&(this.opts=e[1]);var r,n=this.opts||{},i=this.target;"string"==typeof i?r=i:"object"==typeof i&&i instanceof Y?r=i.url:c._A?.URL&&"object"==typeof i&&i instanceof URL&&(r=i.href),T(this,r);var o=(""+(i&&i instanceof Y&&i.method||n.method||"GET")).toUpperCase();this.params.method=o,this.txSize=V(n.body)||0}function A(t,r){var n;this.endTime=(0,p.z)(),this.params||(this.params={}),this.params.status=r?r.status:0,"string"==typeof this.rxSize&&this.rxSize.length>0&&(n=+this.rxSize);var o={txSize:this.txSize,rxSize:n,duration:(0,p.z)()-this.startTime};i("xhr",[this.params,o,this.startTime,this.endTime,"fetch"],this,e.D.ajax)}function E(t){var r=this.params,n=this.metrics;if(!this.ended){this.ended=!0;for(var o=0;o 2&&void 0!==arguments[2])||arguments[2];super(e,t,we.t,r),this.importAggregator()}}new class{constructor(e){let t=arguments.length>1&&void 0!==arguments[1]?arguments[1]:(0,_.ky)(16);c._A?(this.agentIdentifier=t,this.sharedAggregator=new y({agentIdentifier:this.agentIdentifier}),this.features={},this.desiredFeatures=new Set(e.features||[]),this.desiredFeatures.add(m),Object.assign(this,(0,a.j)(this.agentIdentifier,e,e.loaderType||"agent")),this.start()):(0,l.Z)("Failed to initial the agent. Could not determine the runtime environment.")}get config(){return{info:(0,t.C5)(this.agentIdentifier),init:(0,t.P_)(this.agentIdentifier),loader_config:(0,t.DL)(this.agentIdentifier),runtime:(0,t.OP)(this.agentIdentifier)}}start(){const t="features";try{const r=n(this.agentIdentifier),i=[...this.desiredFeatures];i.sort(((t,r)=>e.p[t.featureName]-e.p[r.featureName])),i.forEach((t=>{if(r[t.featureName]||t.featureName===e.D.pageViewEvent){const n=function(t){switch(t){case e.D.ajax:return[e.D.jserrors];case e.D.sessionTrace:return[e.D.ajax,e.D.pageViewEvent];case e.D.sessionReplay:return[e.D.sessionTrace];case e.D.pageViewTiming:return[e.D.pageViewEvent];default:return[]}}(t.featureName);n.every((e=>r[e]))||(0,l.Z)("".concat(t.featureName," is enabled but one or more dependent features has been disabled (").concat((0,D.P)(n),"). This may cause unintended consequences or missing data...")),this.features[t.featureName]=new t(this.agentIdentifier,this.sharedAggregator)}})),(0,T.Qy)(this.agentIdentifier,this.features,t)}catch(e){(0,l.Z)("Failed to initialize all enabled instrument classes (agent aborted) -",e);for(const e in this.features)this.features[e].abortHandler?.();const r=(0,T.fP)();return delete r.initializedAgents[this.agentIdentifier]?.api,delete r.initializedAgents[this.agentIdentifier]?.[t],delete this.sharedAggregator,r.ee?.abort(),delete r.ee?.get(this.agentIdentifier),!1}}}({features:[J,m,S,class extends h{static featureName=oe;constructor(t,r){if(super(t,r,oe,!(arguments.length>2&&void 0!==arguments[2])||arguments[2]),!c.il)return;const n=this.ee;let i;(0,k.QU)(n),this.eventsEE=(0,k.em)(n),this.eventsEE.on(se,(function(e,t){this.bstStart=(0,p.z)()})),this.eventsEE.on(ae,(function(t,r){(0,s.p)("bst",[t[0],r,this.bstStart,(0,p.z)()],void 0,e.D.sessionTrace,n)})),n.on(ce+ne,(function(e){this.time=(0,p.z)(),this.startPath=location.pathname+location.hash})),n.on(ce+ie,(function(t){(0,s.p)("bstHist",[location.pathname+location.hash,this.startPath,this.time],void 0,e.D.sessionTrace,n)}));try{i=new PerformanceObserver((t=>{const r=t.getEntries();(0,s.p)(te,[r],void 0,e.D.sessionTrace,n)})),i.observe({type:re,buffered:!0})}catch(e){}this.importAggregator({resourceObserver:i})}},C,xe,B,class extends h{static featureName=de;constructor(e,r){if(super(e,r,de,!(arguments.length>2&&void 0!==arguments[2])||arguments[2]),!c.il)return;if(!(0,t.OP)(e).xhrWrappable)return;try{this.removeOnAbort=new AbortController}catch(e){}let n,i=0;const o=this.ee.get("tracer"),a=(0,k._L)(this.ee),s=(0,k.Lg)(this.ee),u=(0,k.BV)(this.ee),d=(0,k.Kf)(this.ee),f=this.ee.get("events"),l=(0,k.u5)(this.ee),h=(0,k.QU)(this.ee),g=(0,k.Gm)(this.ee);function m(e,t){h.emit("newURL",[""+window.location,t])}function v(){i++,n=window.location.hash,this[ve]=(0,p.z)()}function b(){i--,window.location.hash!==n&&m(0,!0);var e=(0,p.z)();this[pe]=~~this[pe]+e-this[ve],this[ye]=e}function y(e,t){e.on(t,(function(){this[t]=(0,p.z)()}))}this.ee.on(ve,v),s.on(be,v),a.on(be,v),this.ee.on(ye,b),s.on(ge,b),a.on(ge,b),this.ee.buffer([ve,ye,"xhr-resolved"],this.featureName),f.buffer([ve],this.featureName),u.buffer(["setTimeout"+le,"clearTimeout"+fe,ve],this.featureName),d.buffer([ve,"new-xhr","send-xhr"+fe],this.featureName),l.buffer([me+fe,me+"-done",me+he+fe,me+he+le],this.featureName),h.buffer(["newURL"],this.featureName),g.buffer([ve],this.featureName),s.buffer(["propagate",be,ge,"executor-err","resolve"+fe],this.featureName),o.buffer([ve,"no-"+ve],this.featureName),a.buffer(["new-jsonp","cb-start","jsonp-error","jsonp-end"],this.featureName),y(l,me+fe),y(l,me+"-done"),y(a,"new-jsonp"),y(a,"jsonp-end"),y(a,"cb-start"),h.on("pushState-end",m),h.on("replaceState-end",m),window.addEventListener("hashchange",m,(0,O.m$)(!0,this.removeOnAbort?.signal)),window.addEventListener("load",m,(0,O.m$)(!0,this.removeOnAbort?.signal)),window.addEventListener("popstate",(function(){m(0,i>1)}),(0,O.m$)(!0,this.removeOnAbort?.signal)),this.abortHandler=this.#e,this.importAggregator()}#e(){this.removeOnAbort?.abort(),this.abortHandler=void 0}}],loaderType:"spa"})})(),window.NRBA=o})(); window.jQuery || document.write(' ') CKEDITOR_BASEPATH='https://f1000research.com/js/vendor/ckeditor/' window.reactTheme = 'research'; window.MathJax = { CommonHTML: { linebreaks: { automatic: true } }, 'HTML-CSS': { linebreaks: { automatic: true } }, SVG: { linebreaks: { automatic: true } }, AuthorInit: function() { MathJax.Hub.Register.MessageHook('End Process', function () { let timeout = false; // holder for timeout id const delay = 250; // delay after event is "complete" to run callback const reflowMath = function() { const dispFormulas = document.querySelectorAll('.disp-formula.panel'); if (!dispFormulas) { return; } for (const dispFormula of dispFormulas) { const child = dispFormula.querySelector('.MathJax_Preview').nextSibling.firstChild; const isMultiline = MathJax.Hub.getAllJax(dispFormula)[0].root.isMultiline; if (dispFormula.offsetWidth < child.offsetWidth || isMultiline) { MathJax.Hub.Queue(['Rerender', MathJax.Hub, dispFormula]); } } }; window.addEventListener('resize', function() { clearTimeout(timeout); // clear the timeout timeout = setTimeout(reflowMath, delay); // start timing for event "completion" }); }); }, }; if (window.location.hash == '#_=_'){ window.location = window.location.href.split('#')[0] } !function(f,b,e,v,n,t,s){if(f.fbq)return;n=f.fbq=function() {n.callMethod? n.callMethod.apply(n,arguments):n.queue.push(arguments)} ;if(!f._fbq)f._fbq=n; n.push=n;n.loaded=!0;n.version='2.0';n.queue=[];t=b.createElement(e);t.async=!0; t.src=v;s=b.getElementsByTagName(e)[0];s.parentNode.insertBefore(t,s)}(window, document,'script','https://connect.facebook.net/en_US/fbevents.js'); fbq('init', '1641728616063202'); fbq('track', "PixelInitialized", {}); (function(h,o,t,j,a,r){ h.hj=h.hj||function(){(h.hj.q=h.hj.q||[]).push(arguments)}; h._hjSettings={hjid:2318163,hjsv:6}; a=o.getElementsByTagName('head')[0]; r=o.createElement('script');r.async=1; r.src=t+h._hjSettings.hjid+j+h._hjSettings.hjsv; a.appendChild(r); })(window,document,'https://static.hotjar.com/c/hotjar-','.js?sv='); search file_upload Submit your research search menu close search Browse Gateways & Collections How to Publish Submit your Research My Submissions Article Guidelines Article Guidelines (New Versions) Open Data, Software and Code Guidelines Open Data and Accessible Source Materials Guidelines (HSS) Open Data, Software and Code Guidelines (PSE) Prepublication Checks Production Process Posters and Slides Guidelines Document Guidelines Article Processing Charges Peer Review Finding Article Reviewers About How it Works For Reviewers Our Advisors Policies Glossary FAQs For Developers Newsroom Contact My Research Submissions Content and Tracking Alerts My Details Sign In file_upload Submit your research { "@context": "https://schema.org", "@type": "ScholarlyArticle", "mainEntityOfPage": { "@type": "WebPage", "@id": "https://f1000research.com/articles/10-1064" }, "headline": "Skin swabbing protocol to collect DNA samples from small-bodied fish species", "datePublished": "2021-10-19T12:36:34", "dateModified": "2024-06-27T12:45:40", "author": [ { "@type": "Person", "name": "Ceinwen Tilley" }, { "@type": "Person", "name": "Iain Barber" }, { "@type": "Person", "name": "William Norton" } ], "publisher": { "@type": "Organization", "name": "F1000Research", "logo": { "@type": "ImageObject", "url": "https://f1000research.com/img/AMP/F1000Research_image.png", "height": 480, "width": 60 } }, "image": { "@type": "ImageObject", "url": "https://f1000research.com/img/AMP/F1000Research_image.png", "height": 1200, "width": 150 }, "description": "Fish species are commonly used as experimental models in the laboratory. DNA is routinely collected from these animals to permit identification of their genotype. The current standard procedure to sample DNA is fin clipping, which involves anaesthetising individuals and removing a portion of the caudal fin. While fin clipping reliably generates good quality DNA samples for downstream applications, there is evidence that it can alter health and welfare, and impact the fish’s behaviour. This in turn can result in greater variation in the data collected. In a recent study we adapted a skin swabbing protocol to collect DNA from small-bodied fish, including sticklebacks and zebrafish, without the use of analgesics, anaesthetics or sharp instruments. A rayon-tipped swab was used to collect mucus from the flank of the fish, which was then used for DNA extraction. We subsequently demonstrated that compared to fin clipping, skin swabbing triggered fewer changes in stress axis activation and behaviour. We also found that gene expression and behaviour data collected from swabbed fish were less variable than similar data collected from fish that had been fin clipped. This potentially allows smaller sample sizes in experimental groups to be used after skin swabbing, thereby reducing animal use. Here we provide a detailed protocol explaining how to collect DNA samples from small laboratory fish using skin swabs." } { "@context": "http://schema.org", "@type": "BreadcrumbList", "itemListElement": [ { "@type": "ListItem", "position": "1", "item": { "@id": "https://f1000research.com/", "name": "Home" } }, { "@type": "ListItem", "position": "2", "item": { "@id": "https://f1000research.com/browse/articles", "name": "Browse" } }, { "@type": "ListItem", "position": "3", "item": { "@id": "https://f1000research.com/articles/10-1064", "name": "Skin swabbing protocol to collect DNA samples from small-bodied fish..." } } ] } Home Browse Skin swabbing protocol to collect DNA samples from small-bodied fish... ALL Metrics - Views Downloads Get PDF Get XML Cite How to cite this article Tilley C, Barber I and Norton W. Skin swabbing protocol to collect DNA samples from small-bodied fish species [version 2; peer review: 2 approved] . F1000Research 2024, 10 :1064 ( https://doi.org/10.12688/f1000research.73115.2 ) NOTE: If applicable, it is important to ensure the information in square brackets after the title is included in all citations of this article. Close Copy Citation Details Export Export Citation Sciwheel EndNote Ref. Manager Bibtex ProCite Sente EXPORT Select a format first Track Share ▬ ✚ Method Article Revised Skin swabbing protocol to collect DNA samples from small-bodied fish species [version 2; peer review: 2 approved] Ceinwen Tilley https://orcid.org/0000-0002-2800-405X 1,2 , Iain Barber https://orcid.org/0000-0003-3955-6674 3,4 , William Norton https://orcid.org/0000-0002-3244-0145 5,6 Ceinwen Tilley https://orcid.org/0000-0002-2800-405X 1,2 , Iain Barber https://orcid.org/0000-0003-3955-6674 3,4 , William Norton https://orcid.org/0000-0002-3244-0145 5,6 PUBLISHED 27 Jun 2024 Author details Author details 1 Genetics and Genome Biology, School of Biological Sciences, University of Leicester, Leicester, England, LE1 7RH, UK 2 Neuroscience, Psychology and Behaviour, University of Leicester, Leicester, Leicestershire, LE1 7RH, UK 3 School of Animal and Rural Sciences, Nottingham Trent University, Nottingham, NG25 0QF, UK 4 Department of Life Sciences, Edward Llwyd Building, Aberystwyth University, Aberystwyth, Wales, SY23 3DA, UK 5 Institute of Biology, Eotvos Lorand University, Budapest, Hungary 6 Genetics and Genome Biology, University of Leicester, Leicester, Leicestershire, LE1 7RH, UK Ceinwen Tilley Roles: Conceptualization, Investigation, Methodology, Writing – Original Draft Preparation, Writing – Review & Editing Iain Barber Roles: Conceptualization, Funding Acquisition, Investigation, Methodology, Supervision, Writing – Original Draft Preparation, Writing – Review & Editing William Norton Roles: Conceptualization, Funding Acquisition, Investigation, Methodology, Supervision, Writing – Original Draft Preparation, Writing – Review & Editing OPEN PEER REVIEW DETAILS REVIEWER STATUS This article is included in the NC3Rs gateway. Abstract Fish species are commonly used as experimental models in the laboratory. DNA is routinely collected from these animals to permit identification of their genotype. The current standard procedure to sample DNA is fin clipping, which involves anaesthetising individuals and removing a portion of the caudal fin. While fin clipping reliably generates good quality DNA samples for downstream applications, there is evidence that it can alter health and welfare, and impact the fish’s behaviour. This in turn can result in greater variation in the data collected. In a recent study we adapted a skin swabbing protocol to collect DNA from small-bodied fish, including sticklebacks and zebrafish, without the use of analgesics, anaesthetics or sharp instruments. A rayon-tipped swab was used to collect mucus from the flank of the fish, which was then used for DNA extraction. We subsequently demonstrated that compared to fin clipping, skin swabbing triggered fewer changes in stress axis activation and behaviour. We also found that gene expression and behaviour data collected from swabbed fish were less variable than similar data collected from fish that had been fin clipped. This potentially allows smaller sample sizes in experimental groups to be used after skin swabbing, thereby reducing animal use. Here we provide a detailed protocol explaining how to collect DNA samples from small laboratory fish using skin swabs. READ ALL READ LESS Keywords Zebrafish, stickleback, skin swabbing, fin clipping, DNA extraction, refinement, reduction Corresponding Author(s) William Norton ( [email protected] ) Close Corresponding author: William Norton Competing interests: No competing interests were disclosed. Grant information: This research was supported by an NC3Rs research Grant to I.B. and W.H.J.N (NC/R001049/1). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Copyright: © 2024 Tilley C et al . This is an open access article distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. How to cite: Tilley C, Barber I and Norton W. Skin swabbing protocol to collect DNA samples from small-bodied fish species [version 2; peer review: 2 approved] . F1000Research 2024, 10 :1064 ( https://doi.org/10.12688/f1000research.73115.2 ) First published: 19 Oct 2021, 10 :1064 ( https://doi.org/10.12688/f1000research.73115.1 ) Latest published: 27 Jun 2024, 10 :1064 ( https://doi.org/10.12688/f1000research.73115.2 ) Revised Amendments from Version 1 We have updated the text taking into account comments made by reviewer 1. We have updated table 1, and included a new table 2. Video 1 has also been updated, and is now a professionally-made film that shows the swabbing protocol in more detail. We have updated the text taking into account comments made by reviewer 1. We have updated table 1, and included a new table 2. Video 1 has also been updated, and is now a professionally-made film that shows the swabbing protocol in more detail. See the authors' detailed response to the review by Luigi Margiotta-Casaluci READ REVIEWER RESPONSES Research highlights Scientific benefits Skin swabbing causes less variation in subsequent gene expression and behavioural data collection compared to fin clipping. This can improve the quality of data collection with the potential to aid comparison of results across laboratories. 3Rs benefits DNA collection by skin swabbing causes fewer changes to stress axis activation and behaviour than fin clipping, the current standard technique. Skin swabbing also removes the need to use analgesic or anaesthetic, and decreases the potential for fish to experience pain or infection compared to removal of tissue by fin clipping. In addition, the smaller variation in data collection caused by skin swabbing compared to fin clipping means that fewer animals need to be included in some types of experiments. Practical benefits Skin swabbing is quick to perform, relatively non-invasive for the fish and collects DNA of suitable quality for PCR amplification. In addition, skin swabbing does not require sharp scalpels, reducing the possibility of harm to researchers. Current applications Skin swabbing can be used to collect DNA samples from fish species with a body size that is greater than 20 mm, the smallest body size that we could swab without risk harm to the animal. It is particularly useful when genotype information is needed from fish, such as identifying transgenic or mutant carriers in a group of animals. Potential applications Skin swabbing should be suitable to collect DNA from any species with a mucus layer on the body, including fish, frogs and toads. The technique may also be suitable for automation in the future. Introduction Model fish species including zebrafish and sticklebacks are used frequently for experiments in the laboratory. Some of the advantages of these species include their small size, short life cycle and ease of maintenance, making it easy to keep many fish within laboratory aquaria. Fish also tend to be easy to manipulate genetically, and display similarities to other vertebrates permitting data to be translated across species ( Bert et al ., 2016 ; Schaeck et al ., 2013 ; NC3Rs, 2014 ; Flecknell, 2002 ). Fish are used to study a range of disciplines including developmental biology, ecology, neuroscience and behaviour. They are also used as models for aspects of human disease including cancer ( Hason and Bartunek, 2019 ), visual impairments ( Richardson et al ., 2017 ) and neurological disorders ( Kalueff et al ., 2014 ; Norton, 2013 ). The recent development of techniques to manipulate the genome, including transgenesis ( Higashijima, 2008 ), optogenetics ( Wyart and Del Bene, 2011 ) and CRISPR-Cas9 mutagenesis ( Cornet et al ., 2018 ; Albadri et al ., 2017 ) means that DNA needs to be collected from many of these animals to facilitate identification of their genotype. In addition, the number of fish used in experiments is increasing each year. For example, in 2015, 14% of all regulated animal procedures in Britain were undertaken on fish ( Home Office, 2019 ) and this rose to 30% in 2019, which represents more than one million procedures in the UK alone ( Home Office, 2019 ). Accordingly, the number of fish undergoing DNA sampling is also likely to rise over time. The current standard procedure to sample DNA is fin clipping under non-terminal anaesthesia ( Xing et al ., 2014 ). Typically, animals are immersed in anaesthetic until they become unresponsive to touch. A small part of the caudal fin is removed using a sterile scalpel before fish are allowed to recover in fresh system water. In some cases, pre-operative analgesia is applied by immersing the fish in water containing lidocaine ( Schroeder and Sneddon, 2017 ). A recent survey indicated that 85% of zebrafish labs use fin clipping to collect DNA ( Lidster et al ., 2017 ). However, despite its popularity, there is evidence that fin clipping can alter health and welfare. Fish display signs of pain after fin clipping ( Deakin et al ., 2019 ), as well as alterations to anxiety-like behaviour, including increased ventilation ( Schroeder and Sneddon, 2017 ), reduced activity ( Deakin et al ., 2019 ; Schroeder and Sneddon, 2017 ), increased time at the bottom of a tank ( Deakin et al ., 2019 ; De Lombaert et al ., 2017 ; Schroeder and Sneddon, 2017 ; White et al ., 2017 ) and decreased feeding ( De Lombaert et al ., 2017 ). Fin clipping can also trigger the release of the primary stress hormone cortisol ( White et al ., 2017 ). This suggests that there is a need for alternative, more refined techniques to collect DNA from model fish species. Our recent research has shown that skin swabbing – collecting mucus from the flank of a fish and extracting DNA from it ( Breacker et al ., 2017 ) – provides a suitable alternative to fin clipping in small laboratory fish. The skin swabbing protocol had already been used to collect DNA from many fish species ( Sebire et al ., 2015 ; Taslima et al ., 2015 ; Mirimin et al ., 2011 ; Le Vin et al ., 2011 ; Campanella and Smalley, 2006 ) including sticklebacks ( Sebire et al ., 2015 ), and we adapted it for use in zebrafish ( Tilley et al ., 2020 , 2023 ; Breacker et al ., 2017 ). In this methods paper, we describe how to swab and extract DNA from fish mucus in a step-by-step manner. We also summarise data from our recent research ( Breacker et al ., 2017 ; Tilley et al ., 2020 ) showing that skin swabbing is a refinement compared to fin clipping, with the added potential to reduce the number of animals used in some types of experiments. Methods Ethical approval All work was conducted under a UK Home Office licence to Dr Norton (licence no. P8F9CCE8B), and was approved by a local Animal Welfare and Ethical Review Body (AWERB) committee at the University of Leicester. Maintaining fish in the laboratory Threespined sticklebacks Stocks of F2 generation lab-bred three-spined sticklebacks ( Gasterosteus aculeatus ) were generated by in vitro fertilisation in July 2017 ( Barber and Arnott, 2000 ). The parental background was a wild freshwater population originally collected from the River Welland (Market Harborough, Leicestershire, UK) in 2015. Adult sticklebacks were fed an ad libitum diet of defrosted bloodworm ( Chironomus sp. larvae). Groups of fish were pooled into large stock tanks (27 L) in a dedicated fish facility at the University of Leicester. The choice of which groups to mix was haphazard, matching fish of similar size and age. We did not expect this to cause changes in behaviour such as aggression, based upon our previous research into adult fish behaviour ( Norton et al. , 2011 ). The tanks housed 40 fish on a re-circulating system (Xenoplus systems, Techniplast) with a flow rate of two tank changes per hour. The system water was made from reverse osmosis water with Instant Ocean marine salts added (Aquarium Systems, UK). The water parameters were pH ~7.1, 0 ppm ammonia, 0 ppm nitrate, ~4 ppm nitrite and ~4000 DKH conductivity. Temperature and light–dark conditions were adjusted periodically to simulate natural seasonal variation until March 2018. Fish were then kept at 12±1°C on a 12:12 h light:dark cycle (i.e. March conditions) to maintain non-breeding conditions for the duration of the experiments, which were conducted from May 2018 onwards. 567 adult sticklebacks were used to develop this protocol, with a mean (± standard deviation) length of 36.74 mm (±2.98 mm) and a mean weight of 0.67 g (±0.2 g). All experimental studies were carried out using non-reproductive individuals, avoiding confounding factors associated with territorial and courtship behaviours. This means that although the sticklebacks were about one year old and adult size and weight, they had not developed sexually because they had not been exposed to spring light conditions and temperatures. Zebrafish Adult AB wild-type zebrafish ( Danio rerio ) were generated from stock maintained at the University of Leicester. Fish were fed ad libitum each afternoon at the end of the experiments (Zebrafeed (Sparos)). The animals used in this study were arbitrarily netted from a group of 40 fish in 8 L tanks on a re-circulating system (ZebTEC multi-link water treatment unit, Techniplast) with a flow rate of 7.6 L per tank per hour (ca. one tank change per hour). The system water was made from reverse osmosis water with Instant Ocean salts (Aquarium Systems, UK) added. The water parameters were pH ~7.1, 0 ppm ammonia, 0 ppm nitrate, ~4 ppm nitrite and ~525 DKH conductivity. The fish were maintained at 28±1°C and in a 14:10 h light:dark cycle, standard lighting conditions for laboratory-housed zebrafish. The following zebrafish strains were used; AB wild-type and Tg ( Vmat2:GFP ) ( Wen et al ., 2008 ). The zebrafish used to develop this protocol (n = 630) had a mean (± s.d.) length of 34.99 mm (±1.66 mm) and a mean weight of 0.38 g (±0.08 g) and included a mix of sexually mature males and females (approximate ratio 1.5:1 males:females) between three and six months old. No enrichment was provided, as is standard procedure in our fish facility. No fish of either species died during these experiments, and all animals were killed by a Schedule 1 procedure at the end of this study. Fin clipping sticklebacks and zebrafish This experiment was first reported in Breacker et al . (2017) . To collect DNA by fin clipping, a single fish was removed from its home tank using a small hand net. The fish was pre-treated with an anaesthetic by placing it in a tank containing 168 mg/L ethyl 3-aminobenzoatemethanesulfonate (MS-222) buffered to pH 7.2 with sodium bicarbonate dissolved in fresh system water. Once the fish was no longer responsive to touch, it was gently caught in a net and placed into a Petri dish containing a small amount of water. Fins were clipped using a sterile razor blade taking care to only remove about one third of the caudal fin. The excised fin tissue was placed into a sterile labelled Eppendorf tube, and the fish was moved to a recovery tank containing system water. The fish’s behaviour was monitored until it had recovered consciousness, so that it swam around in the tank freely. Fish were placed into individual holding tanks until DNA extraction and identification was complete. Fin clip DNA was extracted using the same DNA extraction buffer as for skin swabbing (see section 4.1.2. below), but with the addition of 15 μl of 20 mg/ml Proteinase K. This was incubated at 57°C for 30 minutes, followed by addition of 400 μl chilled isopropanol. The solutions were mixed and the DNA solution was then chilled at −80°C for 30 minutes. The solution was centrifuged for 10 minutes at 10,625 g, the supernatant decanted, and the remaining pellet washed with 190 μl 70% EtOH. After a further centrifugation step (two minutes at 10,625 g) the DNA pellet was air dried and resuspended in 30 μl ddH 2 O. Skin swabbing sticklebacks and zebrafish To collect DNA by skin swabbing, a single fish was removed from its home tank using a small hand net. The fish was then gently restrained on top of a wetted sponge. The net was used to cover the head of the fish. The uppermost surface of the fish was exposed to the air to permit DNA collection. A sterile swab was gently stroked along the flank of the fish, from head to tail, four to five times. The swab was placed into a clean labelled Eppendorf tube, and the fish was placed into a holding tank until DNA extraction and identification was complete. The DNA was extracted from the swab by adding DNA extraction buffer warmed to 55°C and letting it incubate for two minutes. The swab was then removed, taking care to squeeze out as much liquid as possible. The DNA was precipitated by addition of 400 μl chilled isopropanol. The solutions were mixed and the DNA solution was chilled at -80°C for 30 minutes. The solution was centrifuged for 10 minutes at maximum speed (10,625 g), the supernatant decanted, and the remaining pellet washed with 190 μl 70% EtOH. After a further centrifugation step (two minutes at 10,625 g) the DNA pellet was air dried and resuspended in 30 μl ddH 2 O. For experiments comparing skin swabbing to fin clipping in the same animal, fish were first swabbed and then fin clipped immediately afterwards. No lidocaine was used in these experiments, which were performed before we investigated whether pain relief could improve the skin swabbing protocol. Their recovery and welfare was monitored by looking for changes in balance, locomotion or respiration in the hour after the procedure was completed. Behavioural analysis Adult sticklebacks and zebrafish were tested for changes in locomotion and anxiety-like behaviour in the open field test, novel tank diving test and black and white test as described in Egan et al. (2009) and Norton and Carreño Gutiérrez (2019) . Fish were filmed for five minutes the side (novel tank diving test) or above (open filed and black and white tests). In the novel tank test, we compared distance swum, and the time spent in the top or bottom half of a novel trapezoid-shaped tank. An anxious fish should prefer to remain close to the bottom of the tank. In the open field test we measured distance swum, and time spent at the side or in the centre of a novel tank. An anxious fish should prefer to swim close to the side of the tank. In the black and white test, we analysed the preference to spend time on the black or white side of the tank. A more anxious fish should prefer to stay on the black side of the tank. Behaviour was then analysed using videotracking software from ViewPoint Lifesciences. PCR amplification of genes from stickleback and zebrafish The DNA samples obtained from three-spined sticklebacks were amplify the sex-linked molecular marker Isocitrate dehydrogenase (IDH) using the following primers: STKSEX forward primer 5′ GGGACGAGCAAGATTTATTGG 3′; STKSEX reverse primer 5′ TATAGTTAGCCAGGAGATGG 3′. Females produce a single band of approximately 300 bp, whilst males produce two products of 270 bp and 300 bp. 10 μl PCR reactions were set up using 5 μl Red Taq master mix (Sigma-Aldrich, UK), 0.5 μl of the forward and reverse primer, 3 μl of DNA template and 1 μl ddH 2 O). The PCR conditions were 94°C for 5 min, followed by 40 cycles of: 95°C for 30 sec, 56°C for 30 sec, 72°C for 30 sec, with a final extension of 72°C for 10 min. PCR products were visualised on a 5% agarose gel. PCR reactions were run on a Veriti 96 well thermal cycler. For zebrafish, PCR was used to identify AB WT and transgenic Tg ( Vmat2:GFP ) fish. We used primers designed against the genes microphthalmia-associated transcription factor a (for WT) and green fluorescent protein for Tg(Vmat2:eGFP). The primers used were: mitfa forward primer 5′ GCCAACTAAATTTCATGAACC 3′; reverse primer 5′ AAATCAACTAATTGTTTACACG 3′as described by Lister et al. (1999) and GFP forward 5′ TCGAGCTGGACGGCGACGT 3′; reverse 5′ GGTGCTCAGGTAGTGGTTGTC 3′. 10 μl reactions were set up (5 μl Red Taq master mix (Sigma-Aldrich, UK), 0.5 μl of the forward and reverse primer 3 μl of DNA template and 1μl ddH 2 O). The PCR conditions were 94°C for 2 min, followed by 35 cycles of: 94°C for 30 sec, 60°C for 30 sec, 72°C for 1 min, with a final extension of 72°C for 10 min. Products were visualised on a 2% agarose gel. PCR reactions were run on a Veriti 96 well thermal cycler. Cortisol extraction and quantification. Cortisol was extracted from the water samples by pumping it through Sep-pak Plus C18 solid phase extraction cartridges (Waters Ltd., UK) following the protocol developed by the Cefas Weymouth Laboratory ( Ellis et al., 2004 ). Cartridges were primed with 5 ml of methanol followed by 5 ml of distilled water (dH20) and water samples were pumped through the cartridges at 5 ml/min. Each cartridge was washed with 5 ml of dH20, then air-dried, wrapped in Parafilm ® and stored at −80 °C until elution with 5 ml ethyl acetate. For the quantification by radioimmunoassay the eluted extracts were evaporated at 45°C under nitrogen and each residue was reconstituted in 500 μl of RIA buffer until assayed. The elution and the quantification were carried out in a blind manner to reduce bias when analysing the data. Statistical analysis Statistical analyses were carried out using GraphPad Prism7. Data were tested for normality using the using the Shapiro–Wilk test. Since the majority of data were not distributed normally, we analysed all data using the non-parametric Kruskal–Wallis test followed by a Dunn's multiple comparisons test comparing each treatment to the control group. Data variability was investigated using an asymptotic test for the equality of coefficients of variation from k populations. Detailed skin swabbing protocol Equipment needed Please refer to Video 1 to see how the DNA collection part of this protocol can be carried out. • Fish for DNA sampling, for example available from ZIRC or similar organisations. • Two aquariums large enough to hold a single fish, e.g. Techniplast ZebTEC 1.1 L tank or similar, e.g. Techniplast ZB300BF. • Access to fresh water from the main aquarium system. • A small sponge to rest fish on during swabbing, e.g. Vitrex 10 2904 square sponge or similar, available online. We use a sponge measuring approximately 10 cm length × 5 cm width × 3 cm depth. We cut a small 0.5 cm groove into the upper surface of the sponge to make it easier to restrain the fish. • A clean net large enough to comfortably catch and restrain a single fish, e.g. Marina Fine Soft Mesh Fish Net with Plastic Coated Handle or similar, available online. The net should be rinsed with aquarium water in between use. • A sterile rayon-tipped swab such e.g. COPAN 155C Rayon or similar. • A sterile 1.5 ml Eppendorf tube, labelled with a name or number to identify the fish e.g. Sigma Aldrich Ref. EP0030120086. RRID:SCR_000786. • Clean scissors, suitable to cut the stem of a sterile swab e.g. Brabantia 121746 Tasty+ Kitchen Scissors, or similar, available online. • Lidocaine hydrochloride e.g. Sigma Aldrich Ref. PHT1257. • DNA extraction solution (see preparation of reagents below). • Isopropanol (also known as 2-Propanol) e.g. Sigma Aldrich Ref. I9516. • Absolute ethanol e.g. Sigma Aldrich Ref. 51976. • Trizma Base (TRIS) e.g. Sigma Aldrich Ref. 648310-M. • Ethylenediaminetetraacetic acid (EDTA) e.g. Sigma Aldrich Ref. EDS-100G. • Sodium chloride (NaCl) e.g. Sigma Aldrich Ref. S7563. • Sodium dodecyl sulphate (SDS) e.g. Sigma Aldrich Ref. L3771. Preparation of reagents Prepare stock solutions to make the DNA extraction solution: • 1 M TRIS pH 7.5 • 0.5 M EDTA • 2 M NaCl • 10% SDS Make 100 ml DNA extraction buffer from the stock solutions. Mix: • 20 ml 1 M TRIS pH 7.5 • 5 ml 0.5 M EDTA • 12.5 ml 2 M NaCl • 57.5 ml dH 2 O Autoclave the individual stock solutions before use. Once autoclaved, add 5 ml 10% SDS (do not autoclave once SDS has been added). This solution can be stored at room temperature for several weeks until signs of precipitation or contamination become evident. Make a 70% ethanol solution by adding 3 ml ultrapure water, distilled water or similar to 7 ml absolute ethanol. Make a solution of 2 mg/L Lidocaine to use for pre-swabbing analgesia. Make a stock by dissolving 2 g lidocaine in 1 ml ultrapure water. Add 1 ml stock solution to 1 L system water to generate a final concentration of 2 mg/L. Set up equipment in the laboratory Label one 1.5 ml Eppendorf tube with a name or number to identify the fish to be swabbed. Make sure that you have one sterile swab for each animal. Label enough holding tanks to maintain each fish separately until identification is complete. These tanks should be placed onto the main aquarium system so that fish have access to flowing oxygenated water. Fill a small tank with system water up to depth of 1 cm or 2 cm (the swabbing tank). Place the grooved sponge into this water, groove side up, making sure that it is completely wet. The top of the sponge should not be covered in water, so that the exposed flank of the fish can be swabbed easily without getting the swab too wet. Place the group of fish that you wish to identify into a holding tank close to the swabbing tank. Set up a tank containing 2 mg/L lidocaine for pre-operative analgesia/pain relief. Apply pain relief before DNA collection Administer lidocaine prior to swabbing to provide pain relief. Immerse the group of fish in a solution of 2 mg/L lidocaine for 45 minutes prior to swabbing. The fish require 45 minutes for the lidocaine to take effect, and swabbing should be carried out immediately afterwards. Swab the fish to collect DNA Pre-warm an aliquot of DNA extraction solution to 55°C; chill the isopropanol to −20°C. Gently catch a single fish from the analgesia tank in a net and transfer it to the swabbing tank containing the sponge. Use the net to restrain the fish on top of the wetted sponge, positioning the body into the groove. Using thumb and forefinger hold the net so that the side of the fish against the sponge rests on the net, whereas the uppermost side of the fish is exposed for swabbing. The underside of the fish rests on the net, not the sponge, thereby minimising contamination for the sponge between different fish (Video 1). Gently covering the fish's eyes with the net material may decrease the amount that the fish moves during sample collection. Using a sterile rayon-tipped swab (such as a cotton bud or similar), gently stroke the fish five to ten times from the operculum to the base of the caudal fin. Very little pressure is required to collect enough mucus for DNA extraction. Be as gentle as possible to avoid damaging the animal. The whole procedure – netting, swabbing and returning the animal to the tank should only take around 30 seconds (Video 1). Extended data: Swabbing video 1 Preparing the zebrafish for swabbing and carrying out the DNA extraction. https://doi.org/10.6084/m9.figshare.25991122 Place the swab into a labelled 1.5 ml Eppendorf tube. The handle of the swab can be cut off using scissors, and the tip stored at room temperature (either dry or in DNA extraction solution) with the lid of the tube closed. 1 The wetted sponge and the hand-net can be rinsed in aquarium water before another fish is swabbed. Place each fish into a labelled holding tank on the aquarium system. Monitor its health and welfare, including locomotion, balance and respiration, in the immediate recovery period afterwards. The fish will remain in this tank until identification is complete. 2 Typically it takes half a day to extract DNA, run a PCR and identify the fish. Therefore, fish may be held in single tanks for a few hours up to overnight. DNA extraction from swabs 3 • Check that the DNA extraction buffer has been pre-warmed to 55°C. • Add 400 μl DNA extraction buffer into a 1.5 ml Eppendorf tube containing the swab. • Incubate the swab at room temperature for at least two minutes. • Remove the swab using fingers or forceps, and squeeze it against the side of the tube to retain as much extraction solution as possible. • Add 400 μl of pre-chilled isopropanol to the extraction solution. • Mix the tube three to five times using a vortex mixer. • Place the tube into a −80°C freezer for at least five minutes 4 . • Remove the tube from the −80°C freezer and allow it to defrost. • Centrifuge the tube for 10 minutes at full speed (ca. 10,625 g using a desktop centrifuge). • Dry the pellet by gently pouring the supernatant away onto a tissue. • Add 190 μl 70% EtOH and gently flick tube to mix the contents. • Centrifuge the tube for two minutes at full speed (ca. 10,625 g using a desktop centrifuge). • Dry the resulting pellet by removing the excess liquid using a P200 pipette set to 200 μl. Incubate the tube in a heat block set at 55°C for 5-10 minutes until it is fully dry. • Pipette 30 μl dH 2 O into the tube to resuspend the DNA. This can be achieved by aspirating the liquid into a pipette tip and releasing is again several times until the pellet is no longer visible. Incubate the tube in a dry heat block for five to ten minutes at 65°C. The DNA can now be stored at 4°C (for long term use in applications other than genotyping), or immediately used in a PCR reaction. Results Characterisation studies In previous studies from our lab we compared the concentration of DNA collected by skin swabbing and fin clipping, and the ability to amplify genes when using both techniques in stickleback and zebrafish. We also investigated the possibility for cross contamination of mucus samples, and changes to stress axis activity and behaviour following DNA collection. The data presented here have all be published previously in Breacker et al. (2017) and Tilley et al. (2020) . Concentration of DNA collected by fin clipping vs skin swabbing Skin swabbing may be expected to be less invasive than fin clipping since it does not require removal of a portion of tissue from the animal. However, it was not clear whether both techniques are equally useful to genotype animals. We first investigated whether skin swabbing led to similar levels of DNA collection as fin clipping, the current standard procedure ( Xing et al. , 2014 ). Comparing swabs and fin clips taken from the same fish revealed that fin clips produced higher yields of DNA, suggesting that it is a more efficient method ( Table 1 ). However, the DNA samples collected using both methods had similar levels of purity, measured by calculating the 260/280 and 260/230 ratios using a spectrophotometer ( Table 1 and Figure 1 ). Pure DNA samples should have a 260/280 ratio of ~1.8 and a 260/230 ratio of between 2.0 and 2.2. However, slight deviations from this ratio may not affect amplification of genes by PCR. Table 1. Comparison of DNA concentration from fin clips and skin swabs of the same sticklebacks and zebrafish. Skin swabbing led to a lower concentration of DNA extraction than fin clipping in both species. The quality of the DNA collected was similar when using both techniques. DNA concentration was measured using a spectrophotometer following extraction as described above. The purity of the DNA was measured using the 260/280 and 260/230 ratios. Pure DNA samples should have a 260/280 ratio of ~1.8 and a 260/230 ratio of between 2.0 and 2.2. We compared n = 10 sticklebacks and n = 10 zebrafish. Modified with permission from Breacker et al . (2017) . Detailed methods for fin clipping, and a description of the experimental design can be found in Breacker et al . (2017) as well. Swabbing Fin clipping Species DNA ng/nl 260/280 ratio 260/230 ratio DNA ng/nl 260/280 ratio 260/230 ratio Stickleback 1 61.4 2.09 1.53 204.1 2.1 1.99 Stickleback 2 23.3 2.01 1.89 189.3 2.12 1.61 Stickleback 3 8.3 2.12 1.4 122.4 2.06 1.42 Stickleback 4 51.2 2.11 1.26 188.5 2.08 1.67 Stickleback 5 31.2 2.05 2.01 143.8 2.08 1.41 Stickleback 6 26.3 2.08 1.92 75 2.06 1.63 Stickleback 7 67.9 2.04 1.63 112.4 2.02 1.81 Stickleback 8 45.4 2.02 1.79 112.9 2.11 1.41 Stickleback 9 33.3 2.05 1.06 128.4 2.09 1.86 Stickleback 10 10.2 2.064 1.97 63.7 2.1 1.94 Mean stickleback 35.85 2.0634 1.646 134.05 2.082 1.675 Zebrafish 1 21.3 2.06 1.3 45.3 1.94 1.46 Zebrafish 2 17 2.01 2 35.6 1.97 1.4 Zebrafish 3 30.6 2.32 1.14 53.4 1.88 1.4 Zebrafish 4 23.3 1.41 0.42 49 1.99 1.93 Zebrafish 5 14.2 1.8 0.44 29.8 1.99 1.99 Zebrafish 6 28.9 1.95 2.46 44.4 1.97 1.77 Zebrafish 7 50.5 2.02 1.92 99.1 2.02 2.01 Zebrafish 8 41.4 1.95 1.04 87.2 1.97 1.77 Zebrafish 9 17.4 1.95 1.54 35.3 1.88 1.4 Zebrafish 10 43.4 1.95 1.04 49.4 2.21 1.53 Mean zebrafish 28.8 1.942 1.33 52.85 1.982 1.666 Figure 1. Graph of data from Table 1 comparing DNA concentration collected by skin swabbing or fin clipping either zebrafish or sticklebacks. This data is taken from Breacker et al . (2017) . Fin clipping led to more DNA being collected in both species compared to skin swabbing. The same fish were used in both procedures. n = 10 zebrafish and n = 10 sticklebacks. One-way ANOVA followed by Tukey’s post hoc test. **** = p < 0.001. SB = stickleback and ZF = zebrafish. PCR results comparing skin swabbing and fin clipping DNA extracted from fin clipping is commonly used to identify animals via PCR amplification of marker genes. We investigated whether skin swabbing collected enough DNA to allow PCR amplification of genes in stickleback and zebrafish, despite the lower yield recovered compared to fin clipping. In this experiment we used a different group of zebrafish and sticklebacks from those presented in Table 1 . In stickleback, we amplified the gene coding for the sex-linked marker Isocitrate dehydrogenase ( IDH ). In zebrafish, we compared amplification of the microphthalmia-associated transcription factor a ( mitfa ) gene using both sampling techniques. We also compared fish of different sizes, to show that swabbing can be used in animals that have not yet reach adulthood. In both zebrafish and stickleback, skin swabbing and fin clipping led to amplification of genes by PCR, suggesting that both techniques can be used for genetic identification. In addition, we were able to collect mucus from fish with a body size greater than 20 mm without damaging the animals ( Figure 2 ). Figure 2. Representative PCR results from DNA samples. (a) Amplification of mitfa from zebrafish fin clips, swabs and size range; 1-3 = fin clips, standard length (measured from nose to beginning of tail fin) adults, at 6 months old; 4-6 = swabs standard length adults, at 6 months old; 7-9 = swabs from 20 mm standard length adults; 10-12 = swabs from 35 mm standard length adults; 13-15 = swabs from 50 mm standard length adults; 16 = blank. n = 15 zebrafish, one fish per band. The amplified band has a size of around 1,500 bp. (b) Amplification of Isocitrate dehydrogenase from stickleback swabs and size; 1-2 = 50 mm standard length adult male swabs; 3-4 = 50 mm standard length adult female swabs; 5-6 = 20 mm standard length adult male swabs; 7-8 = 20 mm standard length adult female swabs. n = 8 sticklebacks, one fish per band. Females produce a single 300 bp band, whereas male fish produce two bands that are 270 bp and 300 bp. L marks the position of the 1 Kb DNA ladders, and the numbers on the right-hand side show ladder band sizes in Kb. Reproduced with permission from Breacker et al . (2017) . Validation studies Skin swabbing and fin clipping appear to be equally useful when amplifying genes to identify fish. We next examined whether mucus cross contamination occurs in fish held at high density, and whether either technique alters stress axis activation and behaviour following DNA collection. No cross contamination of mucus samples when fish are held at high density Skin swabbing appears to be a suitable technique to collect DNA from small laboratory fish without the need to excise fin tissue ( Tilley et al. , 2020 ; Breacker et al ., 2017 ). We investigated the potential for cross contamination of mucus samples when housing zebrafish in close proximity in a small aquarium. We created a group by mixing 10 AB wild-type and 10 Tg(vmat2:GFP) zebrafish and maintained them in a small 3 L tank overnight. Tg(vmat2: GFP) carry a green fluorescent protein (GFP) transgene that can be amplified by PCR ( Wen et al ., 2008 ) and have long ornamental fins allowing them to be distinguished visually from the AB wild-type animals. We first swabbed the AB wild-types and then the Tg(vmat2: GFP) fish, and we did not assess whether this order of collecting DNA might influence the results. We amplified both mitfa (a control gene that should be present in all animals) and the gene coding for GFP, which should be present in the transgenic carriers but not wild-type. Figure 3 shows a subset of four of these fish for clarity. As hypothesised, mitfa was present in both genotypes ( Figure 3 ; lanes 1-4 AB and 13-16 Tg(vmat2: GFP) ), whereas gfp was only present in the transgenic fish ( Figure 3 ; lanes 5-8 AB and 9-12 Tg(vmat2: GFP) ). This suggests that cross-contamination of mucus had not occurred when keeping fish at high density, and agrees with a previous study that found no cross-contamination of swab samples from cichlid fish housed in a laboratory ( Le Vin et al. , 2011 ). Figure 3. Representative data from a zebrafish cross-contamination test; 1-4 = WT DNA with mitfa primers; 5-8 = WT DNA with gfp primers; 9-12 = Vmat DNA with gfp primers; 13-16 = Vmat DNA with mitfa primers. We used n = 15 zebrafish in this experiment, and show n = 4 WT and n = 4 Tg ( vmat2: GFP ) zebrafish here for clarity. The mitfa bands are approximately 1,500 bp long, and the vmat band is approximately 2,500 bp long. L marks the position of the 25 bp DNA ladders. Reproduced with permission from Breacker et al . (2017) . Refer to Breacker et al . (2017) for detailed methods. No changes in cortisol release after skin swabbing Release of cortisol – the primary stress hormone in vertebrates – can be used as a read-out of stress axis activity following experimental manipulation ( Sebire et al ., 2007 ). We compared cortisol release in separate groups of sticklebacks and zebrafish that were either non-manipulated, fin clipped or swabbed. We then collected the cortisol they had excreted into their tank water one hour later as described previously ( Sebire et al ., 2007 , 2009 ; Ellis et al. , 2004 ). The cortisol was extracted from the fish’s holding water and quantified by radioimmunoassay. Collecting mucus by skin swabbing did not trigger an increase in cortisol release compared to control, non-manipulated fish that had not been handled at all, whereas fin clipping led to heightened release of this hormone ( Figure 4 ). This suggests that fin clipping is more stressful for fish than skin swabbing when used to sample DNA. This likely occurs because the fin clipping procedure involves application of the anaesthetic MS-222, whereas skin swabbing does not. Figure 4. Changes in cortisol excretion in zebrafish following skin swabbing without MS-222 (tricaine) treatment or fin clipping following immersion in MS-222. We measured the concentration of cortisol release (in ng) per fish body weight (grams body weight) in an hour. n = 27 fish in each group. Kruskal-Wallis test followed by Dunn’s multiple comparisons test. ** indicates a significant difference compared to control, p < 0.001. NS indicates a non-significant difference compared to control. Reproduced with permission from Tilley et al . (2020) . Detailed methods are available in Tilley et al . (2020) , and the groups shown here have been taken from a larger experiment. Please refer to Tilley et al. (2020) for further control treatment groups and data points. Greater variability in results after clipping compared to swabbing We next examined the effect of skin swabbing and fin clipping on subsequent experimental data. We recorded the opercular beat rate (OBR, a read out of ventilation response to stress in fish ( Bell et al. , 2010 ; Brown et al. , 2005 ), and behaviour in the open field ( Norton and Carreño Gutiérrez, 2019 ), novel tank and black and white tests (for anxiety-like behaviour: Norton and Carreño Gutiérrez, 2019 ; Blaser and Rosemberg, 2012 ; Egan et al. , 2009 ). Both skin swabbing and fin clipping caused complex changes to behaviour that varied over time ( Tilley et al. , 2020 ). Fin clipping caused a decrease in opercular beat rate in sticklebacks and an increase in zebrafish, whereas skin swabbing did not affect this behaviour. In the novel tank test, skin swabbing decreased the distance swum and increased time spent at the bottom of the tank by zebrafish, an index of anxiety-like behaviour on days 2 and 7. Conversely, fin clipping increased the distance swum in a novel tank by sticklebacks on day 1, and decreased zebrafish swimming on day 1 in both the novel tank and open field tests (see figure 7 in Tilley et al. , 2020 ). Fin clipping also led to greater variation in gene expression and behavioural data collected following DNA sampling compared to skin swabbing ( Table 2 ). This means that if fin clips are used for identification, more individuals need to be used in each experimental group in order to test hypotheses with sufficient statistical power ( Tilley et al. , 2020 ). DNA collection by skin swabbing may lead to a reduction of total number of animals needed in gene expression or behavioural experiments. Table 2. Asymptotic test for the equality of coefficients of variation from k populations comparing physiological and behavioural data after skin swabbing or fin clipping. Bold values indicate significant differences compared to control values. Test name Species Control vs clipped Control vs swabbed Test statistic p value Test statistic p value OBR Stickleback 56.96 4.45E−14 2.3 0.13 OBR Zebrafish 75.35 3.94E−18 13.21 0.00027 Cortisol Stickleback 15.4 8.69E−05 0.13 0.72 Cortisol Zebrafish -0.31 0.57 5.64 0.017 Novel tank distance Stickleback 50.49 1.19E−12 0.23 0.63 Novel tank distance Zebrafish 63 1.97E−15 1.31 0.25 Novel tank time Stickleback 71.17 3.27E−17 6.36 0.01 Novel tank time Zebrafish 55.49 9.40E−14 0.02 0.88 Open field distance Stickleback 64.31 1.06E−15 0.32 0.57 Open field distance Zebrafish 60.57 7.09E−15 5.59 0.02 Open field time Stickleback 7.35 0.0067 0.8 0.37 Open field time Zebrafish 56.54 5.49E−14 0.35 0.55 Black white time Stickleback 0.03 0.85 9.77 0.001 Black white time Zebrafish 29.57 5.38E−08 0.24 0.62 Discussion This protocol describes in detail the steps needed to collect DNA from small-bodied fish species using skin swabbing. We have also included findings from our previous research, comparing PCR amplification of genes in zebrafish and stickleback, and investigating the potential for cross-contamination of mucus samples during husbandry ( Tilley et al. , 2020 ; Breacker et al. , 2017 ). We also showed that skin swabbing does not activate release of the stress hormone cortisol, suggesting that it may be less stressful than fin clipping ( Tilley et al. , 2020 ). In summary, both skin swabbing and fin clipping can alter stress axis activation and behaviour. However, skin swabbing appeared to have less impact upon zebrafish and stickleback than fin clipping, since fewer of the read-outs that we measured were altered by this technique. Several previous studies have shown that fin clipping can have side effects that may alter the outcome of experimental studies. For example, fin clipping is painful for fish ( Deakin et al. , 2019 ), and therefore requires them to be anaesthetised, raising the potential for further disruption of the stress response or behaviour. As a result of these observations, concerns have been raised about the welfare implications of collecting DNA by fin clipping. Skin swabbing appears to be a less invasive method for obtaining DNA samples since it only requires a small amount of mucus to be removed from the fish’s flank. In a recent set of experiments, we demonstrated that skin swabbing can be performed in the absence of analgesic or anaesthetic without exacerbating changes in cortisol release ( Tilley et al. , 2020 , 2023 ). However, our previous comparison of both techniques uncovered complex changes in gene expression and behaviour that varied over time following DNA collection. Importantly, we observed a greater variation in behaviour in groups of fish that had been fin clipped compared to those that had been swabbed ( Tilley et al ., 2020 ). Therefore, fewer animals need to be measured in order to generate statistically significant gene expression and behavioural data when DNA is collected with a swab compared to a fin clip. This can improve the quality of data collection and reduce the number of animals used, thereby decreasing the cost of experiments. Removal of tissue during fin clipping led to an acute increase in water-borne cortisol release in both fish species whereas skin swabbing did not ( Tilley et al. , 2020 ). Most changes to experimental data due to fin clipping appeared on the first day after DNA collection. In contrast, the changes in gene expression and behaviour caused by skin swabbing tended to appear between two and seven days after manipulation. However, we also observed changes in the behaviour of control non-manipulated fish over time, demonstrating the difficulty of comparing repeat measures of behaviour and accounting for the influence of routine maintenance on animals ( Tilley et al. , 2020 ). Some differences between species were observed as well. Zebrafish displayed more changes in behaviour than sticklebacks after manipulation; and both fin clipping and skin swabbing had a greater effect on gene expression in stickleback than zebrafish ( Tilley et al., 2020 ). We also confirmed that cross-contamination of mucus samples did not occur when fish were held at high densities overnight. We maintained a group of wild-type and transgenic zebrafish at densities greater than those recommended for normal housing conditions ( Le Vin et al. , 2011 ). Nevertheless, we were still unable to amplify the gene coding for Green fluorescent protein in wild-type fish, despite crowding them together with transgenic Tg(vmat2:GFP) carriers ( Figure 2 ). This suggests that skin swabbing is an appropriate technique to collect DNA even when fish have been in close contact with each other. In summary, our previous research has shown that skin swabbing can yield DNA concentrations and purities that are comparable to fin clipping when combined with a low-cost recovery method ( Table 1 , adapted from Breacker et al ., 2017 ). Swabbing is a suitable technique for small laboratory fish that are as small as 20 mm – when used on smaller animals there is the potential for harm when swabbing ( Breacker et al. , 2017 ). Skin swabbing triggers fewer changes in stress axis activation, behaviour and gene expression than fin clipping. In addition, no sharp scalpels are needed when collecting DNA by skin swabbing, therefore reducing the possibility of harm to researchers. Skin swabbing is simple to perform once researchers have been trained in the technique, although care must be taken to swab the fish from head to tail using very light pressure. In the future, the use of skin swabbing might be expanded to other species that have a mucus layer on their body such as fish, frogs and toads. Data availability Underlying data Open Science Framework: Skin swabbing protocol to collect DNA samples from small-bodied fish species, https://doi.org/10.17605/OSF.IO/HS83T/ . This project contains the following underlying data: - Breacker et al. (2017) raw data.xlsx - Skin swabbing protocol to collect DNA samples from small-bodied fish species file 2.csv - Tilley et al. (2020) raw data.xlsx Extended data Figshare: Swabbing video 1, https://doi.org/10.6084/m9.figshare.25991122 ( Norton et al. , 2024 ). This project contains the following extended data: - Swabbing video 1.mp4 Data are available under the terms of the Creative Commons Attribution 4.0 International license (CC-BY 4.0). Reporting guidelines Open Science Framework: ARRIVE checklist for Tilley et al. , Skin swabbing protocol to collect DNA samples from small-bodied fish species, https://doi.org/10.17605/OSF.IO/HS83T/ . Data are available under the terms of the Creative Commons Attribution 4.0 International license (CC-BY 4.0). Acknowledgements We are grateful to Carl Breacker, Kieran Dewing, Aimee Mason, Dave White and members of the Preclinical Research Facility (University of Leicester) for fish care, and to Volko Straub for insightful discussions about this data. The data for Figures 1 and 2 were collected with help from Carl Breacker and Jonathan McDearmid. The cortisol samples were processed by Marion Sebire and Ioanna Katsiadaki in Cefas. The fin clip and skin swab samples used to prepare Table 2 and Figure 3 were collected by Héctor Carreño Gutierrez. All data are modified from Breacker et al . (2017) and Tilley et al . (2020) . References Albadri S, Del Bene F, Revenu C:Genome editing using CRISPR/Cas9-based knock-in approaches in zebrafish. Methods. 2017; 121-122 : 77–85. PubMed Abstract | Publisher Full Text Barber I, Arnott SA:Split-clutch IVF: A technique to examine indirect fitness consequences of mate preferences in sticklebacks. Behaviour. 2000; 137 : 1129–1140. Publisher Full Text Bell AM, Henderson L, Huntingford FA:Behavioral and respiratory responses to stressors in multiple populations of three-spined sticklebacks that differ in predation pressure. J. Comp. Physiol. B. 2010; 180 : 211–220. PubMed Abstract | Publisher Full Text | Free Full Text Bert B, et al. :Considerations for a European animal welfare standard to evaluate adverse phenotypes in teleost fish. EMBO J. 2016; 35 : 1151–1154. PubMed Abstract | Publisher Full Text | Free Full Text Bitetti A, Mallory AC, Golini E, et al. :MicroRNA degradation by a conserved target RNA regulates animal behaviour. Nat. Struct. Mol. Biol. 2018 Mar; 25 (3): 244–251. Epub 2018 Feb 26. Publisher Full Text Blaser RE, Rosemberg DB:Measures of anxiety in zebrafish (Danio rerio): dissociation of black/white preference and novel tank test. PLoS One. 2012; 7 : e36931. PubMed Abstract | Publisher Full Text | Free Full Text Breacker C, et al. :A Low-Cost Method of Skin Swabbing for the Collection of DNA Samples from Small Laboratory Fish. Zebrafish. 2017; 14 : 35–41. PubMed Abstract | Publisher Full Text | Free Full Text Brønseth T, Folstad I:The effect of parasites on courtship dance in threespine sticklebacks: more than meets the eye?. Can. J. Zool. 1997; 75 : 589–594. Publisher Full Text Brooks R, Endler JA:Female guppies agree to differ: phenotypic and genetic variation in mate-choice behavior and the consequences for sexual selection. Evolution. 2001; 55 : 1644–1655. PubMed Abstract | Publisher Full Text Brown C, Gardner C, Braithwaite VA:Differential stress responses in fish from areas of high- and low-predation pressure. J. Comp. Physiol. B. 2005; 175 : 305–312. Publisher Full Text Campanella JJ, Smalley JV:A minimally invasive method of piscine tissue collection and an analysis of long-term field-storage conditions for samples. BMC Genet. 2006; 7 : 32. PubMed Abstract | Publisher Full Text | Free Full Text Cornet C, Di Donato V, Terriente J:Combining Zebrafish and CRISPR/Cas9: Toward a More Efficient Drug Discovery Pipeline. Front. Pharmacol. 2018; 9 : 703. Publisher Full Text Deakin AG, et al. :Automated monitoring of behaviour in zebrafish after invasive procedures. Sci. Rep. 2019; 9 : 9042. PubMed Abstract | Publisher Full Text | Free Full Text De Lombaert MCM, et al. :Behavioral Characteristics of Adult Zebrafish (Danio rerio) after MS222 Anesthesia for Fin Excision. J. Am. Assoc. Lab. Anim. Sci. 2017; 56 : 377–381. PubMed Abstract | Free Full Text Egan RJ, et al. :Understanding behavioral and physiological phenotypes of stress and anxiety in zebrafish. Behav. Brain Res. 2009; 205 : 38–44. PubMed Abstract | Publisher Full Text | Free Full Text Ellis T, et al. :A non-invasive stress assay based upon measurement of free cortisol released into the water by rainbow trout. J. Fish Biol. 2004; 65 : 1233–1252. Publisher Full Text Feltz CJ, Miller GE:An asymptotic test for the equality of coefficients of variation from k populations. Stat. Med. 1996; 15 : 647–658. <a target="xrefwindow" id="d625642e2302" href="https://doi.org/10.1002/(SICI)1097-0258(19960330)15:6 Publisher Full Text Flecknell P:Replacement, reduction and refinement. ALTEX. 2002; 19 : 73–78. PubMed Abstract Hason M, Bartunek P:Zebrafish Models of Cancer-New Insights on Modeling Human Cancer in a Non-Mammalian Vertebrate. Genes (Basel) 2019 Nov 15; 10 (11): 935. Publisher Full Text Higashijima S:Transgenic zebrafish expressing fluorescent proteins in central nervous system neurons. Develop. Growth Differ. 2008; 50 : 407–413. Publisher Full Text Home Office:Annual Statistics of Scientific Procedures on Living Animals Great Britain.2019. Reference Source Kalueff AV, Stewart AM, Gerlai R:Zebrafish as an emerging model for studying complex brain disorders. Trends Pharmacol. Sci. 2014; 35 : 63–75. PubMed Abstract | Publisher Full Text | Free Full Text Le Vin AL, et al. :Validation of swabs as a non-destructive and relatively non-invasive DNA sampling method in fish. Mol. Ecol. Resour. 2011; 11 : 107–109. PubMed Abstract | Publisher Full Text Lidster K, et al. :International survey on the use and welfare of zebrafish Danio rerio in research. J. Fish Biol. 2017; 90 : 1891–1905. PubMed Abstract | Publisher Full Text Mirimin L, et al. :A quick, least-invasive, inexpensive and reliable method for sampling Gadus morhua postlarvae for genetic analysis. J. Fish Biol. 2011; 79 : 801–805. PubMed Abstract | Publisher Full Text NC3Rs:Five Reasons Why Zebrafish Make Excellent Research Models.2014. Reference Source Norton WHJ:Toward developmental models of psychiatric disorders in zebrafish. Front Neural Circuits. 2013 Apr 26; 7 : 79. eCollection. Publisher Full Text Norton WHJ, Stumpenhorst K, Faus-Kesler T, et al. :Modulation of Fgfr1a signaling in zebrafish reveals a genetic basis for the aggression-boldness syndrome. J. Neurosci. 2011 Sep 28; 31 (39): 13796–807. PubMed Abstract | Publisher Full Text | Free Full Text Norton WHJ, Gutiérrez HC:The three-spined stickleback as a model for behavioural neuroscience. PLoS One. 2019; 14 : e0213320. PubMed Abstract | Publisher Full Text | Free Full Text Norton W, Tilley CA, Barber I:Swabbing video 1. f1000research.com. Media. 2024. Publisher Full Text Percie du Sert N, et al. :The experimental design assistant. PLoS Biol. 2017; 15 : e2003779. PubMed Abstract | Publisher Full Text | Free Full Text Richardson R, Tracey-White D, Webster A, Moosajee M:The zebrafish eye-a paradigm for investigating human ocular genetics. Eye. 2017 Jan; 31 (1): 68–86. Epub 2016 Sep 9. Publisher Full Text Scott A, Sheldrick E, Flint A:Measurement of 17α, 20β-dihydroxy-4-pregnen-3-one in plasma of trout (Salmo gairdneri Richardson): seasonal changes and response to salmon pituitary extract. Gen. Comp. Endocrinol. 1982; 46 : 444–451. PubMed Abstract | Publisher Full Text Schaeck M, et al. :Fish as research tools: alternatives to in vivo experiments. Altern. Lab. Anim. 2013; 41 : 219–229. PubMed Abstract | Publisher Full Text Schroeder PG, Sneddon LU:Exploring the efficacy of immersion analgesics in zebrafish using an integrative approach. Appl. Anim. Behav. Sci. 2017; 187 : 93–102. Publisher Full Text Sebire M, et al. :Prozac affects stickleback nest quality without altering androgen, spiggin or aggression levels during a 21-day breeding test. Aquat. Toxicol. 2015; 168 : 78–89. PubMed Abstract | Publisher Full Text Sebire M, Katsiadaki I, Scott AP:Non-invasive measurement of 11-ketotestosterone, cortisol and androstenedione in male three-spined stickleback (Gasterosteus aculeatus). Gen. Comp. Endocrinol. 2007; 152 : 30–38. PubMed Abstract | Publisher Full Text Sebire M, Katsiadaki I, Scott AP:Further refinement of the non-invasive procedure for measuring steroid production in the male three-spined stickleback Gasterosteus aculeatus. J. Fish Biol. 2009; 75 : 2082–2094. PubMed Abstract | Publisher Full Text Spence R, et al. :The behaviour and ecology of the zebrafish, Danio rerio. Biol. Rev. Camb. Philos. Soc. 2008; 83 : 13–34. PubMed Abstract | Publisher Full Text Taslima K, et al. :DNA sampling from mucus in the Nile tilapia, Oreochromis niloticus: minimally invasive sampling for aquaculture-related genetics research. Aquac. Res. 2015; 47 (12): 4032–4037. Tilley CA, et al. :Skin swabbing is a refined technique to collect DNA from model fish species. Sci. Rep. 2020; 10 : 18212. PubMed Abstract | Publisher Full Text | Free Full Text Tilley CA, et al. :Validating skin swabbing as a refined technique to collect DNA from small-bodied fish species. F1000Res. 2023; 12 : 28. Venta PJ, et al. :A 13-plex of tetra- and penta-STRs to identify zebrafish. Sci. Rep. 2020; 10 : 3851. PubMed Abstract | Publisher Full Text | Free Full Text Wen L, Wei W, Gu W, et al. :Visualization of monoaminergic neurons and neurotoxicity of MPTP in live transgenic zebrafish. Dev. Biol. 2008; 314 : 84–92. PubMed Abstract | Publisher Full Text White LJ, et al. :The impact of social context on behaviour and the recovery from welfare challenges in zebrafish, Danio rerio. Anim. Behav. 2017; 132 : 189–199. Publisher Full Text Wyart C, Del Bene F:Let there be light: zebrafish neurobiology and the optogenetic revolution. Rev. Neurosci. 2011; 22 : 121–130. PubMed Abstract | Publisher Full Text Xing L, et al. :Rapid and efficient zebrafish genotyping using PCR with high-resolution melt analysis. J. Vis. Exp. 2014; e51138. Publisher Full Text Footnotes 1 We have posted a swab in DNA extraction solution to ourselves using the normal postal service. DNA was recovered successfully from the swab one week later. 2 This protocol can be completed in around four hours – one hour to extract DNA, two hours to run a PCR and one hour to visualise the product on an electrophoresis gel. We routinely identify around twenty animals at a time. 3 Other research groups have reported DNA extraction by the hot-shot method following skin swabbing: e.g. Venta et al . (2020) . 4 The tubes can be stored at -80°C overnight if required. Comments on this article Comments (1) Version 2 VERSION 2 PUBLISHED 27 Jun 2024 Revised Comment ADD YOUR COMMENT Version 1 VERSION 1 PUBLISHED 19 Oct 2021 Discussion is closed on this version, please comment on the latest version above. Reader Comment 22 Oct 2021 Tim Moser , University of Otago, New Zealand 22 Oct 2021 Reader Comment Table 1 is missing information on which columns refer to the swabbing results and which represent the fin clipping (though it can be deduced from the caption). Competing Interests: Nothing to disclose. Table 1 is missing information on which columns refer to the swabbing results and which represent the fin clipping (though it can be deduced from the caption). Table 1 is missing information on which columns refer to the swabbing results and which represent the fin clipping (though it can be deduced from the caption). Competing Interests: Nothing to disclose. Close Report a concern Discussion is closed on this version, please comment on the latest version above. Author details Author details 1 Genetics and Genome Biology, School of Biological Sciences, University of Leicester, Leicester, England, LE1 7RH, UK 2 Neuroscience, Psychology and Behaviour, University of Leicester, Leicester, Leicestershire, LE1 7RH, UK 3 School of Animal and Rural Sciences, Nottingham Trent University, Nottingham, NG25 0QF, UK 4 Department of Life Sciences, Edward Llwyd Building, Aberystwyth University, Aberystwyth, Wales, SY23 3DA, UK 5 Institute of Biology, Eotvos Lorand University, Budapest, Hungary 6 Genetics and Genome Biology, University of Leicester, Leicester, Leicestershire, LE1 7RH, UK Ceinwen Tilley Roles: Conceptualization, Investigation, Methodology, Writing – Original Draft Preparation, Writing – Review & Editing Iain Barber Roles: Conceptualization, Funding Acquisition, Investigation, Methodology, Supervision, Writing – Original Draft Preparation, Writing – Review & Editing William Norton Roles: Conceptualization, Funding Acquisition, Investigation, Methodology, Supervision, Writing – Original Draft Preparation, Writing – Review & Editing Competing interests No competing interests were disclosed. Grant information This research was supported by an NC3Rs research Grant to I.B. and W.H.J.N (NC/R001049/1). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Article Versions (2) version 2 Revised Published: 27 Jun 2024, 10:1064 https://doi.org/10.12688/f1000research.73115.2 version 1 Published: 19 Oct 2021, 10:1064 https://doi.org/10.12688/f1000research.73115.1 Copyright © 2024 Tilley C et al . This is an open access article distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Download Export To Sciwheel Bibtex EndNote ProCite Ref. Manager (RIS) Sente metrics Views Downloads F1000Research - - PubMed Central info_outline Data from PMC are received and updated monthly. - - Citations open_in_new 0 open_in_new 0 open_in_new SEE MORE DETAILS CITE how to cite this article Tilley C, Barber I and Norton W. Skin swabbing protocol to collect DNA samples from small-bodied fish species [version 2; peer review: 2 approved] . F1000Research 2024, 10 :1064 ( https://doi.org/10.12688/f1000research.73115.2 ) NOTE: If applicable, it is important to ensure the information in square brackets after the title is included in all citations of this article. COPY CITATION DETAILS track receive updates on this article Track an article to receive email alerts on any updates to this article. TRACK THIS ARTICLE Share Open Peer Review Current Reviewer Status: ? Key to Reviewer Statuses VIEW HIDE Approved The paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved Fundamental flaws in the paper seriously undermine the findings and conclusions Version 2 VERSION 2 PUBLISHED 27 Jun 2024 Revised Views 0 Cite How to cite this report: Margiotta-Casaluci L. Reviewer Report For: Skin swabbing protocol to collect DNA samples from small-bodied fish species [version 2; peer review: 2 approved] . F1000Research 2024, 10 :1064 ( https://doi.org/10.5256/f1000research.165869.r296346 ) The direct URL for this report is: https://f1000research.com/articles/10-1064/v2#referee-response-296346 NOTE: it is important to ensure the information in square brackets after the title is included in this citation. Close Copy Citation Details Reviewer Report 22 Aug 2024 Luigi Margiotta-Casaluci , Kings College London, London, UK Approved VIEWS 0 https://doi.org/10.5256/f1000research.165869.r296346 The authors have satisfactorily addressed all the comments and ... Continue reading READ ALL The authors have satisfactorily addressed all the comments and concerns that I shared in the review of Version 1. Competing Interests: No competing interests were disclosed. Reviewer Expertise: Fish physiology, endocrinology, behaviour, 3Rs, toxicology. Referee suggested by the NC3Rs for their scientific expertise and experience in assessing 3Rs impact. I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard. Close READ LESS CITE CITE HOW TO CITE THIS REPORT Margiotta-Casaluci L. Reviewer Report For: Skin swabbing protocol to collect DNA samples from small-bodied fish species [version 2; peer review: 2 approved] . F1000Research 2024, 10 :1064 ( https://doi.org/10.5256/f1000research.165869.r296346 ) The direct URL for this report is: https://f1000research.com/articles/10-1064/v2#referee-response-296346 NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article. COPY CITATION DETAILS Report a concern Respond or Comment COMMENT ON THIS REPORT Views 0 Cite How to cite this report: Cason E. Reviewer Report For: Skin swabbing protocol to collect DNA samples from small-bodied fish species [version 2; peer review: 2 approved] . F1000Research 2024, 10 :1064 ( https://doi.org/10.5256/f1000research.165869.r296345 ) The direct URL for this report is: https://f1000research.com/articles/10-1064/v2#referee-response-296345 NOTE: it is important to ensure the information in square brackets after the title is included in this citation. Close Copy Citation Details Reviewer Report 28 Jun 2024 Errol Cason , University of the Free State, Bloemfontein, South Africa Approved VIEWS 0 https://doi.org/10.5256/f1000research.165869.r296345 no ... Continue reading READ ALL no further comments Competing Interests: No competing interests were disclosed. Reviewer Expertise: Genetics, Genomics, Microbiomes, I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard. Close READ LESS CITE CITE HOW TO CITE THIS REPORT Cason E. Reviewer Report For: Skin swabbing protocol to collect DNA samples from small-bodied fish species [version 2; peer review: 2 approved] . F1000Research 2024, 10 :1064 ( https://doi.org/10.5256/f1000research.165869.r296345 ) The direct URL for this report is: https://f1000research.com/articles/10-1064/v2#referee-response-296345 NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article. COPY CITATION DETAILS Report a concern Respond or Comment COMMENT ON THIS REPORT Version 1 VERSION 1 PUBLISHED 19 Oct 2021 Views 0 Cite How to cite this report: Cason E. Reviewer Report For: Skin swabbing protocol to collect DNA samples from small-bodied fish species [version 2; peer review: 2 approved] . F1000Research 2024, 10 :1064 ( https://doi.org/10.5256/f1000research.76741.r144865 ) The direct URL for this report is: https://f1000research.com/articles/10-1064/v1#referee-response-144865 NOTE: it is important to ensure the information in square brackets after the title is included in this citation. Close Copy Citation Details Reviewer Report 17 Aug 2022 Errol Cason , University of the Free State, Bloemfontein, South Africa Approved VIEWS 0 https://doi.org/10.5256/f1000research.76741.r144865 This paper provides detailed steps to collect DNA from small-bodied fish species using skin swabbing. This is offered as a alternative, easier, less invasive and more ethical methods of acquiring DNA from fish during trials when compared to the standard ... Continue reading READ ALL This paper provides detailed steps to collect DNA from small-bodied fish species using skin swabbing. This is offered as a alternative, easier, less invasive and more ethical methods of acquiring DNA from fish during trials when compared to the standard method of fin clipping. Evidence is provided that enough DNA an be obtained for downstream application with less stress, discomfort and pain to the fish. In essence this paper is a "manual" for methods already put out in Breaker et al. (2017) and Tilley et al. (2020). 1 , 2 It appears to only exist as a easily accessible and referenceable recipe. It will save scientists time and effort to go and dig through the other papers if all they really want is A) to know if the method works and B) how to do it. While this is not a novel study, and is just a bullet point + video version of previously published methods, I do however feel that this is not a bad thing. I can see how the other two papers might not be getting the traction they deserve for a method that mostly works just as well but you don't need to mutilate an animal to get DNA. I therefore see no reason not to index this. Are a suitable application and appropriate end-users identified? Yes Are the 3Rs implications of the work described accurately? Yes If applicable, is the statistical analysis and its interpretation appropriate? Yes Is the rationale for developing the new method (or application) clearly explained? Yes Is the description of the method technically sound? Yes Are sufficient details provided to allow replication of the method development and its use by others? Yes If any results are presented, are all the source data underlying the results available to ensure full reproducibility? Yes Are the conclusions about the method and its performance adequately supported by the findings presented in the article? Yes References 1. Breacker C, Barber I, Norton WH, McDearmid JR, et al.: A Low-Cost Method of Skin Swabbing for the Collection of DNA Samples from Small Laboratory Fish. Zebrafish . 14 (1): 35-41 PubMed Abstract | Publisher Full Text 2. Tilley C, Carreño Gutierrez H, Sebire M, Obasaju O, et al.: Skin swabbing is a refined technique to collect DNA from model fish species. Scientific Reports . 2020; 10 (1). Publisher Full Text Competing Interests: No competing interests were disclosed. Reviewer Expertise: Genetics, Genomics, Microbiomes, I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard. Close READ LESS CITE CITE HOW TO CITE THIS REPORT Cason E. Reviewer Report For: Skin swabbing protocol to collect DNA samples from small-bodied fish species [version 2; peer review: 2 approved] . F1000Research 2024, 10 :1064 ( https://doi.org/10.5256/f1000research.76741.r144865 ) The direct URL for this report is: https://f1000research.com/articles/10-1064/v1#referee-response-144865 NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article. COPY CITATION DETAILS Report a concern Respond or Comment COMMENT ON THIS REPORT Views 0 Cite How to cite this report: Margiotta-Casaluci L. Reviewer Report For: Skin swabbing protocol to collect DNA samples from small-bodied fish species [version 2; peer review: 2 approved] . F1000Research 2024, 10 :1064 ( https://doi.org/10.5256/f1000research.76741.r117243 ) The direct URL for this report is: https://f1000research.com/articles/10-1064/v1#referee-response-117243 NOTE: it is important to ensure the information in square brackets after the title is included in this citation. Close Copy Citation Details Reviewer Report 27 Jan 2022 Luigi Margiotta-Casaluci , Kings College London, London, UK Approved with Reservations VIEWS 0 https://doi.org/10.5256/f1000research.76741.r117243 General comments In this article, the authors describe a skin swabbing protocol for DNA collection from small laboratory fish species that could provide a suitable alternative to the commonly used fin clipping procedure. The latter is ... Continue reading READ ALL General comments In this article, the authors describe a skin swabbing protocol for DNA collection from small laboratory fish species that could provide a suitable alternative to the commonly used fin clipping procedure. The latter is an increasingly common procedure used in most zebrafish laboratories at global level. As mentioned by the authors, 85% of zebrafish laboratories use fin clipping to collect DNA. This procedure requires anaesthesia and involve surgical removal of tissue; therefore, the development of alternative minimally invasive methods in this area may have significant implications for the welfare of laboratory fish. The alternative skin swabbing protocol presented in this article is well described, and the work provides a valuable contribution to the advancement of laboratory fish welfare. However - although the potential welfare benefits of skin swabbing vs fin clipping may sound obvious - I believe that the specific datasets presented in the article do not allow a robust cost-benefit assessment of the protocol from a 3Rs perspective and the evaluation of its superiority compared to the commonly used fin clipping procedure. Hence, I suggest that that aspect of the article should be improved, expanded, and integrated with other data (if available). Specific comments and suggestions are provided below. Skin swabbing protocol The methodology described in the article appears to be sound, and I believe that the details provided allow to reliably replicate the simple method in other laboratories. The supplemental video clips are clear and very informative. Despite a lower DNA yield obtained with skin swabs, the DNA samples collected using both methods had similar levels of purity. The authors demonstrated that DNA extracted from skin mucus allows a reliable amplification of target genes, and that no mucus cross contamination occurs in fish held at high density. The supplemental videos are very good and clearly demonstrate the key practical steps. In the video the operator apparently restrains the fish on the sponge by gently covering the eyes with a gloved finger. I suppose this procedure calms the fish and reduces potential harm. Do the authors suggest that this should be a key step of the protocol? If yes, I suggest to add more details about this step in the main text. In the published protocol the authors reported that fish were immersed in lidocaine for 45 minutes before performing the procedure. Can the authors explain why this duration was selected? Does water temperature affect uptake and pharmacokinetics of lidocaine in different species, and in turn the incubation time? Considering the time needed to perform the skin swab, how many fish should be added to the lidocaine solution to ensure that no fish experiences an excessive exposure? Considering the use of static water conditions for the exposure to lidocaine, I foresee that the temperature may change very rapidly unless the room temperature is controlled. Can the authors recommend a specific strategy to ensure the maintenance of optimal water temperature (and hence the reduction of stress) throughout the lidocaine exposure phase? E.g. using an incubator or a dedicated genotyping rack. Table 1 shows the comparison of DNA concentration from fin clips and skin swabs of the same sticklebacks and zebrafish. I believe the top row displaying the column titles is missing. Cross-contamination To evaluate the potential cross contamination of mucus samples when fish are held at high density, the authors kept 10 AB wild-type and 10 transgenic zebrafish in a small 3 L tank overnight. The analysis show that, in these conditions, there is no contamination. However, it appears that the authors reached this conclusion after a non-random sampling where all ABs were swabbed first, followed by all transgenic fish (displaying a longer tail). Although one may conclude that there is no cross contamination in the fish tank, the experimental design does not allow to evaluate whether the full procedure itself (i.e. including the transfer onto the sponge) may be a source of contamination. Although the probability is low, do the authors think that the sponge may represent a contamination source? If yes, do they recommend to replace the sponge after sampling a certain number of fish (e.g. how many?). Similar considerations are valid for gloves and nets. How often should these elements be replaced/washed? Claims of adversity of fin clipping – Introduction and discussion The Introduction reports the following statement: “ However, despite its popularity, there is evidence that fin clipping can alter health and welfare, leading to infection and altering growth and survival (Taslima et al., 2015) ”. However, Taslima et al. (2015) 1 appears to be an aquaculture-related paper focused on Nile tilapia and, as far as I can see, that paper does not provide any evidence of fin clipping-induced damage. Taslima et al. (2015) provided the following generic statement “ tissue biopsy may have negative impacts on fish, potentially including infection and effects on survival, growth or behaviour”, and to support this statement they cited Le Vin et al. (2011) (this paper is also cited in the present manuscript).[red-2] The latter concerns the validation of swabs methods for DNA sampling in fish. Again, the study did not investigate the adverse effects of fin clipping. On the other hand, Le Vin et al. (2011) also stated that fin clipping can be detrimental. This time, to support that statement, they cited several papers from the 60s, 70s, and 80s. However, those papers appear to be referred mainly to aquaculture and field ecology studies where fish are reintroduced in the environment after fin-clipping. Going back to the introduction of the present paper, I believe that whereas the potential adverse effects of fin clipping on behaviour are evidenced with appropriate supporting citations, the other potential adverse effects on infection, growth. and survival are not. Is there any evidence that fin clipping can adversely affect growth, survival, and infection susceptibility in a laboratory setting? If not, the authors should specific that it is not the case, and discuss potential effects observed in aquaculture studies providing an accurate citation and reporting of the primary papers. If yes, it would be useful to have specific data on this important aspect. Similarly, in the Discussion, the authors wrote that “ Several previous studies have shown that fin clipping can have side effects that may alter the outcome of experimental studies. For example, it can lead to secondary infections and elevate the non-specific immune response (Dash et al., 2018) ”. However, Dash et al. (2018) do not seem to mention fin clipping at all, as it is a study focused on the role played by fish mucus in health maintenance. 3 Please, revise this reference and replace with primary papers, if possible. Behavioural studies and variability of behavioural and stress endpoints In the present paper, the negative effects of fin clipping of fish behaviour was used as key argument to justify the potential superiority of skin swabbing over fin clipping. However, I believe that this argument is only weakly supported by the data presented here. I suggest to add more data, if available, to strengthen this argument. The methodological description of the behavioural tests is too basic and requires more details. For example, in the novel tank diving test, fish were observed/recorded for the first five minutes. Is this observation time justified by other studies for both stickleback and zebrafish? If yes, what are the supporting references? Were multiple fish/tanks filmed simultaneously using multiple tanks? If yes, did the operator add the fish using a specific sequence or removed the first seconds of the video where the operator was still in the room? (The operator in the room is a source of stress). The results section indicates that multiple time points were tested. However, the different timepoints and the rationale behind their selection are not described in the methods section. The importance of providing an accurate description of the methods is clearly demonstrated by the following, and more important, point. The results section indicates that there is “ Greater variability in results after clipping compared to swabbing ”. I found that statement confusing as, by itself, it leads one to believe that there is a variability in genotyping results whereas the authors refer to behavioural and stress endpoints (which are not the focus of the paper). Later, the article provides the following statement: “ Behavioural data collected subsequent to fin clipping showed more variable data compared to skin swabbed animals, meaning that more individuals need to be measured to test hypotheses with sufficient statistical power (Tilley et al., 2020). 4 This means that collecting DNA by skin swabbing may lead to a reduction of total number of animals needed in experiments ”. In my opinion, it is unclear why skin swabbing could allow to use fewer animals. Do the authors refer to a specific context? I suggest to clarify this point or to remove it. Overall, this specific aspect of the work (i.e. data variability) has been highlighted very strongly in the manuscript; however, my main concern is the data does not appear to support the hypothesis of a treatment-dependent effect. The present manuscript does not provide any figure or table of the behavioural data; however, this data can be retrieved from Tilley et al. (2020). Reading the latter, it is possible to note that the observed behavioural effects appeared to be (almost always) driven by fish handing procedures and not by fin clipping or skin swabbing themselves. The same consideration is valid for the assessment of opercular beats. The fact that control fish display behavioural responses more often (or as often) as fish that underwent DNA collection weakens the argument of treatment-specific effects, and hence treatment-specific benefits, including 3Rs benefits. Can the authors provide more data concerning this aspect? Effects on cortisol release To measure the effects of the different procedures on the stress axis, the authors measured cortisol excretion in the tanks of fish that underwent 1) no manipulation, 2) skin swabbing, 3) fin clipping. I believe that the experimental design described in the article is not suitable to provide an answer to the specific research question considered here. Although measuring the cortisol released by a non-manipulated group provided a useful reference value, I believe that there are multiple factors to consider for a more rigorous comparison. 1) Fish handing – it is known that fish netting and air contact are major stress factors that induce an increase of cortisol release in the surrounding water (Ellis, James, Scott 2004). 5 Measuring cortisol concentrations in tanks of non-manipulated fish will very likely indicate lower values, independently from skin swabbing or fin clipping. Hence, a more appropriate control would be represented by fish that underwent the same handling (i.e. netting and transfer to a new tank) without DNA sampling procedure. 2) The pre-procedure treatment of fish that underwent skin swabbing or fin clipping were very different (i.e. 45 minutes exposure to lidocaine in a confined space versus rapid treatment with MS-222). From the results presented here, it is not possible to evaluate whether the 45 minutes pre-treatment with lidocaine did or did not affect cortisol release. In conclusion, this suggests that an experiment aimed at evaluating the stress response to different DNA sampling procedures should include specific negative controls for each treatment type and fish handling procedure. Other comments In the discussion, the authors reported that “ changes in gene expression and behaviour caused by skin swabbing tended to appear between two and seven days after manipulation, perhaps due to the activation of an immune response, or changes in ionic or osmotic regulation (Dash et al., 2018 )’. In my opinion, this possibility is concerning and should be explored in further studies, as it may hamper any 3Rs benefit of skin swabs. For example, are swabbed fish in the laboratory more susceptible to infection and disease in the longer term compared to fin clipped fish? The reference de Lombaert et al. (2017) is not present in the reference list. Are a suitable application and appropriate end-users identified? Yes Are the 3Rs implications of the work described accurately? Partly If applicable, is the statistical analysis and its interpretation appropriate? Partly Is the rationale for developing the new method (or application) clearly explained? Partly Is the description of the method technically sound? Yes Are sufficient details provided to allow replication of the method development and its use by others? Yes If any results are presented, are all the source data underlying the results available to ensure full reproducibility? Yes Are the conclusions about the method and its performance adequately supported by the findings presented in the article? Partly References 1. Taslima K, et al: DNA sampling from mucus in the Nile tilapia, Oreochromis niloticus: minimally invasive sampling for aquaculture-related genetics research dust. Aquac. Res . 2015; 47 (12). 2. Le Vin AL, Adam A, Tedder A, Arnold KE, et al.: Validation of swabs as a non-destructive and relatively non-invasive DNA sampling method in fish. Mol Ecol Resour . 2011; 11 (1): 107-9 PubMed Abstract | Publisher Full Text 3. Dash S, Das SK, Samal J, Thatoi HN: Epidermal mucus, a major determinant in fish health: a review. Iran J Vet Res . 2018; 19 (2): 72-81 PubMed Abstract 4. Norton W, Tilley CA, Barber I: Swabbing videos 1 and 2. f1000research.com Media . 2021. 5. Ellis T, James J, Stewart C, Scott A: A non-invasive stress assay based upon measurement of free cortisol released into the water by rainbow trout. Journal of Fish Biology . 2004; 65 (5): 1233-1252 Publisher Full Text Competing Interests: No competing interests were disclosed. Reviewer Expertise: Fish physiology, endocrinology, behaviour, 3Rs, toxicology. Referee suggested by the NC3Rs for their scientific expertise and experience in assessing 3Rs impact. I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above. Close READ LESS CITE CITE HOW TO CITE THIS REPORT Margiotta-Casaluci L. Reviewer Report For: Skin swabbing protocol to collect DNA samples from small-bodied fish species [version 2; peer review: 2 approved] . F1000Research 2024, 10 :1064 ( https://doi.org/10.5256/f1000research.76741.r117243 ) The direct URL for this report is: https://f1000research.com/articles/10-1064/v1#referee-response-117243 NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article. COPY CITATION DETAILS Report a concern Author Response 27 Jun 2024 Will Norton , Genetics and Genome Biology, University of Leicester, Leicester, LE1 7RH, UK 27 Jun 2024 Author Response Author Response: The reviewer has provided us with excellent feedback upon the first version of this study. We have answered these comments in full, and our responses to the comments ... Continue reading Author Response: The reviewer has provided us with excellent feedback upon the first version of this study. We have answered these comments in full, and our responses to the comments are included below. We are very sorry that it has taken us so long to respond to these suggestions, and we hope that you still accept to re-review this paper. A change in person circumstances prevented us from addressing your suggestions sooner. Thank you for reading this study so thoroughly, and for helping us to improve this manuscript. Reviewer Comment: Although the potential welfare benefits of skin swabbing vs fin clipping may sound obvious, I believe that the specific datasets presented in the article do not allow a robust cost-benefit assessment of the protocol from a 3Rs perspective and the evaluation of its superiority compared to the commonly used fin clipping procedure. Hence, I suggest that that aspect of the article should be improved, expanded, and integrated with other data (if available). Specific comments and suggestions are provided below. 1. The methodology described in the article appears to be sound, and I believe that the details provided allow to reliably replicate the simple method in other laboratories. The supplemental video clips are clear and very informative. Author Response: We thank the reviewer for this positive comment about our article. The video forms a core part of this protocol, and bearing this in mind we have now made a new, more professional, film demonstrating the swabbing technique. This video has been incorporated into the updated version of this paper. Reviewer Comment: 2. Despite a lower DNA yield obtained with skin swabs, the DNA samples collected using both methods had similar levels of purity. The authors demonstrated that DNA extracted from skin mucus allows a reliable amplification of target genes, and that no mucus cross contamination occurs in fish held at high density . Author Response: Thank you for highlighting this aspect of our research. Reviewer Comment: 3. The supplemental videos are very good and clearly demonstrate the key practical steps. In the video the operator apparently restrains the fish on the sponge by gently covering the eyes with a gloved finger. I suppose this procedure calms the fish and reduces potential harm. Do the authors suggest that this should be a key step of the protocol? If yes, I suggest to add more details about this step in the main text. Author Response: The reviewer is correct that gently covering the eyes of the fish can help stop them from moving. We routinely carry this out using a hand net. Our new video shows this step of the protocol in more detail. We have also added this information to the main text describing the technique as suggested. Reviewer Comment: 4. In the published protocol the authors reported that fish were immersed in lidocaine for 45 minutes before performing the procedure. Can the authors explain why this duration was selected? Does water temperature affect uptake and pharmacokinetics of lidocaine in different species, and in turn the incubation time? Considering the time needed to perform the skin swab, how many fish should be added to the lidocaine solution to ensure that no fish experiences an excessive exposure? Considering the use of static water conditions for the exposure to lidocaine, I foresee that the temperature may change very rapidly unless the room temperature is controlled. Can the authors recommend a specific strategy to ensure the maintenance of optimal water temperature (and hence the reduction of stress) throughout the lidocaine exposure phase? E.g. using an incubator or a dedicated genotyping rack. Author Response: Since submitting the first version of this protocol, we have published a follow up study that shows that lidocaine treatment is not needed for DNA collection by skin swabbing (Tilley et al., 2023, Validating skin swabbing as a refined technique to collect DNA from small-bodied fish species). We have therefore removed all mentions of lidocaine pre-treatment from the protocol steps included here. Reviewer Comment: 5. Table 1 shows the comparison of DNA concentration from fin clips and skin swabs of the same sticklebacks and zebrafish. I believe the top row displaying the column titles is missing. Author Response: Thank you for spotting this error. Table 1 does miss the top column indicating whether the samples came from swabbed or fin clipped fish. We have now replaced this table with a new version that contains this information. Reviewer Comment: 6. To evaluate the potential cross contamination of mucus samples when fish are held at high density, the authors kept 10 AB wild-type and 10 transgenic zebrafish in a small 3 L tank overnight. The analysis show that, in these conditions, there is no contamination. However, it appears that the authors reached this conclusion after a non-random sampling where all ABs were swabbed first, followed by all transgenic fish (displaying a longer tail). Although one may conclude that there is no cross contamination in the fish tank, the experimental design does not allow to evaluate whether the full procedure itself (i.e. including the transfer onto the sponge) may be a source of contamination. Although the probability is low, do the authors think that the sponge may represent a contamination source? If yes, do they recommend to replace the sponge after sampling a certain number of fish (e.g. how many?). Author Response: The reviewer makes a good point about the possible transfer of mucus on the sponge leading to cross-contamination. We routinely rinse the sponge between sample collection, an important detail that was not described in our protocol. We have now added this information to the updated version of the protocol as suggested. Reviewer Comment: 7. Similar considerations are valid for gloves and nets. How often should these elements be replaced/washed? Author Response: We routinely wash the net that is used to restrain the fish between sampling. This detail has been added to the protocol as per the reviewer’s suggestion. However, we do not change gloves, because we have not noticed any issues with cross-contamination, and this is our standard practice when handling animals and genotyping. Reviewer Comment: 8. The Introduction reports the following statement: “However, despite its popularity, there is evidence that fin clipping can alter health and welfare, leading to infection and altering growth and survival (Taslima et al., 2015)”. However, Taslima et al. (2015) appears to be an aquaculture-related paper focused on Nile tilapia and, as far as I can see, that paper does not provide any evidence of fin clipping-induced damage. Taslima et al. (2015) provided the following generic statement “tissue biopsy may have negative impacts on fish, potentially including infection and effects on survival, growth or behaviour”, and to support this statement they cited Le Vin et al. (2011) (this paper is also cited in the present manuscript). The latter concerns the validation of swabs methods for DNA sampling in fish. Again, the study did not investigate the adverse effects of fin clipping. On the other hand, Le Vin et al. (2011) also stated that fin clipping can be detrimental. This time, to support that statement, they cited several papers from the 60s, 70s, and 80s. However, those papers appear to be referred mainly to aquaculture and field ecology studies where fish are reintroduced in the environment after fin-clipping. Going back to the introduction of the present paper, I believe that whereas the potential adverse effects of fin clipping on behaviour are evidenced with appropriate supporting citations, the other potential adverse effects on infection, growth. and survival are not. Is there any evidence that fin clipping can adversely affect growth, survival, and infection susceptibility in a laboratory setting? If not, the authors should specific that it is not the case, and discuss potential effects observed in aquaculture studies providing an accurate citation and reporting of the primary papers. If yes, it would be useful to have specific data on this important aspect. Author Response: The reviewer makes an important point here. Our statement about effects on growth, infection and survival are not sufficiently supported by the references that we have provided. This has occurred because we over-interpreted the Taslima et al. study, which in turn mis-cited earlier papers including Le Vin et al. 2011. We have now modified the introduction section to reflect this, deleting the suggestion that fin clipping can alter growth, survival and infection. We apologise for this mistake, and hope that the new version of the introduction is acceptable in its current format. Reviewer Comment: 9. Similarly, in the Discussion, the authors wrote that “Several previous studies have shown that fin clipping can have side effects that may alter the outcome of experimental studies. For example, it can lead to secondary infections and elevate the non-specific immune response (Dash et al., 2018)”. However, Dash et al. (2018) do not seem to mention fin clipping at all, as it is a study focused on the role played by fish mucus in health maintenance. Please, revise this reference and replace with primary papers, if possible. Author Response: I am afraid that this is also a mistake on our part. The Dash et al. paper does indeed focus on mucus sampling and not fin clipping, making our statement incorrect. We have removed this sentence in the discussion as suggested by the reviewer. Although skin swabbing is a refined technique compared to fin clipping, it is important not to overstate its benefits. We thank the reviewer for spotting these errors and pointing them out to us. Reviewer Comment: 10. In the present paper, the negative effects of fin clipping of fish behaviour was used as key argument to justify the potential superiority of skin swabbing over fin clipping. However, I believe that this argument is only weakly supported by the data presented here. I suggest to add more data, if available, to strengthen this argument. Author Response: The main aim of this paper is to provide an easy-to-follow protocol for researchers who wish to adopt skin swabbing for DNA collection. The experimental data that is shown aims to provide a background for the technique, and to convince researchers to give it a go. All of the data shown here is modified from previous publications (e.g., Tilley et al., 2020; Breacker et al., 2017). However, the reviewer is correct that this issue could be presented more clearly. To address this issue, we have now added a second data table, modified from Tilley et al., 2020, that shows the greater variability in gene expression and behavioural data following fin clipping compared to skin swabbing. Reviewer Comment: 11. The methodological description of the behavioural tests is too basic and requires more details. For example, in the novel tank diving test, fish were observed/recorded for the first five minutes. Is this observation time justified by other studies for both stickleback and zebrafish? If yes, what are the supporting references? Were multiple fish/tanks filmed simultaneously using multiple tanks? If yes, did the operator add the fish using a specific sequence or removed the first seconds of the video where the operator was still in the room? (The operator in the room is a source of stress). The results section indicates that multiple time points were tested. However, the different timepoints and the rationale behind their selection are not described in the methods section. The importance of providing an accurate description of the methods is clearly demonstrated by the following, and more important, point. Author Response: As per the responses above, the behavioural information mentioned here is not the main focus of this paper. Rather, we have used data from Tilley et al., 2020 to demonstrate the variability in experimental results seen after fin clipping. The behaviour methods that we have used here are standard for the field of zebrafish research. The novel tank diving test protocol mentioned here is based upon the published work of Egan and colleagues in zebrafish, (Egan et al., 2009 – now included in the reference list), and modified for sticklebacks by Gutierrez and colleagues (Norton and Gutierrez, 2019). In brief, we recorded a single fish at a time for 5 minutes, and analysed the entirety of the behavioural response. Each timepoint that we looked at was recorded separately, using the same setup in the same room. The experimenter was present in the room throughout recording. Reviewer Comment: 12. The results section indicates that there is “Greater variability in results after clipping compared to swabbing”. I found that statement confusing as, by itself, it leads one to believe that there is a variability in genotyping results whereas the authors refer to behavioural and stress endpoints (which are not the focus of the paper). Later, the article provides the following statement: “Behavioural data collected subsequent to fin clipping showed more variable data compared to skin swabbed animals, meaning that more individuals need to be measured to test hypotheses with sufficient statistical power (Tilley et al., 2020). This means that collecting DNA by skin swabbing may lead to a reduction of total number of animals needed in experiments”. In my opinion, it is unclear why skin swabbing could allow to use fewer animals. Do the authors refer to a specific context? I suggest to clarify this point or to remove it. Author Response: We published data showing that compared to skin swabbing, fin clipping led to a greater variation in gene expression and behavioural data in Tilley et al., 2020. This data used an asymptotic test for the equality of coefficients of variation from k populations to contrast physiological and behavioural data after skin swabbing or fin clipping. When compared to control undisturbed fish, fin clipping led a large variation in data whereas skin swabbing did not. This means that fewer animals would need to be included in each experimental group in order to collect statistically significant data, if skin swabbing is used for DNA collection rather fin clipping. We have included table 2 in this manuscript, and re-written the results and discussion section to make this clearer. Reviewer Comment: 13. Overall, this specific aspect of the work (i.e. data variability) has been highlighted very strongly in the manuscript; however, my main concern is the data does not appear to support the hypothesis of a treatment-dependent effect. The present manuscript does not provide any figure or table of the behavioural data; however, this data can be retrieved from Tilley et al. (2020). Reading the latter, it is possible to note that the observed behavioural effects appeared to be (almost always) driven by fish handing procedures and not by fin clipping or skin swabbing themselves. The same consideration is valid for the assessment of opercular beats. The fact that control fish display behavioural responses more often (or as often) as fish that underwent DNA collection weakens the argument of treatment-specific effects, and hence treatment-specific benefits, including 3Rs benefits. Can the authors provide more data concerning this aspect? Author Response: The data shown here is modified from Tilley et al., 2020, where we investigate which components of the fin clipping and swabbing procedures trigger a stress response in fish. While handling fish does trigger stress, we were able to show that the fin clipping procedure in its entirety is more stressful than the swabbing or handling alone. We have included a new table 2 in this version of the manuscript that shows some of this information, as suggested by the reviewer. Reviewer Comment: 14. To measure the effects of the different procedures on the stress axis, the authors measured cortisol excretion in the tanks of fish that underwent 1) no manipulation, 2) skin swabbing, 3) fin clipping. I believe that the experimental design described in the article is not suitable to provide an answer to the specific research question considered here. Although measuring the cortisol released by a non-manipulated group provided a useful reference value, I believe that there are multiple factors to consider for a more rigorous comparison. 1) Fish handing – it is known that fish netting and air contact are major stress factors that induce an increase of cortisol release in the surrounding water (Ellis, James, Scott 2004). Measuring cortisol concentrations in tanks of non-manipulated fish will very likely indicate lower values, independently from skin swabbing or fin clipping. Hence, a more appropriate control would be represented by fish that underwent the same handling (i.e. netting and transfer to a new tank) without DNA sampling procedure. 2) The pre-procedure treatment of fish that underwent skin swabbing or fin clipping were very different (i.e. 45 minutes exposure to lidocaine in a confined space versus rapid treatment with MS-222). From the results presented here, it is not possible to evaluate whether the 45 minutes pre-treatment with lidocaine did or did not affect cortisol release. In conclusion, this suggests that an experiment aimed at evaluating the stress response to different DNA sampling procedures should include specific negative controls for each treatment type and fish handling procedure. Author Response: The author is right to note that handling fish, and removing them from their tank could affect cortisol release. We have already investigated the constituent steps that make up the swabbing and fin clipping procedures, and these results have been published in two separate papers (Tilley et al., 2020; Tilley et al., 2023). Since the focus of this paper is the step-by-step protocol that to aid uptake of the swabbing technique, we have chosen not to include all of this data here. We have made this point clearer, by modifying the legend to figure 4 (showing the cortisol results) to read “Please refer to Tilley et al., 2020 for further control treatment groups and data points”. Reviewer Comment: 15. In the discussion, the authors reported that “changes in gene expression and behaviour caused by skin swabbing tended to appear between two and seven days after manipulation, perhaps due to the activation of an immune response, or changes in ionic or osmotic regulation (Dash et al., 2018)’. In my opinion, this possibility is concerning and should be explored in further studies, as it may hamper any 3Rs benefit of skin swabs. For example, are swabbed fish in the laboratory more susceptible to infection and disease in the longer term compared to fin clipped fish? Author Response: Thank you for this suggestion. We don’t know why we see such as delayed impact of swabbing upon gene expression and behaviour, but we are currently investigating this. We hope to be able to report the effect of swabbing upon the mucus layer in more detail in a future publication. Reviewer Comment: 16. The reference de Lombaert et al. (2017) is not present in the reference list. Author Response: Thank you for spotting this error. We have now added de Lombaert et al., 2017 to the reference list. Author Response: The reviewer has provided us with excellent feedback upon the first version of this study. We have answered these comments in full, and our responses to the comments are included below. We are very sorry that it has taken us so long to respond to these suggestions, and we hope that you still accept to re-review this paper. A change in person circumstances prevented us from addressing your suggestions sooner. Thank you for reading this study so thoroughly, and for helping us to improve this manuscript. Reviewer Comment: Although the potential welfare benefits of skin swabbing vs fin clipping may sound obvious, I believe that the specific datasets presented in the article do not allow a robust cost-benefit assessment of the protocol from a 3Rs perspective and the evaluation of its superiority compared to the commonly used fin clipping procedure. Hence, I suggest that that aspect of the article should be improved, expanded, and integrated with other data (if available). Specific comments and suggestions are provided below. 1. The methodology described in the article appears to be sound, and I believe that the details provided allow to reliably replicate the simple method in other laboratories. The supplemental video clips are clear and very informative. Author Response: We thank the reviewer for this positive comment about our article. The video forms a core part of this protocol, and bearing this in mind we have now made a new, more professional, film demonstrating the swabbing technique. This video has been incorporated into the updated version of this paper. Reviewer Comment: 2. Despite a lower DNA yield obtained with skin swabs, the DNA samples collected using both methods had similar levels of purity. The authors demonstrated that DNA extracted from skin mucus allows a reliable amplification of target genes, and that no mucus cross contamination occurs in fish held at high density . Author Response: Thank you for highlighting this aspect of our research. Reviewer Comment: 3. The supplemental videos are very good and clearly demonstrate the key practical steps. In the video the operator apparently restrains the fish on the sponge by gently covering the eyes with a gloved finger. I suppose this procedure calms the fish and reduces potential harm. Do the authors suggest that this should be a key step of the protocol? If yes, I suggest to add more details about this step in the main text. Author Response: The reviewer is correct that gently covering the eyes of the fish can help stop them from moving. We routinely carry this out using a hand net. Our new video shows this step of the protocol in more detail. We have also added this information to the main text describing the technique as suggested. Reviewer Comment: 4. In the published protocol the authors reported that fish were immersed in lidocaine for 45 minutes before performing the procedure. Can the authors explain why this duration was selected? Does water temperature affect uptake and pharmacokinetics of lidocaine in different species, and in turn the incubation time? Considering the time needed to perform the skin swab, how many fish should be added to the lidocaine solution to ensure that no fish experiences an excessive exposure? Considering the use of static water conditions for the exposure to lidocaine, I foresee that the temperature may change very rapidly unless the room temperature is controlled. Can the authors recommend a specific strategy to ensure the maintenance of optimal water temperature (and hence the reduction of stress) throughout the lidocaine exposure phase? E.g. using an incubator or a dedicated genotyping rack. Author Response: Since submitting the first version of this protocol, we have published a follow up study that shows that lidocaine treatment is not needed for DNA collection by skin swabbing (Tilley et al., 2023, Validating skin swabbing as a refined technique to collect DNA from small-bodied fish species). We have therefore removed all mentions of lidocaine pre-treatment from the protocol steps included here. Reviewer Comment: 5. Table 1 shows the comparison of DNA concentration from fin clips and skin swabs of the same sticklebacks and zebrafish. I believe the top row displaying the column titles is missing. Author Response: Thank you for spotting this error. Table 1 does miss the top column indicating whether the samples came from swabbed or fin clipped fish. We have now replaced this table with a new version that contains this information. Reviewer Comment: 6. To evaluate the potential cross contamination of mucus samples when fish are held at high density, the authors kept 10 AB wild-type and 10 transgenic zebrafish in a small 3 L tank overnight. The analysis show that, in these conditions, there is no contamination. However, it appears that the authors reached this conclusion after a non-random sampling where all ABs were swabbed first, followed by all transgenic fish (displaying a longer tail). Although one may conclude that there is no cross contamination in the fish tank, the experimental design does not allow to evaluate whether the full procedure itself (i.e. including the transfer onto the sponge) may be a source of contamination. Although the probability is low, do the authors think that the sponge may represent a contamination source? If yes, do they recommend to replace the sponge after sampling a certain number of fish (e.g. how many?). Author Response: The reviewer makes a good point about the possible transfer of mucus on the sponge leading to cross-contamination. We routinely rinse the sponge between sample collection, an important detail that was not described in our protocol. We have now added this information to the updated version of the protocol as suggested. Reviewer Comment: 7. Similar considerations are valid for gloves and nets. How often should these elements be replaced/washed? Author Response: We routinely wash the net that is used to restrain the fish between sampling. This detail has been added to the protocol as per the reviewer’s suggestion. However, we do not change gloves, because we have not noticed any issues with cross-contamination, and this is our standard practice when handling animals and genotyping. Reviewer Comment: 8. The Introduction reports the following statement: “However, despite its popularity, there is evidence that fin clipping can alter health and welfare, leading to infection and altering growth and survival (Taslima et al., 2015)”. However, Taslima et al. (2015) appears to be an aquaculture-related paper focused on Nile tilapia and, as far as I can see, that paper does not provide any evidence of fin clipping-induced damage. Taslima et al. (2015) provided the following generic statement “tissue biopsy may have negative impacts on fish, potentially including infection and effects on survival, growth or behaviour”, and to support this statement they cited Le Vin et al. (2011) (this paper is also cited in the present manuscript). The latter concerns the validation of swabs methods for DNA sampling in fish. Again, the study did not investigate the adverse effects of fin clipping. On the other hand, Le Vin et al. (2011) also stated that fin clipping can be detrimental. This time, to support that statement, they cited several papers from the 60s, 70s, and 80s. However, those papers appear to be referred mainly to aquaculture and field ecology studies where fish are reintroduced in the environment after fin-clipping. Going back to the introduction of the present paper, I believe that whereas the potential adverse effects of fin clipping on behaviour are evidenced with appropriate supporting citations, the other potential adverse effects on infection, growth. and survival are not. Is there any evidence that fin clipping can adversely affect growth, survival, and infection susceptibility in a laboratory setting? If not, the authors should specific that it is not the case, and discuss potential effects observed in aquaculture studies providing an accurate citation and reporting of the primary papers. If yes, it would be useful to have specific data on this important aspect. Author Response: The reviewer makes an important point here. Our statement about effects on growth, infection and survival are not sufficiently supported by the references that we have provided. This has occurred because we over-interpreted the Taslima et al. study, which in turn mis-cited earlier papers including Le Vin et al. 2011. We have now modified the introduction section to reflect this, deleting the suggestion that fin clipping can alter growth, survival and infection. We apologise for this mistake, and hope that the new version of the introduction is acceptable in its current format. Reviewer Comment: 9. Similarly, in the Discussion, the authors wrote that “Several previous studies have shown that fin clipping can have side effects that may alter the outcome of experimental studies. For example, it can lead to secondary infections and elevate the non-specific immune response (Dash et al., 2018)”. However, Dash et al. (2018) do not seem to mention fin clipping at all, as it is a study focused on the role played by fish mucus in health maintenance. Please, revise this reference and replace with primary papers, if possible. Author Response: I am afraid that this is also a mistake on our part. The Dash et al. paper does indeed focus on mucus sampling and not fin clipping, making our statement incorrect. We have removed this sentence in the discussion as suggested by the reviewer. Although skin swabbing is a refined technique compared to fin clipping, it is important not to overstate its benefits. We thank the reviewer for spotting these errors and pointing them out to us. Reviewer Comment: 10. In the present paper, the negative effects of fin clipping of fish behaviour was used as key argument to justify the potential superiority of skin swabbing over fin clipping. However, I believe that this argument is only weakly supported by the data presented here. I suggest to add more data, if available, to strengthen this argument. Author Response: The main aim of this paper is to provide an easy-to-follow protocol for researchers who wish to adopt skin swabbing for DNA collection. The experimental data that is shown aims to provide a background for the technique, and to convince researchers to give it a go. All of the data shown here is modified from previous publications (e.g., Tilley et al., 2020; Breacker et al., 2017). However, the reviewer is correct that this issue could be presented more clearly. To address this issue, we have now added a second data table, modified from Tilley et al., 2020, that shows the greater variability in gene expression and behavioural data following fin clipping compared to skin swabbing. Reviewer Comment: 11. The methodological description of the behavioural tests is too basic and requires more details. For example, in the novel tank diving test, fish were observed/recorded for the first five minutes. Is this observation time justified by other studies for both stickleback and zebrafish? If yes, what are the supporting references? Were multiple fish/tanks filmed simultaneously using multiple tanks? If yes, did the operator add the fish using a specific sequence or removed the first seconds of the video where the operator was still in the room? (The operator in the room is a source of stress). The results section indicates that multiple time points were tested. However, the different timepoints and the rationale behind their selection are not described in the methods section. The importance of providing an accurate description of the methods is clearly demonstrated by the following, and more important, point. Author Response: As per the responses above, the behavioural information mentioned here is not the main focus of this paper. Rather, we have used data from Tilley et al., 2020 to demonstrate the variability in experimental results seen after fin clipping. The behaviour methods that we have used here are standard for the field of zebrafish research. The novel tank diving test protocol mentioned here is based upon the published work of Egan and colleagues in zebrafish, (Egan et al., 2009 – now included in the reference list), and modified for sticklebacks by Gutierrez and colleagues (Norton and Gutierrez, 2019). In brief, we recorded a single fish at a time for 5 minutes, and analysed the entirety of the behavioural response. Each timepoint that we looked at was recorded separately, using the same setup in the same room. The experimenter was present in the room throughout recording. Reviewer Comment: 12. The results section indicates that there is “Greater variability in results after clipping compared to swabbing”. I found that statement confusing as, by itself, it leads one to believe that there is a variability in genotyping results whereas the authors refer to behavioural and stress endpoints (which are not the focus of the paper). Later, the article provides the following statement: “Behavioural data collected subsequent to fin clipping showed more variable data compared to skin swabbed animals, meaning that more individuals need to be measured to test hypotheses with sufficient statistical power (Tilley et al., 2020). This means that collecting DNA by skin swabbing may lead to a reduction of total number of animals needed in experiments”. In my opinion, it is unclear why skin swabbing could allow to use fewer animals. Do the authors refer to a specific context? I suggest to clarify this point or to remove it. Author Response: We published data showing that compared to skin swabbing, fin clipping led to a greater variation in gene expression and behavioural data in Tilley et al., 2020. This data used an asymptotic test for the equality of coefficients of variation from k populations to contrast physiological and behavioural data after skin swabbing or fin clipping. When compared to control undisturbed fish, fin clipping led a large variation in data whereas skin swabbing did not. This means that fewer animals would need to be included in each experimental group in order to collect statistically significant data, if skin swabbing is used for DNA collection rather fin clipping. We have included table 2 in this manuscript, and re-written the results and discussion section to make this clearer. Reviewer Comment: 13. Overall, this specific aspect of the work (i.e. data variability) has been highlighted very strongly in the manuscript; however, my main concern is the data does not appear to support the hypothesis of a treatment-dependent effect. The present manuscript does not provide any figure or table of the behavioural data; however, this data can be retrieved from Tilley et al. (2020). Reading the latter, it is possible to note that the observed behavioural effects appeared to be (almost always) driven by fish handing procedures and not by fin clipping or skin swabbing themselves. The same consideration is valid for the assessment of opercular beats. The fact that control fish display behavioural responses more often (or as often) as fish that underwent DNA collection weakens the argument of treatment-specific effects, and hence treatment-specific benefits, including 3Rs benefits. Can the authors provide more data concerning this aspect? Author Response: The data shown here is modified from Tilley et al., 2020, where we investigate which components of the fin clipping and swabbing procedures trigger a stress response in fish. While handling fish does trigger stress, we were able to show that the fin clipping procedure in its entirety is more stressful than the swabbing or handling alone. We have included a new table 2 in this version of the manuscript that shows some of this information, as suggested by the reviewer. Reviewer Comment: 14. To measure the effects of the different procedures on the stress axis, the authors measured cortisol excretion in the tanks of fish that underwent 1) no manipulation, 2) skin swabbing, 3) fin clipping. I believe that the experimental design described in the article is not suitable to provide an answer to the specific research question considered here. Although measuring the cortisol released by a non-manipulated group provided a useful reference value, I believe that there are multiple factors to consider for a more rigorous comparison. 1) Fish handing – it is known that fish netting and air contact are major stress factors that induce an increase of cortisol release in the surrounding water (Ellis, James, Scott 2004). Measuring cortisol concentrations in tanks of non-manipulated fish will very likely indicate lower values, independently from skin swabbing or fin clipping. Hence, a more appropriate control would be represented by fish that underwent the same handling (i.e. netting and transfer to a new tank) without DNA sampling procedure. 2) The pre-procedure treatment of fish that underwent skin swabbing or fin clipping were very different (i.e. 45 minutes exposure to lidocaine in a confined space versus rapid treatment with MS-222). From the results presented here, it is not possible to evaluate whether the 45 minutes pre-treatment with lidocaine did or did not affect cortisol release. In conclusion, this suggests that an experiment aimed at evaluating the stress response to different DNA sampling procedures should include specific negative controls for each treatment type and fish handling procedure. Author Response: The author is right to note that handling fish, and removing them from their tank could affect cortisol release. We have already investigated the constituent steps that make up the swabbing and fin clipping procedures, and these results have been published in two separate papers (Tilley et al., 2020; Tilley et al., 2023). Since the focus of this paper is the step-by-step protocol that to aid uptake of the swabbing technique, we have chosen not to include all of this data here. We have made this point clearer, by modifying the legend to figure 4 (showing the cortisol results) to read “Please refer to Tilley et al., 2020 for further control treatment groups and data points”. Reviewer Comment: 15. In the discussion, the authors reported that “changes in gene expression and behaviour caused by skin swabbing tended to appear between two and seven days after manipulation, perhaps due to the activation of an immune response, or changes in ionic or osmotic regulation (Dash et al., 2018)’. In my opinion, this possibility is concerning and should be explored in further studies, as it may hamper any 3Rs benefit of skin swabs. For example, are swabbed fish in the laboratory more susceptible to infection and disease in the longer term compared to fin clipped fish? Author Response: Thank you for this suggestion. We don’t know why we see such as delayed impact of swabbing upon gene expression and behaviour, but we are currently investigating this. We hope to be able to report the effect of swabbing upon the mucus layer in more detail in a future publication. Reviewer Comment: 16. The reference de Lombaert et al. (2017) is not present in the reference list. Author Response: Thank you for spotting this error. We have now added de Lombaert et al., 2017 to the reference list. Competing Interests: We have no competing interests to declare. Close Report a concern Respond or Comment COMMENTS ON THIS REPORT Author Response 27 Jun 2024 Will Norton , Genetics and Genome Biology, University of Leicester, Leicester, LE1 7RH, UK 27 Jun 2024 Author Response Author Response: The reviewer has provided us with excellent feedback upon the first version of this study. We have answered these comments in full, and our responses to the comments ... Continue reading Author Response: The reviewer has provided us with excellent feedback upon the first version of this study. We have answered these comments in full, and our responses to the comments are included below. We are very sorry that it has taken us so long to respond to these suggestions, and we hope that you still accept to re-review this paper. A change in person circumstances prevented us from addressing your suggestions sooner. Thank you for reading this study so thoroughly, and for helping us to improve this manuscript. Reviewer Comment: Although the potential welfare benefits of skin swabbing vs fin clipping may sound obvious, I believe that the specific datasets presented in the article do not allow a robust cost-benefit assessment of the protocol from a 3Rs perspective and the evaluation of its superiority compared to the commonly used fin clipping procedure. Hence, I suggest that that aspect of the article should be improved, expanded, and integrated with other data (if available). Specific comments and suggestions are provided below. 1. The methodology described in the article appears to be sound, and I believe that the details provided allow to reliably replicate the simple method in other laboratories. The supplemental video clips are clear and very informative. Author Response: We thank the reviewer for this positive comment about our article. The video forms a core part of this protocol, and bearing this in mind we have now made a new, more professional, film demonstrating the swabbing technique. This video has been incorporated into the updated version of this paper. Reviewer Comment: 2. Despite a lower DNA yield obtained with skin swabs, the DNA samples collected using both methods had similar levels of purity. The authors demonstrated that DNA extracted from skin mucus allows a reliable amplification of target genes, and that no mucus cross contamination occurs in fish held at high density . Author Response: Thank you for highlighting this aspect of our research. Reviewer Comment: 3. The supplemental videos are very good and clearly demonstrate the key practical steps. In the video the operator apparently restrains the fish on the sponge by gently covering the eyes with a gloved finger. I suppose this procedure calms the fish and reduces potential harm. Do the authors suggest that this should be a key step of the protocol? If yes, I suggest to add more details about this step in the main text. Author Response: The reviewer is correct that gently covering the eyes of the fish can help stop them from moving. We routinely carry this out using a hand net. Our new video shows this step of the protocol in more detail. We have also added this information to the main text describing the technique as suggested. Reviewer Comment: 4. In the published protocol the authors reported that fish were immersed in lidocaine for 45 minutes before performing the procedure. Can the authors explain why this duration was selected? Does water temperature affect uptake and pharmacokinetics of lidocaine in different species, and in turn the incubation time? Considering the time needed to perform the skin swab, how many fish should be added to the lidocaine solution to ensure that no fish experiences an excessive exposure? Considering the use of static water conditions for the exposure to lidocaine, I foresee that the temperature may change very rapidly unless the room temperature is controlled. Can the authors recommend a specific strategy to ensure the maintenance of optimal water temperature (and hence the reduction of stress) throughout the lidocaine exposure phase? E.g. using an incubator or a dedicated genotyping rack. Author Response: Since submitting the first version of this protocol, we have published a follow up study that shows that lidocaine treatment is not needed for DNA collection by skin swabbing (Tilley et al., 2023, Validating skin swabbing as a refined technique to collect DNA from small-bodied fish species). We have therefore removed all mentions of lidocaine pre-treatment from the protocol steps included here. Reviewer Comment: 5. Table 1 shows the comparison of DNA concentration from fin clips and skin swabs of the same sticklebacks and zebrafish. I believe the top row displaying the column titles is missing. Author Response: Thank you for spotting this error. Table 1 does miss the top column indicating whether the samples came from swabbed or fin clipped fish. We have now replaced this table with a new version that contains this information. Reviewer Comment: 6. To evaluate the potential cross contamination of mucus samples when fish are held at high density, the authors kept 10 AB wild-type and 10 transgenic zebrafish in a small 3 L tank overnight. The analysis show that, in these conditions, there is no contamination. However, it appears that the authors reached this conclusion after a non-random sampling where all ABs were swabbed first, followed by all transgenic fish (displaying a longer tail). Although one may conclude that there is no cross contamination in the fish tank, the experimental design does not allow to evaluate whether the full procedure itself (i.e. including the transfer onto the sponge) may be a source of contamination. Although the probability is low, do the authors think that the sponge may represent a contamination source? If yes, do they recommend to replace the sponge after sampling a certain number of fish (e.g. how many?). Author Response: The reviewer makes a good point about the possible transfer of mucus on the sponge leading to cross-contamination. We routinely rinse the sponge between sample collection, an important detail that was not described in our protocol. We have now added this information to the updated version of the protocol as suggested. Reviewer Comment: 7. Similar considerations are valid for gloves and nets. How often should these elements be replaced/washed? Author Response: We routinely wash the net that is used to restrain the fish between sampling. This detail has been added to the protocol as per the reviewer’s suggestion. However, we do not change gloves, because we have not noticed any issues with cross-contamination, and this is our standard practice when handling animals and genotyping. Reviewer Comment: 8. The Introduction reports the following statement: “However, despite its popularity, there is evidence that fin clipping can alter health and welfare, leading to infection and altering growth and survival (Taslima et al., 2015)”. However, Taslima et al. (2015) appears to be an aquaculture-related paper focused on Nile tilapia and, as far as I can see, that paper does not provide any evidence of fin clipping-induced damage. Taslima et al. (2015) provided the following generic statement “tissue biopsy may have negative impacts on fish, potentially including infection and effects on survival, growth or behaviour”, and to support this statement they cited Le Vin et al. (2011) (this paper is also cited in the present manuscript). The latter concerns the validation of swabs methods for DNA sampling in fish. Again, the study did not investigate the adverse effects of fin clipping. On the other hand, Le Vin et al. (2011) also stated that fin clipping can be detrimental. This time, to support that statement, they cited several papers from the 60s, 70s, and 80s. However, those papers appear to be referred mainly to aquaculture and field ecology studies where fish are reintroduced in the environment after fin-clipping. Going back to the introduction of the present paper, I believe that whereas the potential adverse effects of fin clipping on behaviour are evidenced with appropriate supporting citations, the other potential adverse effects on infection, growth. and survival are not. Is there any evidence that fin clipping can adversely affect growth, survival, and infection susceptibility in a laboratory setting? If not, the authors should specific that it is not the case, and discuss potential effects observed in aquaculture studies providing an accurate citation and reporting of the primary papers. If yes, it would be useful to have specific data on this important aspect. Author Response: The reviewer makes an important point here. Our statement about effects on growth, infection and survival are not sufficiently supported by the references that we have provided. This has occurred because we over-interpreted the Taslima et al. study, which in turn mis-cited earlier papers including Le Vin et al. 2011. We have now modified the introduction section to reflect this, deleting the suggestion that fin clipping can alter growth, survival and infection. We apologise for this mistake, and hope that the new version of the introduction is acceptable in its current format. Reviewer Comment: 9. Similarly, in the Discussion, the authors wrote that “Several previous studies have shown that fin clipping can have side effects that may alter the outcome of experimental studies. For example, it can lead to secondary infections and elevate the non-specific immune response (Dash et al., 2018)”. However, Dash et al. (2018) do not seem to mention fin clipping at all, as it is a study focused on the role played by fish mucus in health maintenance. Please, revise this reference and replace with primary papers, if possible. Author Response: I am afraid that this is also a mistake on our part. The Dash et al. paper does indeed focus on mucus sampling and not fin clipping, making our statement incorrect. We have removed this sentence in the discussion as suggested by the reviewer. Although skin swabbing is a refined technique compared to fin clipping, it is important not to overstate its benefits. We thank the reviewer for spotting these errors and pointing them out to us. Reviewer Comment: 10. In the present paper, the negative effects of fin clipping of fish behaviour was used as key argument to justify the potential superiority of skin swabbing over fin clipping. However, I believe that this argument is only weakly supported by the data presented here. I suggest to add more data, if available, to strengthen this argument. Author Response: The main aim of this paper is to provide an easy-to-follow protocol for researchers who wish to adopt skin swabbing for DNA collection. The experimental data that is shown aims to provide a background for the technique, and to convince researchers to give it a go. All of the data shown here is modified from previous publications (e.g., Tilley et al., 2020; Breacker et al., 2017). However, the reviewer is correct that this issue could be presented more clearly. To address this issue, we have now added a second data table, modified from Tilley et al., 2020, that shows the greater variability in gene expression and behavioural data following fin clipping compared to skin swabbing. Reviewer Comment: 11. The methodological description of the behavioural tests is too basic and requires more details. For example, in the novel tank diving test, fish were observed/recorded for the first five minutes. Is this observation time justified by other studies for both stickleback and zebrafish? If yes, what are the supporting references? Were multiple fish/tanks filmed simultaneously using multiple tanks? If yes, did the operator add the fish using a specific sequence or removed the first seconds of the video where the operator was still in the room? (The operator in the room is a source of stress). The results section indicates that multiple time points were tested. However, the different timepoints and the rationale behind their selection are not described in the methods section. The importance of providing an accurate description of the methods is clearly demonstrated by the following, and more important, point. Author Response: As per the responses above, the behavioural information mentioned here is not the main focus of this paper. Rather, we have used data from Tilley et al., 2020 to demonstrate the variability in experimental results seen after fin clipping. The behaviour methods that we have used here are standard for the field of zebrafish research. The novel tank diving test protocol mentioned here is based upon the published work of Egan and colleagues in zebrafish, (Egan et al., 2009 – now included in the reference list), and modified for sticklebacks by Gutierrez and colleagues (Norton and Gutierrez, 2019). In brief, we recorded a single fish at a time for 5 minutes, and analysed the entirety of the behavioural response. Each timepoint that we looked at was recorded separately, using the same setup in the same room. The experimenter was present in the room throughout recording. Reviewer Comment: 12. The results section indicates that there is “Greater variability in results after clipping compared to swabbing”. I found that statement confusing as, by itself, it leads one to believe that there is a variability in genotyping results whereas the authors refer to behavioural and stress endpoints (which are not the focus of the paper). Later, the article provides the following statement: “Behavioural data collected subsequent to fin clipping showed more variable data compared to skin swabbed animals, meaning that more individuals need to be measured to test hypotheses with sufficient statistical power (Tilley et al., 2020). This means that collecting DNA by skin swabbing may lead to a reduction of total number of animals needed in experiments”. In my opinion, it is unclear why skin swabbing could allow to use fewer animals. Do the authors refer to a specific context? I suggest to clarify this point or to remove it. Author Response: We published data showing that compared to skin swabbing, fin clipping led to a greater variation in gene expression and behavioural data in Tilley et al., 2020. This data used an asymptotic test for the equality of coefficients of variation from k populations to contrast physiological and behavioural data after skin swabbing or fin clipping. When compared to control undisturbed fish, fin clipping led a large variation in data whereas skin swabbing did not. This means that fewer animals would need to be included in each experimental group in order to collect statistically significant data, if skin swabbing is used for DNA collection rather fin clipping. We have included table 2 in this manuscript, and re-written the results and discussion section to make this clearer. Reviewer Comment: 13. Overall, this specific aspect of the work (i.e. data variability) has been highlighted very strongly in the manuscript; however, my main concern is the data does not appear to support the hypothesis of a treatment-dependent effect. The present manuscript does not provide any figure or table of the behavioural data; however, this data can be retrieved from Tilley et al. (2020). Reading the latter, it is possible to note that the observed behavioural effects appeared to be (almost always) driven by fish handing procedures and not by fin clipping or skin swabbing themselves. The same consideration is valid for the assessment of opercular beats. The fact that control fish display behavioural responses more often (or as often) as fish that underwent DNA collection weakens the argument of treatment-specific effects, and hence treatment-specific benefits, including 3Rs benefits. Can the authors provide more data concerning this aspect? Author Response: The data shown here is modified from Tilley et al., 2020, where we investigate which components of the fin clipping and swabbing procedures trigger a stress response in fish. While handling fish does trigger stress, we were able to show that the fin clipping procedure in its entirety is more stressful than the swabbing or handling alone. We have included a new table 2 in this version of the manuscript that shows some of this information, as suggested by the reviewer. Reviewer Comment: 14. To measure the effects of the different procedures on the stress axis, the authors measured cortisol excretion in the tanks of fish that underwent 1) no manipulation, 2) skin swabbing, 3) fin clipping. I believe that the experimental design described in the article is not suitable to provide an answer to the specific research question considered here. Although measuring the cortisol released by a non-manipulated group provided a useful reference value, I believe that there are multiple factors to consider for a more rigorous comparison. 1) Fish handing – it is known that fish netting and air contact are major stress factors that induce an increase of cortisol release in the surrounding water (Ellis, James, Scott 2004). Measuring cortisol concentrations in tanks of non-manipulated fish will very likely indicate lower values, independently from skin swabbing or fin clipping. Hence, a more appropriate control would be represented by fish that underwent the same handling (i.e. netting and transfer to a new tank) without DNA sampling procedure. 2) The pre-procedure treatment of fish that underwent skin swabbing or fin clipping were very different (i.e. 45 minutes exposure to lidocaine in a confined space versus rapid treatment with MS-222). From the results presented here, it is not possible to evaluate whether the 45 minutes pre-treatment with lidocaine did or did not affect cortisol release. In conclusion, this suggests that an experiment aimed at evaluating the stress response to different DNA sampling procedures should include specific negative controls for each treatment type and fish handling procedure. Author Response: The author is right to note that handling fish, and removing them from their tank could affect cortisol release. We have already investigated the constituent steps that make up the swabbing and fin clipping procedures, and these results have been published in two separate papers (Tilley et al., 2020; Tilley et al., 2023). Since the focus of this paper is the step-by-step protocol that to aid uptake of the swabbing technique, we have chosen not to include all of this data here. We have made this point clearer, by modifying the legend to figure 4 (showing the cortisol results) to read “Please refer to Tilley et al., 2020 for further control treatment groups and data points”. Reviewer Comment: 15. In the discussion, the authors reported that “changes in gene expression and behaviour caused by skin swabbing tended to appear between two and seven days after manipulation, perhaps due to the activation of an immune response, or changes in ionic or osmotic regulation (Dash et al., 2018)’. In my opinion, this possibility is concerning and should be explored in further studies, as it may hamper any 3Rs benefit of skin swabs. For example, are swabbed fish in the laboratory more susceptible to infection and disease in the longer term compared to fin clipped fish? Author Response: Thank you for this suggestion. We don’t know why we see such as delayed impact of swabbing upon gene expression and behaviour, but we are currently investigating this. We hope to be able to report the effect of swabbing upon the mucus layer in more detail in a future publication. Reviewer Comment: 16. The reference de Lombaert et al. (2017) is not present in the reference list. Author Response: Thank you for spotting this error. We have now added de Lombaert et al., 2017 to the reference list. Author Response: The reviewer has provided us with excellent feedback upon the first version of this study. We have answered these comments in full, and our responses to the comments are included below. We are very sorry that it has taken us so long to respond to these suggestions, and we hope that you still accept to re-review this paper. A change in person circumstances prevented us from addressing your suggestions sooner. Thank you for reading this study so thoroughly, and for helping us to improve this manuscript. Reviewer Comment: Although the potential welfare benefits of skin swabbing vs fin clipping may sound obvious, I believe that the specific datasets presented in the article do not allow a robust cost-benefit assessment of the protocol from a 3Rs perspective and the evaluation of its superiority compared to the commonly used fin clipping procedure. Hence, I suggest that that aspect of the article should be improved, expanded, and integrated with other data (if available). Specific comments and suggestions are provided below. 1. The methodology described in the article appears to be sound, and I believe that the details provided allow to reliably replicate the simple method in other laboratories. The supplemental video clips are clear and very informative. Author Response: We thank the reviewer for this positive comment about our article. The video forms a core part of this protocol, and bearing this in mind we have now made a new, more professional, film demonstrating the swabbing technique. This video has been incorporated into the updated version of this paper. Reviewer Comment: 2. Despite a lower DNA yield obtained with skin swabs, the DNA samples collected using both methods had similar levels of purity. The authors demonstrated that DNA extracted from skin mucus allows a reliable amplification of target genes, and that no mucus cross contamination occurs in fish held at high density . Author Response: Thank you for highlighting this aspect of our research. Reviewer Comment: 3. The supplemental videos are very good and clearly demonstrate the key practical steps. In the video the operator apparently restrains the fish on the sponge by gently covering the eyes with a gloved finger. I suppose this procedure calms the fish and reduces potential harm. Do the authors suggest that this should be a key step of the protocol? If yes, I suggest to add more details about this step in the main text. Author Response: The reviewer is correct that gently covering the eyes of the fish can help stop them from moving. We routinely carry this out using a hand net. Our new video shows this step of the protocol in more detail. We have also added this information to the main text describing the technique as suggested. Reviewer Comment: 4. In the published protocol the authors reported that fish were immersed in lidocaine for 45 minutes before performing the procedure. Can the authors explain why this duration was selected? Does water temperature affect uptake and pharmacokinetics of lidocaine in different species, and in turn the incubation time? Considering the time needed to perform the skin swab, how many fish should be added to the lidocaine solution to ensure that no fish experiences an excessive exposure? Considering the use of static water conditions for the exposure to lidocaine, I foresee that the temperature may change very rapidly unless the room temperature is controlled. Can the authors recommend a specific strategy to ensure the maintenance of optimal water temperature (and hence the reduction of stress) throughout the lidocaine exposure phase? E.g. using an incubator or a dedicated genotyping rack. Author Response: Since submitting the first version of this protocol, we have published a follow up study that shows that lidocaine treatment is not needed for DNA collection by skin swabbing (Tilley et al., 2023, Validating skin swabbing as a refined technique to collect DNA from small-bodied fish species). We have therefore removed all mentions of lidocaine pre-treatment from the protocol steps included here. Reviewer Comment: 5. Table 1 shows the comparison of DNA concentration from fin clips and skin swabs of the same sticklebacks and zebrafish. I believe the top row displaying the column titles is missing. Author Response: Thank you for spotting this error. Table 1 does miss the top column indicating whether the samples came from swabbed or fin clipped fish. We have now replaced this table with a new version that contains this information. Reviewer Comment: 6. To evaluate the potential cross contamination of mucus samples when fish are held at high density, the authors kept 10 AB wild-type and 10 transgenic zebrafish in a small 3 L tank overnight. The analysis show that, in these conditions, there is no contamination. However, it appears that the authors reached this conclusion after a non-random sampling where all ABs were swabbed first, followed by all transgenic fish (displaying a longer tail). Although one may conclude that there is no cross contamination in the fish tank, the experimental design does not allow to evaluate whether the full procedure itself (i.e. including the transfer onto the sponge) may be a source of contamination. Although the probability is low, do the authors think that the sponge may represent a contamination source? If yes, do they recommend to replace the sponge after sampling a certain number of fish (e.g. how many?). Author Response: The reviewer makes a good point about the possible transfer of mucus on the sponge leading to cross-contamination. We routinely rinse the sponge between sample collection, an important detail that was not described in our protocol. We have now added this information to the updated version of the protocol as suggested. Reviewer Comment: 7. Similar considerations are valid for gloves and nets. How often should these elements be replaced/washed? Author Response: We routinely wash the net that is used to restrain the fish between sampling. This detail has been added to the protocol as per the reviewer’s suggestion. However, we do not change gloves, because we have not noticed any issues with cross-contamination, and this is our standard practice when handling animals and genotyping. Reviewer Comment: 8. The Introduction reports the following statement: “However, despite its popularity, there is evidence that fin clipping can alter health and welfare, leading to infection and altering growth and survival (Taslima et al., 2015)”. However, Taslima et al. (2015) appears to be an aquaculture-related paper focused on Nile tilapia and, as far as I can see, that paper does not provide any evidence of fin clipping-induced damage. Taslima et al. (2015) provided the following generic statement “tissue biopsy may have negative impacts on fish, potentially including infection and effects on survival, growth or behaviour”, and to support this statement they cited Le Vin et al. (2011) (this paper is also cited in the present manuscript). The latter concerns the validation of swabs methods for DNA sampling in fish. Again, the study did not investigate the adverse effects of fin clipping. On the other hand, Le Vin et al. (2011) also stated that fin clipping can be detrimental. This time, to support that statement, they cited several papers from the 60s, 70s, and 80s. However, those papers appear to be referred mainly to aquaculture and field ecology studies where fish are reintroduced in the environment after fin-clipping. Going back to the introduction of the present paper, I believe that whereas the potential adverse effects of fin clipping on behaviour are evidenced with appropriate supporting citations, the other potential adverse effects on infection, growth. and survival are not. Is there any evidence that fin clipping can adversely affect growth, survival, and infection susceptibility in a laboratory setting? If not, the authors should specific that it is not the case, and discuss potential effects observed in aquaculture studies providing an accurate citation and reporting of the primary papers. If yes, it would be useful to have specific data on this important aspect. Author Response: The reviewer makes an important point here. Our statement about effects on growth, infection and survival are not sufficiently supported by the references that we have provided. This has occurred because we over-interpreted the Taslima et al. study, which in turn mis-cited earlier papers including Le Vin et al. 2011. We have now modified the introduction section to reflect this, deleting the suggestion that fin clipping can alter growth, survival and infection. We apologise for this mistake, and hope that the new version of the introduction is acceptable in its current format. Reviewer Comment: 9. Similarly, in the Discussion, the authors wrote that “Several previous studies have shown that fin clipping can have side effects that may alter the outcome of experimental studies. For example, it can lead to secondary infections and elevate the non-specific immune response (Dash et al., 2018)”. However, Dash et al. (2018) do not seem to mention fin clipping at all, as it is a study focused on the role played by fish mucus in health maintenance. Please, revise this reference and replace with primary papers, if possible. Author Response: I am afraid that this is also a mistake on our part. The Dash et al. paper does indeed focus on mucus sampling and not fin clipping, making our statement incorrect. We have removed this sentence in the discussion as suggested by the reviewer. Although skin swabbing is a refined technique compared to fin clipping, it is important not to overstate its benefits. We thank the reviewer for spotting these errors and pointing them out to us. Reviewer Comment: 10. In the present paper, the negative effects of fin clipping of fish behaviour was used as key argument to justify the potential superiority of skin swabbing over fin clipping. However, I believe that this argument is only weakly supported by the data presented here. I suggest to add more data, if available, to strengthen this argument. Author Response: The main aim of this paper is to provide an easy-to-follow protocol for researchers who wish to adopt skin swabbing for DNA collection. The experimental data that is shown aims to provide a background for the technique, and to convince researchers to give it a go. All of the data shown here is modified from previous publications (e.g., Tilley et al., 2020; Breacker et al., 2017). However, the reviewer is correct that this issue could be presented more clearly. To address this issue, we have now added a second data table, modified from Tilley et al., 2020, that shows the greater variability in gene expression and behavioural data following fin clipping compared to skin swabbing. Reviewer Comment: 11. The methodological description of the behavioural tests is too basic and requires more details. For example, in the novel tank diving test, fish were observed/recorded for the first five minutes. Is this observation time justified by other studies for both stickleback and zebrafish? If yes, what are the supporting references? Were multiple fish/tanks filmed simultaneously using multiple tanks? If yes, did the operator add the fish using a specific sequence or removed the first seconds of the video where the operator was still in the room? (The operator in the room is a source of stress). The results section indicates that multiple time points were tested. However, the different timepoints and the rationale behind their selection are not described in the methods section. The importance of providing an accurate description of the methods is clearly demonstrated by the following, and more important, point. Author Response: As per the responses above, the behavioural information mentioned here is not the main focus of this paper. Rather, we have used data from Tilley et al., 2020 to demonstrate the variability in experimental results seen after fin clipping. The behaviour methods that we have used here are standard for the field of zebrafish research. The novel tank diving test protocol mentioned here is based upon the published work of Egan and colleagues in zebrafish, (Egan et al., 2009 – now included in the reference list), and modified for sticklebacks by Gutierrez and colleagues (Norton and Gutierrez, 2019). In brief, we recorded a single fish at a time for 5 minutes, and analysed the entirety of the behavioural response. Each timepoint that we looked at was recorded separately, using the same setup in the same room. The experimenter was present in the room throughout recording. Reviewer Comment: 12. The results section indicates that there is “Greater variability in results after clipping compared to swabbing”. I found that statement confusing as, by itself, it leads one to believe that there is a variability in genotyping results whereas the authors refer to behavioural and stress endpoints (which are not the focus of the paper). Later, the article provides the following statement: “Behavioural data collected subsequent to fin clipping showed more variable data compared to skin swabbed animals, meaning that more individuals need to be measured to test hypotheses with sufficient statistical power (Tilley et al., 2020). This means that collecting DNA by skin swabbing may lead to a reduction of total number of animals needed in experiments”. In my opinion, it is unclear why skin swabbing could allow to use fewer animals. Do the authors refer to a specific context? I suggest to clarify this point or to remove it. Author Response: We published data showing that compared to skin swabbing, fin clipping led to a greater variation in gene expression and behavioural data in Tilley et al., 2020. This data used an asymptotic test for the equality of coefficients of variation from k populations to contrast physiological and behavioural data after skin swabbing or fin clipping. When compared to control undisturbed fish, fin clipping led a large variation in data whereas skin swabbing did not. This means that fewer animals would need to be included in each experimental group in order to collect statistically significant data, if skin swabbing is used for DNA collection rather fin clipping. We have included table 2 in this manuscript, and re-written the results and discussion section to make this clearer. Reviewer Comment: 13. Overall, this specific aspect of the work (i.e. data variability) has been highlighted very strongly in the manuscript; however, my main concern is the data does not appear to support the hypothesis of a treatment-dependent effect. The present manuscript does not provide any figure or table of the behavioural data; however, this data can be retrieved from Tilley et al. (2020). Reading the latter, it is possible to note that the observed behavioural effects appeared to be (almost always) driven by fish handing procedures and not by fin clipping or skin swabbing themselves. The same consideration is valid for the assessment of opercular beats. The fact that control fish display behavioural responses more often (or as often) as fish that underwent DNA collection weakens the argument of treatment-specific effects, and hence treatment-specific benefits, including 3Rs benefits. Can the authors provide more data concerning this aspect? Author Response: The data shown here is modified from Tilley et al., 2020, where we investigate which components of the fin clipping and swabbing procedures trigger a stress response in fish. While handling fish does trigger stress, we were able to show that the fin clipping procedure in its entirety is more stressful than the swabbing or handling alone. We have included a new table 2 in this version of the manuscript that shows some of this information, as suggested by the reviewer. Reviewer Comment: 14. To measure the effects of the different procedures on the stress axis, the authors measured cortisol excretion in the tanks of fish that underwent 1) no manipulation, 2) skin swabbing, 3) fin clipping. I believe that the experimental design described in the article is not suitable to provide an answer to the specific research question considered here. Although measuring the cortisol released by a non-manipulated group provided a useful reference value, I believe that there are multiple factors to consider for a more rigorous comparison. 1) Fish handing – it is known that fish netting and air contact are major stress factors that induce an increase of cortisol release in the surrounding water (Ellis, James, Scott 2004). Measuring cortisol concentrations in tanks of non-manipulated fish will very likely indicate lower values, independently from skin swabbing or fin clipping. Hence, a more appropriate control would be represented by fish that underwent the same handling (i.e. netting and transfer to a new tank) without DNA sampling procedure. 2) The pre-procedure treatment of fish that underwent skin swabbing or fin clipping were very different (i.e. 45 minutes exposure to lidocaine in a confined space versus rapid treatment with MS-222). From the results presented here, it is not possible to evaluate whether the 45 minutes pre-treatment with lidocaine did or did not affect cortisol release. In conclusion, this suggests that an experiment aimed at evaluating the stress response to different DNA sampling procedures should include specific negative controls for each treatment type and fish handling procedure. Author Response: The author is right to note that handling fish, and removing them from their tank could affect cortisol release. We have already investigated the constituent steps that make up the swabbing and fin clipping procedures, and these results have been published in two separate papers (Tilley et al., 2020; Tilley et al., 2023). Since the focus of this paper is the step-by-step protocol that to aid uptake of the swabbing technique, we have chosen not to include all of this data here. We have made this point clearer, by modifying the legend to figure 4 (showing the cortisol results) to read “Please refer to Tilley et al., 2020 for further control treatment groups and data points”. Reviewer Comment: 15. In the discussion, the authors reported that “changes in gene expression and behaviour caused by skin swabbing tended to appear between two and seven days after manipulation, perhaps due to the activation of an immune response, or changes in ionic or osmotic regulation (Dash et al., 2018)’. In my opinion, this possibility is concerning and should be explored in further studies, as it may hamper any 3Rs benefit of skin swabs. For example, are swabbed fish in the laboratory more susceptible to infection and disease in the longer term compared to fin clipped fish? Author Response: Thank you for this suggestion. We don’t know why we see such as delayed impact of swabbing upon gene expression and behaviour, but we are currently investigating this. We hope to be able to report the effect of swabbing upon the mucus layer in more detail in a future publication. Reviewer Comment: 16. The reference de Lombaert et al. (2017) is not present in the reference list. Author Response: Thank you for spotting this error. We have now added de Lombaert et al., 2017 to the reference list. Competing Interests: We have no competing interests to declare. Close Report a concern COMMENT ON THIS REPORT Comments on this article Comments (1) Version 2 VERSION 2 PUBLISHED 27 Jun 2024 Revised Comment ADD YOUR COMMENT Version 1 VERSION 1 PUBLISHED 19 Oct 2021 Discussion is closed on this version, please comment on the latest version above. Reader Comment 22 Oct 2021 Tim Moser , University of Otago, New Zealand 22 Oct 2021 Reader Comment Table 1 is missing information on which columns refer to the swabbing results and which represent the fin clipping (though it can be deduced from the caption). Competing Interests: Nothing to disclose. Table 1 is missing information on which columns refer to the swabbing results and which represent the fin clipping (though it can be deduced from the caption). Table 1 is missing information on which columns refer to the swabbing results and which represent the fin clipping (though it can be deduced from the caption). Competing Interests: Nothing to disclose. Close Report a concern Discussion is closed on this version, please comment on the latest version above. keyboard_arrow_left keyboard_arrow_right Open Peer Review Reviewer Status info_outline Alongside their report, reviewers assign a status to the article: Approved The paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved Fundamental flaws in the paper seriously undermine the findings and conclusions Reviewer Reports Invited Reviewers 1 2 Version 2 (revision) 27 Jun 24 read read Version 1 19 Oct 21 read read Luigi Margiotta-Casaluci , Kings College London, London, UK Errol Cason , University of the Free State, Bloemfontein, South Africa Comments on this article All Comments (1) Add a comment Sign up for content alerts Sign Up You are now signed up to receive this alert Browse by related subjects keyboard_arrow_left Back to all reports Reviewer Report 0 Views copyright © 2024 Margiotta-Casaluci L. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. 22 Aug 2024 | for Version 2 Luigi Margiotta-Casaluci , Kings College London, London, UK 0 Views copyright © 2024 Margiotta-Casaluci L. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. format_quote Cite this report speaker_notes Responses (0) Approved info_outline Alongside their report, reviewers assign a status to the article: Approved The paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved Fundamental flaws in the paper seriously undermine the findings and conclusions The authors have satisfactorily addressed all the comments and concerns that I shared in the review of Version 1. Competing Interests No competing interests were disclosed. Reviewer Expertise Fish physiology, endocrinology, behaviour, 3Rs, toxicology. Referee suggested by the NC3Rs for their scientific expertise and experience in assessing 3Rs impact. I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard. reply Respond to this report Responses (0) Margiotta-Casaluci L. Peer Review Report For: Skin swabbing protocol to collect DNA samples from small-bodied fish species [version 2; peer review: 2 approved] . F1000Research 2024, 10 :1064 ( https://doi.org/10.5256/f1000research.165869.r296346) NOTE: it is important to ensure the information in square brackets after the title is included in this citation. The direct URL for this report is: https://f1000research.com/articles/10-1064/v2#referee-response-296346 keyboard_arrow_left Back to all reports Reviewer Report 0 Views copyright © 2024 Cason E. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. 28 Jun 2024 | for Version 2 Errol Cason , University of the Free State, Bloemfontein, South Africa 0 Views copyright © 2024 Cason E. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. format_quote Cite this report speaker_notes Responses (0) Approved info_outline Alongside their report, reviewers assign a status to the article: Approved The paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved Fundamental flaws in the paper seriously undermine the findings and conclusions no further comments Competing Interests No competing interests were disclosed. Reviewer Expertise Genetics, Genomics, Microbiomes, I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard. reply Respond to this report Responses (0) Cason E. Peer Review Report For: Skin swabbing protocol to collect DNA samples from small-bodied fish species [version 2; peer review: 2 approved] . F1000Research 2024, 10 :1064 ( https://doi.org/10.5256/f1000research.165869.r296345) NOTE: it is important to ensure the information in square brackets after the title is included in this citation. The direct URL for this report is: https://f1000research.com/articles/10-1064/v2#referee-response-296345 keyboard_arrow_left Back to all reports Reviewer Report 0 Views copyright © 2022 Cason E. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. 17 Aug 2022 | for Version 1 Errol Cason , University of the Free State, Bloemfontein, South Africa 0 Views copyright © 2022 Cason E. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. format_quote Cite this report speaker_notes Responses (0) Approved info_outline Alongside their report, reviewers assign a status to the article: Approved The paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved Fundamental flaws in the paper seriously undermine the findings and conclusions This paper provides detailed steps to collect DNA from small-bodied fish species using skin swabbing. This is offered as a alternative, easier, less invasive and more ethical methods of acquiring DNA from fish during trials when compared to the standard method of fin clipping. Evidence is provided that enough DNA an be obtained for downstream application with less stress, discomfort and pain to the fish. In essence this paper is a "manual" for methods already put out in Breaker et al. (2017) and Tilley et al. (2020). 1 , 2 It appears to only exist as a easily accessible and referenceable recipe. It will save scientists time and effort to go and dig through the other papers if all they really want is A) to know if the method works and B) how to do it. While this is not a novel study, and is just a bullet point + video version of previously published methods, I do however feel that this is not a bad thing. I can see how the other two papers might not be getting the traction they deserve for a method that mostly works just as well but you don't need to mutilate an animal to get DNA. I therefore see no reason not to index this. Are a suitable application and appropriate end-users identified? Yes Are the 3Rs implications of the work described accurately? Yes If applicable, is the statistical analysis and its interpretation appropriate? Yes Is the rationale for developing the new method (or application) clearly explained? Yes Is the description of the method technically sound? Yes Are sufficient details provided to allow replication of the method development and its use by others? Yes If any results are presented, are all the source data underlying the results available to ensure full reproducibility? Yes Are the conclusions about the method and its performance adequately supported by the findings presented in the article? Yes References 1. Breacker C, Barber I, Norton WH, McDearmid JR, et al.: A Low-Cost Method of Skin Swabbing for the Collection of DNA Samples from Small Laboratory Fish. Zebrafish . 14 (1): 35-41 PubMed Abstract | Publisher Full Text 2. Tilley C, Carreño Gutierrez H, Sebire M, Obasaju O, et al.: Skin swabbing is a refined technique to collect DNA from model fish species. Scientific Reports . 2020; 10 (1). Publisher Full Text Competing Interests No competing interests were disclosed. Reviewer Expertise Genetics, Genomics, Microbiomes, I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard. reply Respond to this report Responses (0) Cason E. Peer Review Report For: Skin swabbing protocol to collect DNA samples from small-bodied fish species [version 2; peer review: 2 approved] . F1000Research 2024, 10 :1064 ( https://doi.org/10.5256/f1000research.76741.r144865) NOTE: it is important to ensure the information in square brackets after the title is included in this citation. The direct URL for this report is: https://f1000research.com/articles/10-1064/v1#referee-response-144865 keyboard_arrow_left Back to all reports Reviewer Report 0 Views copyright © 2022 Margiotta-Casaluci L. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. 27 Jan 2022 | for Version 1 Luigi Margiotta-Casaluci , Kings College London, London, UK 0 Views copyright © 2022 Margiotta-Casaluci L. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. format_quote Cite this report speaker_notes Responses (1) Approved With Reservations info_outline Alongside their report, reviewers assign a status to the article: Approved The paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved Fundamental flaws in the paper seriously undermine the findings and conclusions General comments In this article, the authors describe a skin swabbing protocol for DNA collection from small laboratory fish species that could provide a suitable alternative to the commonly used fin clipping procedure. The latter is an increasingly common procedure used in most zebrafish laboratories at global level. As mentioned by the authors, 85% of zebrafish laboratories use fin clipping to collect DNA. This procedure requires anaesthesia and involve surgical removal of tissue; therefore, the development of alternative minimally invasive methods in this area may have significant implications for the welfare of laboratory fish. The alternative skin swabbing protocol presented in this article is well described, and the work provides a valuable contribution to the advancement of laboratory fish welfare. However - although the potential welfare benefits of skin swabbing vs fin clipping may sound obvious - I believe that the specific datasets presented in the article do not allow a robust cost-benefit assessment of the protocol from a 3Rs perspective and the evaluation of its superiority compared to the commonly used fin clipping procedure. Hence, I suggest that that aspect of the article should be improved, expanded, and integrated with other data (if available). Specific comments and suggestions are provided below. Skin swabbing protocol The methodology described in the article appears to be sound, and I believe that the details provided allow to reliably replicate the simple method in other laboratories. The supplemental video clips are clear and very informative. Despite a lower DNA yield obtained with skin swabs, the DNA samples collected using both methods had similar levels of purity. The authors demonstrated that DNA extracted from skin mucus allows a reliable amplification of target genes, and that no mucus cross contamination occurs in fish held at high density. The supplemental videos are very good and clearly demonstrate the key practical steps. In the video the operator apparently restrains the fish on the sponge by gently covering the eyes with a gloved finger. I suppose this procedure calms the fish and reduces potential harm. Do the authors suggest that this should be a key step of the protocol? If yes, I suggest to add more details about this step in the main text. In the published protocol the authors reported that fish were immersed in lidocaine for 45 minutes before performing the procedure. Can the authors explain why this duration was selected? Does water temperature affect uptake and pharmacokinetics of lidocaine in different species, and in turn the incubation time? Considering the time needed to perform the skin swab, how many fish should be added to the lidocaine solution to ensure that no fish experiences an excessive exposure? Considering the use of static water conditions for the exposure to lidocaine, I foresee that the temperature may change very rapidly unless the room temperature is controlled. Can the authors recommend a specific strategy to ensure the maintenance of optimal water temperature (and hence the reduction of stress) throughout the lidocaine exposure phase? E.g. using an incubator or a dedicated genotyping rack. Table 1 shows the comparison of DNA concentration from fin clips and skin swabs of the same sticklebacks and zebrafish. I believe the top row displaying the column titles is missing. Cross-contamination To evaluate the potential cross contamination of mucus samples when fish are held at high density, the authors kept 10 AB wild-type and 10 transgenic zebrafish in a small 3 L tank overnight. The analysis show that, in these conditions, there is no contamination. However, it appears that the authors reached this conclusion after a non-random sampling where all ABs were swabbed first, followed by all transgenic fish (displaying a longer tail). Although one may conclude that there is no cross contamination in the fish tank, the experimental design does not allow to evaluate whether the full procedure itself (i.e. including the transfer onto the sponge) may be a source of contamination. Although the probability is low, do the authors think that the sponge may represent a contamination source? If yes, do they recommend to replace the sponge after sampling a certain number of fish (e.g. how many?). Similar considerations are valid for gloves and nets. How often should these elements be replaced/washed? Claims of adversity of fin clipping – Introduction and discussion The Introduction reports the following statement: “ However, despite its popularity, there is evidence that fin clipping can alter health and welfare, leading to infection and altering growth and survival (Taslima et al., 2015) ”. However, Taslima et al. (2015) 1 appears to be an aquaculture-related paper focused on Nile tilapia and, as far as I can see, that paper does not provide any evidence of fin clipping-induced damage. Taslima et al. (2015) provided the following generic statement “ tissue biopsy may have negative impacts on fish, potentially including infection and effects on survival, growth or behaviour”, and to support this statement they cited Le Vin et al. (2011) (this paper is also cited in the present manuscript).[red-2] The latter concerns the validation of swabs methods for DNA sampling in fish. Again, the study did not investigate the adverse effects of fin clipping. On the other hand, Le Vin et al. (2011) also stated that fin clipping can be detrimental. This time, to support that statement, they cited several papers from the 60s, 70s, and 80s. However, those papers appear to be referred mainly to aquaculture and field ecology studies where fish are reintroduced in the environment after fin-clipping. Going back to the introduction of the present paper, I believe that whereas the potential adverse effects of fin clipping on behaviour are evidenced with appropriate supporting citations, the other potential adverse effects on infection, growth. and survival are not. Is there any evidence that fin clipping can adversely affect growth, survival, and infection susceptibility in a laboratory setting? If not, the authors should specific that it is not the case, and discuss potential effects observed in aquaculture studies providing an accurate citation and reporting of the primary papers. If yes, it would be useful to have specific data on this important aspect. Similarly, in the Discussion, the authors wrote that “ Several previous studies have shown that fin clipping can have side effects that may alter the outcome of experimental studies. For example, it can lead to secondary infections and elevate the non-specific immune response (Dash et al., 2018) ”. However, Dash et al. (2018) do not seem to mention fin clipping at all, as it is a study focused on the role played by fish mucus in health maintenance. 3 Please, revise this reference and replace with primary papers, if possible. Behavioural studies and variability of behavioural and stress endpoints In the present paper, the negative effects of fin clipping of fish behaviour was used as key argument to justify the potential superiority of skin swabbing over fin clipping. However, I believe that this argument is only weakly supported by the data presented here. I suggest to add more data, if available, to strengthen this argument. The methodological description of the behavioural tests is too basic and requires more details. For example, in the novel tank diving test, fish were observed/recorded for the first five minutes. Is this observation time justified by other studies for both stickleback and zebrafish? If yes, what are the supporting references? Were multiple fish/tanks filmed simultaneously using multiple tanks? If yes, did the operator add the fish using a specific sequence or removed the first seconds of the video where the operator was still in the room? (The operator in the room is a source of stress). The results section indicates that multiple time points were tested. However, the different timepoints and the rationale behind their selection are not described in the methods section. The importance of providing an accurate description of the methods is clearly demonstrated by the following, and more important, point. The results section indicates that there is “ Greater variability in results after clipping compared to swabbing ”. I found that statement confusing as, by itself, it leads one to believe that there is a variability in genotyping results whereas the authors refer to behavioural and stress endpoints (which are not the focus of the paper). Later, the article provides the following statement: “ Behavioural data collected subsequent to fin clipping showed more variable data compared to skin swabbed animals, meaning that more individuals need to be measured to test hypotheses with sufficient statistical power (Tilley et al., 2020). 4 This means that collecting DNA by skin swabbing may lead to a reduction of total number of animals needed in experiments ”. In my opinion, it is unclear why skin swabbing could allow to use fewer animals. Do the authors refer to a specific context? I suggest to clarify this point or to remove it. Overall, this specific aspect of the work (i.e. data variability) has been highlighted very strongly in the manuscript; however, my main concern is the data does not appear to support the hypothesis of a treatment-dependent effect. The present manuscript does not provide any figure or table of the behavioural data; however, this data can be retrieved from Tilley et al. (2020). Reading the latter, it is possible to note that the observed behavioural effects appeared to be (almost always) driven by fish handing procedures and not by fin clipping or skin swabbing themselves. The same consideration is valid for the assessment of opercular beats. The fact that control fish display behavioural responses more often (or as often) as fish that underwent DNA collection weakens the argument of treatment-specific effects, and hence treatment-specific benefits, including 3Rs benefits. Can the authors provide more data concerning this aspect? Effects on cortisol release To measure the effects of the different procedures on the stress axis, the authors measured cortisol excretion in the tanks of fish that underwent 1) no manipulation, 2) skin swabbing, 3) fin clipping. I believe that the experimental design described in the article is not suitable to provide an answer to the specific research question considered here. Although measuring the cortisol released by a non-manipulated group provided a useful reference value, I believe that there are multiple factors to consider for a more rigorous comparison. 1) Fish handing – it is known that fish netting and air contact are major stress factors that induce an increase of cortisol release in the surrounding water (Ellis, James, Scott 2004). 5 Measuring cortisol concentrations in tanks of non-manipulated fish will very likely indicate lower values, independently from skin swabbing or fin clipping. Hence, a more appropriate control would be represented by fish that underwent the same handling (i.e. netting and transfer to a new tank) without DNA sampling procedure. 2) The pre-procedure treatment of fish that underwent skin swabbing or fin clipping were very different (i.e. 45 minutes exposure to lidocaine in a confined space versus rapid treatment with MS-222). From the results presented here, it is not possible to evaluate whether the 45 minutes pre-treatment with lidocaine did or did not affect cortisol release. In conclusion, this suggests that an experiment aimed at evaluating the stress response to different DNA sampling procedures should include specific negative controls for each treatment type and fish handling procedure. Other comments In the discussion, the authors reported that “ changes in gene expression and behaviour caused by skin swabbing tended to appear between two and seven days after manipulation, perhaps due to the activation of an immune response, or changes in ionic or osmotic regulation (Dash et al., 2018 )’. In my opinion, this possibility is concerning and should be explored in further studies, as it may hamper any 3Rs benefit of skin swabs. For example, are swabbed fish in the laboratory more susceptible to infection and disease in the longer term compared to fin clipped fish? The reference de Lombaert et al. (2017) is not present in the reference list. Are a suitable application and appropriate end-users identified? Yes Are the 3Rs implications of the work described accurately? Partly If applicable, is the statistical analysis and its interpretation appropriate? Partly Is the rationale for developing the new method (or application) clearly explained? Partly Is the description of the method technically sound? Yes Are sufficient details provided to allow replication of the method development and its use by others? Yes If any results are presented, are all the source data underlying the results available to ensure full reproducibility? Yes Are the conclusions about the method and its performance adequately supported by the findings presented in the article? Partly References 1. Taslima K, et al: DNA sampling from mucus in the Nile tilapia, Oreochromis niloticus: minimally invasive sampling for aquaculture-related genetics research dust. Aquac. Res . 2015; 47 (12). 2. Le Vin AL, Adam A, Tedder A, Arnold KE, et al.: Validation of swabs as a non-destructive and relatively non-invasive DNA sampling method in fish. Mol Ecol Resour . 2011; 11 (1): 107-9 PubMed Abstract | Publisher Full Text 3. Dash S, Das SK, Samal J, Thatoi HN: Epidermal mucus, a major determinant in fish health: a review. Iran J Vet Res . 2018; 19 (2): 72-81 PubMed Abstract 4. Norton W, Tilley CA, Barber I: Swabbing videos 1 and 2. f1000research.com Media . 2021. 5. Ellis T, James J, Stewart C, Scott A: A non-invasive stress assay based upon measurement of free cortisol released into the water by rainbow trout. Journal of Fish Biology . 2004; 65 (5): 1233-1252 Publisher Full Text Competing Interests No competing interests were disclosed. Reviewer Expertise Fish physiology, endocrinology, behaviour, 3Rs, toxicology. Referee suggested by the NC3Rs for their scientific expertise and experience in assessing 3Rs impact. I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above. reply Respond to this report Responses (1) Author Response 27 Jun 2024 Will Norton, Genetics and Genome Biology, University of Leicester, Leicester, LE1 7RH, UK Author Response: The reviewer has provided us with excellent feedback upon the first version of this study. We have answered these comments in full, and our responses to the comments are included below. We are very sorry that it has taken us so long to respond to these suggestions, and we hope that you still accept to re-review this paper. A change in person circumstances prevented us from addressing your suggestions sooner. Thank you for reading this study so thoroughly, and for helping us to improve this manuscript. Reviewer Comment: Although the potential welfare benefits of skin swabbing vs fin clipping may sound obvious, I believe that the specific datasets presented in the article do not allow a robust cost-benefit assessment of the protocol from a 3Rs perspective and the evaluation of its superiority compared to the commonly used fin clipping procedure. Hence, I suggest that that aspect of the article should be improved, expanded, and integrated with other data (if available). Specific comments and suggestions are provided below. 1. The methodology described in the article appears to be sound, and I believe that the details provided allow to reliably replicate the simple method in other laboratories. The supplemental video clips are clear and very informative. Author Response: We thank the reviewer for this positive comment about our article. The video forms a core part of this protocol, and bearing this in mind we have now made a new, more professional, film demonstrating the swabbing technique. This video has been incorporated into the updated version of this paper. Reviewer Comment: 2. Despite a lower DNA yield obtained with skin swabs, the DNA samples collected using both methods had similar levels of purity. The authors demonstrated that DNA extracted from skin mucus allows a reliable amplification of target genes, and that no mucus cross contamination occurs in fish held at high density . Author Response: Thank you for highlighting this aspect of our research. Reviewer Comment: 3. The supplemental videos are very good and clearly demonstrate the key practical steps. In the video the operator apparently restrains the fish on the sponge by gently covering the eyes with a gloved finger. I suppose this procedure calms the fish and reduces potential harm. Do the authors suggest that this should be a key step of the protocol? If yes, I suggest to add more details about this step in the main text. Author Response: The reviewer is correct that gently covering the eyes of the fish can help stop them from moving. We routinely carry this out using a hand net. Our new video shows this step of the protocol in more detail. We have also added this information to the main text describing the technique as suggested. Reviewer Comment: 4. In the published protocol the authors reported that fish were immersed in lidocaine for 45 minutes before performing the procedure. Can the authors explain why this duration was selected? Does water temperature affect uptake and pharmacokinetics of lidocaine in different species, and in turn the incubation time? Considering the time needed to perform the skin swab, how many fish should be added to the lidocaine solution to ensure that no fish experiences an excessive exposure? Considering the use of static water conditions for the exposure to lidocaine, I foresee that the temperature may change very rapidly unless the room temperature is controlled. Can the authors recommend a specific strategy to ensure the maintenance of optimal water temperature (and hence the reduction of stress) throughout the lidocaine exposure phase? E.g. using an incubator or a dedicated genotyping rack. Author Response: Since submitting the first version of this protocol, we have published a follow up study that shows that lidocaine treatment is not needed for DNA collection by skin swabbing (Tilley et al., 2023, Validating skin swabbing as a refined technique to collect DNA from small-bodied fish species). We have therefore removed all mentions of lidocaine pre-treatment from the protocol steps included here. Reviewer Comment: 5. Table 1 shows the comparison of DNA concentration from fin clips and skin swabs of the same sticklebacks and zebrafish. I believe the top row displaying the column titles is missing. Author Response: Thank you for spotting this error. Table 1 does miss the top column indicating whether the samples came from swabbed or fin clipped fish. We have now replaced this table with a new version that contains this information. Reviewer Comment: 6. To evaluate the potential cross contamination of mucus samples when fish are held at high density, the authors kept 10 AB wild-type and 10 transgenic zebrafish in a small 3 L tank overnight. The analysis show that, in these conditions, there is no contamination. However, it appears that the authors reached this conclusion after a non-random sampling where all ABs were swabbed first, followed by all transgenic fish (displaying a longer tail). Although one may conclude that there is no cross contamination in the fish tank, the experimental design does not allow to evaluate whether the full procedure itself (i.e. including the transfer onto the sponge) may be a source of contamination. Although the probability is low, do the authors think that the sponge may represent a contamination source? If yes, do they recommend to replace the sponge after sampling a certain number of fish (e.g. how many?). Author Response: The reviewer makes a good point about the possible transfer of mucus on the sponge leading to cross-contamination. We routinely rinse the sponge between sample collection, an important detail that was not described in our protocol. We have now added this information to the updated version of the protocol as suggested. Reviewer Comment: 7. Similar considerations are valid for gloves and nets. How often should these elements be replaced/washed? Author Response: We routinely wash the net that is used to restrain the fish between sampling. This detail has been added to the protocol as per the reviewer’s suggestion. However, we do not change gloves, because we have not noticed any issues with cross-contamination, and this is our standard practice when handling animals and genotyping. Reviewer Comment: 8. The Introduction reports the following statement: “However, despite its popularity, there is evidence that fin clipping can alter health and welfare, leading to infection and altering growth and survival (Taslima et al., 2015)”. However, Taslima et al. (2015) appears to be an aquaculture-related paper focused on Nile tilapia and, as far as I can see, that paper does not provide any evidence of fin clipping-induced damage. Taslima et al. (2015) provided the following generic statement “tissue biopsy may have negative impacts on fish, potentially including infection and effects on survival, growth or behaviour”, and to support this statement they cited Le Vin et al. (2011) (this paper is also cited in the present manuscript). The latter concerns the validation of swabs methods for DNA sampling in fish. Again, the study did not investigate the adverse effects of fin clipping. On the other hand, Le Vin et al. (2011) also stated that fin clipping can be detrimental. This time, to support that statement, they cited several papers from the 60s, 70s, and 80s. However, those papers appear to be referred mainly to aquaculture and field ecology studies where fish are reintroduced in the environment after fin-clipping. Going back to the introduction of the present paper, I believe that whereas the potential adverse effects of fin clipping on behaviour are evidenced with appropriate supporting citations, the other potential adverse effects on infection, growth. and survival are not. Is there any evidence that fin clipping can adversely affect growth, survival, and infection susceptibility in a laboratory setting? If not, the authors should specific that it is not the case, and discuss potential effects observed in aquaculture studies providing an accurate citation and reporting of the primary papers. If yes, it would be useful to have specific data on this important aspect. Author Response: The reviewer makes an important point here. Our statement about effects on growth, infection and survival are not sufficiently supported by the references that we have provided. This has occurred because we over-interpreted the Taslima et al. study, which in turn mis-cited earlier papers including Le Vin et al. 2011. We have now modified the introduction section to reflect this, deleting the suggestion that fin clipping can alter growth, survival and infection. We apologise for this mistake, and hope that the new version of the introduction is acceptable in its current format. Reviewer Comment: 9. Similarly, in the Discussion, the authors wrote that “Several previous studies have shown that fin clipping can have side effects that may alter the outcome of experimental studies. For example, it can lead to secondary infections and elevate the non-specific immune response (Dash et al., 2018)”. However, Dash et al. (2018) do not seem to mention fin clipping at all, as it is a study focused on the role played by fish mucus in health maintenance. Please, revise this reference and replace with primary papers, if possible. Author Response: I am afraid that this is also a mistake on our part. The Dash et al. paper does indeed focus on mucus sampling and not fin clipping, making our statement incorrect. We have removed this sentence in the discussion as suggested by the reviewer. Although skin swabbing is a refined technique compared to fin clipping, it is important not to overstate its benefits. We thank the reviewer for spotting these errors and pointing them out to us. Reviewer Comment: 10. In the present paper, the negative effects of fin clipping of fish behaviour was used as key argument to justify the potential superiority of skin swabbing over fin clipping. However, I believe that this argument is only weakly supported by the data presented here. I suggest to add more data, if available, to strengthen this argument. Author Response: The main aim of this paper is to provide an easy-to-follow protocol for researchers who wish to adopt skin swabbing for DNA collection. The experimental data that is shown aims to provide a background for the technique, and to convince researchers to give it a go. All of the data shown here is modified from previous publications (e.g., Tilley et al., 2020; Breacker et al., 2017). However, the reviewer is correct that this issue could be presented more clearly. To address this issue, we have now added a second data table, modified from Tilley et al., 2020, that shows the greater variability in gene expression and behavioural data following fin clipping compared to skin swabbing. Reviewer Comment: 11. The methodological description of the behavioural tests is too basic and requires more details. For example, in the novel tank diving test, fish were observed/recorded for the first five minutes. Is this observation time justified by other studies for both stickleback and zebrafish? If yes, what are the supporting references? Were multiple fish/tanks filmed simultaneously using multiple tanks? If yes, did the operator add the fish using a specific sequence or removed the first seconds of the video where the operator was still in the room? (The operator in the room is a source of stress). The results section indicates that multiple time points were tested. However, the different timepoints and the rationale behind their selection are not described in the methods section. The importance of providing an accurate description of the methods is clearly demonstrated by the following, and more important, point. Author Response: As per the responses above, the behavioural information mentioned here is not the main focus of this paper. Rather, we have used data from Tilley et al., 2020 to demonstrate the variability in experimental results seen after fin clipping. The behaviour methods that we have used here are standard for the field of zebrafish research. The novel tank diving test protocol mentioned here is based upon the published work of Egan and colleagues in zebrafish, (Egan et al., 2009 – now included in the reference list), and modified for sticklebacks by Gutierrez and colleagues (Norton and Gutierrez, 2019). In brief, we recorded a single fish at a time for 5 minutes, and analysed the entirety of the behavioural response. Each timepoint that we looked at was recorded separately, using the same setup in the same room. The experimenter was present in the room throughout recording. Reviewer Comment: 12. The results section indicates that there is “Greater variability in results after clipping compared to swabbing”. I found that statement confusing as, by itself, it leads one to believe that there is a variability in genotyping results whereas the authors refer to behavioural and stress endpoints (which are not the focus of the paper). Later, the article provides the following statement: “Behavioural data collected subsequent to fin clipping showed more variable data compared to skin swabbed animals, meaning that more individuals need to be measured to test hypotheses with sufficient statistical power (Tilley et al., 2020). This means that collecting DNA by skin swabbing may lead to a reduction of total number of animals needed in experiments”. In my opinion, it is unclear why skin swabbing could allow to use fewer animals. Do the authors refer to a specific context? I suggest to clarify this point or to remove it. Author Response: We published data showing that compared to skin swabbing, fin clipping led to a greater variation in gene expression and behavioural data in Tilley et al., 2020. This data used an asymptotic test for the equality of coefficients of variation from k populations to contrast physiological and behavioural data after skin swabbing or fin clipping. When compared to control undisturbed fish, fin clipping led a large variation in data whereas skin swabbing did not. This means that fewer animals would need to be included in each experimental group in order to collect statistically significant data, if skin swabbing is used for DNA collection rather fin clipping. We have included table 2 in this manuscript, and re-written the results and discussion section to make this clearer. Reviewer Comment: 13. Overall, this specific aspect of the work (i.e. data variability) has been highlighted very strongly in the manuscript; however, my main concern is the data does not appear to support the hypothesis of a treatment-dependent effect. The present manuscript does not provide any figure or table of the behavioural data; however, this data can be retrieved from Tilley et al. (2020). Reading the latter, it is possible to note that the observed behavioural effects appeared to be (almost always) driven by fish handing procedures and not by fin clipping or skin swabbing themselves. The same consideration is valid for the assessment of opercular beats. The fact that control fish display behavioural responses more often (or as often) as fish that underwent DNA collection weakens the argument of treatment-specific effects, and hence treatment-specific benefits, including 3Rs benefits. Can the authors provide more data concerning this aspect? Author Response: The data shown here is modified from Tilley et al., 2020, where we investigate which components of the fin clipping and swabbing procedures trigger a stress response in fish. While handling fish does trigger stress, we were able to show that the fin clipping procedure in its entirety is more stressful than the swabbing or handling alone. We have included a new table 2 in this version of the manuscript that shows some of this information, as suggested by the reviewer. Reviewer Comment: 14. To measure the effects of the different procedures on the stress axis, the authors measured cortisol excretion in the tanks of fish that underwent 1) no manipulation, 2) skin swabbing, 3) fin clipping. I believe that the experimental design described in the article is not suitable to provide an answer to the specific research question considered here. Although measuring the cortisol released by a non-manipulated group provided a useful reference value, I believe that there are multiple factors to consider for a more rigorous comparison. 1) Fish handing – it is known that fish netting and air contact are major stress factors that induce an increase of cortisol release in the surrounding water (Ellis, James, Scott 2004). Measuring cortisol concentrations in tanks of non-manipulated fish will very likely indicate lower values, independently from skin swabbing or fin clipping. Hence, a more appropriate control would be represented by fish that underwent the same handling (i.e. netting and transfer to a new tank) without DNA sampling procedure. 2) The pre-procedure treatment of fish that underwent skin swabbing or fin clipping were very different (i.e. 45 minutes exposure to lidocaine in a confined space versus rapid treatment with MS-222). From the results presented here, it is not possible to evaluate whether the 45 minutes pre-treatment with lidocaine did or did not affect cortisol release. In conclusion, this suggests that an experiment aimed at evaluating the stress response to different DNA sampling procedures should include specific negative controls for each treatment type and fish handling procedure. Author Response: The author is right to note that handling fish, and removing them from their tank could affect cortisol release. We have already investigated the constituent steps that make up the swabbing and fin clipping procedures, and these results have been published in two separate papers (Tilley et al., 2020; Tilley et al., 2023). Since the focus of this paper is the step-by-step protocol that to aid uptake of the swabbing technique, we have chosen not to include all of this data here. We have made this point clearer, by modifying the legend to figure 4 (showing the cortisol results) to read “Please refer to Tilley et al., 2020 for further control treatment groups and data points”. Reviewer Comment: 15. In the discussion, the authors reported that “changes in gene expression and behaviour caused by skin swabbing tended to appear between two and seven days after manipulation, perhaps due to the activation of an immune response, or changes in ionic or osmotic regulation (Dash et al., 2018)’. In my opinion, this possibility is concerning and should be explored in further studies, as it may hamper any 3Rs benefit of skin swabs. For example, are swabbed fish in the laboratory more susceptible to infection and disease in the longer term compared to fin clipped fish? Author Response: Thank you for this suggestion. We don’t know why we see such as delayed impact of swabbing upon gene expression and behaviour, but we are currently investigating this. We hope to be able to report the effect of swabbing upon the mucus layer in more detail in a future publication. Reviewer Comment: 16. The reference de Lombaert et al. (2017) is not present in the reference list. Author Response: Thank you for spotting this error. We have now added de Lombaert et al., 2017 to the reference list. View more View less Competing Interests We have no competing interests to declare. reply Respond Report a concern Margiotta-Casaluci L. Peer Review Report For: Skin swabbing protocol to collect DNA samples from small-bodied fish species [version 2; peer review: 2 approved] . F1000Research 2024, 10 :1064 ( https://doi.org/10.5256/f1000research.76741.r117243) NOTE: it is important to ensure the information in square brackets after the title is included in this citation. The direct URL for this report is: https://f1000research.com/articles/10-1064/v1#referee-response-117243 Alongside their report, reviewers assign a status to the article: Approved - the paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations - A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved - fundamental flaws in the paper seriously undermine the findings and conclusions Adjust parameters to alter display View on desktop for interactive features Includes Interactive Elements View on desktop for interactive features Competing Interests Policy Provide sufficient details of any financial or non-financial competing interests to enable users to assess whether your comments might lead a reasonable person to question your impartiality. Consider the following examples, but note that this is not an exhaustive list: Examples of 'Non-Financial Competing Interests' Within the past 4 years, you have held joint grants, published or collaborated with any of the authors of the selected paper. You have a close personal relationship (e.g. parent, spouse, sibling, or domestic partner) with any of the authors. You are a close professional associate of any of the authors (e.g. scientific mentor, recent student). You work at the same institute as any of the authors. You hope/expect to benefit (e.g. favour or employment) as a result of your submission. You are an Editor for the journal in which the article is published. Examples of 'Financial Competing Interests' You expect to receive, or in the past 4 years have received, any of the following from any commercial organisation that may gain financially from your submission: a salary, fees, funding, reimbursements. You expect to receive, or in the past 4 years have received, shared grant support or other funding with any of the authors. You hold, or are currently applying for, any patents or significant stocks/shares relating to the subject matter of the paper you are commenting on. Stay Updated Sign up for content alerts and receive a weekly or monthly email with all newly published articles Register with F1000Research Already registered? Sign in Not now, thanks close PLEASE NOTE If you are an AUTHOR of this article, please check that you signed in with the account associated with this article otherwise we cannot automatically identify your role as an author and your comment will be labelled as a “User Comment”. If you are a REVIEWER of this article, please check that you have signed in with the account associated with this article and then go to your account to submit your report, please do not post your review here. If you do not have access to your original account, please contact us . All commenters must hold a formal affiliation as per our Policies . The information that you give us will be displayed next to your comment. User comments must be in English, comprehensible and relevant to the article under discussion. We reserve the right to remove any comments that we consider to be inappropriate, offensive or otherwise in breach of the User Comment Terms and Conditions . Commenters must not use a comment for personal attacks. When criticisms of the article are based on unpublished data, the data should be made available. I accept the User Comment Terms and Conditions Please confirm that you accept the User Comment Terms and Conditions. Affiliation ✕ refresh Please enter your institution. Note: To add your institution or organisation, start typing the name and then select the correct name from the list. Where applicable, the name will appear in both the original language and in English. Do not paste in the name. If the name does not appear in the drop-down list, we will display the information you have entered. ✕ refresh Country/Region * USA UK Canada China France Germany Afghanistan Aland Islands Albania Algeria American Samoa Andorra Angola Anguilla Antarctica Antigua and Barbuda Argentina Armenia Aruba Australia Austria Azerbaijan Bahamas Bahrain Bangladesh Barbados Belarus Belgium Belize Benin Bermuda Bhutan Bolivia Bosnia and Herzegovina Botswana Bouvet Island Brazil British Indian Ocean Territory British Virgin Islands Brunei Bulgaria Burkina Faso Burundi Cambodia Cameroon Canada Cape Verde Cayman Islands Central African Republic Chad Chile China Christmas Island Cocos (Keeling) Islands Colombia Comoros Congo Cook Islands Costa Rica Cote d'Ivoire Croatia Cuba Cyprus Czech Republic Democratic Republic of the Congo Denmark Djibouti Dominica Dominican Republic Ecuador Egypt El Salvador Equatorial Guinea Eritrea Estonia Ethiopia Falkland Islands Faroe Islands Federated States of Micronesia Fiji Finland France French Guiana French Polynesia French Southern Territories Gabon Georgia Germany Ghana Gibraltar Greece Greenland Grenada Guadeloupe Guam Guatemala Guernsey Guinea Guinea-Bissau Guyana Haiti Heard Island and Mcdonald Islands Holy See (Vatican City State) Honduras Hong Kong Hungary Iceland India Indonesia Iran Iraq Ireland Israel Italy Jamaica Japan Jersey Jordan Kazakhstan Kenya Kiribati Kosovo (Serbia and Montenegro) Kuwait Kyrgyzstan Lao People's Democratic Republic Latvia Lebanon Lesotho Liberia Libya Liechtenstein Lithuania Luxembourg Macao Madagascar Malawi Malaysia Maldives Mali Malta Marshall Islands Martinique Mauritania Mauritius Mayotte Mexico Minor Outlying Islands of the United States Moldova Monaco Mongolia Montenegro Montserrat Morocco Mozambique Myanmar Namibia Nauru Nepal Netherlands Antilles New Caledonia New Zealand Nicaragua Niger Nigeria Niue Norfolk Island North Korea North Macedonia Northern Mariana Islands Norway Oman Pakistan Palau Palestinian Territory Panama Papua New Guinea Paraguay Peru Philippines Pitcairn Poland Portugal Puerto Rico Qatar Reunion Romania Russian Federation Rwanda Saint Helena Saint Kitts and Nevis Saint Lucia Saint Pierre and Miquelon Saint Vincent and the Grenadines Samoa San Marino Sao Tome and Principe Saudi Arabia Senegal Serbia Seychelles Sierra Leone Singapore Slovakia Slovenia Solomon Islands Somalia South Africa South Georgia and the South Sandwich Is South Korea South Sudan Spain Sri Lanka Sudan Suriname Svalbard and Jan Mayen Swaziland Sweden Switzerland Syria Taiwan Tajikistan Tanzania Thailand The Gambia The Netherlands Timor-Leste Togo Tokelau Tonga Trinidad and Tobago Tunisia Turkey Turkmenistan Turks and Caicos Islands Tuvalu UK USA Uganda Ukraine United Arab Emirates United States Virgin Islands Uruguay Uzbekistan Vanuatu Venezuela Vietnam Wallis and Futuna West Bank and Gaza Strip Western Sahara Yemen Zambia Zimbabwe Please select your country/region. You must enter a comment. Competing Interests Please disclose any competing interests that might be construed to influence your judgment of the article's or peer review report's validity or importance. Competing Interests Policy Provide sufficient details of any financial or non-financial competing interests to enable users to assess whether your comments might lead a reasonable person to question your impartiality. Consider the following examples, but note that this is not an exhaustive list: Examples of 'Non-Financial Competing Interests' Within the past 4 years, you have held joint grants, published or collaborated with any of the authors of the selected paper. You have a close personal relationship (e.g. parent, spouse, sibling, or domestic partner) with any of the authors. You are a close professional associate of any of the authors (e.g. scientific mentor, recent student). You work at the same institute as any of the authors. You hope/expect to benefit (e.g. favour or employment) as a result of your submission. You are an Editor for the journal in which the article is published. Examples of 'Financial Competing Interests' You expect to receive, or in the past 4 years have received, any of the following from any commercial organisation that may gain financially from your submission: a salary, fees, funding, reimbursements. You expect to receive, or in the past 4 years have received, shared grant support or other funding with any of the authors. You hold, or are currently applying for, any patents or significant stocks/shares relating to the subject matter of the paper you are commenting on. Please state your competing interests The comment has been saved. An error has occurred. Please try again. Cancel Post var lTitle = "Skin swabbing protocol to collect DNA samples...".replace("'", ''); var linkedInUrl = "http://www.linkedin.com/shareArticle?url=https://f1000research.com/articles/10-1064/v2" + "&title=" + encodeURIComponent(lTitle) + "&summary=" + encodeURIComponent('Read the article by '); var deliciousUrl = "https://del.icio.us/post?url=https://f1000research.com/articles/10-1064/v2&title=" + encodeURIComponent(lTitle); var redditUrl = "http://reddit.com/submit?url=https://f1000research.com/articles/10-1064/v2" + "&title=" + encodeURIComponent(lTitle); linkedInUrl += encodeURIComponent('Tilley C et al.'); var offsetTop = /chrome/i.test( navigator.userAgent ) ? 4 : -10; var addthis_config = { ui_offset_top: offsetTop, services_compact : "facebook,twitter,www.linkedin.com,www.mendeley.com,reddit.com", services_expanded : "facebook,twitter,www.linkedin.com,www.mendeley.com,reddit.com", services_custom : [ { name: "LinkedIn", url: linkedInUrl, icon:"/img/icon/at_linkedin.svg" }, { name: "Mendeley", url: "http://www.mendeley.com/import/?url=https://f1000research.com/articles/10-1064/v2/mendeley", icon:"/img/icon/at_mendeley.svg" }, { name: "Reddit", url: redditUrl, icon:"/img/icon/at_reddit.svg" }, ] }; var addthis_share = { url: "https://f1000research.com/articles/10-1064", templates : { twitter : "Skin swabbing protocol to collect DNA samples from small-bodied.... Tilley C et al., published by " + "@F1000Research" + ", https://f1000research.com/articles/10-1064/v2" } }; if (typeof(addthis) != "undefined"){ addthis.addEventListener('addthis.ready', checkCount); addthis.addEventListener('addthis.menu.share', checkCount); } $(".f1r-shares-twitter").attr("href", "https://twitter.com/intent/tweet?text=" + addthis_share.templates.twitter); $(".f1r-shares-facebook").attr("href", "https://www.facebook.com/sharer/sharer.php?u=" + addthis_share.url); $(".f1r-shares-linkedin").attr("href", addthis_config.services_custom[0].url); $(".f1r-shares-reddit").attr("href", addthis_config.services_custom[2].url); $(".f1r-shares-mendelay").attr("href", addthis_config.services_custom[1].url); function checkCount(){ setTimeout(function(){ $(".addthis_button_expanded").each(function(){ var count = $(this).text(); if (count !== "" && count != "0") $(this).removeClass("is-hidden"); else $(this).addClass("is-hidden"); }); }, 1000); } close How to cite this report {{reportCitation}} Cancel Copy Citation Details $(function(){R.ui.buttonDropdowns('.dropdown-for-downloads');}); $(function(){R.ui.toolbarDropdowns('.toolbar-dropdown-for-downloads');}); $.get("/articles/acj/73115/165869") new F1000.Clipboard(); new F1000.ThesaurusTermsDisplay("articles", "article", "165869"); $(document).ready(function() { $( "#frame1" ).on('load', function() { var mydiv = $(this).contents().find("div"); var h = mydiv.height(); console.log(h) }); var tooltipLivingFigure = jQuery(".interactive-living-figure-label .icon-more-info"), titleLivingFigure = tooltipLivingFigure.attr("title"); tooltipLivingFigure.simpletip({ fixed: true, position: ["-115", "30"], baseClass: 'small-tooltip', content:titleLivingFigure + " " }); tooltipLivingFigure.removeAttr("title"); $("body").on("click", ".cite-living-figure", function(e) { e.preventDefault(); var ref = $(this).attr("data-ref"); $(this).closest(".living-figure-list-container").find("#" + ref).fadeIn(200); }); $("body").on("click", ".close-cite-living-figure", function(e) { e.preventDefault(); $(this).closest(".popup-window-wrapper").fadeOut(200); }); $(document).on("mouseup", function(e) { var metricsContainer = $(".article-metrics-popover-wrapper"); if (!metricsContainer.is(e.target) && metricsContainer.has(e.target).length === 0) { $(".article-metrics-close-button").click(); } }); var articleId = $('#articleId').val(); if($("#main-article-count-box").attachArticleMetrics) { $("#main-article-count-box").attachArticleMetrics(articleId, { articleMetricsView: true }); } }); var figshareWidget = $(".new_figshare_widget"); if (figshareWidget.length > 0) { window.figshare.load("f1000", function(Widget) { // Select a tag/tags defined in your page. In this tag we will place the widget. _.map(figshareWidget, function(el){ var widget = new Widget({ articleId: $(el).attr("figshare_articleId") //height:300 // this is the height of the viewer part. [Default: 550] }); widget.initialize(); // initialize the widget widget.mount(el); // mount it in a tag that's on your page // this will save the widget on the global scope for later use from // your JS scripts. This line is optional. //window.widget = widget; }); }); } close Error Close Add Reset F1000.MICROSERVICES.AFFILIATION = ''; $(document).ready(function () { $('.js-affiliations-form').each((index, form) => { new AffiliationForm({ formId: form.id, institutionErrorSelector: '.comment-enter-institution', departmentErrorSelector: '.comment-enter-department', placeSelector: '.js-add-comment-place', stateSelector: '.js-add-comment-state', zipCodeSelector: '.js-add-comment-zipcode', countrySelector: '.js-add-comment-country', countryErrorSelector: '.comment-enter-country', }); }); }); $(document).ready(function () { var reportIds = { "127489": 0, "127488": 0, "127491": 0, "127490": 0, "98821": 0, "128644": 0, "127492": 0, "98439": 0, "107913": 0, "99929": 0, "99677": 0, "296345": 11, "296346": 11, "144866": 0, "144867": 0, "144864": 0, "144865": 26, "144868": 0, "122235": 0, "117243": 84, "122234": 0, "97341": 0, "122237": 0, "97340": 0, "122236": 0, "97343": 0, "97342": 0, }; $(".referee-response-container,.js-referee-report").each(function(index, el) { var reportId = $(el).attr("data-reportid"), reportCount = reportIds[reportId] || 0; $(el).find(".comments-count-container,.js-referee-report-views").html(reportCount); }); var uuidInput = $("#article_uuid"), oldUUId = uuidInput.val(), newUUId = "08dd2a05-64fe-4c44-8cc0-00a30990e75e"; uuidInput.val(newUUId); $("a[href*='article_uuid=']").each(function(index, el) { var newHref = $(el).attr("href").replace(oldUUId, newUUId); $(el).attr("href", newHref); }); }); An innovative open access publishing platform offering rapid publication and open peer review, whilst supporting data deposition and sharing. Browse Gateways Collections How it Works Contact For Developers Cookie Notice Privacy Notice RSS Submit Your Research Follow us © 2012-2026 F1000 Research Ltd. ISSN 2046-1402 | Legal | Partner of Research4Life • CrossRef • ORCID • FAIRSharing R.templateTests.simpleTemplate = R.template(' $text $text $text $text $text '); R.templateTests.runTests(); var F1000platform = new F1000.Platform({ name: "f1000research", displayName: "F1000Research", hostName: "f1000research.com", id: "1", editorialEmail: "
[email protected]", infoEmail: "
[email protected]", usePmcStats: true }); $(function(){R.ui.dropdowns('.dropdown-for-authors, .dropdown-for-about, .dropdown-for-myresearch');}); // $(function(){R.ui.dropdowns('.dropdown-for-referees');}); $(document).ready(function () { if ($(".cookie-warning").is(":visible")) { $(".sticky").css("margin-bottom", "35px"); $(".devices").addClass("devices-and-cookie-warning"); } $(".cookie-warning .close-button").click(function (e) { $(".devices").removeClass("devices-and-cookie-warning"); $(".sticky").css("margin-bottom", "0"); }); $("#tweeter-feed .tweet-message").each(function (i, message) { var self = $(message); self.html(linkify(self.html())); }); $(".partner").on("mouseenter mouseleave", function() { $(this).find(".gray-scale, .colour").toggleClass("is-hidden"); }); }); Sign In Remember me Forgotten your password? Sign In Cancel Email or password not correct. Please try again Please wait... $(function(){ // Note: All the setup needs to run against a name attribute and *not* the id due the clonish // nature of facebox... $("a[id=googleSignInButton]").click(function(event){ event.preventDefault(); $("input[id=oAuthSystem]").val("GOOGLE"); $("form[id=oAuthForm]").submit(); }); $("a[id=facebookSignInButton]").click(function(event){ event.preventDefault(); $("input[id=oAuthSystem]").val("FACEBOOK"); $("form[id=oAuthForm]").submit(); }); $("a[id=orcidSignInButton]").click(function(event){ event.preventDefault(); $("input[id=oAuthSystem]").val("ORCID"); $("form[id=oAuthForm]").submit(); }); }); If you've forgotten your password, please enter your email address below and we'll send you instructions on how to reset your password. The email address should be the one you originally registered with F1000. Email address not valid, please try again You registered with F1000 via Google, so we cannot reset your password. To sign in, please click here . If you still need help with your Google account password, please click here . You registered with F1000 via Facebook, so we cannot reset your password. To sign in, please click here . If you still need help with your Facebook account password, please click here . Code not correct, please try again Reset password Cancel Email us for further assistance. Server error, please try again. If your email address is registered with us, we will email you instructions to reset your password. If you think you should have received this email but it has not arrived, please check your spam filters and/or contact for further assistance. Please wait... Register $(document).ready(function () { signIn.createSignInAsRow($("#sign-in-form-gfb-popup")); $(".target-field").each(function () { var uris = $(this).val().split("/"); if (uris.pop() === "login") { $(this).val(uris.toString().replace(",","/")); } }); });
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.