Abstract
While much is known about the encoding of experience, how the brain creates neural circuits capable of learning and memory formation is largely unstudied. Canonical critical periods emerge from a convergence of maturation- and experience-dependent processes. Notably, they rely on experience itself to close, resulting in permanent traces of early life. Mechanisms of perceptual critical periods have been well-studied, but cognitive critical periods are rare and poorly understood. One well-established critical period for learning is in the juvenile male zebra finch songbird. Juvenile females also perform sensory song learning at ages that overlap with those of the male critical period, though females may learn outside of its age boundaries. The examination of critical period closure allows for mechanistic evaluation of the convergence of maturation and experience, plus it provides a unique opportunity to identify neural factors that promote or limit the ability to learn. Because regulated transcription is necessary for the organization and function of cells and circuits, we used a discovery tool (ChIP-seq) for H3K27ac, a strong epigenetic marker of active promoters and enhancers. We examined male and female auditory forebrain, a region necessary for sensory song learning, at two ages and under rearing conditions that affect the male critical period. We present datasets including H3K27ac-defined regions, potential transcription factors that may coordinate biological functions, and predictions of genes that may regulated. This study thus contributes novel information about the processes, and the factors that may direct them, that may promote or limit the ability to learn across development.
Introduction.
One of the central questions of development is how mechanisms of programmed maturation and experience-dependent plasticity can converge to create specific windows when the environment can have profound and permanent changes on neural function and behavior. While often times changes in maturation can alone generate windows of opportunity, canonical critical periods include the element that the closure of these phases depends on the experience itself occurring; lack of relevant experience extends the window even as programmed maturation progresses (Hess, 1959; Knudsen, 2004; Takesian & Hensch, 2013; London, 2019). The juvenile male zebra finch songbird ( Taeniopygia guttata ) displays such a canonical critical period (Eales, 1985; 1987; Morrison & Nottebohm, 1993; Slater et al., 1993; London, 2019). This creates a unique opportunity to probe biological mechanisms of maturation and experience in the context of the ability to learn in ways that have meaningful influence on complex natural behavior across species (Eales, 1987; Morrison & Nottebohm, 1993; Slater et al., 1993; Doupe & Kuhl, 1999).
Both adult male and female zebra finches rely on juvenile sensory song learning to influence their behaviors. Juvenile male zebra finches need to listen and learn to an adult male to themselves generate a socially meaningful song as adults. Adult females cannot sing, but they do show song biases that relate to their experiences with hearing song as juveniles (Riebel, 2009; London, 2019). For males, the ability to learn from adult song is constrained to 35 days in posthatch (P) development, from P30-65 (Eales, 1985; 1987; Morrison & Nottebohm, 1993; Slater et al., 1993; Roper & Zann, 2006). However, isolating juvenile males from adult males during this phase extends the age at which sensory song learning from a tutor can occur – the end of the learning phase at P65 depends on the opportunity to learn occurring before then (Eales, 1987; Morrison & Nottebohm, 1993; Slater et al., 1993). Although rigorous tests for such a constrained ability to learn in females have not been performed, the ages during which exposure to song effectively influences female behavior overlaps with the male critical period (Miller, 1979b; Miller, 1979a; Clayton, 1988; Clayton, 1990; Riebel, 2009; Braaten, 2010; Holveck & Riebel, 2014).
Critical periods for learning may be fundamentally directed by alterations in chromatin that influence transcription. This is because maturational shifts in cell types, properties, and connections rely on regulated gene expression, and experience-dependent transcription is a hallmark of long-term memory formation (Alberini, 2009). Transcription is regulated by a set of proteins including transcription factors (Spitz & Furlong, 2012; Weidemüller et al., 2021). To operate, transcription factors need access to select genomic regulatory regions that contain sequences that permit binding. Although the diversity of regulatory regions and their markers are complex, posttranslational acetylation on Lysine 27 on the histone H3 protein (H3K27ac) is primarily associated with active regulatory regions, both proximal promoters and distal enhancers (Heintzman et al., 2007; Wang et al., 2008; Creyghton et al., 2010). We took advantage of this biological feature to discover possible transcription factors, and the genes they may regulate, that differ based on age, sex, and prior tutor experience at ages relevant to the closure of the male zebra finch critical period.
As far as we know, only one study has specifically investigated biological mechanisms of the closure of the male critical period for sensory song learning, and zero have examined females at these same ages (Kelly et al., 2018b). To assess the biology related to active regulatory regions, we performed H3K27ac chromatin immunoprecipitation followed by DNAseq (ChIP-seq). We assayed the auditory forebrain, a brain region required for juvenile sensory song learning (Jin & Clayton, 1997; Bolhuis et al., 2000; Lauay et al., 2005; Terpstra et al., 2006; Tomaszycki et al., 2006; London & Clayton, 2008; London et al., 2009; Yanagihara & Yazaki-Sugiyama, 2016; Ahmadiantehrani & London, 2017; Lampen et al., 2017; Diez et al., 2019). Focusing on the ages and experiences that define critical period closure in males, we endeavored to discover the extent to which regulatory region profiles track with states of learning. We also assessed female profiles at the same ages assess developmental changes and possible sex differences; despite no macroscopic volumetric differences in auditory forebrain, there are molecular distinctions (Ahmadiantehrani & London, 2017).
We present comprehensive datasets including called and differential H3K27ac-defined peaks, transcription factor binding site (TFBS) enrichment analysis to identify potential transcription factors (TFs) that may coordinate biological functions, and gene predictions based on the peaks with differential H3K27ac signal. Ultimately, this study thus contributes novel information about the potential processes, and factors that may underlie them, that create auditory forebrain properties to promote or limit the ability to learn across development, especially at the closure of an established critical period.
Methods.
Animals and housing. All procedures were conducted in accordance with the NIH guidelines for the care and use of animals for experimentation and were approved by the University of Chicago Institutional Animal Care and Use Committee (ACUP no. 72220). All experimental birds were hatched in the London laboratory breeding colony at the University of Chicago. Animals were housed on a 14:10 h light:dark cycle. Food and water were provided ad libitum .
To test the effect of age and sex on chromatin profiles, males and females were reared to either P60 (before the end of the critical period), and P67 (at the close of the critical period), under several conditions ( Figure 1 ). In the “ ’Normal” condition, birds spent the entirety of their lives in the communal aviaries in which they hatched. To parse the influence of maturation and tutor song experience in establishing H3K27ac peak profiles related to the known experience-dependent close of the male critical period, two independent sets of male birds were reared in “Tutored” and “Isolate” controlled conditions (Kelly et al., 2018b). All Tutored and Isolate birds were removed from home aviaries one day after fledging (P21-P23) and moved to cages within a sound-attenuating chamber coinhabited by two adult foster females and one or two other juveniles within 5 days of age. At P30, each Tutored male was moved to a new cage within a sound-attenuating chamber to live with one adult female and one adult male. To control for hearing species-specific vocalizations and the complexity of social interaction while preventing song exposure from a tutor male, at P30, each Isolate male was moved to a new cage within a sound-attenuating chamber to live with two adult female birds. Tutored and Isolate males remained in these conditions until P67.
Auditory forebrain collections. Auditory forebrain collections for ChIP-seq were performed between 6- and 8-hours post-lights-on. Auditory forebrains were dissected within 2 minutes of sacrifice, and the bilateral tissues were immediately flash-frozen using dry ice. Based on hatching patterns in the naturalistic colony, samples were collected between June 4 - October 11, 2019. All tissue was stored at -80°C until ChIP processing, beginning October 13, 2019. To obtain enough chromatin to perform successful ChIPseq, each analyzed sample was a pool of auditory forebrains from 3 individuals. There were n=3 pooled samples for all six ChIP-seq groups: P60 males (P60M), P60 females (P60F), P67 males (P67M), P67 females (P67F), P67 Tutored males (Tut), and P67 Isolated males (Iso). For RNAseq, an independent set of P60M, P60F, P67M, and P67F auditory forebrain samples were collected as part of a larger experiment. To obtain baseline RNA measures, birds were placed in an acoustic isolation chamber overnight at either P59 or P66. 6-8-hours after the lights turned on the next morning, auditory forebrains were dissected and rapidly frozen on dry ice and stored at -80C until processing. No pooling was performed; each RNAseq sample corresponded to a single individual (n = 4 for all groups) . The sex of all birds was confirmed by visual inspection of the testes or ovary. To avoid introducing bias based on genetic relatedness or parental behavior, no biological pool (ChIP-seq) or group (RNAseq) contained tissue from siblings.
Figure 1. Experimental groups and ages of collection superimposed on a timeline of posthatch development. Timeline depicts hatching (P1) through adulthood, P90. Solid red line shows defined critical period for male sensory song learning under tutored conditions; hashed lines indicate that the age range during which females can learn extends beyond the male period. Normal juvenile males (cheek patches) and females (no cheek patches) were reared in the communal aviaries in which they hatched until P60 or P67 (circles). Between P30 and P67, Tutored and Isolate males, collected at P67 (circles) lived in sound-attenuating chambers with either one adult male-female pair (Tutored) or two adult females (Isolate).
ChIP-seq and bioinformatic analysis. ChIP-seq for H3K27ac histone modifications was performed by the Service department at Active Motif using a previously validated antibody for immunoprecipitation (Active Motif Cat# 39133; Carlsbad, CA). Input was obtained from sequencing a pool of unprecipitated DNA combined in equal proportions from all samples. 75 nt single-end reads were acquired with Illumina NextSeq 500. Sequence data files can be found as NCBI BioProject PRJNA1177253.
Reads were analyzed as previously described (Kunzelman, in press). Briefly, after quality checks and trimming with FastQC and TrimGalore, reads were mapped to the 2021 zebra finch genome assembly (RefSeq bTaeGut1.4.pri) using Bowtie 2 (Langmead & Salzberg, 2012; Rhie et al., 2021) set with default sensitive parameters. With SAMtools (Li et al., 2009), we filtered out non-uniquely mapped reads. We called peaks with MACS2 with an effective genome size of 2.09E+09 and a q-value cutoff of 0.01, using ChIPQC to assess samples (Zhang et al., 2008; Feng et al., 2012; Carroll et al., 2014). We used the MACS2 output for differential peak analysis using the DESeq2 module of DiffBind after default library normalization (Stark & Brown, 2011; Ross-Innes et al., 2012; Love et al., 2014). Differential H3K27ac-defined regions reaching FDR < 0.05 were reported and used for genomic localization and predicted gene annotation with bTaeGut1.4.pri assembly (GCF_003957565.2) in ChIPseeker (Yu et al., 2015). Predicted gene names were entered into the Genotype-Tissue Expression (GTEx) portal to check for human adult cortex expression (calling “present” those with >2 TPM in GTEx v10 on 08/26/25), and compared to RNAseq data.
To evaluate nucleosome-free regions (NFRs), where transcription factor binding sites ( TF BSs) are primarily localized, we first called broad peaks in MACS2 with a q-value 0.1 cutoff, then identified NFRS from these peaks using HisTrader (Zhang et al., 2008; Feng et al., 2012; Yan et al., 2020). To generate the NFR regions within the differential peaks from the initial MACS2 peak calls, we intersected the differential peaks with the NFR profiles in bedtools (Quinlan & Hall, 2010; Quinlan, 2014). Finally, NFR BED files were converted to FASTA files, which were then used to identify enriched TF motifs (E-value ≤ 10) using Simple Enrichment Analysis (SEA; (Bailey et al., 2015; Bailey & Grant, 2021). TF motifs were taken from the JASPAR CORE (2022) non-redundant vertebrates database (Castro-Mondragon et al., 2022). TFs with enriched binding sites were compared to the Genotype-Tissue Expression (GTEx) portal to check for human adult cortex expression (calling “present” those with GO term analysis was performed on HGNC symbols for TFs with enriched binding sites and predicted gene sets using ShinyGO (Ge et al., 2020), with two lists per comparison and the human genome (GRCh38.p13) option.
ChIP-PCR validation. Independent Tutored and Isolate auditory forebrain (n=17 males to create n=3 pools per condition, average starting mass = 83mg) were used for amplification of 6 regions based on differential peak analysis. ChIP for H3K27ac was performed following a protocol adapted from Cold Springs Harbor (Cotney & Noonan, 2015). Protein A Dynabeads (Thermo Fisher, Cat# 10001D) and H3K27ac antibody (Active Motif, Cat# 39133) were used for IP. Samples were sonicated to achieve fragments 200-500bp using Model 120 Sonic Dismembrator (Fisher Scientific, Cat# FB120110) set to 30% amplitude, with 10-second pulses followed by a 10-second rest for a total of 50 minutes. Primer specificity and ideal annealing temperature were confirmed via melt curve analysis and further verified by gel electrophoresis (data not shown). Primers are listed in Table 1 .
| Chr10 | GGCTCAGTTTCAGGGATGTTAT | CCGTTTCTGAAATGCCATGG |
| Chr13 | AGCCTGGGAAAAAGGCAGAG | CCATCCCTTCCTCCGCTTG |
| Chr20 | CAAAGTCCCCTTGCTGTTCC | GAGGTTGCAGCAGAGGAAAC |
| Chr22.1 | CTGCACTGAACGGGCAGA | GAATCAGTGGCTGCGGGAT |
| Chr22.2 | GACACAGACAAAGCCACCAG | TCCTTCCCAACCACATCACA |
| Chr28 | TTCAGTGAGAGCCCTTGGTT | GCAGCTTTTACAGACGAGGG |
| Chr20 (negative control) | AAGCCACTCTGACCCTCATC | TTTCACTCCCACCTCACCTG |
| Chr4 (negative control) | TACGGTGACATGGCTGACTG | AGCTGGTCTCTGGTAGGGTG |
| GAPDH (positive, normalization) | CTACAGCTGCTGACGAAGAGT | GGTATGCGCTGCTTTCACCT |
Table 1. Primer sequences for ChIP-PCR.
Real-time PCR was performed on triplicate 20µl reactions containing 16ng of purified chromatin using SsoAdvanced Universal SYBR Green Supermix (Bio-Rad, Cat# 1725274). The reactions were performed on a CFX384 Touch Real-Time PCR machine (Cat# 1855484, Bio-Rad) using an initial denaturation and polymerase activation at 98°C for 3 minutes, then 50 cycles of 98°C for 15 seconds, 60°C or 66°C for 30 seconds and 72°C for 30 seconds. Average Cq values were calculated from the three technical replicates for both the target primer set and GAPDH. The ΔCq value was calculated (ΔCq = Cq Primer − Cq GAPDH ), and relative expression was determined using the 2ΔCq method. Data were analyzed using PRISM software (GraphPad Software 8.0.1, Inc) and expressed as mean ± SEM. Two-tailed Student´s t-test was used identify potential statistical differences between Tutored and Isolate data, with α < 0.05.
RNA Sequencing (RNAseq) and analysis. To provide an RNA dataset to inform ChIP-seq findings, auditory forebrain RNA was isolated from P60 and P67, males and females, with the RNeasy Micro Plus Kit (Qiagen, #74034) with RNase-Free DNase I treatment (Qiagen, #79256). PolyA selected RNA Tecan libraries (Ovation Ultralow v2) were prepped and sequenced via NovaSeq 6000 with S4 flow cells to acquire 150nt paired-end reads by the Roy J. Carver Biotechnology Center at the University of Illinois, Urban-Champaign. Reads were quality-checked, aligned with STAR (v2.7.8) to the zebra finch reference genome (bTaeGut1.4.pri), and analyzed with one-way ANOVA followed by multiple testing correction with the Benjamini–Hochberg (step-up) procedure using Partek Flow (Illumina) as in (Kunzelman, in press). We compared across age (P60M-P67M, P60F-P67F) and sex (P60M-P60F, P67M-P67F). Statistically significant (p 2 were also cross-referenced with lists of TFs with enriched binding sites and predicted genes generated from ChIP-seq analysis of normally-reared males and females.
Results.
ChIP-Seq data are of high quality. Sample read and peak measures showed that the raw data and peak calls were of high quality ( Supplementary Figures 1 and 2, Supplementary Tables 1 and 2 ). Consistent with published profiles, peaks were predominately located in promoter, intronic, and distal intergenic regions for all samples ( Supplementary Figure 1a and 2, Supplementary Table 3 ). Pearson correlation values between pairs of the triplicates were typically high (0.9-0.95, lowest = 0.75; Supplementary Figure 1b ). We found the expected profiles of the narrow peaks used for differential signal analysis and gene prediction, as well as that HisTrader-refined broad peaks for NFR and TFBS enrichment analysis ( Supplementary Figure 1c ). 65% of the putative TFs with enriched binding sites are expressed in the adult human cortex database GTEx, as are 97% of the predicted genes (data not shown). Validation ChIP-PCR reactions confirmed low abundance of negative control regions (Cq negative – Cq GAPDH range = 1.35-5.58) and 4/6 experimental peaks returned the expected greater abundance of chromatin in the Isolate compared to the Tutored samples after Cq normalization to GAPDH (Chr10 Tutored = 2.56, Isolate = 1.57; Chr13 Tutored = 5.83, Isolate = 6.81; Chr20 Tutored = 1.69, Isolate = 1.29; Chr22.1 Tutored = 1.54, Isolate = 2.88; Chr22.2 Tutored = 0.42, Isolate = 0.72; Chr28 Tutored = 1.21, Isolate = 3.79).
TFBSs and genes related to brain development and synaptic function were differentially represented in normally-reared P60 and P67 male auditory forebrain data. To investigate the H3K27ac-defined regions from auditory forebrain of males across the close of the critical period, we compared the peak sets from normally-reared P60 and P67 samples (Eales, 1985; 1987; Morrison & Nottebohm, 1993). A total of 103 regions had different levels of H3K27ac signal between P60 and P67 males, with approximately 3.5-fold more in P60 males (P60M-over-P67M) than in P67 males (P67M-over-P60M; Supplementary Table 3 ).
P60M-over-P67M regions were enriched with binding sites for two TF: PAX4 and ZNF707, neither of which are well-studied in brain and do not support significantly overrepresented GO categories ( Supplementary Table 4 ). P67M-over-P60M regions were enriched with binding sites for 11 TFs, including MEF2A, NR4A2, ESR2, NR2C1, RFX2, and REST ( Supplementary Table 4 ). These TFs are documented to regulate cellular maturation and differentiation, synapse structure and function, and learning and memory and together are overrepresented in categories of brain development, cell death, and signaling responses ( Figure 2a, Supplementary Tables 4, 5; (Liu et al., 2008; Shyr et al., 2009; Assali et al., 2019; Català-Solsona et al., 2021b; Jiang et al., 2023b).
We annotated and analyzed the differential peaks with the gene with the nearest transcriptional start site (TSS; Supplementary Table 3 ). The 23 genes predicted from the P60M-over-P67M regions included the synaptic ATP transporter SLC17A9, heterochromatin regulator PWP1, calcium-activated potassium channel KCNMB2, transcriptional repressor ZNF438, and tight junction scaffold protein TJP1 ( ZO-1; (Zhong et al., 2007; Fong et al., 2008; Sawada et al., 2008; Luissint et al., 2012; Yu et al., 2019), but there were no overrepresented GO terms within this gene set ( Supplementary Table 6 ). The 76 genes predicted from the P67M-over-P60M regions included CDK5RAP2 (a centrosome organizer), LINGO1 (a negative regulator of processes including myelination), CIC (a transcriptional repressor involved in cell differentiation), GRM2 (a glutamate metabotropic receptor subunit), MAPK1 (a core ERK kinase protein necessary for juvenile male sensory song learning), and another MEF2 family member implicated in synaptic plasticity, MEF2D ( Figure 2b, Supplementary Table 3 ; (Mi et al., 2005; Potthoff & Olson, 2007b; Fong et al., 2008; London & Clayton, 2008; Hwang et al., 2020; Nisar et al., 2022). The P67M-over-P60M predicted gene set was overrepresented in GO categories related to glutamatergic synapses and dendrites, transporters, and molecular adaptors Figure 2b, Supplementary Table 6 ) .
Figure 2. Functional overrepresentation of enriched TFBSs and predicted genes resulting from male P60 and P67 peak comparisons. Sankey dot plots showing GO categories overrepresented in (a) P67M-over-P60M enriched TFBSs and (b) predicted genes.
Analysis of differential female peaks indicate regulation of developmental and signaling processes between P60 and P67. Because tests for a critical period in female juvenile sensory song learning have not been performed, it is difficult to directly relate changes in female H3K27ac profiles between P60 and P67 to differences in the ability to learn. These comparisons could provide mechanistic evidence for a transition in the ability to learn, and present the opportunity to compare to male H3K27ac-defined peaks. As such, we assessed H3K27ac-defined peaks in female auditory forebrains at the same two ages as males. A total of 1748 peaks showed differential H3K27ac signal between P60F and P67F auditory forebrains ( Supplementary Table 3 ). Enrichment analysis identified 307 TFBSs in the P60-over-P67 female regions and 101 TFBS within the P67F-over-P60F regions (Supplementary Table 4).
TFs with enriched motifs in the P60-over-P67 female comparison included hormone receptors and related proteins (AR, ESR1, ESR2, ESRRA, ESRRB, ESRRG, THRA, THRB), CREB proteins involved in experience-dependent plasticity (CREB1, CREB3, CREM), Dlx and RFX factors involved in cell cycle and differentiation, immediate early genes (IEGs) like FOS, JUN, and EGR1, and MEF2 family proteins (Emery et al., 1996; Kandel, 2012; Rubenstein et al., 2024). Biological Process GO term analysis of P60-over-P67 female TFBSs predominantly revealed categories of development, including neurogenesis, cell differentiation, and brain regionalization, as well as intracellular signaling for several pathways ( Figure 3a, Supplementary Table 5 ).
In addition to IEGs, MEF2, and CREB, enriched TFBSs in the P67F-over-P60F H3K27ac-defined peaks also included a set of related zinc finger proteins of the KLF (kruppel-like factor) and SP (specificity protein) families, which can act as transcriptional repressors and activators to affect many aspects of cell function ( Figure 3b, Supplementary Table 4 ; (Suske, 1999; Kaczynski et al., 2003b). GO analysis of P67F-over-P60F enriched TF motifs, like those from the P60F-over-P67F peaks, highlighted themes of cell proliferation and cellular differentiation. Enriched motifs in the P67F-over-P60F peaks were also overrepresented in GO categories that highlighted responsivity to various endogenous stimuli ( Figure 3b, Supplementary Table 5 ).
Figure 3. GO categories overrepresented in enriched TFBSs and predicted genes revealed from P60F-P67F H3K27ac peak analysis. Dot plots showing significantly overrepresented Biological Process GO categories and the TF with enriched motifs that contribute to them in the ( a ) P60F-over-P67F and ( b ) P67F-over-P60F peaks. ( c, d ) Dot plots showing major overrepresented BP categories in the set of predicted genes in the female ( c ) P60-over-P67 and ( d ) P67-over-P60 H3K27ac-defined peaks.
Predicted genes associated with female H3K27ac-defined peaks reveal changes in auditory forebrain organization and signaling properties. There were 1104 and 324 genes ascribed to P60-over-P67 and P67-over-P60 female regions, respectively ( Supplementary Table 3 ). In the P60F-over-P67F comparison, genes included those related to learning and memory ( CREB1, CREM, CAMK2B, GRIN2A, SYNGAP1 ), synaptic properties ( GNAI2, GNA11, GNAS, SLC6A8, SLC8A1, MAST3, MNT, MXI1 ), axon and dendrite development ( EPHA3, EPHB3, ROBO4, DLG3, DLGAP4, KIF21B, KIF3C, KIF7, KIFC3 ), and more general development ( Wnt, OGT ). In the P67F-over-P60F comparison, genes included synaptic proteins ( SYT9/13, DLG1/2, SV2B, RIMS1, PCDH17, SLC1A2 ) and a variety of receptors for guidance molecules, growth factors, hormones, and neurotransmitters (e.g. ROBO 1 and 2, NTRK3, NR3C2, GRIN2A, HTR2B, HTR4 ; Supplementary Table 3 ).
Functional analysis revealed some overrepresented GO categories ̵̶ cell proliferation, differentiation, migration, and adhesion, those related to synapses, and molecular cascade signaling terms ̵̶ that were significantly overrepresented in predicted genes from both the P60F-over-P67F and P67F-over-P60F peaks ( Figure 3c, d; Supplementary Table 6 ). Genes in the P60F-over-P67F set were also overrepresented in categories for protein localization and phosphorylation ( Figure 3c; Supplementary Table 6 ). GO analysis of the P67F-over-P60F predicted gene set returned categories of cell adhesion and enzyme activity ( Figure 3d, Supplementary Table 6 ). Although some GO categories were significantly overrepresented in both P60F-over-P67F and P67F-over-P60F gene lists, there was very little (1-4%) overlap in the gene identifies betwee the P60F-over-P67F and P67F-over-P60F data.
Direct comparisons of age-matched male and female H3K27ac-defined peaks revealed the potential for chromatin-based sex differences in auditory forebrain. The developmental ages during which males and females are influenced by tutors overlap but there are sex differences in molecular responses to song at the male critical period onset, when both sexes are capable of learning (Eales, 1985; 1987; Roper & Zann, 2006; Riebel, 2009; Ahmadiantehrani & London, 2017). Here, we endeavored to probe the extent to which auditory forebrains display sex differences in H3K27ac-defined regions for two main reasons: 1) to assess the possibility that normally-reared P67 females, like males, show reduced learning potential, and 2) to identify potential TFs, genes, and processes that may be essential to auditory forebrain development regardless of sex. We thus performed direct differential analysis of peaks from normally-reared male and female auditory forebrains at each age. We identified 4659 regions with sex differences in H3K27ac signal at P60 and 1852 differential regions at P67 ( Supplementary Table 3 ). The proportion of peaks localized to sex chromosomes depended on the comparison, with a range of 0.1% to 76% (P60F-over-P60M: chrW 266/2602, chrZ 3/2602; P60M-over-P60F: chrZ 1564/2057; P67F-over-P67M: chrW 231/451, chrZ 1/451; P67M-over-P67F: chrZ 1029/1401; Supplementary Table 3 ).
TF motifs enriched in the direct sex peak comparison reveal the potential for complex regulation of cell properties and signaling across sex and age. The direct sex comparisons returned 94-325 TF BSs enriched within each of the four within-age, between-sex comparisons ( Supplementary Table 4 ). Some TF BSs were exclusive to either the male-over-female or female-over male peaks at each age, and others were present in both direct sex comparisons ( Supplementary Table 4 ).
Direct sex comparison at P60 reinforces active processes of brain development, though often with sex-specific TFs implicated. For example, at P60, there was a set of 135 TFBSs present in both male-over-female and female-over male comparisons ( Supplementary Table 4 ). These included fos and jun -related IEGs, CREB1, MEF2 and HOX family members, and Arx, which has multiple essential roles in brain development (Friocourt & Parnavelas, 2010).
Also at P60, 42 TFBSs were exclusively enriched in the male-over-female comparison. These included several IEGs (EGR1, FOS, FOSL1/2, JUN, JUNB, JUND), MEF2 family members that regulate synaptic plasticity (MEF2A-D), CREB-related TFs involved in learning and memory (CREB, CREB3L1, CREB3L4, CREB5, CREM), and sets of KLF and TBX proteins involved in multiple developmental events (Kaczynski et al., 2003b; Papaioannou, 2014). Other TFs with enriched binding sites in the P60M-over-P60F comparison are involved in aspects of brain development such as patterning, cell survival, and differentiation of cell subtypes including inhibitory and excitatory neurons as well as glia subtypes (e.g. EMX, LHX, HOX, GSX genes).
The 190 TFBSs exclusive to the P60F-over-P60M comparison include sets of DLX and FOX family members necessary for brain development, DMRT DNA methylation regulators DMRT1, DMRTA2) estrogen receptors and related proteins (ESR1, ESR2, ESRRA, ESRRB, ESRRG), hormone receptors (NR5A1, THRB), and critical period-implicated OTX2 ( Supplementary Table 4 ; (Golson & Kaestner, 2016; Lee et al., 2017; Co et al., 2020b; Rubenstein et al., 2024).
The GO categories significantly overrepresented by TFBSs that emerged from the P60 direct sex H3K27ac peak comparison included those related to Wnt and Notch signaling (female-over-male) and developmental processes and insulin regulation (male-over-female; Figure 4a, b, Supplementary Table 5 ). Some categories (behavior, development, cell proliferation and differentiation, and axon maturation) were also overrepresented in TFBSs enriched in both the male-over-female and female-over-male H3K27ac-defined peak sets ( Figure 4a, b, Supplementary Table 5 ). Some TFs that contribute to these categories are also shared (e.g. MEF2A, MEF2C, FOS, CREB1, ARX, FOS, JUN), but the peaks cannot be, by virtue of them being the output of a direct sex statistical contrast.
Direct sex comparison at P67 revealed some persistent differences in enriched TFBSs, but others that indicate distinct processes at the close of the male critical period. By P67, some of the TFBSs enriched in sexually dimorphic peaks switched the directionality of their enrichment ( Supplementary Table 4 ). For example, at P67, the IEG EGR1 was in the female-over-male-exclusive list of 40 enriched TF motifs, and ESR1 and ESR2, as well as a set of FOX proteins, were in the male-over-female-exclusive list, which contained 109 TFBSs total . Some TFs with enriched binding sites in both male-over-female and female-over-male peaks at P60 remain in both P67 sex comparisons, including CREB1, MEF2D, and IEG dimers such as those with JUN and FOS. In fact, FOS and JUN-related proteins, as well as CREB1, were represented within the list of 40 TFs that were present in all four comparisons (more below).
In addition to IEGs, the P67M-over-P67F comparison returned enriched motifs for other TFs involved in learning, memory, and synapses (e.g. LHX family members, MEF2A-C; Supplementary Table 4 ; (Hobert & Ruvkun, 1998; Chen et al., 2012; Doucet-Beaupré et al., 2015; Assali et al., 2019; Leung et al., 2022). TFs that regulate cell proliferation and differentiation (e.g. FOX, SOX6) also have enriched binding sites, with sets of FOX TFBSs exclusively enriched in the P67M-over-P67F comparison (Hagiwara, 2011; Co et al., 2020a; Stevanovic et al., 2021).
The P67F-over-P67M analysis returned enriched binding sites for multiple TFs not found in the male-over-female comparison ( Supplementary Table 4 ). This includes two IEGs (EGR1 and JUN), KLF factors involved in brain development, and two TFs, CTCF and DMRT3, with broad implications for chromatin organization and transcription including developmental processes (Moore et al., 2011; Sams et al., 2016; Davis et al., 2018; De Clercq et al., 2018; Konno et al., 2019; Kikkawa & Osumi, 2021; Dehingia et al., 2022; Kirk et al., 2025).
There was also set of TF motifs that were enriched in both P67 direct sex comparisons. These included SP and RFX family members that direct aspects of brain development and synaptic plasticity that contribute to cognition ( Supplementary Table 4; (Mao et al., 2009; Sugiaman-Trapman et al., 2018; Harris et al., 2021).
Functional analysis of the enriched TF motifs in the P67 direct sex comparison returned multiple overrepresented GO categories that highlight features of development, plasticity, cell generation and differentiation, as well as specific features of brain function ( Figure 4c, d, Supplementary Table 5 ). Categories indicating axon development, insulin regulation, neurogenesis, oligodendrocyte differentiation, and Notch signaling were exclusive to the P67M-over-P67F categories ( Figure 4c ). Categories overrepresented only in the P67F-over-P67M TF motifs include DNA methylation and histone acetylation. Several categories, such as apoptosis, miRNA transcription, and hormone signaling, and those related to cognition and behavior including learning and memory, were overrepresented in lists of enriched TFBSs from both P67M-over-P67F and P67F-over-P67M comparisons ( Figure 4c, d ).
Figure 4. Biological Process GO categories overrepresented in enriched TFBSs from direct sex comparisons of H3K27ac signal. Dot plots showing categories, -log 10 (p-values), and number of contributing motifs for data from ( a ) P60M-over-P60F, ( b ) P60F-over-P60M, ( c ) P67M-over-P67F, and ( d ) P67F-over-P67M peak comparisons. Black = unique categories, orange = category found in 2 comparisons, blue = category found in 3 comparisons, turquoise = category found in all four comparisons.
At P60, predicted genes that arose from direct sex comparison of H3K27ac-defined peaks indicated shared developmental processes but also sex-specific types of signaling. The genes predicted from sexually dimorphic peaks at P60 reinforce the distinct regulation of multiple developmental processes that emerged from the enriched TF motifs. ( Figure 5a-d, Supplementary Table 3 ). For example, there were 49 and 119 predicted genes that contributed to the GO category of “central nervous system development” in the P60M-over-P60F and P60F-over-P60M analyses, respectively. Genes from both P60 direct sex comparisons were also overrepresented in categories of synaptic signaling, cytoskeletal organization, as well as cell proliferation and death ( Figure 5a, b, Supplementary Tables 3, 6 ).
However, while 26 genes (e.g. CDK5RAP2, CCNI, CORO1C, MRAS, ITKPA, RBFOX1, FZD1, NAP1L4, SLC2A2 ) were common in the P60 predicted gene sets that arose from comparison of male and female H3K27ac peak signals, and despite some overlap in functional categories, at least 97% genes were exclusive to either the P60M-over-P60F or P60F-over P60M comparison ( Figure 5a, b, Supplementary Tables 3, 6 ). For example, genes involved in NMDA receptor activity ( MEF2C, RASGRF2, GRIA3, NRXN1, GRIN2A, DAPK1 ), and up to 27 genes related to Rho/Ras GTPase signaling are present only in the P60M-over-P60F gene set, which had 987 predicted genes total ( Figure 5a, Supplementary Tables 3, 6 ). In the P60F-over-P60M set of predicted genes (1816 genes total) only, there were 144 genes that contributed to the category of cell adhesion and other non-overlapping sets of genes that supported categories of adherens junctions and basal lamina ( Figure 5b, Supplementary Tables 3, 6 ). Further, 147 genes regulate cell death, and a suite of 6 genes ( GNA11, GNAI2, CHRM3, GRK2, CDK5R1, AGRN ) support acetylcholine signaling functions only in the genes predicted from P60F-over-P60M peaks ( Figure 5b, Supplementary Tables 3, 6 ).
Figure 5. Biological Process GO categories overrepresented in genes predicted from direct sex comparisons of H3K27ac-defined peaks. Dot plots showing categories, -log 10 (p-values), and number of contributing motifs for data from ( a ) P60M-over-P60F, ( b ) P60F-over-P60M, ( c ) P67M-over-P67F, and ( d ) P67F-over-P67M peak comparisons. Black = unique categories, orange = category found in 2 comparisons, blue = category found in 3 comparisons, turquoise = category found in all four comparisons.
At P67, predicted genes from direct comparison of male and female H3K27ac peak signals revealed sex differences in signaling and protein processing. At P67, there were 760 and 306 genes predicted in the male-over-female and female-over-male comparisons, respectively ( Supplementary Table 3 ). Only one gene, STARD8, a Rho GTPase activating protein (RhoGAP), was present in both direct sex comparisons ( Supplementary Tables 3, 6 ; (Stankiewicz & Linseman, 2014; Amin et al., 2016), but several GO categories, including those related to neurogenesis, as well as synaptic development and function were overrepresented in both P67M-over-P67F and P67F-over-P67M comparisons ( Figure 5c,d, Supplementary Table 6 ).
In the P67M-over-P67F predicted geneset, at least 35 genes were involved in actin cytoskeleton organization, 18 genes were related to Ras/Rho signaling, 40 were involved in actin cytoskeleton processes, and 10 ( GOLPH3 WDR24 SH3BP4 PRKAA1 RPS6 C9orf72 PINK1 SIK3 PRR5 CASTOR1 ) were related to TOR (Target of Rapamycin) cascade signaling; mTOR signaling is required for male juvenile sensory song learning ( Figure 5c, Supplementary Table 6 ; (Ahmadiantehrani & London, 2017).
Genes that supported unique P67F-over-P67M GO categories included 7 related to insulin signaling ( SRI, GPR68, SNAP25, PPP3CA, ADCYAP1, TIAM1, RIMS2 ), and 7 involved in learning and memory ( NRXN3, LGMN, DBH, ATXN1, EIF2AK4, SNAP25, GRM5; Figure 5d, Supplementary Table 6 ).
A set of “core” TFBSs were enriched in all four direct sex comparisons of H3K27ac peak signals. We noted that a subset of 40 TFBSs were enriched in all four by-sex, within-age comparisons ( Figure 6a, Supplementary Figure 3, Supplementary Table 7 ). We termed these “core” TFBSs because they may direct processes essential for auditory forebrain function regardless of age of sex. These included motifs for neural plasticity TFs (e.g. AP-1 and IEGs in the Fos and Jun families, CREB1/5 and CREM, MEF2D), and a set that direct aspects of development (HOXA1, HOXB4, ELF5, MEF2D, PATZ1, RFXs, ZNF530, CREB5, NFIC, and KLF and SP family members; Figure 6b, Supplementary Table 7 ). Immune system processes, some of which are implicated in developmental neural plasticity, are also represented in the core TFBS set (SPI1, PRDM9, and RFX family members; Figure 6b, Supplementary Table 7 ; (Zhang et al., 2007; Boulanger, 2009; Bilbo & Schwarz, 2012; Di Zazzo et al., 2013; Mehl et al., 2022; Lai et al., 2025; Wu et al., 2025). No predicted genes were present in all four comparisons.
Figure 6. Identification and functions of TFs with enriched motifs in the core and sex-specific categories. ( a ) Venn diagram displaying the number and overlap of TFBSs identified from the four possible direct sex comparisons. ( b ) Plot showing significantly overrepresented Biological Process GO categories and the TF with enriched motifs that contribute to them. Core TFBS are in black, TFBSs unique to female comparisons are in green; there is some overlap in categories between these two groups. TFBSs uniquely enriched in the male-biased H3K27ac peaks are only overrepresented in transcription-related GO categories (brown).
Tutored and Isolate male auditory forebrain analyses revealed distinctions in neural organization and response properties. Withholding tutor experience from male zebra finches during their critical period extends the age at which they memorize tutor song (Eales, 1985; 1987; Morrison & Nottebohm, 1993; Slater et al., 1993). Tutor isolation alters epigenetic signatures, gene expression, and functional connectivity in P67 male auditory forebrains (Kelly et al., 2018a; Layden et al., 2020). To compare H3K27ac-defined peaks in auditory forebrains from age-matched males who can and cannot still memorize tutor song at the close of the critical period, we raised birds under tutored and non-tutored conditions until P67 (“Tutored” and “Isolate” groups, respectively).
Direct comparison of Tutored and Isolate peak sets identified a total of 51 regions with distinct H3K27ac signal ( Supplementary Table 3 ). We found 3 TF BSs enriched in the Tutored-over-Isolate regions (ZNF708, SPIB, and ELF3) and 11 that were enriched in the Isolate-over-Tutored regions, including SP5, THAP11, and AP-1 family members ( Supplementary Table 4 ). GO analysis returned no overrepresented terms from the Tutored-over-Isolate TFBS data, but Biological Process categories mostly related to cell responsivity emerged from the TFs with enriched binding sites in the Isolate-over-Tutored comparison ( Figure 7a, Supplementary Table 5 ).
Genes predicted from the Tutored-over-Isolate peak analysis included those related to development of cells and their connectivity (e.g. CELSR3, SDK2, SEMA6B, PRICKLE2 ) including those involved in synaptic function (e.g. APBA3, DTNB, SNTA1, SLC6A9 ; Figure 7b ; (Blake et al., 1998; Blake et al., 1999; Koncina et al., 2007; Bhat et al., 2013; Qu et al., 2014; Goodman et al., 2016; Marques et al., 2020; Bayat et al., 2021). Genes predicted from Isolate-over-Tutored peaks include some that alter neuronal structure and connectivity in ways that influence learning and memory (e.g. DYNC1I1, PTPRF, SEPTIN7 ), and two that are directly related to chromatin and transcriptional processes ( BEND5, PHF21B ; (Tada et al., 2007; Dai et al., 2013; Krienen et al., 2016; Liu et al., 2016; Basu et al., 2020; Ageta-Ishihara & Kinoshita, 2021; Cornejo et al., 2021; Chin et al., 2022; McFarlan et al., 2024). GO analysis of predicted genes based on peaks with differential H3K27ac signal in the Tutored-over-Isolate and Isolate-over-Tutored comparisons returned categories related to cell adhesion and cell cycle, respectively ( Figure 7c, Supplementary Tables 3, 6 ).
Figure 7. Comparison of Tutored and Isolate data. Sankey plots of significantly overrepresented BP GO categories based on ( a ) enriched TF motifs from the Tutored-over-Isolate peak comparison, and ( b-c ) predicted genes from the ( b ) Tutored-over-Isolate and ( c ) and Isolate-over-Tutored analysis.
Comparing H3K27ac signals between aviary-reared P67M and those from Tutored and Isolate samples reveals little effect of controlled rearing condition. We recognized that while the Tutored and Isolate conditions provided a well-controlled direct contrast, that we had the opportunity to also compare H3K27ac-defined peaks with those from age-matched aviary-reared male auditory forebrains. We thus also compared peaks, enriched TF BSs, and predicted genes from the P67M “Normal” group and the Tutored and Isolate groups.
Overall, we found little indication that our controlled rearing condition disrupts auditory forebrain development. There were 3-15 TFs with enriched binding sites across the four comparisons ( Supplementary Table 4 ). Enriched motif lists did not support significantly overrepresented GO categories, but examination of known functions indicated that each included at least one TF directly implicated in learning and memory (e.g. ELK1, ESR2, NPAS4, KLF9, ATF1 ; Supplementary Table 4 ; (Matynia et al., 2002; Lin et al., 2008; Scobie et al., 2009; Biason-Lauber & Lang-Muritano, 2022)). Except for motifs identified in the P67M-over-Tutored analysis, enrichment lists did include at least one TF with a direct role in differentiation of brain cell types, including KLF7, LHX6, MAFK, ELK1, and HOXA1 ( Supplementary Table 4 ; (Töröcsik et al., 2002; Laub et al., 2005; Liodis et al., 2007; Besnard et al., 2011; De Kumar et al., 2017).
Collectively, 13 genes were predicted to be affected by transcriptional regulation at the differential peaks ( Supplementary Table 3 ); no GO categories were significantly overrepresented. There were no genes directly implicated in learning and memory processes in any of the four comparisons. Of the 7 genes predicted from the P67M and Tutored comparison, 3 ( BEND5, RPC4, ZNF280D ) regulate transcriptional processes (Buonincontri et al., 2011; White, 2011; Dai et al., 2013). Of the five genes predicted by the P67M-over-Isolate peaks, four ( SDK2, SEMA7A, SEMA4C, PPP3CC ) that regulate axonal and synaptic processes (Mann et al., 2007; Monroe & Heathcote, 2013; Chowdhury et al., 2021). GPATCH8 was the only gene predicted from Isolate-over-P67M peaks; it regulates RNA processing (Nagase et al., 1998).
RNAseq confirms expression of a majority of predicted TFs and genes in the P60 and P67 auditory forebrain. We compared the TFs with enriched motifs and genes predicted from the H3K27ac peak analyses to RNAseq data we collected from an independent set of P60 and P67, male and female, auditory forebrains ( Supplementary Table 8 ). RNAs for 47.2% of the putative TFs and 80.3% of the predicted genes are detectable in our RNAseq data ( Supplementary Table 9 ). At P60, 59.0% of the P60M-over-P60F genes were localized to the Z chromosome; at P67, this proportion is 54.1%. Analysis of the RNAseq data alone reveals differences in RNAs consistent with processes represented in the H3K27ac data, including significantly overrepresented (FDR<0.05) GO categories related to the extracellular space and signaling ( Supplementary Table 9 ).
Discussion.
Developmental critical periods are phases when experiences can have robust and permanent influence on brain and behavior (Hess, 1959; Knudsen, 2004; Takesian & Hensch, 2013). Understanding the processes that underlie a transition in learning abilities across the close of the critical period may provide insight more generally into neural properties that support or limit the ability to learn. Because male zebra finches have a well-established developmental critical period for sensory song learning, and both juvenile males and females learn in ways that influence their adult behaviors, this species is a uniquely important model for these investigations. Here, to advance our broader understanding of how the ability for developmental learning may be regulated, and provide novel targets for continued investigation, we employed H3K27ac ChIP-seq and downstream analysis to discover the effects of age, sex, and tutor song experience on putative active regulatory regions, enriched TFBSs, and genes that may be regulated.
Perhaps unsurprisingly, given the role of both maturation and experience in regulating critical periods, analysis of H3K27ac-defined peak profiles from P60 and P67 males revealed two major themes: development and plasticity. Some of the TFs enriched in binding sites identified here have been previously implicated in the potential for sensory song learning, for example MEF2 family members and NR4A2 (Dong et al., 2009; London et al., 2009; Kelly et al., 2018b). MEF2 proteins can act as transcriptional activators and repressors depending on context, and contribute to synaptic plasticity and other cell features (Shalizi & Bonni, 2005; Shalizi et al., 2006; Potthoff & Olson, 2007a; Assali et al., 2019). NR4A2 supports synaptic plasticity and learning, and is rapidly transcribed in auditory forebrain in response to hearing song (Dong et al., 2009; Català-Solsona et al., 2021a). It may be that accessible binding motifs facilitate NR4A2-mediated transcriptional underpinnings of these processes. Several novel targets we identified, such as RFX2, RFX4, MEIS2, and TFAP2B, are transcription factors that coordinate key features of brain organization; they can be now tested for their potential to alter auditory forebrain properties pertaining to the changing ability to learn across the close of the male critical period (Eckert et al., 2005; Harris et al., 2021; Jiang et al., 2023a; Choi et al., 2024; Dvoretskova et al., 2024).
Genes predicted by differential P60 and P67 male auditory forebrain peak analysis indicated specific processes that may be altered as the critical period closes. These include two new previously-untested factors with ties to known auditory forebrain learning mechanisms: receptor tyrosine kinases and Ras signaling. For example, MAPK1 (Mitogen-Activated Protein Kinase 1) is one gene that contributes to the receptor protein tyrosine kinase GO category. MAPK1 (also called ERK; Extracellular signal Regulated Kinase) signaling in the auditory forebrain is essential during tutor experiences for juvenile males to effectively memorize song (London & Clayton, 2008). However, SPRY3 (Sprouty RTK Signaling Antagonist 3), another gene on the list, inhibits receptor tyrosine kinase cascades, and is known to antagonize ERK signaling (Mason et al., 2006). Additionally, RHBDF1 (Rhomboid 5 Homolog 1) indirectly modulates activation of EGF receptors, which are receptor tyrosine kinases (Dulloo et al., 2019; Düsterhöft et al., 2019). Receptor tyrosine kinase signaling can also influence Ras cascades, including those that regulate the two cascades known to be necessary for male juvenile sensory song learning, ERK and mTOR (London & Clayton, 2008; Mendoza et al., 2011; Ahmadiantehrani & London, 2017; Hossain, 2024). More generally, the genes related to Ras signaling are known to regulate synaptic plasticity events for learning and memory (Brambilla et al., 1997; Ryu et al., 2019; López-Merino et al., 2025). Given the complex and central functions of receptor tyrosine kinase and Ras signaling, and the known involvement of ERK and mTOR signaling in male critical period learning, these genes and their processes may be fruitful targets for future mechanistic investigations.
We included P60 and P67 females for several reasons. First, because there is a paucity of biological information on sensory song learning in juvenile females, second because juvenile females do perform sensory song learning that affects their behavior – song preferences – in adulthood, third, because tests for critical period closure have not yet been performed, and lastly, because despite no obvious sex difference in the auditory forebrain structure, as is the case for the singing circuitry, there are molecular sex differences but the paradigms used to assess learning males and females thus far often do not match and it is thus difficult to draw precise mechanistic conclusions (Miller, 1979b; Miller, 1979a; Clayton, 1988; Clayton, 1990; Riebel, 2009; Braaten, 2010; Holveck & Riebel, 2014; Ahmadiantehrani & London, 2017) (Eales, 1987; Clayton, 1990; Roper & Zann, 2006; Riebel, 2009; Holveck & Riebel, 2014). Including both sexes here provides some consistency to begin to evaluate female sensory song learning. Interestingly, we did find differences based on H3K27ac-defined peaks between P60 and P67 female auditory forebrains, including some intriguing processes related to the ability to learn. These included enriched motifs for TFs involved in Notch, Wnt and BMP signaling. All of these are essential maturational pathways that set up cell populations and their patterning to create functional brain circuits (Hayward et al., 2008; Manzari-Tavakoli et al., 2022; Bing et al., 2023). Dysregulation of these types of organizational processes disrupt learning and memory (Alberini, 2025). Further, predicted genes indicate that protein phosphorylation and localization, crucial processes for cellular and synaptic plasticity, may be differentially regulated between P60 and P67 female auditory forebrains (Sweatt, 2001; Hernandez & Abel, 2008; Rosenegger et al., 2008). It is thus possible that features uncovered here may signal a shift in the ability of females to learn around the same ages as males; this idea needs to be empirically tested and reconciled with existing behavioral data (Riebel, 2009).
We note that some processes identified here may appear general, but may still have direct consequences for the ability to learn. For example, processes of cell generation, differentiation, and death are regulated differentially in P60 and P67 male and female auditory forebrain data. This signature appears to be particularly robust for neurons, though it is not exclusive to neurons. In zebra finches, forebrain cell proliferation persists through adulthood, and the auditory forebrain is bounded by lateral ventricle which is lined with stem cells (Vates et al., 1996; DeWulf & Bottjer, 2002; 2005). Although no data are available at P60 or P67, at P30 and adults, there are reported sex differences in cell proliferation measures in the posterior telencephalon, where auditory forebrain is localized (DeWulf & Bottjer, 2002). Additionally, age, sex, and song experience can alter the number of new cells, and their dendritic morphology, in the auditory forebrain (Pytte et al., 2010; Pytte, 2016). Incorporation of new cells is related to song structure in adult songbirds including male zebra finches (Lipkind et al., 2002; NOTTEBOHM, 2004; Barnea et al., 2006; Adar et al., 2008; Barnea & Pravosudov, 2011; Cohen et al., 2016). It is thus possible that similar effects occur for juvenile sensory song learning across the critical period.
Our results suggest that there is a subset of essential transcriptional regulation that must occur regardless of sex and age for auditory forebrain function, but there are also alternative strategies that can establish neural properties capable of learning. We did observe a set of 40 “core” motifs for TFS that represented a full overlap of the four direct sex comparisons. The direct sex comparisons also identified motifs for IEGs well studied in the context of learning and memory such as Fos, Jun, and CREB that were commonly enriched in both male-over-female and female-over-male peaks (Sweatt, 2001; Loebrich & Nedivi, 2009; Kida & Serita, 2014; Khan et al., 2025). Similarly, while the specific genes were distinct in the male-over-female and female-over-male analyses, both sets were overrepresented in GO categories for behavior, axons and dendrites, glutamatergic synapses, and neurogenesis.
However, we did find sex differences in the enriched binding sites and gene functions. For example, at P60, peaks were enriched for KLF and SP (male-over-female), and DLX, POU (Pit-Oct-Unc; female-over-male) families. None of these TFs are directly implicated in learning and memory, but they are in core developmental processes that could influence circuit organization to support learning such as cell differentiation and migration (Schonemann et al., 1998; Suske, 1999; Kaczynski et al., 2003a; Malik et al., 2018; Rubenstein et al., 2024; Kirk et al., 2025). Interestingly, several of these TFs such as SP9 (male-over-female) and Dlx1, Dlx5, and Dlx6 (female-over-male) direct development of GABAergic inhibitory cells that are instrumental in brain development and critical period shifts in excitatory/inhibitory balance (Liu et al., 2019; Warm et al., 2021; Rubenstein et al., 2024). Predicted gene sets also showed sex-specific process such as TOR signaling (male-over-female), known to be necessary for male juvenile sensory song learning, and insulin secretion (female-over-male, more below; (Ahmadiantehrani & London, 2017).
One of the intriguing findings in these data was the signature of hormones, which, with the exception of the P60M-over-P67M comparison, had multiple TFs and predicted genes associated with secretion and responses emerging from the H3K27ac-defined peaks. Particularly intriguing was the identification of estrogen and insulin hormones. Estrogen is synthesized within the auditory forebrain, is rapidly regulated upon song experience, and may regulate synaptic properties in ways that alter stimulus encoding (Remage-Healey et al., 2010; Spool et al., 2022). Insulin is largely unstudied in the zebra finch (but see: (Holzenberger et al., 1997), but has notable consequences for brain organization and mechanisms of synaptic plasticity, with implications for learning and memory (McNay & Recknagel, 2011; Gray et al., 2014; Lee et al., 2016; Alberry & Silveira, 2023). Of note, insulin receptors are of the receptor tyrosine kinase type, furthering the interest in this signaling as potentially central to juvenile auditory forebrain organization and function.
We anticipated that comparing H3K27ac-defined peaks from the auditory forebrains of P67 males reared in controlled conditions with and without experience with a live tutor would elucidate key factors that determine the ability to learn because 1) tutored males no longer perform sensory song learning whereas untutored males do, and 2) prior ChIPseq experiments using these conditions revealed distinct epigenetic landscapes in the auditory forebrain (Eales, 1987; Clayton, 1990; Slater et al., 1993; Kelly et al., 2018b). We found few differences in our analysis, but interestingly, the Isolate-over-Tutored regions were enriched with binding sites for several IEG TFs, including FOS, FOSL2, FOSB, JUNB, JUN, suggesting that they may coordinate a retention of the ability to learn. In fact, 8 of the TFs indicated by the Tutored-Isolate comparison contribute to functional categories that indicate regulation of cellular responses. These results are consistent with the prior idea that the Isolate auditory forebrain is characterized by a state of enhanced transcriptional regulation. This could be important in the Isolate condition because new transcription and translation support memory formation. It is possible that the TFs identified here help establish or maintain a genomic state that remains specifically capable of responding to incoming song experience.
These experiments provide new information for future analyses and experiments investigating mechanisms by which maturation and experience intersect to direct developmental learning. They do have some limitations. For example, technically, ChIPseq analysis relies on algorithms that do not yet fully capture the complexity of chromatin states. Biologically, our data come from bulk sequencing of pooled samples, which undoubtably mask some more subtle findings. On the other hand, outcomes presented are likely the most robust and replicable, as they emerge from genetically unrelated individuals and the heterogeneous auditory forebrain tissue. For now, these data present a novel set of putative active regulatory regions that can be further parsed for roles as enhancers, which are regulatory regions that have special relevance for cell subtype specialization across development (Blankvoort et al., 2018; Herrmann et al., 2022). The opportunity now also exists to analyze this and prior sequencing experiments together to build a more comprehensive and cohesive epigenetic landscape of the auditory forebrain as it transitions across the critical period. That kind of effort would be enhanced by the addition of single cell data acquisition. Finally, there are now candidate TFs and genes implicated in regulating neural plasticity that can be empirically tested for their roles in development and the neural properties that support or limit the ability to learn.
References.
Adar, E., Nottebohm, F. & Barnea, A. (2008) The relationship between nature of social change, age, and position of new neurons and their survival in adult zebra finch brain. J Neurosci, 28, 5394-5400.
Ageta-Ishihara, N. & Kinoshita, M. (2021) Developmental and postdevelopmental roles of septins in the brain. Neuroscience Research, 170, 6-12.
Ahmadiantehrani, S. & London, S.E. (2017) Bidirectional manipulation of mTOR signaling disrupts socially mediated vocal learning in juvenile songbirds. Proceedings of the National Academy of Sciences of the United States of America, 114, 9463-9468.
Alberini, C.M. (2009) Transcription factors in long-term memory and synaptic plasticity. Physiol Rev, 89, 121-145.
Alberini, C.M. (2025) Not just neurons: The diverse cellular landscape of learning and memory. Neuron, 113, 1664-1679.
Alberry, B. & Silveira, P.P. (2023) Brain insulin signaling as a potential mediator of early life adversity effects on physical and mental health. Neuroscience & Biobehavioral Reviews, 153, 105350.
Amin, E., Jaiswal, M., Derewenda, U., Reis, K., Nouri, K., Koessmeier, K.T., Aspenström, P., Somlyo, A.V., Dvorsky, R. & Ahmadian, M.R. (2016) Deciphering the Molecular and Functional Basis of RHOGAP Family Proteins: A SYSTEMATIC APPROACH TOWARD SELECTIVE INACTIVATION OF RHO FAMILY PROTEINS. J Biol Chem, 291, 20353-20371.
Assali, A., Harrington, A.J. & Cowan, C.W. (2019) Emerging roles for MEF2 in brain development and mental disorders. Curr Opin Neurobiol, 59, 49-58.
Bailey, T.L. & Grant, C.E. (2021) SEA: Simple Enrichment Analysis of motifs. bioRxiv, 2021.2008.2023.457422.
Bailey, T.L., Johnson, J., Grant, C.E. & Noble, W.S. (2015) The MEME Suite. Nucleic Acids Res, 43, W39-49.
Barnea, A., Mishal, A. & Nottebohm, F. (2006) Social and spatial changes induce multiple survival regimes for new neurons in two regions of the adult brain: An anatomical representation of time? Behavioural Brain Research, 167, 63-74.
Barnea, A. & Pravosudov, V. (2011) Birds as a model to study adult neurogenesis: bridging evolutionary, comparative and neuroethological approaches. European Journal of Neuroscience, 34, 884-907.
Basu, A., Mestres, I., Sahu, S.K., Tiwari, N., Khongwir, B., Baumgart, J., Singh, A., Calegari, F. & Tiwari, V.K. (2020) Phf21b imprints the spatiotemporal epigenetic switch essential for neural stem cell differentiation. Genes & Development, 34, 1190-1209.
Bayat, A., Iqbal, S., Borredy, K., Amiel, J., Zweier, C., Barcia, G., Kraus, C., Weyhreter, H., Bassuk, A.G. & Chopra, M. (2021) PRICKLE2 revisited—further evidence implicating PRICKLE2 in neurodevelopmental disorders. European Journal of Human Genetics, 29, 1235-1244.
Besnard, A., Galan-Rodriguez, B., Vanhoutte, P. & Caboche, J. (2011) Elk-1 a transcription factor with multiple facets in the brain. Front Neurosci, 5, 35.
Bhat, H.F., Adams, M.E. & Khanday, F.A. (2013) Syntrophin proteins as Santa Claus: role(s) in cell signal transduction. Cell Mol Life Sci, 70, 2533-2554.
Biason-Lauber, A. & Lang-Muritano, M. (2022) Estrogens: Two nuclear receptors, multiple possibilities. Molecular and Cellular Endocrinology, 554, 111710.
Bilbo, S.D. & Schwarz, J.M. (2012) The immune system and developmental programming of brain and behavior. Frontiers in Neuroendocrinology, 33, 267-286.
Bing, J., Sun, J., Zhao, R., Sun, L., Xi, C., Liu, J., Zhang, X. & Zeng, S. (2023) The effects of Wnt, BMP, and Notch signaling pathways on cell proliferation and neural differentiation in a song control nucleus (HVC) of Lonchura striata. Developmental Neurobiology, 83, 157-166.
Blake, D.J., Hawkes, R., Benson, M.A. & Beesley, P.W. (1999) Different dystrophin-like complexes are expressed in neurons and glia. The Journal of cell biology, 147, 645-658.
Blake, D.J., Nawrotzki, R., Loh, N.Y., Górecki, D.C. & Davies, K.E. (1998) β-dystrobrevin, a member of the dystrophin-related protein family. Proceedings of the National Academy of Sciences, 95, 241-246.
Blankvoort, S., Witter, M.P., Noonan, J., Cotney, J. & Kentros, C. (2018) Marked Diversity of Unique Cortical Enhancers Enables Neuron-Specific Tools by Enhancer-Driven Gene Expression. Current Biology, 28, 2103-2114.e2105.
Bolhuis, J.J., Zijlstra, G.G., den Boer-Visser, A.M. & Van der Zee, E.A. (2000) Localized neuronal activation in the zebra finch brain is related to the strength of song learning. Proceedings of the National Academy of Sciences, 97, 2282-2285.
Boulanger, L.M. (2009) Immune Proteins in Brain Development and Synaptic Plasticity. Neuron, 64, 93-109.
Braaten, R.F. (2010) Song recognition in zebra finches: Are there sensitive periods for song memorization? Learning and Motivation, 41, 202-212.
Brambilla, R., Gnesutta, N., Minichiello, L., White, G., Roylance, A.J., Herron, C.E., Ramsey, M., Wolfer, D.P., Cestari, V., Rossi-Arnaud, C., Grant, S.G., Chapman, P.F., Lipp, H.P., Sturani, E. & Klein, R. (1997) A role for the Ras signalling pathway in synaptic transmission and long-term memory. Nature, 390, 281-286.
Buonincontri, R., Bache, I., Silahtaroglu, A., Elbro, C., Nielsen, A.M., Ullmann, R., Arkesteijn, G. & Tommerup, N. (2011) A cohort of balanced reciprocal translocations associated with dyslexia: identification of two putative candidate genes at DYX1. Behav Genet, 41, 125-133.
Carroll, T.S., Liang, Z., Salama, R., Stark, R. & de Santiago, I. (2014) Impact of artifact removal on ChIP quality metrics in ChIP-seq and ChIP-exo data. Frontiers in Genetics, 5 .
Castro-Mondragon, J.A., Riudavets-Puig, R., Rauluseviciute, I., Lemma, R.B., Turchi, L., Blanc-Mathieu, R., Lucas, J., Boddie, P., Khan, A., Manosalva Pérez, N., Fornes, O., Leung, T.Y., Aguirre, A., Hammal, F., Schmelter, D., Baranasic, D., Ballester, B., Sandelin, A., Lenhard, B., Vandepoele, K., Wasserman, W.W., Parcy, F. & Mathelier, A. (2022) JASPAR 2022: the 9th release of the open-access database of transcription factor binding profiles. Nucleic Acids Res, 50, D165-d173.
Català-Solsona, J., Miñano-Molina, A.J. & Rodríguez-Álvarez, J. (2021a) Nr4a2 Transcription Factor in Hippocampal Synaptic Plasticity, Memory and Cognitive Dysfunction: A Perspective Review. Front Mol Neurosci, 14, 786226.
Català-Solsona, J., Miñano-Molina, A.J. & Rodríguez-Álvarez, J. (2021b) Nr4a2 Transcription Factor in Hippocampal Synaptic Plasticity, Memory and Cognitive Dysfunction: A Perspective Review. Frontiers in Molecular Neuroscience, Volume 14 - 2021 .
Chen, Simon X., Cherry, A., Tari, Parisa K., Podgorski, K., Kwong, Yue Kay K. & Haas, K. (2012) The Transcription Factor MEF2 Directs Developmental Visually Driven Functional and Structural Metaplasticity. Cell, 151, 41-55.
Chin, E.W., Ma, Q., Ruan, H., Chin, C., Somasundaram, A., Zhang, C., Liu, C., Lewis, M.D., White, M., Smith, T.L., Battersby, M., Yao, W.D., Lu, X.Y., Arap, W., Licinio, J. & Wong, M.L. (2022) The epigenetic reader PHF21B modulates murine social memory and synaptic plasticity-related genes. JCI Insight, 7 .
Choi, W., Choe, M.S., Kim, S.M., Kim, S.J., Lee, J., Lee, Y., Lee, S.M., Dho, S.H., Lee, M.Y. & Kim, L.K. (2024) RFX4 is an intrinsic factor for neuronal differentiation through induction of proneural genes POU3F2 and NEUROD1. Cell Mol Life Sci, 81, 99.
Chowdhury, D., Watters, K. & Biederer, T. (2021) Synaptic recognition molecules in development and disease. Curr Top Dev Biol, 142, 319-370.
Clayton, N. (1988) Song discrimination learning in zebra finches. Animal Behaviour, 36, 1016-1024.
Clayton, N.S. (1990) The effects of cross-fostering on assortative mating between zebra finch subspecies. Animal Behaviour, 40, 1102-1110.
Co, M., Anderson, A.G. & Konopka, G. (2020a) FOXP transcription factors in vertebrate brain development, function, and disorders. WIREs Developmental Biology, 9, e375.
Co, M., Anderson, A.G. & Konopka, G. (2020b) FOXP transcription factors in vertebrate brain development, function, and disorders. Wiley Interdiscip Rev Dev Biol, 9, e375.
Cohen, R.E., Macedo-Lima, M., Miller, K.E. & Brenowitz, E.A. (2016) Adult Neurogenesis Leads to the Functional Reconstruction of a Telencephalic Neural Circuit. The Journal of Neuroscience, 36, 8947-8956.
Cornejo, F., Cortés, B.I., Findlay, G.M. & Cancino, G.I. (2021) LAR Receptor Tyrosine Phosphatase Family in Healthy and Diseased Brain. Front Cell Dev Biol, 9, 659951.
Cotney, J.L. & Noonan, J.P. (2015) Chromatin immunoprecipitation with fixed animal tissues and preparation for high-throughput sequencing. Cold Spring Harb Protoc, 2015, 191-199.
Creyghton, M.P., Cheng, A.W., Welstead, G.G., Kooistra, T., Carey, B.W., Steine, E.J., Hanna, J., Lodato, M.A., Frampton, G.M., Sharp, P.A., Boyer, L.A., Young, R.A. & Jaenisch, R. (2010) Histone H3K27ac separates active from poised enhancers and predicts developmental state. Proc Natl Acad Sci U S A, 107, 21931-21936.
Dai, Q., Ren, A., Westholm, J.O., Serganov, A.A., Patel, D.J. & Lai, E.C. (2013) The BEN domain is a novel sequence-specific DNA-binding domain conserved in neural transcriptional repressors. Genes & Development, 27, 602-614.
Davis, L., Onn, I. & Elliott, E. (2018) The emerging roles for the chromatin structure regulators CTCF and cohesin in neurodevelopment and behavior. Cell Mol Life Sci, 75, 1205-1214.
De Clercq, S., Keruzore, M., Desmaris, E., Pollart, C., Assimacopoulos, S., Preillon, J., Ascenzo, S., Matson, C.K., Lee, M., Nan, X., Li, M., Nakagawa, Y., Hochepied, T., Zarkower, D., Grove, E.A. & Bellefroid, E.J. (2018) DMRT5 Together with DMRT3 Directly Controls Hippocampus Development and Neocortical Area Map Formation. Cereb Cortex, 28, 493-509.
De Kumar, B., Parker, H.J., Paulson, A., Parrish, M.E., Zeitlinger, J. & Krumlauf, R. (2017) Hoxa1 targets signaling pathways during neural differentiation of ES cells and mouse embryogenesis. Developmental Biology, 432, 151-164.
Dehingia, B., Milewska, M., Janowski, M. & Pękowska, A. (2022) CTCF shapes chromatin structure and gene expression in health and disease. EMBO reports, 23, e55146.
DeWulf, V. & Bottjer, S.W. (2002) Age and Sex Differences in Mitotic Activity within the Zebra Finch Telencephalon. The Journal of Neuroscience, 22, 4080-4094.
DeWulf, V. & Bottjer, S.W. (2005) Neurogenesis within the juvenile zebra finch telencephalic ventricular zone: A map of proliferative activity. Journal of Comparative Neurology, 481, 70-83.
Di Zazzo, E., De Rosa, C., Abbondanza, C. & Moncharmont, B. (2013) PRDM Proteins: Molecular Mechanisms in Signal Transduction and Transcriptional Regulation. Biology, 2, 107-141.
Diez, A., Cui, A. & MacDougall-Shackleton, S.A. (2019) The neural response of female zebra finches (Taeniopygia guttata) to conspecific, heterospecific, and isolate song depends on early-life song exposure. Behavioural Processes, 163, 37-44.
Dong, S., Replogle, K.L., Hasadsri, L., Imai, B.S., Yau, P.M., Rodriguez-Zas, S., Southey, B.R., Sweedler, J.V. & Clayton, D.F. (2009) Discrete molecular states in the brain accompany changing responses to a vocal signal. Proceedings of the National Academy of Sciences, 106, 11364-11369.
Doucet-Beaupré, H., Ang, S.-L. & Lévesque, M. (2015) Cell fate determination, neuronal maintenance and disease state: The emerging role of transcription factors Lmx1a and Lmx1b. FEBS Letters, 589, 3727-3738.
Doupe, A.J. & Kuhl, P.K. (1999) Birdsong and human speech: common themes and mechanisms. Annu Rev Neurosci, 22, 567-631.
Dulloo, I., Muliyil, S. & Freeman, M. (2019) The molecular, cellular and pathophysiological roles of iRhom pseudoproteases. Open Biol, 9, 190003.
Düsterhöft, S., Babendreyer, A., Giese, A.A., Flasshove, C. & Ludwig, A. (2019) Status update on iRhom and ADAM17: It’s still complicated. Biochimica et Biophysica Acta (BBA) - Molecular Cell Research, 1866, 1567-1583.
Dvoretskova, E., Ho, M.C., Kittke, V., Neuhaus, F., Vitali, I., Lam, D.D., Delgado, I., Feng, C., Torres, M., Winkelmann, J. & Mayer, C. (2024) Spatial enhancer activation influences inhibitory neuron identity during mouse embryonic development. Nature Neuroscience, 27, 862-872.
Eales, L.A. (1985) Song Learning in Zebra Finches - Some Effects of Song Model Availability on What Is Learnt and When. Animal Behaviour, 33, 1293-1300.
Eales, L.A. (1987) Song learning in female-raised zebra finches: another look at the sensitive phase. Animal Behaviour, 35, 1356-1365.
Eckert, D., Buhl, S., Weber, S., Jäger, R. & Schorle, H. (2005) The AP-2 family of transcription factors. Genome biology, 6, 246.
Eden, E., Navon, R., Steinfeld, I., Lipson, D. & Yakhini, Z. (2009) GOrilla: a tool for discovery and visualization of enriched GO terms in ranked gene lists. BMC Bioinformatics, 10, 48.
Emery, P., Durand, B., Mach, B. & Reith, W. (1996) RFX proteins, a novel family of DNA binding proteins conserved in the eukaryotic kingdom. Nucleic Acids Res, 24, 803-807.
Feng, J., Liu, T., Qin, B., Zhang, Y. & Liu, X.S. (2012) Identifying ChIP-seq enrichment using MACS. Nat Protoc, 7, 1728-1740.
Fong, K.-W., Choi, Y.-K., Rattner, J.B. & Qi, R.Z. (2008) CDK5RAP2 Is a Pericentriolar Protein That Functions in Centrosomal Attachment of the γ-Tubulin Ring Complex. Molecular Biology of the Cell, 19, 115-125.
Friocourt, G. & Parnavelas, J.G. (2010) Mutations in ARX result in several defects involving GABAergic neurons. Frontiers in Cellular Neuroscience, Volume 4 - 2010 .
Ge, S.X., Jung, D. & Yao, R. (2020) ShinyGO: a graphical gene-set enrichment tool for animals and plants. Bioinformatics, 36, 2628-2629.
Golson, M.L. & Kaestner, K.H. (2016) Fox transcription factors: from development to disease. Development, 143, 4558-4570.
Goodman, K.M., Yamagata, M., Jin, X., Mannepalli, S., Katsamba, P.S., Ahlsén, G., Sergeeva, A.P., Honig, B., Sanes, J.R. & Shapiro, L. (2016) Molecular basis of sidekick-mediated cell-cell adhesion and specificity. eLife, 5, e19058.
Gray, S.M., Meijer, R.I. & Barrett, E.J. (2014) Insulin regulates brain function, but how does it get there? Diabetes, 63, 3992-3997.
Hagiwara, N. (2011) Sox6, jack of all trades: A versatile regulatory protein in vertebrate development. Developmental Dynamics, 240, 1311-1321.
Harris, H.K., Nakayama, T., Lai, J., Zhao, B., Argyrou, N., Gubbels, C.S., Soucy, A., Genetti, C.A., Suslovitch, V., Rodan, L.H., Tiller, G.E., Lesca, G., Gripp, K.W., Asadollahi, R., Hamosh, A., Applegate, C.D., Turnpenny, P.D., Simon, M.E.H., Volker-Touw, C.M.L., Gassen, K.L.I.v., Binsbergen, E.v., Pfundt, R., Gardeitchik, T., Vries, B.B.A.d., Immken, L.L., Buchanan, C., Willing, M., Toler, T.L., Fassi, E., Baker, L., Vansenne, F., Wang, X., Ambrus, J.L., Fannemel, M., Posey, J.E., Agolini, E., Novelli, A., Rauch, A., Boonsawat, P., Fagerberg, C.R., Larsen, M.J., Kibaek, M., Labalme, A., Poisson, A., Payne, K.K., Walsh, L.E., Aldinger, K.A., Balciuniene, J., Skraban, C., Gray, C., Murrell, J., Bupp, C.P., Pascolini, G., Grammatico, P., Broly, M., Küry, S., Nizon, M., Rasool, I.G., Zahoor, M.Y., Kraus, C., Reis, A., Iqbal, M., Uguen, K., Audebert-Bellanger, S., Ferec, C., Redon, S., Baker, J., Wu, Y., Zampino, G., Syrbe, S., Brosse, I., Jamra, R.A., Dobyns, W.B., Cohen, L.L., Blomhoff, A., Mignot, C., Keren, B., Courtin, T., Agrawal, P.B., Beggs, A.H. & Yu, T.W. (2021) Disruption of RFX family transcription factors causes autism, attention-deficit/hyperactivity disorder, intellectual disability, and dysregulated behavior. Genetics in Medicine, 23, 1028-1040.
Hayward, P., Kalmar, T. & Martinez Arias, A. (2008) Wnt/Notch signalling and information processing during development. Development, 135, 411-424.
Heintzman, N.D., Stuart, R.K., Hon, G., Fu, Y., Ching, C.W., Hawkins, R.D., Barrera, L.O., Van Calcar, S., Qu, C., Ching, K.A., Wang, W., Weng, Z., Green, R.D., Crawford, G.E. & Ren, B. (2007) Distinct and predictive chromatin signatures of transcriptional promoters and enhancers in the human genome. Nat Genet, 39, 311-318.
Hernandez, P.J. & Abel, T. (2008) The role of protein synthesis in memory consolidation: progress amid decades of debate. Neurobiol Learn Mem, 89, 293-311.
Herrmann, J.C., Beagrie, R.A. & Hughes, J.R. (2022) Making connections: enhancers in cellular differentiation. Trends in Genetics, 38, 395-408.
Hess, E.H. (1959) Imprinting, an effect of early experience, imprinting determines later social behavior in animals. Science, 130, 133-141.
Hobert, O. & Ruvkun, G. (1998) A common theme for LIM homeobox gene function across phylogeny? The Biological Bulletin, 195, 377-380.
Holveck, M.-J. & Riebel, K. (2014) Female zebra finches learn to prefer more than one song and from more than one tutor. Animal Behaviour, 88, 125-135.
Holzenberger, M., Jarvis, E.D., Chong, C., Grossman, M., Nottebohm, F. & Scharff, C. (1997) Selective Expression of Insulin-Like Growth Factor II in the Songbird Brain. The Journal of Neuroscience, 17, 6974-6987.
Hossain, M.A. (2024) Targeting the RAS upstream and downstream signaling pathway for cancer treatment. European Journal of Pharmacology, 979, 176727.
Hwang, I., Pan, H., Yao, J., Elemento, O., Zheng, H. & Paik, J. (2020) CIC is a critical regulator of neuronal differentiation. JCI Insight, 5 .
Jiang, F., Zhou, X., Qian, Y., Zhu, M., Wang, L., Li, Z., Shen, Q., Wang, M., Qu, F., Cui, G., Chen, K. & Peng, G. (2023a) Simultaneous profiling of spatial gene expression and chromatin accessibility during mouse brain development. Nature Methods, 20, 1-10.
Jiang, F., Zhou, X., Qian, Y., Zhu, M., Wang, L., Li, Z., Shen, Q., Wang, M., Qu, F., Cui, G., Chen, K. & Peng, G. (2023b) Simultaneous profiling of spatial gene expression and chromatin accessibility during mouse brain development. Nature Methods, 20, 1048-1057.
Jin, H. & Clayton, D.F. (1997) Localized Changes in Immediate-Early Gene Regulation during Sensory and Motor Learning in Zebra Finches. Neuron, 19, 1049-1059.
Kaczynski, J., Cook, T. & Urrutia, R. (2003a) Sp1- and Krüppel-like transcription factors. Genome Biol, 4, 206.
Kaczynski, J., Cook, T. & Urrutia, R. (2003b) Sp1- and Krüppel-like transcription factors. Genome Biology, 4, 206.
Kandel, E.R. (2012) The molecular biology of memory: cAMP, PKA, CRE, CREB-1, CREB-2, and CPEB. Molecular Brain, 5, 14.
Kelly, T.K., Ahmadiantehrani, S., Blattler, A. & London, S.E. (2018a) Epigenetic regulation of transcriptional plasticity associated with developmental song learning. Proceedings of the Royal Society B: Biological Sciences, 285, 20180160.
Kelly, T.K., Ahmadiantehrani, S., Blattler, A. & London, S.E. (2018b) Epigenetic regulation of transcriptional plasticity associated with developmental song learning. Proceedings of the Royal Society B: Biological Sciences, 285 .
Khan, Z.U., Carretero-Rey, M., de León-López, C.A.M. & Navarro-Lobato, I. (2025) Memory-Associated Immediate Early Genes: Roles in Synaptic Function, Memory Processes, and Neurological Diseases. Molecular Neurobiology .
Kida, S. & Serita, T. (2014) Functional roles of CREB as a positive regulator in the formation and enhancement of memory. Brain Research Bulletin, 105, 17-24.
Kikkawa, T. & Osumi, N. (2021) Multiple Functions of the Dmrt Genes in the Development of the Central Nervous System. Frontiers in Neuroscience, Volume 15 - 2021 .
Kirk, R.W., Sun, L., Xiao, R., Clark, E.A. & Nelson, S. (2025) Multiplexed CRISPRi Reveals a Transcriptional Switch Between KLF Activators and Repressors in the Maturing Neocortex. eLife Sciences Publications, Ltd.
Knudsen, E.I. (2004) Sensitive periods in the development of the brain and behavior. Journal of cognitive neuroscience, 16, 1412-1425.
Koncina, E., Roth, L., Gonthier, B. & Bagnard, D. (2007) Role of semaphorins during axon growth and guidance. Axon growth and guidance, 50-64.
Konno, D., Kishida, C., Maehara, K., Ohkawa, Y., Kiyonari, H., Okada, S. & Matsuzaki, F. (2019) Dmrt factors determine the positional information of cerebral cortical progenitors via differential suppression of homeobox genes. Development, 146 .
Krienen, F.M., Yeo, B.T., Ge, T., Buckner, R.L. & Sherwood, C.C. (2016) Transcriptional profiles of supragranular-enriched genes associate with corticocortical network architecture in the human brain. Proc Natl Acad Sci U S A, 113, E469-478.
Kunzelman, G.W.B., Alice; London, Sarah E. (in press) Chromatin profiling reveals distinct male and female trajectories for developmental learning potential. Developmental Neurobiology .
Lai, J., Demirbas, D., Phillips, K., Zhao, B., Wallace, H., Seferian, M., Nakayama, T., Harris, H., Chatzipli, A., Lee, E.A. & Yu, T.W. (2025) Multi-omic analysis of the ciliogenic transcription factor RFX3 reveals a role in promoting activity-dependent responses via enhancing CREB binding in human neurons. bioRxiv, 2025.2002.2027.640588.
Lampen, J., McAuley, J.D., Chang, S.-E. & Wade, J. (2017) ZENK induction in the zebra finch brain by song: Relationship to hemisphere, rhythm, oestradiol and sex. Journal of Neuroendocrinology, 29, e12543.
Langmead, B. & Salzberg, S.L. (2012) Fast gapped-read alignment with Bowtie 2. Nature Methods, 9, 357-359.
Lauay, C., Komorowski, R.W., Beaudin, A.E. & Devoogd, T.J. (2005) Adult female and male zebra finches show distinct patterns of spine deficits in an auditory area and in the song system when reared without exposure to normal adult song. J Comp Neurol, 487, 119-126.
Laub, F., Lei, L., Sumiyoshi, H., Kajimura, D., Dragomir, C., Smaldone, S., Puche, A.C., Petros, T.J., Mason, C., Parada, L.F. & Ramirez, F. (2005) Transcription factor KLF7 is important for neuronal morphogenesis in selected regions of the nervous system. Mol Cell Biol, 25, 5699-5711.
Layden, E.A., Li, H., Schertz, K.E., Berman, M.G. & London, S.E. (2020) Experience selectively alters functional connectivity within a neural network to predict learned behavior in juvenile songbirds. NeuroImage, 222, 117218.
Lee, H.H.C., Bernard, C., Ye, Z., Acampora, D., Simeone, A., Prochiantz, A., Di Nardo, A.A. & Hensch, T.K. (2017) Genetic Otx2 mis-localization delays critical period plasticity across brain regions. Mol Psychiatry, 22, 680-688.
Lee, S.-H., Zabolotny, J.M., Huang, H., Lee, H. & Kim, Y.-B. (2016) Insulin in the nervous system and the mind: Functions in metabolism, memory, and mood. Molecular Metabolism, 5, 589-601.
Leung, R.F., George, A.M., Roussel, E.M., Faux, M.C., Wigle, J.T. & Eisenstat, D.D. (2022) Genetic Regulation of Vertebrate Forebrain Development by Homeobox Genes. Frontiers in Neuroscience, Volume 16 - 2022 .
Li, H., Handsaker, B., Wysoker, A., Fennell, T., Ruan, J., Homer, N., Marth, G., Abecasis, G., Durbin, R. & Genome Project Data Processing, S. (2009) The Sequence Alignment/Map format and SAMtools. Bioinformatics, 25, 2078-2079.
Lin, Y., Bloodgood, B.L., Hauser, J.L., Lapan, A.D., Koon, A.C., Kim, T.-K., Hu, L.S., Malik, A.N. & Greenberg, M.E. (2008) Activity-dependent regulation of inhibitory synapse development by Npas4. Nature, 455, 1198-1204.
Liodis, P., Denaxa, M., Grigoriou, M., Akufo-Addo, C., Yanagawa, Y. & Pachnis, V. (2007) Lhx6 activity is required for the normal migration and specification of cortical interneuron subtypes. J Neurosci, 27, 3078-3089.
Lipkind, D., Nottebohm, F., Rado, R. & Barnea, A. (2002) Social change affects the survival of new neurons in the forebrain of adult songbirds. Behavioural Brain Research, 133, 31-43.
Liu, F., Day, M., Muniz, L.C., Bitran, D., Arias, R., Revilla-Sanchez, R., Grauer, S., Zhang, G., Kelley, C. & Pulito, V. (2008) Activation of estrogen receptor-β regulates hippocampal synaptic plasticity and improves memory. Nature neuroscience, 11, 334-343.
Liu, Z., Zhang, Z., Lindtner, S., Li, Z., Xu, Z., Wei, S., Liang, Q., Wen, Y., Tao, G., You, Y., Chen, B., Wang, Y., Rubenstein, J.L. & Yang, Z. (2019) Sp9 Regulates Medial Ganglionic Eminence-Derived Cortical Interneuron Development. Cereb Cortex, 29, 2653-2667.
Liu, Z.D., Zhang, S., Hao, J.J., Xie, T.R. & Kang, J.S. (2016) Cellular model of neuronal atrophy induced by DYNC1I1 deficiency reveals protective roles of RAS-RAF-MEK signaling. Protein Cell, 7, 638-650.
Loebrich, S. & Nedivi, E. (2009) The function of activity-regulated genes in the nervous system. Physiol Rev, 89, 1079-1103.
London, S.E. (2019) Developmental song learning as a model to understand neural mechanisms that limit and promote the ability to learn. Behavioural Processes, 163, 13-23.
London, S.E. & Clayton, D.F. (2008) Functional identification of sensory mechanisms required for developmental song learning. Nat Neurosci, 11, 579-586.
London, S.E., Dong, S., Replogle, K. & Clayton, D.F. (2009) Developmental shifts in gene expression in the auditory forebrain during the sensitive period for song learning. Developmental Neurobiology, 69, 437-450.
López-Merino, E., Fernández-Rodrigo, A., Jiang, J.G., Gutiérrez-Eisman, S., Fernández de Sevilla, D., Fernández-Medarde, A., Santos, E., Guerra, C., Barbacid, M., Esteban, J.A. & Briz, V. (2025) Different Ras isoforms regulate synaptic plasticity in opposite directions. The EMBO Journal, 44, 2106-2133.
Love, M.I., Huber, W. & Anders, S. (2014) Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biology, 15, 550.
Luissint, A.-C., Artus, C., Glacial, F., Ganeshamoorthy, K. & Couraud, P.-O. (2012) Tight junctions at the blood brain barrier: physiological architecture and disease-associated dysregulation. Fluids and Barriers of the CNS, 9, 23.
Malik, V., Zimmer, D. & Jauch, R. (2018) Diversity among POU transcription factors in chromatin recognition and cell fate reprogramming. Cell Mol Life Sci, 75, 1587-1612.
Mann, F., Chauvet, S. & Rougon, G. (2007) Semaphorins in development and adult brain: Implication for neurological diseases. Progress in Neurobiology, 82, 57-79.
Manzari-Tavakoli, A., Babajani, A., Farjoo, M.H., Hajinasrollah, M., Bahrami, S. & Niknejad, H. (2022) The Cross-Talks Among Bone Morphogenetic Protein (BMP) Signaling and Other Prominent Pathways Involved in Neural Differentiation. Front Mol Neurosci, 15, 827275.
Mao, X.R., Moerman-Herzog, A.M., Chen, Y. & Barger, S.W. (2009) Unique aspects of transcriptional regulation in neurons – nuances in NFκB and Sp1-related factors. Journal of Neuroinflammation, 6, 16.
Marques, B.L., Oliveira-Lima, O.C., Carvalho, G.A., de Almeida Chiarelli, R., Ribeiro, R.I., Parreira, R.C., da Madeira Freitas, E.M., Resende, R.R., Klempin, F., Ulrich, H., Gomez, R.S. & Pinto, M.C.X. (2020) Neurobiology of glycine transporters: From molecules to behavior. Neuroscience & Biobehavioral Reviews, 118, 97-110.
Mason, J.M., Morrison, D.J., Albert Basson, M. & Licht, J.D. (2006) Sprouty proteins: multifaceted negative-feedback regulators of receptor tyrosine kinase signaling. Trends in Cell Biology, 16, 45-54.
Matynia, A., Kushner, S.A. & Silva, A.J. (2002) Genetic approaches to molecular and cellular cognition: a focus on LTP and learning and memory. Annu Rev Genet, 36, 687-720.
McFarlan, A.R., Guo, C., Gomez, I., Weinerman, C., Liang, T.A. & Sjöström, P.J. (2024) The spike-timing-dependent plasticity of VIP interneurons in motor cortex. Front Cell Neurosci, 18, 1389094.
McNay, E.C. & Recknagel, A.K. (2011) Brain insulin signaling: A key component of cognitive processes and a potential basis for cognitive impairment in type 2 diabetes. Neurobiology of Learning and Memory, 96, 432-442.
Mehl, L.C., Manjally, A.V., Bouadi, O., Gibson, E.M. & Tay, T.L. (2022) Microglia in brain development and regeneration. Development, 149 .
Mendoza, M.C., Er, E.E. & Blenis, J. (2011) The Ras-ERK and PI3K-mTOR pathways: cross-talk and compensation. Trends in Biochemical Sciences, 36, 320-328.
Mi, S., Miller, R.H., Lee, X., Scott, M.L., Shulag-Morskaya, S., Shao, Z., Chang, J., Thill, G., Levesque, M. & Zhang, M. (2005) LINGO-1 negatively regulates myelination by oligodendrocytes. Nature neuroscience, 8, 745-751.
Miller, D.B. (1979a) The acoustic basis of mate recognition by female zebra finches (Taeniopygia guttata). Animal Behaviour, 27, 376-380.
Miller, D.B. (1979b) Long-term recognition of father’s song by female zebra finches. Nature, 280, 389-391.
Monroe, J.D. & Heathcote, R.D. (2013) Protein phosphatases regulate the growth of developing neurites. International Journal of Developmental Neuroscience, 31, 250-257.
Moore, D.L., Apara, A. & Goldberg, J.L. (2011) Krüppel-like transcription factors in the nervous system: novel players in neurite outgrowth and axon regeneration. Mol Cell Neurosci, 47, 233-243.
Morrison, R.G. & Nottebohm, F. (1993) Role of a Telencephalic Nucleus in the Delayed Song Learning of Socially Isolated Zebra Finches. J Neurobiol, 24, 1045-1064.
Nagase, T., Ishikawa, K., Miyajima, N., Tanaka, A., Kotani, H., Nomura, N. & Ohara, O. (1998) Prediction of the coding sequences of unidentified human genes. IX. The complete sequences of 100 new cDNA clones from brain which can code for large proteins in vitro. DNA Res, 5, 31-39.
Nisar, S., Bhat, A.A., Masoodi, T., Hashem, S., Akhtar, S., Ali, T.A., Amjad, S., Chawla, S., Bagga, P., Frenneaux, M.P., Reddy, R., Fakhro, K. & Haris, M. (2022) Genetics of glutamate and its receptors in autism spectrum disorder. Molecular Psychiatry, 27, 2380-2392.
NOTTEBOHM, F. (2004) The Road We Travelled: Discovery, Choreography, and Significance of Brain Replaceable Neurons. Annals of the New York Academy of Sciences, 1016, 628-658.
Papaioannou, V.E. (2014) The T-box gene family: emerging roles in development, stem cells and cancer. Development, 141, 3819-3833.
Potthoff, M.J. & Olson, E.N. (2007a) MEF2: a central regulator of diverse developmental programs.
Potthoff, M.J. & Olson, E.N. (2007b) MEF2: a central regulator of diverse developmental programs. Development, 134, 4131-4140.
Pytte, C.L. (2016) Adult Neurogenesis in the Songbird: Region-Specific Contributions of New Neurons to Behavioral Plasticity and Stability. Brain Behavior and Evolution, 87, 191-204.
Pytte, C.L., Parent, C., Wildstein, S., Varghese, C. & Oberlander, S. (2010) Deafening decreases neuronal incorporation in the zebra finch caudomedial nidopallium (NCM). Behavioural Brain Research, 211, 141-147.
Qu, Y., Huang, Y., Feng, J., Alvarez-Bolado, G., Grove, E.A., Yang, Y., Tissir, F., Zhou, L. & Goffinet, A.M. (2014) Genetic evidence that Celsr3 and Celsr2, together with Fzd3, regulate forebrain wiring in a Vangl-independent manner. Proceedings of the National Academy of Sciences, 111, E2996-E3004.
Quinlan, A.R. (2014) BEDTools: The Swiss-Army Tool for Genome Feature Analysis. Curr Protoc Bioinformatics, 47, 11 12 11-34.
Quinlan, A.R. & Hall, I.M. (2010) BEDTools: a flexible suite of utilities for comparing genomic features. Bioinformatics, 26, 841-842.
Remage-Healey, L., London, S.E. & Schlinger, B.A. (2010) Birdsong and the neural production of steroids. Journal of Chemical Neuroanatomy, 39, 72-81.
Rhie, A. & McCarthy, S.A. & Fedrigo, O. & Damas, J. & Formenti, G. & Koren, S. & Uliano-Silva, M. & Chow, W. & Fungtammasan, A. & Kim, J. & Lee, C. & Ko, B.J. & Chaisson, M. & Gedman, G.L. & Cantin, L.J. & Thibaud-Nissen, F. & Haggerty, L. & Bista, I. & Smith, M. & Haase, B. & Mountcastle, J. & Winkler, S. & Paez, S. & Howard, J. & Vernes, S.C. & Lama, T.M. & Grutzner, F. & Warren, W.C. & Balakrishnan, C.N. & Burt, D. & George, J.M. & Biegler, M.T. & Iorns, D. & Digby, A. & Eason, D. & Robertson, B. & Edwards, T. & Wilkinson, M. & Turner, G. & Meyer, A. & Kautt, A.F. & Franchini, P. & Detrich, H.W. & Svardal, H. & Wagner, M. & Naylor, G.J.P. & Pippel, M. & Malinsky, M. & Mooney, M. & Simbirsky, M. & Hannigan, B.T. & Pesout, T. & Houck, M. & Misuraca, A. & Kingan, S.B. & Hall, R. & Kronenberg, Z. & Sović, I. & Dunn, C. & Ning, Z. & Hastie, A. & Lee, J. & Selvaraj, S. & Green, R.E. & Putnam, N.H. & Gut, I. & Ghurye, J. & Garrison, E. & Sims, Y. & Collins, J. & Pelan, S. & Torrance, J. & Tracey, A. & Wood, J. & Dagnew, R.E. & Guan, D. & London, S.E. & Clayton, D.F. & Mello, C.V. & Friedrich, S.R. & Lovell, P.V. & Osipova, E. & Al-Ajli, F.O. & Secomandi, S. & Kim, H. & Theofanopoulou, C. & Hiller, M. & Zhou, Y. & Harris, R.S. & Makova, K.D. & Medvedev, P. & Hoffman, J. & Masterson, P. & Clark, K. & Martin, F. & Howe, K. & Flicek, P. & Walenz, B.P. & Kwak, W. & Clawson, H. & Diekhans, M. & Nassar, L. & Paten, B. & Kraus, R.H.S. & Crawford, A.J. & Gilbert, M.T.P. & Zhang, G. & Venkatesh, B. & Murphy, R.W. & Koepfli, K.-P. & Shapiro, B. & Johnson, W.E. & Di Palma, F. & Marques-Bonet, T. & Teeling, E.C. & Warnow, T. & Graves, J.M. & Ryder, O.A. & Haussler, D. & O’Brien, S.J. & Korlach, J. & Lewin, H.A. & Howe, K. & Myers, E.W. & Durbin, R. & Phillippy, A.M. & Jarvis, E.D. (2021) Towards complete and error-free genome assemblies of all vertebrate species. Nature, 592, 737-746.
Riebel, K. (2009) Chapter 6 Song and Female Mate Choice in Zebra Finches: A Review Advances in the Study of Behavior . Academic Press, pp. 197-238.
Roper, A. & Zann, R. (2006) The onset of song learning and song tutor selection in fledgling zebra finches. Ethology, 112, 458-470.
Rosenegger, D., Parvez, K. & Lukowiak, K. (2008) Enhancing memory formation by altering protein phosphorylation balance. Neurobiology of Learning and Memory, 90, 544-552.
Ross-Innes, C.S., Stark, R., Teschendorff, A.E., Holmes, K.A., Ali, H.R., Dunning, M.J., Brown, G.D., Gojis, O., Ellis, I.O., Green, A.R., Ali, S., Chin, S.F., Palmieri, C., Caldas, C. & Carroll, J.S. (2012) Differential oestrogen receptor binding is associated with clinical outcome in breast cancer. Nature, 481, 389-393.
Rubenstein, J.L., Nord, A.S. & Ekker, M. (2024) DLX genes and proteins in mammalian forebrain development. Development, 151 .
Ryu, H.-H., Kim, T., Kim, J.-W., Kang, M., Park, P., Kim, Y.G., Kim, H., Ha, J., Choi, J.E., Lee, J., Lim, C.-S., Kim, C.-H., Kim, S.J., Silva, A.J., Kaang, B.-K. & Lee, Y.-S. (2019) Excitatory neuron–specific SHP2-ERK signaling network regulates synaptic plasticity and memory. Science Signaling, 12, eaau5755.
Sams, D.S., Nardone, S., Getselter, D., Raz, D., Tal, M., Rayi, P.R., Kaphzan, H., Hakim, O. & Elliott, E. (2016) Neuronal CTCF Is Necessary for Basal and Experience-Dependent Gene Regulation, Memory Formation, and Genomic Structure of BDNF and Arc. Cell Reports, 17, 2418-2430.
Sawada, K., Echigo, N., Juge, N., Miyaji, T., Otsuka, M., Omote, H., Yamamoto, A. & Moriyama, Y. (2008) Identification of a vesicular nucleotide transporter. Proceedings of the National Academy of Sciences, 105, 5683-5686.
Schonemann, M.D., Ryan, A.K., Erkman, L., McEvilly, R.J., Bermingham, J. & Rosenfeld, M.G. (1998) POU Domain Factors in Neural Development. In Zingg, H.H., Bourque, C.W., Bichet, D.G. (eds) Vasopressin and Oxytocin: Molecular, Cellular, and Clinical Advances . Springer US, Boston, MA, pp. 39-53.
Scobie, K.N., Hall, B.J., Wilke, S.A., Klemenhagen, K.C., Fujii-Kuriyama, Y., Ghosh, A., Hen, R. & Sahay, A. (2009) Krüppel-like factor 9 is necessary for late-phase neuronal maturation in the developing dentate gyrus and during adult hippocampal neurogenesis. Journal of Neuroscience, 29, 9875-9887.
Shalizi, A., Gaudillière, B., Yuan, Z., Stegmüller, J., Shirogane, T., Ge, Q., Tan, Y., Schulman, B., Harper, J.W. & Bonni, A. (2006) A calcium-regulated MEF2 sumoylation switch controls postsynaptic differentiation. Science, 311, 1012-1017.
Shalizi, A.K. & Bonni, A. (2005) brawn for brains: the role of MEF2 proteins in the developing nervous system. Current topics in developmental biology, 69, 239-266.
Shyr, C.-R., Kang, H.-Y., Tsai, M.-Y., Liu, N.-C., Ku, P.-Y., Huang, K.-E. & Chang, C. (2009) Roles of Testicular Orphan Nuclear Receptors 2 and 4 in Early Embryonic Development and Embryonic Stem Cells. Endocrinology, 150, 2454-2462.
Slater, P., Jones, A. & ten Cate, C. (1993) Can lack of experience delay the end of the sensitive phase for song learning. Netherlands Journal of Zoology, 43, 80-90.
Spitz, F. & Furlong, E.E.M. (2012) Transcription factors: from enhancer binding to developmental control. Nature Reviews Genetics, 13, 613-626.
Spool, J.A., Bergan, J.F. & Remage-Healey, L. (2022) A neural circuit perspective on brain aromatase. Front Neuroendocrinol, 65, 100973.
Stankiewicz, T.R. & Linseman, D.A. (2014) Rho family GTPases: key players in neuronal development, neuronal survival, and neurodegeneration. Frontiers in Cellular Neuroscience, Volume 8 - 2014 .
Stark, R. & Brown, G. (2011) DiffBind: Differential Binding Analysis of ChIP-Seq Peak Data. Bioconductor.
Stevanovic, M., Drakulic, D., Lazic, A., Ninkovic, D.S., Schwirtlich, M. & Mojsin, M. (2021) SOX Transcription Factors as Important Regulators of Neuronal and Glial Differentiation During Nervous System Development and Adult Neurogenesis. Front Mol Neurosci, 14, 654031.
Sugiaman-Trapman, D., Vitezic, M., Jouhilahti, E.-M., Mathelier, A., Lauter, G., Misra, S., Daub, C.O., Kere, J. & Swoboda, P. (2018) Characterization of the human RFX transcription factor family by regulatory and target gene analysis. BMC Genomics, 19, 181.
Suske, G. (1999) The Sp-family of transcription factors. Gene, 238, 291-300.
Sweatt, J.D. (2001) Memory mechanisms: The yin and yang of protein phosphorylation. Current Biology, 11, R391-R394.
Tada, T., Simonetta, A., Batterton, M., Kinoshita, M., Edbauer, D. & Sheng, M. (2007) Role of Septin Cytoskeleton in Spine Morphogenesis and Dendrite Development in Neurons. Current Biology, 17, 1752-1758.
Takesian, A.E. & Hensch, T.K. (2013) Balancing plasticity/stability across brain development. Prog Brain Res, 207, 3-34.
Terpstra, N.J., Bolhuis, J.J., Riebel, K., van der Burg, J.M. & den Boer‐Visser, A.M. (2006) Localized brain activation specific to auditory memory in a female songbird. Journal of Comparative Neurology, 494, 784-791.
Tomaszycki, M.L., Sluzas, E.M., Sundberg, K.A., Newman, S.W. & DeVoogd, T.J. (2006) Immediate early gene (ZENK) responses to song in juvenile female and male zebra finches: Effects of rearing environment. J Neurobiol, 66, 1175-1182.
Töröcsik, B., Angelastro, J.M. & Greene, L.A. (2002) The basic region and leucine zipper transcription factor MafK is a new nerve growth factor-responsive immediate early gene that regulates neurite outgrowth. J Neurosci, 22, 8971-8980.
Vates, G.E., Broome, B.M., Mello, C.V. & Nottebohm, F. (1996) Auditory pathways of caudal telencephalon and their relation to the song system of adult male zebra finches. J Comp Neurol, 366, 613-642.
Wang, Z., Zang, C., Rosenfeld, J.A., Schones, D.E., Barski, A., Cuddapah, S., Cui, K., Roh, T.-Y., Peng, W. & Zhang, M.Q. (2008) Combinatorial patterns of histone acetylations and methylations in the human genome. Nature genetics, 40, 897-903.
Warm, D., Schroer, J. & Sinning, A. (2021) Gabaergic Interneurons in Early Brain Development: Conducting and Orchestrated by Cortical Network Activity. Front Mol Neurosci, 14, 807969.
Weidemüller, P., Kholmatov, M., Petsalaki, E. & Zaugg, J.B. (2021) Transcription factors: Bridge between cell signaling and gene regulation. PROTEOMICS, 21, 2000034.
White, R.J. (2011) Transcription by RNA polymerase III: more complex than we thought. Nature Reviews Genetics, 12, 459-463.
Wu, Y., Guo, W., Kuang, H., Wu, X., Trinh, T.H., Wang, Y., Zhao, S., Wen, Z. & Yu, T. (2025) Pu.1/Spi1 dosage controls the turnover and maintenance of microglia in zebrafish and mammals. eLife Sciences Publications, Ltd.
Yan, Y., Gnanapragasam, A. & Bailey, S. (2020) HisTrader: A Tool to Identify Nucleosome Free Regions from ChIP-Seq of Histone Post-Translational Modifications. bioRxiv, 2020.2003.2012.989228.
Yanagihara, S. & Yazaki-Sugiyama, Y. (2016) Auditory experience-dependent cortical circuit shaping for memory formation in bird song learning. Nature Communications, 7, 11946.
Yu, G., Wang, L.G. & He, Q.Y. (2015) ChIPseeker: an R/Bioconductor package for ChIP peak annotation, comparison and visualization. Bioinformatics, 31, 2382-2383.
Yu, Y., Jia, W., Lyu, Y., Su, D., Bai, M., Shen, J., Qiao, J., Han, T., Liu, W., Chen, J., Chen, W., Ye, D., Guo, X., Zhu, S., Xi, J., Zhu, R., Wan, X., Gao, S., Zhu, J. & Kang, J. (2019) Pwp1 regulates telomere length by stabilizing shelterin complex and maintaining histone H4K20 trimethylation. Cell Discovery, 5, 47.
Zhang, D., Zeldin, D.C. & Blackshear, P.J. (2007) Regulatory factor X4 variant 3: A transcription factor involved in brain development and disease. Journal of Neuroscience Research, 85, 3515-3522.
Zhang, Y., Liu, T., Meyer, C.A., Eeckhoute, J., Johnson, D.S., Bernstein, B.E., Nusbaum, C., Myers, R.M., Brown, M., Li, W. & Liu, X.S. (2008) Model-based analysis of ChIP-Seq (MACS). Genome Biol, 9, R137.
Zhong, Z., Wan, B., Qiu, Y., Ni, J., Tang, W., Chen, X., Yang, Y., Shen, S., Wang, Y., Bai, M., Lang, Q. & Yu, L. (2007) Identification of a novel human zinc finger gene, ZNF438, with transcription inhibition activity. J Biochem Mol Biol, 40, 517-524.
Figure legends.
Figure 1. Experimental groups and ages of collection superimposed on a timeline of posthatch development. Timeline depicts hatching (P1) through adulthood, P90. Solid red line shows defined critical period for male sensory song learning under tutored conditions; hashed lines indicate that the age range during which females can learn extends beyond the male period. Normal juvenile males (cheek patches) and females (no cheek patches) were reared in the communal aviaries in which they hatched until P60 or P67 (circles). Between P30 and P67, Tutored and Isolate males, collected at P67 (circles) lived in sound-attenuating chambers with either one adult male-female pair (Tutored) or two adult females (Isolate).
Figure 2. Functional overrepresentation of enriched TFBSs and predicted genes resulting from male P60 and P67 peak comparisons. Sankey dot plots showing GO categories overrepresented in (a) P67M-over-P60M enriched TFBSs and (b) predicted genes.
Figure 3. GO categories overrepresented in enriched TFBSs and predicted genes revealed from P60F-P67F H3K27ac peak analysis. Dot plots showing significantly overrepresented Biological Process GO categories and the TF with enriched motifs that contribute to them in the ( a ) P60F-over-P67F and ( b ) P67F-over-P60F peaks. ( c, d ) Dot plots showing major overrepresented BP categories in the set of predicted genes in the female ( c ) P60-over-P67 and ( d ) P67-over-P60 H3K27ac-defined peaks.
Figure 4. Biological Process GO categories overrepresented in enriched TFBSs from direct sex comparisons of H3K27ac signal. Dot plots showing categories, -log 10 (p-values), and number of contributing motifs for data from ( a ) P60M-over-P60F, ( b ) P60F-over-P60M, ( c ) P67M-over-P67F, and ( d ) P67F-over-P67M peak comparisons. Black = unique categories, orange = category found in 2 comparisons, blue = category found in 3 comparisons, turquoise = category found in all four comparisons.
Figure 5. Biological Process GO categories overrepresented in genes predicted from direct sex comparisons of H3K27ac-defined peaks. Dot plots showing categories, -log 10 (p-values), and number of contributing motifs for data from ( a ) P60M-over-P60F, ( b ) P60F-over-P60M, ( c ) P67M-over-P67F, and ( d ) P67F-over-P67M peak comparisons. Black = unique categories, orange = category found in 2 comparisons, blue = category found in 3 comparisons, turquoise = category found in all four comparisons.
Figure 6. Identification and functions of TFs with enriched motifs in the core and sex-specific categories. ( a ) Venn diagram displaying the number and overlap of TFBSs identified from the four possible direct sex comparisons. ( b ) Plot showing significantly overrepresented Biological Process GO categories and the TF with enriched motifs that contribute to them. Core TFBS are in black, TFBSs unique to female comparisons are in green; there is some overlap in categories between these two groups. TFBSs uniquely enriched in the male-biased H3K27ac peaks are only overrepresented in transcription-related GO categories (brown).
Figure 7. Comparison of Tutored and Isolate data. Sankey plots of significantly overrepresented BP GO categories based on ( a ) enriched TF motifs from the Tutored-over-Isolate peak comparison, and ( b-c ) predicted genes from the ( b ) Tutored-over-Isolate and ( c ) and Isolate-over-Tutored analysis.
Information & Authors
Information
Version history
Copyright
This work is licensed under a Non Exclusive No Reuse License.