Nutritionally responsive PMv DAT neurons are dynamically regulated during pubertal transition

preprint OA: closed CC-BY-NC-ND-4.0
📄 Open PDF Full text JSON View at publisher
Full text 81,451 characters · extracted from preprint-html · click to expand
Nutritionally responsive PMv DAT neurons are dynamically regulated during pubertal transition | bioRxiv /* */ /* */ <!-- <!-- /*! * yepnope1.5.4 * (c) WTFPL, GPLv2 */ (function(a,b,c){function d(a){return"[object Function]"==o.call(a)}function e(a){return"string"==typeof a}function f(){}function g(a){return!a||"loaded"==a||"complete"==a||"uninitialized"==a}function h(){var a=p.shift();q=1,a?a.t?m(function(){("c"==a.t?B.injectCss:B.injectJs)(a.s,0,a.a,a.x,a.e,1)},0):(a(),h()):q=0}function i(a,c,d,e,f,i,j){function k(b){if(!o&&g(l.readyState)&&(u.r=o=1,!q&&h(),l.onload=l.onreadystatechange=null,b)){"img"!=a&&m(function(){t.removeChild(l)},50);for(var d in y[c])y[c].hasOwnProperty(d)&&y[c][d].onload()}}var j=j||B.errorTimeout,l=b.createElement(a),o=0,r=0,u={t:d,s:c,e:f,a:i,x:j};1===y[c]&&(r=1,y[c]=[]),"object"==a?l.data=c:(l.src=c,l.type=a),l.width=l.height="0",l.onerror=l.onload=l.onreadystatechange=function(){k.call(this,r)},p.splice(e,0,u),"img"!=a&&(r||2===y[c]?(t.insertBefore(l,s?null:n),m(k,j)):y[c].push(l))}function j(a,b,c,d,f){return q=0,b=b||"j",e(a)?i("c"==b?v:u,a,b,this.i++,c,d,f):(p.splice(this.i++,0,a),1==p.length&&h()),this}function k(){var a=B;return a.loader={load:j,i:0},a}var l=b.documentElement,m=a.setTimeout,n=b.getElementsByTagName("script")[0],o={}.toString,p=[],q=0,r="MozAppearance"in l.style,s=r&&!!b.createRange().compareNode,t=s?l:n.parentNode,l=a.opera&&"[object Opera]"==o.call(a.opera),l=!!b.attachEvent&&!l,u=r?"object":l?"script":"img",v=l?"script":u,w=Array.isArray||function(a){return"[object Array]"==o.call(a)},x=[],y={},z={timeout:function(a,b){return b.length&&(a.timeout=b[0]),a}},A,B;B=function(a){function b(a){var a=a.split("!"),b=x.length,c=a.pop(),d=a.length,c={url:c,origUrl:c,prefixes:a},e,f,g;for(f=0;f<d;f++)g=a[f].split("="),(e=z[g.shift()])&&(c=e(c,g));for(f=0;f<b;f++)c=x[f](c);return c}function g(a,e,f,g,h){var i=b(a),j=i.autoCallback;i.url.split(".").pop().split("?").shift(),i.bypass||(e&&(e=d(e)?e:e[a]||e[g]||e[a.split("/").pop().split("?")[0]]),i.instead?i.instead(a,e,f,g,h):(y[i.url]?i.noexec=!0:y[i.url]=1,f.load(i.url,i.forceCSS||!i.forceJS&&"css"==i.url.split(".").pop().split("?").shift()?"c":c,i.noexec,i.attrs,i.timeout),(d(e)||d(j))&&f.load(function(){k(),e&&e(i.origUrl,h,g),j&&j(i.origUrl,h,g),y[i.url]=2})))}function h(a,b){function c(a,c){if(a){if(e(a))c||(j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}),g(a,j,b,0,h);else if(Object(a)===a)for(n in m=function(){var b=0,c;for(c in a)a.hasOwnProperty(c)&&b++;return b}(),a)a.hasOwnProperty(n)&&(!c&&!--m&&(d(j)?j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}:j[n]=function(a){return function(){var b=[].slice.call(arguments);a&&a.apply(this,b),l()}}(k[n])),g(a[n],j,b,n,h))}else!c&&l()}var h=!!a.test,i=a.load||a.both,j=a.callback||f,k=j,l=a.complete||f,m,n;c(h?a.yep:a.nope,!!i),i&&c(i)}var i,j,l=this.yepnope.loader;if(e(a))g(a,0,l,0);else if(w(a))for(i=0;i (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0];var j=d.createElement(s);var dl=l!='dataLayer'?'&l='+l:'';j.src='//www.googletagmanager.com/gtm.js?id='+i+dl;j.type='text/javascript';j.async=true;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-M677548'); Skip to main content Home About Submit ALERTS / RSS Search for this keyword Advanced Search New Results Nutritionally responsive PMv DAT neurons are dynamically regulated during pubertal transition View ORCID Profile Cristina Sáenz de Miera , Nicole Bellefontaine , View ORCID Profile Marina A Silveira , Chelsea N Fortin , View ORCID Profile Thais T Zampieri , View ORCID Profile Jose Donato Jr , View ORCID Profile Kevin W Williams , View ORCID Profile Cristiano Mendes-da-Silva , Laura Heikkinen , View ORCID Profile Christian Broberger , View ORCID Profile Renata Frazao , View ORCID Profile Carol F Elias doi: https://doi.org/10.1101/2025.02.03.636271 Cristina Sáenz de Miera a Department of Molecular and Integrative Physiology Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Cristina Sáenz de Miera Nicole Bellefontaine a Department of Molecular and Integrative Physiology Find this author on Google Scholar Find this author on PubMed Search for this author on this site Marina A Silveira c Department of Neuroscience, Developmental and Regenerative Biology, The University of Texas at San Antonio , San Antonio, TX, 78249 d Department of Anatomy, Institute of Biomedical Sciences, University of Sao Paulo , Sao Paulo, SP, Brazil , 05508 Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Marina A Silveira Chelsea N Fortin b Department of Obstetrics and Gynecology University of Michigan , Ann Arbor, MI, 48109 Find this author on Google Scholar Find this author on PubMed Search for this author on this site Thais T Zampieri d Department of Anatomy, Institute of Biomedical Sciences, University of Sao Paulo , Sao Paulo, SP, Brazil , 05508 Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Thais T Zampieri Jose Donato Jr e Department of Physiology and Biophysics, Institute of Biomedical Sciences, University of Sao Paulo , Sao Paulo, SP, Brazil , 05508 Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Jose Donato Jr Kevin W Williams f Center for Hypothalamic Research, Department of Internal Medicine, Peter O’Donnell Jr. Brain Institute, The University of Texas Southwestern Medical Center at Dallas , Dallas, TX, 75390 Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Kevin W Williams Cristiano Mendes-da-Silva g Department of Biosciences, Federal University of Sao Paulo , Santos, SP, Brazil , 11015 Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Cristiano Mendes-da-Silva Laura Heikkinen h Department of Biochemistry and Biophysics, Stockholm University , Stockholm, Sweden Find this author on Google Scholar Find this author on PubMed Search for this author on this site Christian Broberger h Department of Biochemistry and Biophysics, Stockholm University , Stockholm, Sweden Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Christian Broberger Renata Frazao d Department of Anatomy, Institute of Biomedical Sciences, University of Sao Paulo , Sao Paulo, SP, Brazil , 05508 Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Renata Frazao Carol F Elias a Department of Molecular and Integrative Physiology b Department of Obstetrics and Gynecology University of Michigan , Ann Arbor, MI, 48109 Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Carol F Elias For correspondence: cfelias{at}umich.edu Abstract Full Text Info/History Metrics Preview PDF Abstract Pubertal development is tightly regulated by energy balance. The crosstalk between metabolism and reproduction is orchestrated by complex neural networks and leptin action in the hypothalamus plays a critical role. The ventral premammillary nucleus (PMv) leptin receptor (LepRb) neurons act as an essential relay for leptin action on reproduction. Here, we show that mouse PMv cells expressing the dopamine transporter (DAT) gene, Slc6a3 (PMv DAT ) form a novel subpopulation of LepRb neurons. Virtually all PMv DAT neurons expressed Lepr mRNA and responded to acute leptin treatment. Electrophysiological recordings from DAT CRE ;tdTomato mice showed that PMv DAT cells in prepubertal females have a hyperpolarized resting membrane potential compared to diestrous females. Slc6a3 mRNA expression in the PMv was higher in prepubertal than in adult females. In prepubertal females Slc6a3 mRNA expression was higher in overnourished females from small size litters than in controls. Prepubertal Lep ob females showed decreased PMv Slc6a3 mRNA expression, that recovered to control levels after 3 days of leptin injections. Using a tracer adenoassociated virus in the PMv of adult DAT Cre ;Kiss1 hrGFP females, we observed PMv DAT projections in the anteroventral periventricular and periventricular nucleus (AVPV/PeN), surrounding Kiss1 hrGFP neurons, a population critical for sexual maturation and positive estrogen feedback in females. The DAT CRE ;tdTomato projections to the AVPV were denser in adult than in prepubertal females. In adults, they surrounded tyrosine hydroxylase neurons. Overall, these findings suggest that the DAT expressing PMv LepRb subpopulation play a role in leptin regulation of sexual maturation via actions on AVPV kisspeptin/tyrosine hydroxylase neurons. Significance Statement Women with excess or low energy stores ( e.g., obesity or anorexia) have reproductive deficits, including altered puberty onset, disruption of reproductive cycles and decreased fertility. If able to conceive, they show higher risks of miscarriages and preterm birth. The hypothalamic circuitry controlling the interplay between metabolism and reproduction is poorly defined. Neurons in the ventral premammillary nucleus express the leptin receptor and play a key role in the metabolic control of reproduction. Those neurons are functionally and phenotypically heterogeneous. Here we show that a subset of leptin-sensitive neurons co-expresses the dopamine transporter (DAT), is dynamically regulated during pubertal transition and with nutrition and projects to brain sites relevant for sexual maturation. Download figure Open in new tab Graphical abstract The ventral premammillary nucleus of the hypothalamus plays an essential role in the metabolic control of reproduction. Puberty brings large changes to a subpopulation of PMv LepRb cells expressing the dopamine transporter (PMv DAT ). DAT gene expression is higher in prepubertal than in adults and is regulated by leptin in prepubertal females. Dynamic projections from PMv DAT cells contact the kisspeptin and tyrosine hydroxylase (TH) populations in the AVPV/PeN during puberty, a critical time for the appearance of these cells in the AVPV/PeN. Introduction Pubertal development and the maintenance of reproductive function are disrupted in states of negative energy balance or excess energy reserve ( 1 – 3 ). If energy stores are low, puberty is delayed, the reproductive cycles are prolonged, and sub- or infertility ensues ( 2 – 4 ). High adiposity, on the other end, induces earlier pubertal development and decreased fertility in adult life ( 5 – 7 ). The cross-talk between metabolic and reproductive functions is orchestrated by a complex neuronal network modulated by circulating hormones and metabolic cues ( 8 , 9 ). Among them, leptin has critical roles ( 10 – 12 ). Leptin signaling-deficient subjects develop obesity and remain in an infertile prepubertal state ( 13 – 15 ). In mice, direct leptin actions only in the brain are sufficient to normalize body weight, induce puberty and maintain fertility ( 10 , 14 , 16 ). The ventral premammillary nucleus (PMv) contains a dense collection of leptin receptor (LepRb) neurons, and is recognized as an important hypothalamic site in the metabolic control of reproductive function ( 4 , 16 – 21 ). Bilateral lesions of the PMv disrupt estrous cycles and the ability of leptin to increase luteinizing hormone secretion after fasting ( 4 ). Endogenous restoration of LepRb exclusively in PMv neurons rescues pubertal maturation and fertility in LepRb null female mice ( 16 ), while activation of PMv LepRb neurons is sufficient to induce LH release even in normally fed female mice ( 20 ). The PMv LepRb neurons, however, do not comprise a homogeneous population, i.e., about 75% depolarize and 25% hyperpolarize in response to leptin ( 22 ), but their seemingly dissociated nature and function are poorly understood. The PMv neurons are mostly glutamatergic and innervate brain sites associated with reproductive control, sending direct inputs to kisspeptin and gonadotropin-releasing hormone (GnRH) neurons ( 16 , 18 , 19 , 21 , 23 ). A subset of PMv neurons also expresses the dopamine transporter (DAT), a membrane protein associated with dopamine reuptake at presynaptic terminals ( 24 – 26 ). PMv DAT neurons are unique in the sense that they show seemingly undetectable levels of tyrosine hydroxylase (TH) and dopamine release to specific brain sites ( 25 , 27 ). Manipulation of PMv DAT neuronal activity has shown an action in male social behavior, inter-male and maternal aggression and maternal behaviors ( 25 , 26 , 28 , 29 ). However, the role of PMv DAT neurons in female reproductive physiology has not been described, and whether they participate in the metabolic control of reproductive function is unknown. In this study, we show that DAT is expressed in a subpopulation of PMv LepRb neurons. Slc6a3 ( DAT ) mRNA expression is higher in prepubertal than in adult females and it is increased in overnourished prepubertal females. We also show that PMv DAT neurons project to and make apparent contacts with kisspeptin neurons in the the anteroventral periventricular nucleus (AVPV) in adults, but not in prepubertal mice. Methods Experimental animals All procedures were carried out in accordance with the National Research Council Guide for the Care and Use of Laboratory Animals, and protocols were approved by the University of Michigan IACUC (PRO000010420); and in accordance with the European Community Council directive of November 24, 1986 (86/609/EEC) and had received approval by the local ethical board, Stockholms Djurförsöksetiska Nämnd. Mice were held under a 12h:12h light:dark cycle (lights on at 6 am), temperature-controlled at 21-23 °C, and fed ad libitum on a low-phytoestrogen diet (Envigo 2016 diet) and a higher protein and fat phytoestrogen reduced diet 2019 (Envigo 2019 Teklad diet) when breeding. Strains of mice used were a line expressing Cre-recombinase under the Slc6a3 promoter (DAT Cre , JAX®; Stock 006660) ( 30 ), and ( 31 ) only for female electrophysiology, a ROSA26 stop-floxed tdTomato reporter mouse line (tdTomato, JAX®; Stock 007914), mice expressing GFP under the kiss1 gene promoter: Kiss1 hrGFP (JAX®, stock 023425) ( 32 ), wild type C57B6/J (JAX®; Stock 000664) and the B6.Cg-Lepob/J strain, homozygous mice with an obese spontaneous mutation ( Lep ob , JAX®; Stock 000632). Adult animals used were postnatal (P) age 60-100 days old, unless otherwise specified. Ovariectomy and estradiol replacement To assess the effects of estradiol (E2) on Slc6a3 gene expression we used ovariectomized (OVX, n=5), OVX + E2 (n=5) and diestrous females (n=4). Females were deeply anesthetized with isoflurane and underwent bilateral OVX. OVX females received steroid replacement via a Silastic capsule containing E2 (1 μg, OVX+E2) or oil (OVX) subcutaneously at the time of surgery. OVX females were perfused 7-14 days following surgery, while OVX+E2 females were perfused two days following E2 replacement. Uterus size was used as control for the treatment. Only OVX mice with uterine weight below 80 mg and OVX+E2 mice with uterine weight above 100mg were used. Both groups were perfused in the morning to avoid time-of-day effects of estradiol feedback. Leptin treatment DAT Cre ;tdTomato adult (P60-70) males and females fasted overnight and prepubertal (P19) males and females fasted for 4h were intraperitoneally (i.p.) injected with leptin (2.5 mg/kg, National Hormone and Peptide Program, Harbor-UCLA Medical Center, CA) or saline (n=5-6 animals/group). Sixty minutes following leptin injection, mice were perfused with PBS and 10% neutral buffered formalin (NBF, Sigma), brains were postfixed for 2h in 20% sucrose in 10% NBF and stored with 20% sucrose in PBS. 30 µm coronal tissue sections 120 µm apart were processed for pSTAT3 immunohistochemistry as described below. Two cohorts of adult wild type females in diestrus i.p. injected with saline , Lep ob animals i.p. injected with saline (Lep ob + saline) or with leptin (3 mg/kg/day, Lep ob + leptin group, murine leptin, Preprotech), received the treatment for two days at 9 am and 5 pm and one day at 9 am. One hour after the last saline or leptin injection (at 10 am), females were euthanized by decapitation following anesthesia (isoflurane) and brains were harvested and snap frozen. Coronal frozen sections (16 µm) were collected on a cryostat and stored at -80°C until processing for gene expression. In situ hybridization (ISH) with radioisotopes Adult wild type (WT) male (n=3) and female (n=4) mice were used to study sex differences in Slc6a3 gene expression. Female mice were also used to determine developmental differences in Slc6a3 gene expression, i.e., prepubertal (P19, n=7) vs. adult (P60-70, n=5) diestrous mice. To assess the effects of nutritional factors in development on Slc6a3 gene expression we used P20 females from small litters (SL 2-3 pups/litter, n=5 females) or normal litter (NL 7-9 pups/litter, n=4 females). To assess the effect of leptin in Slc6a3 expression we used diestrous (n=7), Lep ob + saline (n=5) or Lep ob + leptin (n=5) injected females. Coronal sections were used for radioactive ISH, using an 35 S-UTP or 33 P-UTP labelled Slc6a3 riboprobe. The following primers were used (exon 10-15 of the Slc6a3 gene): Forward (5’ ACGTCTTGATCACTGGGCTTGTCGATGAGTT 3’) and reverse (5’ GCATGGATTGGGTGTGAACAGTC 3’) to amplify a 754 base-pair sequence in the Slc6a3 gene (exons 10-15). A clamp sequence followed by sequences for T7 (CCAAGCCTTCTAATACGACTCACTATAGGGAGA) and T3 (CAGAGATGCAATTAACCCTCACTAAAGGGAGA) promoters were added to the reverse and forward primer sequences, respectively. Single-labeled ISH was performed on 20 µm fresh frozen or 30 µm fixed brain (120 µm distance) sections mounted onto SuperFrost Excell or Superfrost Gold slides (Fisher Scientific). Fixed sections were subjected to a 10-minute microwave sodium citrate (pH 6) pre-treatment and hybridized overnight at 57 °C with 35 S-labeled Slc6a3 riboprobes, as previously described ( 17 , 33 ). Frozen sections were fixed in ice-cold 10% NBF, treated with 0.25% acetic anhydride and underwent dehydration in ethanol, and hybridized overnight at 57 °C with 33 P-labeled Slc6a3 riboprobes. All slides were then incubated in 0.002% RNase A followed by stringency washes in sodium chloride-sodium citrate buffer (SSC). Slides were exposed to film autoradiography (Kodak), for 3-5 days. Slides were dipped in autoradiographic emulsion (Kodak), dried for 3 hours and stored in light-protected boxes at 4 °C for 2-4 weeks. Slides were developed in D-19 developer, dehydrated in ethanol, cleared in xylene, and coverslipped with DPX (Electron Microscopy Sciences). Film images were acquired using a stereoscope (Zeiss). Darkfield 10x images were captured using a digital camera on an AxioImager M2 microscope (Zeiss). ISH signals were quantified using integrated optical density (IOD) in ImageJ software (NIH) using the “freehand” tool to outline the PMv. IOD from the tissue background of the same area was subtracted. Fluorescent ISH We used diestrous WT female mice (n=3) to assess Slc6a3 and Lepr mRNA co-expression by fluorescent ISH. ISH was performed on fresh frozen 16-µm thick cryostat sections at 128-µm resolution (8-series). The ISH was performed following the RNAscope protocol for fresh frozen sections, using Protease III (ACDbio, RNAscope Multiplex Fluorescent Reagent Kit v2). Briefly, slides were dried at 60 °C for 15 min, rinsed in PBS for 5 min, fixed in 10% NBF for 15 min at 4 °C, rinsed in PBS-DEPC 2 times for 3 min, dehydrated through rinses in serial ethanols for 3 min each, and air-dried for 20 min. A hydrophobic barrier was created around each slide using the ImmEdge pen (Vector Laboratories). The slides were then incubated in H 2 O 2 for 10 min at RT followed by incubation with Protease III for 30 min at 40 °C. ISH was performed using the RNAscope Protease III (ACDBio). Sections were incubated with Mm-Slc6a3-C1 (#315441), and Mm-Lepr-C3 (#402731-C3, labeling all Lepr isoforms) RNAscope probes for 2 h at 40°C using the HybEZ Humidifying System (ACDBio). After all incubation steps following the kit’s protocol, slides were incubated in DAPI solution for 30 s at room temperature, and coverslipped using ProLong Gold Antifade Mountant (ThermoFisher Scientific). Quantification of mRNA coexpression within cells was performed on PMv images acquired with a 40x oil objective on an AxioImager M2 microscope (Zeiss). Based on observed background outside of the area of interest, a threshold for a minimum number of 5 puncta per cell was used to consider a cell positive for expression of that gene. Confocal images were acquired for illustration on a Nikon A1 confocal microscope. Electrophysiological recordings Hypothalamic slices from adult DAT Cre ;tdTomato male ( 30 ) and female ( 31 ) mice were prepared and the data analyzed as previously described ( 22 ). Briefly, mice were decapitated following isoflurane anesthesia, and the entire brain was removed. After removal, the brains were immediately submerged in ice-cold, carbogen-saturated (95% O 2 and 5% CO 2 ) artificial cerebrospinal fluid (ACSF, 126 mM NaCl, 2.8 mM KCl, 26 mM NaHCO 3 , 1.25 mM NaH 2 PO 4 , 1.2 mM MgSO 4 , 5 mM glucose and 2.5 mM CaCl 2 ). Coronal sections (250 µM) from hypothalamic blocks were cut on a Leica VT1000S vibratome and incubated in oxygenated ACSF at room temperature for at least 1 hour before the recordings. The slices were transferred to the recording chamber and allowed to equilibrate for 10–20 min. The slices were bathed in oxygenated ACSF (32°C) at a flow rate of ∼2 mL/min. The pipette solution was in some cases modified to include an intracellular dye (Alexa Fluor 488) for whole-cell recording: 120 mM K-gluconate, 10 mM KCl, 10 mM HEPES, 5 mM EGTA, 1 mM CaCl 2 , 1 mM MgCl 2 , 2 mM (Mg)-ATP, and 0.03 mM AlexaFluor 488 hydrazide dye, pH 7.3. Whole-cell patch-clamp recordings were performed on tdTomato-positive neurons anatomically restricted to the PMv. Epifluorescence was briefly used to target the fluorescent cells; at which time the light source was switched to infrared differential interference contrast imaging to obtain the whole-cell recording (Leica DM6000 FS equipped with a fixed stage and a fluorescence digital camera). In current-clamp mode, tdTomato neurons were recorded under zero current injection (I = 0) in whole-cell patch-clamp configuration. The recording electrodes had resistances of 5-7 MΩ when filled with the K-gluconate internal solution. The membrane potential values were compensated to account for the junction potential (-8 mV). In males and females at both ages, the resting membrane potential (RMP) was monitored for at least 10-20 minutes (baseline period) before leptin was administered to the bath. Solutions containing leptin (100 nM) were typically perfused for 15-20 minutes after the baseline period, with a 20-minute washout with ACSF. Manipulation of estrous cycles using chemogenetics Adult virgin DAT-Cre females (n=14) received bilateral injection (50 nL/side) of an adenoassociated virus (AAV) expressing a Cre-dependent hM3Dq-mCherry fusion protein,pAAV8-hSyn-DIO-hM3D(Gq)-mCherry (AAV-hM3Dq, Addgene plasmid # 44361, from Bryan Roth) ( 34 ) in the PMv using the following coordinates: Anteroposterior = -5.4 mm (from rostral rhinal vein); mediolateral = -0.52 mm (from sagittal sinus); dorsoventral = -5.4 mm (from dura mater). The stereotaxic protocol is described in detail in a previous study ( 35 ). One month after surgery, we started to follow the reproductive cycle of these females collecting daily vaginal smears with saline solution. After a period of adaptation, we continued for 13 days with added DMSO (0.0068%) in water, as a control. Next, we added CNO (5 mg/kg) dissolved in DMSO in the drinking water and followed the cycles for 13 more days. The abundant presence of cornified cells in the smear was considered as estrus/metestrus, a large abundance of leukocytes was considered as diestrus and a large abundance of nucleated cells with some cornified cells present was considered as proestrus. At the end of the experiment, the females received i.p. injection of CNO and 2 h after mice were perfused with PBS and 10% NBF (Sigma), brains were postfixed for 4 h in 20% sucrose in 10% NBF and stored with 20% sucrose in PBS. We collected 30 µm coronal tissue sections 120 µm apart. Sections were cryoprotected and frozen until processed to verify the injection sites for these females. Tracing PMv-DAT neuronal projections DAT-Cre adult females (n=7) received unilateral stereotaxic injections of an AAV expressing a Cre-dependent channelrhodopsin-mCherry fusion protein (AAV8-hSyn-double floxed-hChR2(H134R)-mCherry, UNC Vector Core, from Karl Deisseroth (Addgene 20297), 25-50 nL) in the PMv. One month after the stereotaxic surgery, mice were perfused with 10% NBF and brains were harvested and processed for histology as above. Fixed coronal 30 µm hypothalamic brain sections were processed for immunofluorescence. Immunohistochemistry Fixed frozen tissue sections (30 µm at 120 µm distance) from perfused animals obtained with a freezing microtome (Leica) were rinsed in PBS and blocked with PBS + Triton-X 0.25% (PBT) and 3% normal donkey serum (NDS). Primary antibodies were incubated in PBT + 3% NDS overnight at room temperature. Primary antibodies used were Rabbit dsRed antibody (1:5000, Clontech 632496, RRID:AB_10013483), rat monoclonal anti-mCherry 16D7 (1:5000, Invitrogen M11217, RRID:AB_2536611), rabbit anti-cFOS (1:5000, Millipore ABE457, RRID:AB_2631318), chicken anti-GFP (1:10000, Aves GFP-1010, RRID:AB_2307313), rabbit polyclonal anti-GnRH (1:5,000, Phoenix Pharmaceuticals H-003-57, RRID:AB_572248), and sheep anti-TH (1:5000, Millipore AB1542, RRID:AB_90755). For detection of Fos, endogenous peroxidase was blocked with 0.3% H 2 O 2 for 30 min before the NDS blocking step. For detection of phosphorylation of signal transducer and activator of transcription 3 (pSTAT3), tissue was pre-treated with 1% H 2 O 2 and with 1% sodium hydroxide in water and then with 0.3% Glycine before blocking with PBT + NDS 3% as before. Tissue was incubated in primary rabbit anti-pSTAT3 (Tyr705) (D3A7) XP ® (1:1,000; Cell Signaling 9145S, RRID:AB_2491009) for 48 h at 4°C. The corresponding secondary fluorescent antibodies were used for detection (1:500, Invitrogen). For the Fos antibody we performed immunoperoxidase detection using a biotinylated-anti rabbit IgG secondary antibody (1:1000, Jackson Immunoresearch), signal amplification with Avidin Biotin Complex (Vectastain ® ABC-HRP Kit, 1:500, Vector labs) for 1 h and signal development with diaminobenzidine (DAB, Sigma) 0.05% and 0.01% H 2 O 2 . Floating sections were then mounted on gelatin-coated slides, dried overnight and coverslipped with Fluoromount-G (Invitrogen). Photomicrographs were acquired using Axio Imager M2 (Carl Zeiss Microscopy). Quantification of pSTAT3, tdTomato and TH positive neurons was performed by an observer unaware of the images’ identity. Dual-labeled tdTomato and pSTAT3 immunoreactive cells were counted in each individual channel and colocalization was considered where pSTAT3 immunoreactivity (-ir) was clearly nuclear in tdTomato-positive cells. Two sections at the mid-PMv level were counted (∼Bregma: -2.46 mm). No correction for double counting was performed because sections were 120μm apart. tdTomato fiber density in the AVPV/PeN was quantified using IOD in ImageJ software (NIH) on both sides of the ventricle in a representative section for each region. An elongated rectangle of the same size for all animals was used as region of interest, placed in contact with the ventricle wall to cover a representative area over the TH-expressing cells. Confocal microscopy images were acquired and analyzed using a Nikon A1 microscope and a Nikon N-SIM + A1R microscope with a resonance scanner. Data analysis Data are expressed and represented as mean ± SEM. When data did not fit a normal distribution or did not have equal variances, they were transformed to fit a normal distribution and re-analyzed. Unpaired two-tailed Student’s t test was used for comparison between two groups. For comparison between three groups, one-way ANOVA was used followed by Tukey’s post-hoc multiple comparison test. For pSTAT3 and %pSTAT3/tdTomato cells, a two-way ANOVA was used with age and sex as factors. Correlation was assessed between body weight and Slc6a3 gene expression using Pearson R correlation coefficient. A P value less than 0.05 was considered significant. Data were organized and calculated in Excel software (Microsoft, inc.). Statistical analyses and graphs were performed using GraphPad Prism v.9.5 (GraphPad software, inc.). Zen Blue 3.7 software (Carl Zeiss Microscopy GmBH) was used to acquire and process epifluorescence images. NIS-elements software (Nikon) was used to acquire and process confocal microscope images. Photoshop 2024 (Adobe, inc.) was used to integrate graphs and digital images into figures. The graphical abstract was prepared using BioRender. Only brightness, contrast, and levels were modified to improve data visualization in the figures. Results Slc6a3 mRNA expression in the PMv is sexually dimorphic and higher in prepubertal females The Slc6a3 (DAT) gene is expressed in the PMv of male and female mice ( 24 , 25 ). To evaluate potential sexual dimorphism or postnatal developmental changes, we assessed Slc6a3 gene expression in the PMv in adult males and females, and in prepubertal and adult females. PMv Slc6a3 mRNA levels were higher in diestrous females compared to male mice (n=3 female, n=4 male, unpaired t-test p=0.032 Figure 1A, B, D ), and higher in prepubertal females compared to diestrous mice (n=7 prepubertal, n=5 diestrous, unpaired t-test p=0.013 Figure 1B, C, E ). Download figure Open in new tab Figure 1. Ventral premammillary nucleus (PMv) Slc6a3 gene expression varies with sex and development. A-C. Darkfield images showing the Slc6a3 - 35 S hybridization signal (silver grains) in the PMv of adult male, a diestrous female and a prepubertal female, respectively. D-F. Graphs showing the quantification of the Slc6a3 hybridization signal in adult male vs . diestrous females, in prepubertal vs . diestrous females and in diestrous vs . ovariectomized (OVX) females and OVX females supplemented with estradiol (E2). All data shown are average ± SEM. * p<0.05. Scale bar = 100 µm. To assess if the reduction of PMv Slc6a3 mRNA in adult female mice is a result of increasing circulating estradiol (E2) during the pubertal transition, hypothalamic sections from diestrous, ovariectomized (OVX), and OVX + E2 mice were analyzed. We found no differences between these groups (n=5 diestrous and OVX+E2, n=4 OVX, one-way ANOVA, p = 0.54, Figure 1F ). PMV DAT neurons show heterogenous responses to leptin We used fluorescent in situ hybridization (ISH) to assess transcript coexpression in adult females in diestrus (n=3). Virtually all Slc6a3 neurons in the PMv coexpressed Lepr mRNA (93.6 % ± 2.1), whereas about half of PMv Lepr neurons coexpressed Slc6a3 mRNA (58.6 % ± 4.1, Figure 2A-C ). Download figure Open in new tab Figure 2. A subpopulation of leptin receptor ( Lepr ) expressing neurons in the ventral premammillary nucleus (PMv) co-expresses dopamine transporter ( Slc6a3) . A. Fluorescent image showing representative fluorescent in situ hybridization depicting the colocalization of Lepr (magenta) and Slc6a3 (green) in the PMv of a diestrous female. Arrows point to cells co-expressing Lepr and Slc6a3 mRNA. Arrowheads point to cells expressing only Lepr , but not Slc6a3 , mRNA. Blue = DAPI. B-C. Higher magnification of individual cells depicted in A that co-express Slc6a3 and Lepr mRNA (B), and of a cell that expresses only Lepr mRNA (C). D. Fluorescent image showing the PMv in the brain slices, recognized by tdTomato expression in DAT Cre neurons. E. Merged image showing the colocalization between a recorded DAT Cre ;tdTomato neuron (magenta) and the AF488 dye (green), dialyzed during the recording. F. Representative current-clamp recording demonstrating leptin (100 nM) induced hyperpolarization in a subset of DAT-Cre tdTomato neurons of a male mouse. The dashed line indicates resting membrane potential (-52 mV). Asterisks indicate square pulse current injections to assess input and access resistance. G. Pie charts representing the percentage of neurons that hyperpolarized, depolarized or did not respond to 100nM leptin in adult males (N=16) and in adult diestrous females (N=8). Scale bars: A and E = 50 µm, B-C: 2 µm, D= 400 µm. To investigate the effect of leptin on the membrane excitability of PMv DAT neurons, we performed current clamp recordings of DAT Cre ;tdTomato neurons. In males, the average RMP of recorded neurons was -52.8 ± 2.0 mV (range from -62 to -38 mV, 16 cells from 8 mice). In a separate cohort of females, the RMP was -57.2 ± 5.7 mV (range from -62 to -51 mV, 8 cells from 6 mice). We found that bath application of 100 nM leptin hyperpolarized 25% of the recorded neurons of male mice (4/16 cells Figure 2D-G ). The RMP of the remaining 75% of the recorded cells was unchanged or showed a continuous depolarizing trend and were removed from the analysis. In females in diestrus, ∼75% (6/8) of recorded cells hyperpolarized in response to bath application of 100nM leptin ( Figure 2G ). Two PMv DAT neurons showed a depolarizing response, and one showed continuous depolarization and was removed from the analysis ( Figure 2E ). The leptin-associated hyperpolarization of PMv DAT cells was of similar amplitude in both sexes: -7.8 ± 0.8 mV in males, and -6.3 ± 2.0 mV in females. Although most (> 90%) of Slc6a3 expressing neurons express Lepr , only a subpopulation exhibits a response, including both de- and hyperpolarization, in electrical properties to the hormone. Long-term activation of PMv DAT neurons does not alter estrous cycles in adult virgin females Given the higher percentage of female’s DAT Cre ;tdTomato neurons that are hyperpolarized by leptin, we decided to investigate if long-term activation of these neurons might impair the reproductive cycle of the adult females. We stereotaxically injected the AAV-hM3Dq virus bilaterally in the PMv of 14 DAT Cre ;tdTomato virgin females. Twelve females had bilateral injections and one had a unilateral injection centered in the PMv, defined by the expression of mCherry and Fos immunoreactivity that indicates they had been activated by CNO ( Figure 3A-B ). Two animals had missed injections with not Cherry expression observed in either PMv, and lack of Fos confirmed in the PMv of these animals ( Figure 3C ). Of the twelve animals with bilateral injection, eleven showed regular cycling (at least two complete cycles) during the control (DMSO) period and were used for the analyses ( Figure 3D ). The cycles of the bilaterally injected females were not altered by the CNO when compared to the DMSO exposure (paired t-test DMSO vs . CNO, days in estrus/metestrus, p=0.59; days in diestrus, p=0.68; cycle length, p=0.69, n=11, Figure 3E-G ). We paid special attention to the potential virus spread to a nearby population of Slc6a3 expressing cells, the tubero-infundibular dopamine (TIDA) neurons in the arcuate nucleus (Arc), ( 24 ). Six mice showed some viral contamination of TIDA neurons, but no differences in cyclicity or cycle length were noticed when these animals were removed from the analysis. These results suggest that these cells have no effect on female cyclicity. Download figure Open in new tab Figure 3. Continuous activation of dopamine-transporter neurons in the ventral premammillary nucleus (PMv DAT ) does not alter estrous cycles in adult DAT Cre female mice. A. Representative low-magnification fluorescent image of bilateral injections of adenoassociated virus (AAV) expressing Cre dependent hM3Dq-mCherry targeted to the PMv of a female DAT Cre mouse. B. High magnification image showing Fos immunoreactivity (Fos-ir) in one PMv side following an intraperitoneal injection of clozapine-N-oxide (CNO) and corresponding fluorescent image of the PMv showing mCherry immunofluorescence. C. High magnification image showing the lack of Fos-ir in one PMv side of a missed AAV injection, following an intraperitoneal injection of clozapine-N-oxide (CNO) and corresponding fluorescent image of the PMv showing the lack of mCherry immunofluorescence. D. Representative estrous cycles of two females with AAV injections centered in the PMv before treatment (drinking water), during the treatment with DMSO (vehicle) and CNO in drinking water. E/M: estrus/metestrus; P: Proestrus; D: Diestrus. E-G. Graphs showing the number of days spent in estrus/metestrus, diestrus and the cycle length (number of days) in the DAT Cre females with bilateral PMv AAV-hM3Dq injections during the DMSO and the CNO treatment. Data are average ± SEM. Scale bars: A = 200 µm, B, C = 100 µm Prepubertal PMv DAT neurons respond to leptin and show distinct membrane properties compared to adult females Due to increased expression of Slc6a3 in prepubertal females, we explored the functional response of PMv DAT neurons to exogenous leptin. Adult and prepubertal DAT Cre ;tdTomato mice received an i.p. injection of leptin, and one hour after, colocalization of pSTAT3-ir in tdTomato neurons was quantified. No differences were observed in the number of pSTAT3-ir cells with age or sex in leptin treated mice (n = 3-5; Two-way ANOVA, p=0.28 for Sex; p=0.79 for Age; Figure 4A-G ). Virtually no pSTAT3-ir was observed in the PMv of saline treated mice (n=5 per group). As expected from the Slc6a3 and Lepr coexpression data, 95.3 – 99.3 % of tdTomato neurons in the PMv colocalized with pSTAT3-ir in adults of both sexes ( Figure 4H ). Similar colocalization was observed in prepubertal mice of both sexes (96.4 – 98.9 %, Figure 4H ). About 30% of PMv pSTAT3-ir neurons colocalized with tdTomato in females (25.9 ± 2.8% prepubertal, and 33 ± 2.4% in diestrous, p=0.14) and males (27.8 ± 1.8% prepubertal, and 35.6 ± 4.8% in adults, p=0.18). Download figure Open in new tab Figure 4. Prepubertal dopamine-transporter neurons in the ventral premammillary nucleus (PMv DAT ) are responsive to leptin but are more hyperpolarized than in adult females. A, B. Fluorescent images showing the colocalization of pSTAT3 (green) and tdTomato (magenta) immunoreactivities in the PMv of prepubertal and adult diestrous DAT Cre ;tdTomato females 1h after a 2.5 mg/kg intraperitoneal leptin injection. C-F : High magnification images of the images depicted in A (C, D) and B (E, F). G, H. Graphs showing the number of pSTAT3 neurons per section (G) and the percentage of tdTomato cells expressing pSTAT3 (H) in the PMv of prepubertal and adult DAT Cre ;tdTomato female mice. Prepubertal (n=5) and diestrous (n= 3) females, prepubertal and adult males (n=4 each). I. Graph showing the resting membrane potential of individual cells from prepubertal and adult females (n=8 each). *** p<0.001. J. Representative current-clamp recording demonstrating leptin (100 nM) - induced hyperpolarization in a DAT-Cre tdTomato neuron of a female prepubertal mouse. The dashed line indicates resting membrane potential (-67 mV). K. Pie chart representing the percentage of neurons that hyperpolarized or did not show a change in membrane potential to 100nM of leptin in prepubertal females (N=8). All data shown are average ± SEM. Scales in A-B = 50 µm. C-F = 20 µm. When examined by electrophysiology, the PMv DAT neurons of prepubertal (unweaned) female mice revealed heterogeneous properties. Interestingly, the RMP of prepubertal PMv DAT neurons was more hyperpolarized compared to adult diestrous females (n=8 prepubertal and n=8 diestrous, unpaired t-test, p <0.0001, Figure 4I ). In response to leptin treatment, three out of eight cells (37.5%) from three mice showed no RMP change and another three out of eight cells (37.5%) responded by hyperpolarization ( Figure 4J, K ). Two out of eight cells (25%) depolarized after acute leptin, but none of them recovered after washout. Two recorded cells showed continuous depolarization and were removed from the analysis. The hyperpolarized cells showed a -6.3 ± 2.1 mV change in the RMP after treatment. Our findings indicate that the PMv DAT neuron population from prepubertal (unweaned) female mice is in a less excitable state compared to adult mice. Postnatal overnutrition increases Slc6a3 mRNA expression in the PMv of prepubertal females We next assessed if the expression of Slc6a3 mRNA is altered in the PMv of leptin deficient Lep ob infertile female mice, which remain in a prepubertal state. We employed a paradigm of leptin treatment and pubertal progression in which Lep ob females were injected with saline or leptin twice a day for 2 ½ days are compared to age-matched wild type diestrous females ( 16 , 36 ). As expected, the leptin-treated Lep ob mice showed a significant decrease in body weight and displayed signs of pubertal progression (vaginal opening) following the leptin treatment. We found that Slc6a3 mRNA expression is ∼40% lower in non-treated Lep ob females, compared to wild type females in diestrus (n=5-7; p=0.0025 one-way ANOVA, Tukey’s post-hoc , p=0.005 Figure 5A ). The short-duration leptin treatment regimen was sufficient to induce a ∼ 40% increase in Slc6a3 mRNA expression in the PMv of Lep ob mice (Tukey’s post-hoc , p=0.005, Figure 5A ), concomitant with the first signs of puberty onset. Download figure Open in new tab Figure 5. Slc6a3 (DAT) gene expression in the ventral premammillary nucleus (PMv) of prepubertal mice is affected by nutrition and leptin. A. Graph showing the quantification of Slc6a3 - 33 P hybridization signal as relative expression (%) in diestrous wild type vs . prepubertal Lep ob females injected with saline or with leptin. n=7 for diestrous and for Lep ob + saline, n = 5 for Lep ob + leptin. B-C. Dark-field images showing the Slc6a3 - 33 P hybridization signal (silver grains) in the PMv of prepubertal females (P20) from normal litter (NL) size (B) and from small litter (SL) size (C). D. Graph showing the quantification of the Slc6a3 hybridization signal (integrated optic density) in P20 females from normal and small size litters. n=4 animals for normal litter and n = 5 animals for small litter. E. Graph showing the correlation between female body mass and the Slc6a3 hybridization signal (IOD) in P20 females from normal and small size litters. Data shown are average ± SEM. ** p<0.01. Scale bar in B = 100 µm. Given the complex phenotype of the Lep ob mouse ( 37 ), we employed a paradigm of postnatal overnutrition, which leads to high leptin levels and early puberty ( 38 , 39 ). We compared Slc6a3 mRNA expression in the PMv of females raised in normal (NL, n=4 females) versus small (SL, n=5 females) litter sizes. Body weight was higher in SL offspring as compared to NL (9.67 ± 0.59 g in SL vs . 5.65 ± 0.39 g in NL, unpaired t-test p=0.001). Slc6a3 mRNA levels were higher in the SL than in those in NL (p=0.007, Figure 5B-D ) and were strongly correlated to body weight (Pearson r=0.78; p=0.01, Figure 5E ). PMv DAT neurons project to kisspeptin AVPV/PeN neurons To assess if PMv DAT neurons are part of the circuitry regulating pubertal development, DAT Cre ; Kiss1 hrGFP females were unilaterally injected with a Cre-dependent AAV expressing a channelrhodopsin-mCherry fusion protein (AAV-ChR2-mCherry) into the PMv (n=7). Abundant mCherry-ir neurons were observed within the PMv in correctly targeted animals (n=6). Mice showing virus spread to nearby DAT expressing populations were removed from the analysis (n=2 were analyzed, Figure 6A ). In accordance with previous studies focused on PMv projections ( 41 , 42 ), dense mCherry-ir fibers were found in several hypothalamic regions including the AVPV ( Figure 6B ), the periventricular nucleus (PeN) the medial preoptic area (MPA, Figure 6C ), and the ventrolateral subdivision of the ventromedial hypothalamus (VMHvl, not shown). Most notably, very sparse innervation of the Arc was observed ( Figure 6D ). No mCherry-ir projections were observed nearby or in contact with GnRH cell bodies in the medial septum (MS) or MPA (not shown). Download figure Open in new tab Figure 6. Dopamine-transporter neurons in the ventral premammillary nucleus (PMv DAT ) project to the AVPV and PeN and contact kisspeptin neurons. A-D . Fluorescent image showing ChR2-mCherry signal at the site of the injection in the PMv A, and the projections to the Anteroventral periventricular nucleus (AVPV, B), the Periventricular nucleus (PeN) and the Medial preoptic area (MPA, C), and presence of few projections in the arcuate nucleus (Arc, D). E. Confocal fluorescent maximum intensity projection image showing the lack of mCherry (magenta) projections close to kisspeptin ( kiss1 hrGFP, khrGFP) neurons (green) in the Arc. Insets are higher magnification single z plane images showing detail of mCherry signal in the external part of the dorsal Arc and the lack of contacts to khrGFP neurons in this area. F. Confocal fluorescent maximum intensity projection image showing mCherry signal (magenta) in the AVPV/PeN and the intense interaction of these projections to khrGFP neurons (green) in this area. are higher magnification single z plane images showing detail of the close contacts between these two populations (arrowheads). f: fornix; 3V: Third ventricle. Scale bar A-D = 50 µm. E-F = 20 µm. To explore a possible interaction of PMv DAT neurons with kisspeptin, we analyzed mCherry-ir fibers in proximity to Kiss1 hrGFP cells using confocal microscopy. As expected, due to the low innervation of the Arc, kisspeptin/neurokinin 3/dynorphin (KNDy) neurons did not receive close appositions from PMv DAT neurons ( Figure 6E ). In contrast, dense mCherry innervation of kisspeptin cells was observed in the AVPV and PeN region (AVPV/PeN, a.k.a. rostral periventricular area of the third ventricle, Figure 6F ) of the adult female mouse. PMv DAT innervation of AVPV/PeN is established during the pubertal transition The AVPV/PeN area contains a sexually dimorphic population of dopaminergic TH and kisspeptin cells, both denser in females. About 50-90% of the Kiss1 cells express TH in mice ( 40 – 43 ), and kisspeptin expression in this region increases during the pubertal transition ( 40 , 44 ). In DAT Cre ;tdTomato mice, we found that AVPV/PeN TH neurons do not express tdTomato. DAT Cre ;tdTomato fiber density was about three times higher in the AVPV (p=0.006, Figure 7A, B and E ), and about ten times higher in the PeN of adult vs . prepubertal females (p=0.003, Figure 7C, D and E ). As observed for Kiss1 , the number of neurons expressing TH was higher in both the AVPV and the PeN of adult diestrous female mice compared to prepubertal females (p<0.0001 in the AVPV; p<0.0001 in the PeN, Figure 7A-D, F ). DAT Cre ;tdTomato terminals were in close apposition to TH neurons and fibers in the AVPV/PeN of adult female mice ( Figure 7G-H ). Download figure Open in new tab Figure 7. DAT Cre ;tdTomato projections to dopaminergic cells in the anteroventral periventricular and periventricular nuclei (AVPV/PeN) arise after puberty. A-D . Fluorescent images showing tdTomato (magenta) and tyrosine hydroxylase (TH) immunoreactivity (green) in prepubertal (A, C) and in diestrous (B, D) DAT Cre ;tdTomato females. E. Graph showing the quantification of the tdTomato fiber density (Integrated optical density, IOD) in prepubertal vs . adult diestrous females in the AVPV and the PeN areas. F. Graph showing the number of TH neurons per section in the AVPV and in the PeN in prepubertal vs . diestrous female mice. G. Confocal fluorescent maximum intensity projection image showing tdTomato (magenta) and TH (green) cells and fibers in the lateral region of the AVPV/PeN in an adult diestrous female. H. Higher magnification confocal fluorescent maximum intensity projection image of a different field from G., showing tdTomato fibers in the PeN (magenta) and the intense interaction of these projections to TH neurons (green) in this area. All data shown are average ± SEM. ** p<0.01, *** p<0.001. Scale bars in A-D = 50 µm. G = 10 µm. H = 5 µm. Discussion The present study revealed a novel subset of leptin responsive cells within the PMv that show dynamic regulation of the Slc6a3 (DAT) mRNA during puberty and specific projections to hypothalamic sites and neurons involved in puberty and reproductive control. The overall PMv Leprb population is key in the metabolic regulation of puberty and fertility, whereas the PMv DAT neurons were previously shown to be involved in aggression, social and maternal behaviour ( 25 , 26 , 28 , 29 ). Our findings indicate that the PMv DAT population represents a discrete subset of PMv LepRb neurons and a novel candidate for mediating nutritional modulation of reproduction and pubertal development. Within the PMv, leptin-induced pSTAT3 was observed in all DAT-expressing cells. However, acute leptin exposure had heterogenous sex- and age-dependent effects on the excitability of DAT Cre neurons. The lack of electrophysiological response of a subpopulation suggests that these neurons are responsive to leptin in ways not tested in this study, e.g. by means of transcriptional regulation. Acute leptin action in the PMv Leprb population is also heterogenous, inducing the depolarization of 75% of these cells, via a putative transient receptor potential channel (TRPC) channel, and hyperpolarizing 25% cells, via activation of a putative Katp channel, while no cells were found to be unresponsive to the treatment ( 22 ). Importantly, the RMP of prepubertal females was more hyperpolarized than that of adult females suggesting that these cells may increase in excitability with maturation and only assume a more active role within the circuit after puberty. PMv DAT cells are responsive to prolactin and oxytocin ( 29 , 45 ) and the influence of these hormones may contribute to switching these cells from a quiescent to an excitable state in their role in maternal aggression ( 29 ). Further studies are needed to determine the acute and chronic effects of leptin on the electrical properties of PMv DAT neurons in distinct developmental and physiological states, as well as the mechanisms associated with changes in intrinsic physiological properties of PMv DAT neurons from prepubertal to adults. PMv DAT cells have been described as a non-dopaminergic population ( 25 , 27 ). These cells are an active glutamatergic population and send excitatory inputs to projection sites, in particular the VMHvl ( 25 , 26 ). Several studies, including ours (not shown) have observed a lack of TH expression in this population ( 27 , 46 ). Only one study has shown an enrichment in TH using Ribotag mice, but to a much lower extent than classical midbrain dopaminergic cells ( 25 ). Still, PMv DAT neurons express other elements of the dopamine/monoamine regulation pathway, such as Gucy2c , Aadc and Vmat2 ( 25 , 47 ). In shrews, dopamine and serotonin have been detected in the PMv after L-DOPA and 5-HTP treatment, respectively ( 47 ). However, in mice studies using fast-scan cyclic voltammetry have suggested that PMv DAT neurons do not produce dopamine, even when supplemented with L-DOPA ( 25 ). Thus, a significant role for dopamine release from these neurons is viewed as unlikely. Still, here we have discerned differences in the regulation of the dopamine transporter that merit further attention. Slc6a3 mRNA expression in the PMv was higher in females than in males, and showed a developmental decrease after puberty, suggesting a regulation during sexual maturation. Removal of the ovaries or changes in estrogen levels did not affect Slc6a3 mRNA expression, making estrogen an unlikely regulator during the pubertal shift. Leptin is critical for puberty and fertility. Here, overnourished prepubertal animals from SL showed increased level of Slc6a3 mRNA expression in PMv, correlated with individual’s body mass, although other factors, such as altered sex distribution in the mostly-females SL could also affect gene expression. Furthermore, the rescue of Slc6a3 mRNA levels observed in leptin-treated Lep ob animals suggests that leptin has an active role in increasing Slc6a3 gene expression during pubertal transition. Whether other hormones ( e.g. prolactin, oxytocin), different physiological states or social behaviors affect PMv Slc6a3 expression is unknown. Leptin regulation of dopaminergic neurotransmission in the midbrain (substantia nigra and ventral tegmental area) is involved in motivation for food rewards and locomotion ( 48 – 50 ). Leptin specifically regulates dopamine-related genes in these populations ( 51 ) and their action in the nucleus accumbens ( 52 ). It is important to note though that most studies investigating the role of PMv neurons have used DAT-Cre mice as a strategy to assess the PMv’s neuronal function and circuitry, not DAT expression and function. More studies are needed to reveal the role of dopamine-related genes in the PMv, but our findings suggest that Slc6a3 and its regulation by leptin have a role in pubertal maturation. DAT is mostly found in presynaptic terminals ( 53 ); so, this role might be relevant in PMv projection sites, perhaps regulating the neurotransmission of PMv neurons. The PMv DAT neurons project to a subset of brain sites innervated by the PMv Leprb population. The PMv Leprb population innervates VMHvl, and key neuronal populations in the control of reproduction, namely, GnRH neurons in the OVLT, MPA and medial septum areas, KNDy neurons in the Arc, and kisspeptin cells in the AVPV/PeN ( 16 , 18 , 54 ). As reported before, PMv DAT neurons project to the VMHvl and the supramammillary nucleus ( 25 , 26 ). In the MPA, we observed little density of axons. However, we observed a very dense collection of terminals in the AVPV/PeN. Differences with previous studies might arise from the use of a different protein marker (ChR2 vs . synaptophysin). Of the reproductive populations targeted by PMv Leprb neurons, the PMv DAT neurons seem to specifically target the kisspeptin population in the AVPV/PeN. These results show that the PMv DAT subpopulation target a group of neurons essential for pubertal development in females, supporting a function in puberty. In adults, AVPV/PeN kisspeptin neurons mediate the positive feedback action of estradiol on LH surge that precedes ovulation on the afternoon of proestrus ( 55 ). We recently showed that acute activation of the PMv Leprb population in females leads to LH release ( 20 ). However, chronic chemogenetic activation of PMv DAT cells had no effect on estrous cycles (present study). Alterations of the LH surge in proestrus have been observed in the absence of effects on estrous cycle progression ( 56 ). Therefore, we cannot discard any effects on the LH surge, which can be disrupted after PMv lesions in rats ( 4 , 57 ). The lack of direct PMv DAT projections to Arc KNDy or GnRH neurons, the dynamic changes in Slc6a3 expression and neuronal properties, the dense projections to the AVPV/PeN, and the AVPV/PeN’s intense chemical remodelling during puberty maturation, suggest that the PMv DAT population could undergo a functional switch during pubertal maturation. We hypothesize that the PMv DAT population could play an important role in the regulation of sexual maturation and later reproductive function, integrating the nutritional state from leptin signal into the AVPV/PeN. Similar to gene expression, the innervation of the AVPV/PeN from DAT Cre neurons was dynamically regulated during female puberty. In adult females DAT projections densely englobed TH neurons, a trait absent in prepubertal females. This timing probably reflects an increase in Slc6a3 -driven Cre expression and a delay to observe tdTomato - ir. The AVPV is a sexually dimorphic population, with higher cell abundance in the female ( 58 ). Similar to kisspeptin neurons, the TH population in the AVPV/PeN is sexually dimorphic, with more cells present in females ( 59 , 60 ). Notably, TH expression in the AVPV/PeN was much lower in prepubertal females than in the adults, a similar developmental time as kisspeptin appearance ( 61 ) and the increase of DAT terminals in the AVPV/PeN. This is significant because the AVPV/PeN region is one of the classical dopaminergic regions of the hypothalamus, also known as A15 area ( 62 ). The A15 TH neurons do not express DAT ( 46 , 63 , 64 ). Prototypical dopaminergic neurons ( i.e., in the midbrain), co-express TH and DAT, so that dopamine is recycled by DAT at the presynaptic terminal. The significance of our current finding is puzzling. However, a recent report provided evidence that DAT plays an integral role in managing the dopaminergic micro-circuitry within the ARH TIDA neurons ( 65 ), suggesting that PMv DAT could participate in the AVPV/PeN dopamine microcircuitry, potentially via expression of Aromatic l-aminoacid decarboxylase (AADC) ( 25 , 47 ). We therefore speculate that the presence of DAT at the PMv presynaptic terminal plays a role in regulating dopaminergic tone in the AVPV/PeN microcircuits and female reproductive function. In addition, PMv DAT neurons likely act on AVPV cells via glutamatergic signaling. AVPV TH neurons play a role in maternal behavior and intermale aggression ( 66 ). Whether the PMv DAT neurons’ action in the same social behaviors is associated with AVPV/PeN TH neuronal innervation has not been determined. Our present findings demonstrate that the role of PMv neurons in regulating reproductive physiology is more complex than previously anticipated. While overall PMv Leprb neurons play a significant role in female reproduction, particularly mediating leptin’s permissive effects in puberty ( 16 ), PMv DAT cells have been studied primarily in the context of social behavior and aggression ( 25 , 26 , 28 , 29 ). The dynamic changes observed in Slc6a3 gene expression during puberty and in response to nutrition, as well as the developmental difference in the innervation of kisspeptin/TH neurons of AVPV/PeN, suggest that the PMv DAT neurons also play a role in sexual maturation. Conflict of Interest All the authors declare no conflicts of interest. Author contributions CSM, CFE Conceived and designed the experiments. NB, JDJr, KWW, generated preliminary data. CSM, MAS, CNF, TTZ, CMS, LH, performed the experiments and acquired the data. CSM, MAS, CB, RF, CFE analyzed and interpreted the data. CSM wrote the manuscript. All authors were involved in revising and approving the manuscript Acknowledgements We thank Dr. Yun-Hee Choi for the design of the DAT riboprobe, and Susan Allen for expert technical assistance. This work was supported by the National Institutes of Health (R01-HD-069702 to CFE, CSM and NB, R21 HD109485 to CFE and CSM), Michigan Nutrition and Obesity Research Center (URM Pilot Grant P30 DK089503 to CSM) CNPq (Brazilian National Council for Scientific and Technological Development fellowship to BCB), the Knut and Alice Wallenberg Foundation (2020.0054) and the Swedish Research Council Distinguished Professorship Grant (2021-00671) to CB, the Coordenação de Aperfeiçoamento de Pessoal de Nível Superior – Brasil (CAPES) – Finance Code 001 (MAS) and by the São Paulo Research Foundation [FAPESP-Brazil, grants number: 13/07908-8 (RF), 15/20198-5 (TTZ) and the National Institutes of Health (R01 DK119169, R56 DK135501, and PO1 DK119130-03 to KWW). Footnotes Author list corrected, Figure 4 revised, manuscript adapted for journal submission. References 1. ↵ Cameron , J. L. , Weltzin , T. E. , McConaha , C. , Helmreich , D. L. , and Kaye , W. H . ( 1991 ) Slowing of pulsatile luteinizing hormone secretion in men after forty-eight hours of fasting . J. Clin. Endocrinol. Metab . 73 , 35 – 41 OpenUrl CrossRef PubMed Web of Science 2. ↵ Kennedy , G. and Mitra , J . ( 1963 ) Body weight and food intake as initiating factors for puberty in the rat . J. Physiol . 166 , 408 – 418 OpenUrl CrossRef PubMed Web of Science 3. ↵ Cagampang , F. , Maeda , K. , Yokoyama , A. , and Ota , K . ( 1990 ) Effect of food deprivation on the pulsatile LH release in the cycling and ovariectomized female rat . Horm. Metab. Res . 22 , 269 – 272 OpenUrl CrossRef PubMed Web of Science 4. ↵ Donato , J. , Silva , R. J. , Sita , L. V , Lee , S. , Lee , C. , Lacchini , S. , Bittencourt , J. C. , Franci , C. R. , Canteras , N. S. , and Elias , C. F . ( 2009 ) The ventral premammillary nucleus links fasting-induced changes in leptin levels and coordinated luteinizing hormone secretion . J. Neurosci . 29 , 5240 – 5250 OpenUrl Abstract / FREE Full Text 5. ↵ Biro , F. M. , Khoury , P. , and Morrison , J. A . ( 2006 ) Influence of obesity on timing of puberty . Int. J. Androl . 29 , 272 – 277 OpenUrl CrossRef PubMed Web of Science 6. Burt Solorzano , C. M. and McCartney , C. R. ( 2010 ) Obesity and the pubertal transition in girls and boys . Reproduction 140 , 399 – 410 OpenUrl Abstract / FREE Full Text 7. ↵ Mahany , E. B. , Han , X. , Borges , B. C. , Da Silveira Cruz-Machado , S. , Allen , S. J. , Garcia-Galiano , D. , Hoenerhoff , M. J. , Bellefontaine , N. H. , and Elias , C. F. ( 2018 ) Obesity and High-Fat Diet Induce Distinct Changes in Placental Gene Expression and Pregnancy Outcome . Endocrinology 159 , 1718 – 1733 OpenUrl CrossRef PubMed 8. ↵ Hill , J. W. and Elias , C. F . ( 2018 ) Neuroanatomical Framework of the Metabolic Control of Reproduction . Physiol. Rev . 98 , 2349 – 2380 OpenUrl CrossRef PubMed 9. ↵ Anderson , G. M. , Hill , J. W. , Kaiser , U. B. , Navarro , V. M. , Ong , K. K. , Perry , J. R. B. , Prevot , V. , Tena-Sempere , M. , and Elias , C. F . ( 2024 ) Metabolic control of puberty: 60 years in the footsteps of Kennedy and Mitra’s seminal work . Nat. Rev. Endocrinol . 20 , 111 – 123 OpenUrl CrossRef PubMed 10. ↵ Quennell , J. H. , Mulligan , A. C. , Tups , A. , Liu , X. , Phipps , S. J. , Kemp , C. J. , Herbison , A. E. , Grattan , D. R. , and Anderson , G. M . ( 2009 ) Leptin indirectly regulates gonadotropin-releasing hormone neuronal function . Endocrinology 150 , 2805 – 2812 OpenUrl CrossRef PubMed Web of Science 11. Ahima , R. S. , Prabakaran , D. , Mantzoros , C. , Qu , D. , Lowell , B. , Maratos-flier , E. , and Flier , J. S . ( 1996 ) Role of leptin in neuroendocrine response to fasting . Nature 382 , 250 – 252 OpenUrl CrossRef PubMed Web of Science 12. ↵ Ahima , R. S. , Dushay , J. , Flier , S. N. , Prabakaran , D. , and Flier , J. S . ( 1997 ) Leptin accelerates the onset of puberty in normal female mice . J. Clin. Invest . 99 , 391 – 395 OpenUrl CrossRef PubMed Web of Science 13. ↵ Farooqi , I. S. , Wangensteen , T. , Collins , S. , Kimber , W. , Matarese , G. , Keogh , J. M. , Lank , E. , Bottomley , B. , Lopez-Fernandez , J. , Ferraz-Amaro , I. , Dattani , M. T. , Ercan , O. , Myhre , A. G. , Retterstol , L. , Stanhope , R. , Edge , J. A. , Mckenzie , S. , Lessan , N. , Ghodsi , M. , De Rosa , V. , Perna , F. , Fontana , S. , Barroso , I. , Undlien , D. E. , and O’Rahilly , S . ( 2007 ) Clinical and Molecular Genetic Spectrum of Congenital Deficiency of the Leptin Receptor . N. Engl. J. Med . 356 , 237 – 247 OpenUrl CrossRef PubMed Web of Science 14. ↵ 14. De Luca , C. , Kowalski , T. J. , Zhang , Y. , Elmquist , J. K. , Lee , C. , Kilimann , M. W. , Ludwig , T. , Liu , S. M. , and Chua , S. C. ( 2005 ) Complete rescue of obesity, diabetes, and infertility in db/db mice by neuron-specific LEPR-B transgenes . J. Clin. Invest . 115 , 3484 – 3493 OpenUrl CrossRef PubMed Web of Science 15. ↵ Tartaglia , L. A. , Dembski , M. , Weng , X. , Deng , N. , Culpepper , J. , Devos , R. , Richards , G. J. , Campfield , L. A. , Clark , F. T. , Deeds , J. , Muir , C. , Sanker , S. , Moriarty , A. , Moore , K. J. , Smutko , J. S. , Mays , G. G. , Woolf , E. A. , Monroe , C. A. , and Tepper , R. I . ( 1995 ) Identification and expression cloning of a leptin receptor, OB-R . Cell 83 , 1263 – 71 OpenUrl CrossRef PubMed Web of Science 16. ↵ Donato , J. , Cravo , R. M. , Frazão , R. , Gautron , L. , Scott , M. M. , Lachey , J. , Castro , I. A. , Margatho , L. O. , Lee , S. , Lee , C. , Richardson , J. A. , Friedman , J. , Chua , S. , Coppari , R. , Zigman , J. M. , Elmquist , J. K. , and Elias , C. F . ( 2011 ) Leptin’s effect on puberty in mice is relayed by the ventral premammillary nucleus and does not require signaling in Kiss1 neurons . J. Clin. Invest . 121 , 355 – 368 OpenUrl CrossRef PubMed Web of Science 17. ↵ Scott , M. M. , Lachey , J. L. , Sternson , S. M. , Lee , C. E. , Elias , C. F. , Friedman , J. M. , and Elmquist , J. K . ( 2009 ) Leptin targets in the mouse brain . J. Comp. Neurol . 514 , 518 – 532 OpenUrl CrossRef PubMed Web of Science 18. ↵ Leshan , R. L. , Louis , G. W. , Jo , Y. H. , Rhodes , C. J. , Münzberg , H. , and Myers , M. G . ( 2009 ) Direct innervation of GnRH neurons by metabolic- and sexual odorant-sensing leptin receptor neurons in the hypothalamic ventral premammillary nucleus . J. Neurosci . 29 , 3138 – 3147 OpenUrl Abstract / FREE Full Text 19. ↵ Louis , G. W. , Greenwald-Yarnell , M. , Phillips , R. , Coolen , L. M. , Lehman , M. N. , and Myers , M. G . ( 2011 ) Molecular mapping of the neural pathways linking leptin to the neuroendocrine reproductive axis . Endocrinology 152 , 2302 – 2310 OpenUrl CrossRef PubMed Web of Science 20. ↵ Sáenz de Miera , C. , Bellefontaine , N. , Allen , S. J. , Myers , M. G. , and Elias , C. F. ( 2024 ) Glutamate neurotransmission from leptin receptor cells is required for typical puberty and reproductive function in female mice . Elife 13 , RP93204 OpenUrl CrossRef PubMed 21. ↵ Ross , R. A. , Leon , S. , Madara , J. C. , Schafer , D. , Fergani , C. , Maguire , C. A. , Verstegen , A. M. J. , Brengle , E. , Kong , D. , Herbison , A. E. , Kaiser , U. B. , Lowell , B. B. , and Navarro , V. M . ( 2018 ) PACAP neurons in the ventral premammillary nucleus regulate reproductive function in the female mouse . Elife 7 , e35960 OpenUrl CrossRef PubMed 22. ↵ Williams , K. W. , Sohn , J.-W. , Donato , J. , Lee , C. E. , Zhao , J. J. , Elmquist , J. K. , and Elias , C. F . ( 2011 ) The acute effects of leptin require PI3K signaling in the hypothalamic ventral premammillary nucleus . J. Neurosci . 31 , 13147 – 13156 OpenUrl Abstract / FREE Full Text 23. ↵ Boehm , U. , Zou , Z. , and Buck , L. B . ( 2005 ) Feedback loops link odor and pheromone signaling with reproduction . Cell 123 , 683 – 695 OpenUrl CrossRef PubMed Web of Science 24. ↵ Meister , B. and Elde , R . ( 1993 ) Dopamine transporter mRNA in neurons of the rat hypothalamus . Neuroendocrinology 58 , 388 – 395 OpenUrl CrossRef PubMed Web of Science 25. ↵ Soden , M. E. , Miller , S. M. , Burgeno , L. M. , Phillips , P. E. M. , Hnasko , T. S. , and Zweifel , L. S . ( 2016 ) Genetic Isolation of Hypothalamic Neurons that Regulate Context-Specific Male Social Behavior . Cell Rep . 16 , 304 – 313 OpenUrl CrossRef PubMed 26. ↵ Stagkourakis , S. , Spigolon , G. , Williams , P. , Protzmann , J. , Fisone , G. , and Broberger , C . ( 2018 ) A neural network for intermale aggression to establish social hierarchy . Nat. Neurosci . 21 , 834 – 842 OpenUrl CrossRef PubMed 27. ↵ Yip , S. H. , York , J. , Hyland , B. , Bunn , S. J. , and Grattan , D. R . ( 2018 ) Incomplete concordance of dopamine transporter Cre (DATIREScre)-mediated recombination and tyrosine hydroxylase immunoreactivity in the mouse forebrain . J. Chem. Neuroanat . 90 , 40 – 48 OpenUrl CrossRef PubMed 28. ↵ Chen , A.-X. , Yan , J.-J. , Zhang , W. , Wang , L. , Yu , Z.-X. , Ding , X.-J. , Wang , D.-Y. , Zhang , M. , Zhang , Y.-L. , Song , N. , Jiao , Z.-L. , Xu , C. , Zhu , S.-J. , and Xu , X.-H . ( 2020 ) Specific Hypothalamic Neurons Required for Sensing Conspecific Male Cues Relevant to Inter-male Aggression . Neuron 108 , 763 – 774 .e6 OpenUrl CrossRef PubMed 29. ↵ Stagkourakis , S. , Williams , P. , Spigolon , G. , Khanal , S. , Ziegler , K. , Heikkinen , L. , Fisone , G. , and Broberger , C. ( 2024 ) Maternal Aggression Driven by the Transient Mobilisation of a Dormant Hormone-Sensitive Circuit . bioRxiv , doi: 10.1101/2023.02.02.526862 OpenUrl Abstract / FREE Full Text 30. ↵ Bäckman , C. M. , Malik , N. , Zhang , Y. J. , Shan , L. , Grinberg , A. , Hoffer , B. J. , Westphal , H. , and Tomac , A. C . ( 2006 ) Characterization of a mouse strain expressing Cre recombinase from the 3′ untranslated region of the dopamine transporter locus . Genesis 44 , 383 – 390 OpenUrl CrossRef PubMed Web of Science 31. ↵ Ekstrand , M. I. , Terzioglu , M. , Galter , D. , Zhu , S. , Hofstetter , C. , Lindqvist , E. , Thams , S. , Bergstrand , A. , Hansson , F. S. , Trifunovic , A. , Hoffer , B. , Cullheim , S. , Mohammed , A. H. , Olson , L. , and Larsson , N. G . ( 2007 ) Progressive parkinsonism in mice with respiratory-chain-deficient dopamine neurons . Proc. Natl. Acad. Sci. U. S. A . 104 , 1325 – 1330 OpenUrl Abstract / FREE Full Text 32. ↵ Cravo , R. M. , Frazao , R. , Perello , M. , Osborne-Lawrence , S. , Williams , K. W. , Zigman , J. M. , Vianna , C. , and Elias , C. F . ( 2013 ) Leptin Signaling in Kiss1 Neurons Arises after Pubertal Development . PLoS One 8 , e58698 OpenUrl CrossRef PubMed 33. ↵ Donato , J. J. , Lee , C. , Ratra , D. , Franci , C. , Canteras , N. , and Elias , C . ( 2013 ) Lesions of the ventral premammillary nucleus disrupt the dynamic changes in kiss1 and gnrh expression characteristic of the proestrus – estrus transition . Neuroscience 241 , 67 – 79 OpenUrl CrossRef PubMed Web of Science 34. ↵ Krashes , M. J. , Roth , B. L. , Lowell , B. B. , Koda , S. , Ye , C. , Rogan , S. C. , Adams , A. C. , Cusher , D. S. , and Maratos-flier , E . ( 2011 ) Rapid, reversible activation of AgRP neurons drives feeding behavior in mice . J. Clin. Invest . 121 , 1424 – 1428 OpenUrl CrossRef PubMed Web of Science 35. ↵ Sáenz de Miera , C. , Feng , J. , Elias , C. F. , and Qi , N. ( 2023 ) Remote Neuronal Activation Coupled with Automated Blood Sampling to Induce and Measure Circulating Luteinizing Hormone in Mice . J. Vis. Exp . 198 , e65875 OpenUrl CrossRef 36. ↵ Han , X. , Burger , L. L. , Garcia-Galiano , D. , Sim , S. , Allen , S. J. , Olson , D. P. , Myers , M. G. , and Elias , C. F . ( 2020 ) Hypothalamic and Cell-Specific Transcriptomes Unravel a Dynamic Neuropil Remodeling in Leptin-Induced and Typical Pubertal Transition in Female Mice . iScience 23 , 101563 OpenUrl CrossRef PubMed 37. ↵ Ingalls , A. M. , Dickie , M. M. , and Snell , G. D . ( 1950 ) Obese, a new mutation in the house mouse . J. Hered . 41 , 315 – 317 OpenUrl CrossRef PubMed 38. ↵ Bohlen , T. M. , Silveira , M. A. , Zampieri , T. T. , Frazão , R. , and Donato , J . ( 2016 ) Fatness rather than leptin sensitivity determines the timing of puberty in female mice . Mol. Cell. Endocrinol . 423 , 11 – 21 OpenUrl CrossRef PubMed 39. ↵ Castellano , J. M. , Bentsen , A. H. , Sánchez-Garrido , M. A. , Ruiz-Pino , F. , Romero , M. , Garcia-Galiano , D. , Aguilar , E. , Pinilla , L. , Diéguez , C. , Mikkelsen , J. D. , and Tena-Sempere , M . ( 2011 ) Early metabolic programming of puberty onset: Impact of changes in postnatal feeding and rearing conditions on the timing of puberty and development of the hypothalamic kisspeptin system . Endocrinology 152 , 3396 – 3408 OpenUrl CrossRef PubMed Web of Science 40. ↵ Semaan , S. J. , Murray , E. K. , Poling , M. C. , Dhamija , S. , Forger , N. G. , and Kauffman , A. S . ( 2010 ) BAX-dependent and BAX-independent regulation of Kiss1 neuron development in mice . Endocrinology 151 , 5807 – 5817 OpenUrl CrossRef PubMed Web of Science 41. ↵ Clarkson , J. and Herbison , A. E . ( 2011 ) Dual Phenotype KisspeptinLDopamine Neurones of the Rostral Periventricular Area . J. Neuroendocrinol . 23 , 293 – 301 OpenUrl CrossRef PubMed Web of Science 42. ↵ Kumar , D. , Candlish , M. , Periasamy , V. , Avcu , N. , Mayer , C. , and Boehm , U . ( 2015 ) Specialized subpopulations of kisspeptin neurons communicate with gnrh neurons in female mice . Endocrinology 156 , 32 – 38 OpenUrl CrossRef PubMed 43. ↵ Stephens , S. B. , Rouse , M. L. , Tolson , K. P. , Liaw , R. B. , Parra , R. A. , Chahal , N. , and Kauffman , A. S . ( 2017 ) Effects of selective deletion of tyrosine hydroxylase from kisspeptin cells on puberty and reproduction in male and female mice . eNeuro 4 , e0150–17.2017 OpenUrl CrossRef 44. ↵ Clarkson , J. , Boon , W. C. , Simpson , E. R. , and Herbison , A. E . ( 2009 ) Postnatal development of an estradiol-kisspeptin positive feedback mechanism implicated in puberty onset . Endocrinology 150 , 3214 – 3220 OpenUrl CrossRef PubMed Web of Science 45. ↵ Silveira , M. A. , Zampieri , T. T. , Furigo , I. C. , Abdulkader , F. , Donato , J. , and Frazão , R . ( 2019 ) Acute effects of somatomammotropin hormones on neuronal components of the hypothalamic-pituitary-gonadal axis . Brain Res . 1714 , 210 – 217 OpenUrl CrossRef PubMed 46. ↵ Hoffman , B. J. , Hansson , S. R. , Mezey , É. , and Palkovits , M . ( 1998 ) Localization and dynamic regulation of biogenic amine transporters in the mammalian central nervous system . Front. Neuroendocrinol . 19 , 187 – 231 OpenUrl CrossRef PubMed Web of Science 47. ↵ Karasawa , N. , Arai , R. , Isomura , G. , Yamada , K. , Sakai , K. , Sakai , M. , Nagatsu , T. , and Nagatsu , I . ( 1994 ) Phenotypic changes of AADC-only immunopositive premammillary neurons in the brain of laboratory shrew Suncus murinus by systemic administration of monoamine precursors . Neurosci. Lett . 179 , 65 – 70 OpenUrl CrossRef PubMed 48. ↵ de Vriend , V. A. , van ’t Sant , L. J. , Rozeboom , A. , Luijendijk-berg , M. C. , Omrani , A. , and Adan , R. A. ( 2021 ) Leptin Receptor Expressing Neurons in the Substantia Nigra Regulate Locomotion, and in The Ventral Tegmental Area Motivation and Feeding . Front. Endocrinol . 12 , 680494 OpenUrl CrossRef 49. Opland , D. M. , Leinninger , G. M. , and Myers , M. G . ( 2010 ) Modulation of the mesolimbic dopamine system by leptin . Brain Res . 1350 , 65 – 70 OpenUrl CrossRef PubMed Web of Science 50. ↵ Xu , Y. , Lu , Y. , Xu , P. , Mangieri , L. R. , Isingrini , E. , Xu , Y. , Giros , B. , and Tong , Q . ( 2017 ) VMAT2-mediated neurotransmission from midbrain leptin receptor neurons in feeding regulation . eNeuro 4 , e0083–17.2017 OpenUrl CrossRef 51. ↵ Fulton , S. , Pissios , P. , Manchon , R. P. , Stiles , L. , Frank , L. , Pothos , E. N. , Maratos-Flier , E. , and Flier , J. S . ( 2006 ) Leptin Regulation of the Mesoaccumbens Dopamine Pathway . Neuron 51 , 811 – 822 OpenUrl CrossRef PubMed Web of Science 52. ↵ Perry , M. L. , Leinninger , G. M. , Chen , R. , Luderman , K. D. , Yang , H. , Gnegy , M. E. , Myers , M. G. , and Kennedy , R. T . ( 2010 ) Leptin promotes dopamine transporter and tyrosine hydroxylase activity in the nucleus accumbens of Sprague-Dawley rats . J. Neurochem . 114 , 666 – 674 OpenUrl CrossRef PubMed Web of Science 53. ↵ Amara , S. G. and Kuhar , M. J . ( 1993 ) Neurotransmitter Transporters: Recent progress . Annu. Rev. Neurosci . 16 , 73 – 93 OpenUrl CrossRef PubMed Web of Science 54. ↵ Merlino , D. J. , Barton , J. R. , Charsar , B. A. , Byrne , M. D. , Rappaport , J. A. , Smeyne , R. J. , Lepore , A. C. , Snook , A. E. , and Waldman , S. A . ( 2019 ) Two distinct GUCY2C circuits with PMV (hypothalamic) and SN/VTA (midbrain) origin . Brain Struct. Funct . 224 , 2983 – 2999 OpenUrl CrossRef PubMed 55. ↵ Wang , L. , Vanacker , C. , Burger , L. L. , Barnes , T. , Shah , Y. M. , Myers , M. G. , and Moenter , S. M . ( 2019 ) Genetic dissection of the different roles of hypothalamic kisspeptin neurons in regulating female reproduction . Elife 8 , e43999 OpenUrl CrossRef PubMed 56. ↵ Wagenmaker , E. R. and Moenter , S. M . ( 2017 ) Exposure to acute psychosocial stress disrupts the luteinizing hormone surge independent of estrous cycle alterations in female mice . Endocrinology 158 , 2593 – 2602 OpenUrl CrossRef PubMed 57. ↵ Beltramino , C. and Taleisnik , S . ( 1985 ) Ventral premammillary nuclei mediate pheromonal-induced LH release stimuli in the rat . Neuroendocrinology 41 , 119 – 124 OpenUrl CrossRef PubMed Web of Science 58. ↵ Bleier , R. , Byne , W. , and Siggelkow , I . ( 1982 ) Cytoarchitectonic sexual dimorphisms of the medial preoptic and anterior hypothalamic areas in guinea pig, rat, hamster, and mouse . J. Comp. Neurol . 212 , 118 – 130 OpenUrl CrossRef PubMed Web of Science 59. ↵ Simerly , R. B. , Swanson , L. W. , and Gorski , R. A . ( 1985 ) The distribution of monoaminergic cells and fibers in a periventricular preoptic nucleus involved in the control of gonadotropin release: Immunohistochemical evidence for a dopaminergic sexual dimorphism . Brain Res . 330 , 55 – 64 OpenUrl CrossRef PubMed Web of Science 60. ↵ Simerly , R. B. , Zee , M. C. , Pendleton , J. W. , Lubahn , D. B. , and Korach , K. S . ( 1997 ) Estrogen receptor-dependent sexual differentiation of dopaminergic neurons in the preoptic region of the mouse . Proc. Natl. Acad. Sci. U. S. A . 94 , 14077 – 14082 OpenUrl Abstract / FREE Full Text 61. ↵ Clarkson , J. and Herbison , A. E . ( 2006 ) Postnatal development of kisspeptin neurons in mouse hypothalamus; sexual dimorphism and projections to gonadotropin-releasing hormone neurons . Endocrinology 147 , 5817 – 5825 OpenUrl CrossRef PubMed Web of Science 62. ↵ Björklund , A. and Hökfelt , T ., eds. ( 1984 ) Handbook of Chemical Neuroanatomy. Vol 2: Classical Transmitters in the CNS. Part 1 . Elsevier Science Publishers B.V . 63. ↵ Lorang , D. , Amara , S. G. , and Simerly , R. B . ( 1994 ) Cell-type-specific expression of catecholamine transporters in the rat brain . J. Neurosci . 14 , 4903 – 4914 OpenUrl Abstract / FREE Full Text 64. ↵ Ciliax , B. J. , Drash , G. W. , Staley , J. K. , Haber , S. , Mobley , C. J. , Miller , G. W. , Mufson , E. J. , Mash , D. C. , and Levey , A. I . ( 1999 ) Immunocytochemical localization of the dopamine transporter in human brain . J. Comp. Neurol . 409 , 38 – 56 OpenUrl CrossRef PubMed Web of Science 65. ↵ Stagkourakis , S. , Kim , H. , Lyons , D. J. , and Broberger , C . ( 2016 ) Dopamine Autoreceptor Regulation of a Hypothalamic Dopaminergic Network . Cell Rep . 15 , 735 – 747 OpenUrl CrossRef PubMed 66. ↵ Scott , N. , Prigge , M. , Yizhar , O. , and Kimchi , T . ( 2015 ) A sexually dimorphic hypothalamic circuit controls maternal care and oxytocin secretion . Nature 525 , 519 – 522 OpenUrl CrossRef PubMed View the discussion thread. Back to top Previous Next Posted February 11, 2025. Download PDF Email Thank you for your interest in spreading the word about bioRxiv. NOTE: Your email address is requested solely to identify you as the sender of this article. Your Email * Your Name * Send To * Enter multiple addresses on separate lines or separate them with commas. You are going to email the following Nutritionally responsive PMv DAT neurons are dynamically regulated during pubertal transition Message Subject (Your Name) has forwarded a page to you from bioRxiv Message Body (Your Name) thought you would like to see this page from the bioRxiv website. Your Personal Message CAPTCHA This question is for testing whether or not you are a human visitor and to prevent automated spam submissions. Share Nutritionally responsive PMv DAT neurons are dynamically regulated during pubertal transition Cristina Sáenz de Miera , Nicole Bellefontaine , Marina A Silveira , Chelsea N Fortin , Thais T Zampieri , Jose Donato Jr , Kevin W Williams , Cristiano Mendes-da-Silva , Laura Heikkinen , Christian Broberger , Renata Frazao , Carol F Elias bioRxiv 2025.02.03.636271; doi: https://doi.org/10.1101/2025.02.03.636271 Share This Article: Copy Citation Tools Nutritionally responsive PMv DAT neurons are dynamically regulated during pubertal transition Cristina Sáenz de Miera , Nicole Bellefontaine , Marina A Silveira , Chelsea N Fortin , Thais T Zampieri , Jose Donato Jr , Kevin W Williams , Cristiano Mendes-da-Silva , Laura Heikkinen , Christian Broberger , Renata Frazao , Carol F Elias bioRxiv 2025.02.03.636271; doi: https://doi.org/10.1101/2025.02.03.636271 Citation Manager Formats BibTeX Bookends EasyBib EndNote (tagged) EndNote 8 (xml) Medlars Mendeley Papers RefWorks Tagged Ref Manager RIS Zotero Tweet Widget Facebook Like Google Plus One Subject Area Neuroscience Subject Areas All Articles Animal Behavior and Cognition (7622) Biochemistry (17648) Bioengineering (13871) Bioinformatics (41880) Biophysics (21423) Cancer Biology (18561) Cell Biology (25461) Clinical Trials (138) Developmental Biology (13364) Ecology (19866) Epidemiology (2067) Evolutionary Biology (24290) Genetics (15590) Genomics (22475) Immunology (17713) Microbiology (40328) Molecular Biology (17148) Neuroscience (88473) Paleontology (666) Pathology (2827) Pharmacology and Toxicology (4816) Physiology (7635) Plant Biology (15114) Scientific Communication and Education (2044) Synthetic Biology (4286) Systems Biology (9815) Zoology (2268)

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2025) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00
unpaywall
last seen: 2026-05-23T02:00:01.238055+00:00
License: CC-BY-NC-ND-4.0