Comparative molecular insights into selenium metabolism and nanoparticle biogenesis by Fructobacillus tropaeoli CRL2034 and Lactiplantibacillus plantarum CRL2051

Comparative molecular insights into selenium metabolism and nanoparticle biogenesis by Fructobacillus tropaeoli CRL2034 and Lactiplantibacillus plantarum CRL2051 | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Comparative molecular insights into selenium metabolism and nanoparticle biogenesis by Fructobacillus tropaeoli CRL2034 and Lactiplantibacillus plantarum CRL2051 Laura Crespo, Maria Victoria Tuttolomondo, Fernando Gabriel Martínez, and 2 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-9023036/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Lactic acid bacteria (LAB) produce selenium-nanoparticles (SeNPs). However, the molecular and genetic mechanisms involved in these biotransformation processes are not yet fully understood. This work aimed to physicochemically characterize the SeNPs produced by Fructobacillus tropaeoli CRL2034 and Lactiplantibacillus plantarum CRL2051, study the differential expression of genes related to SeNPs synthesis and to analyze the relative expression of genes and proteins of selenized and non-selenized cells (control). The SeNPs produced by F. tropaeoli CRL2034 and L. plantarum CRL2051 showed an average size of 216.05 ± 19 and 286.14 ± 44 nm and ζ of –59.42 ± 5 and –56.77 ± 7 mV, respectively. The SeNPs produced showed spectroscopic signals compatible with Se–Se bonds and functional groups that confirm a biological coating composed of proteins, polysaccharides, and lipids. These SeNPs showed a dual structure, amorphous and crystalline. F. tropaeoli CRL2034 glutathione reductases and thioredoxin reductase could be involved in Se metabolism and SeNPs synthesis, while in L. plantarum CRL2051 a different strategy for SeNPs synthesis could be implicated. Selenized cells of L. plantarum differentially expressed proteins related to fatty acid metabolism and overexpressed a lysozyme/muramidase, which could be related to membrane and cell wall adaptation to Se-induced stress. Selenized cells of both strains repressed energy metabolism-related enzymes, which could be harmful to cell survival. The SeNPs produced by both LAB strains have suitable characteristics to be used in nutrition and/or biomedicinal applications. Moreover, the selenized LAB strains could have improved stress resistance properties and/or better adhesion to intestinal cells. Biological Chemistry Applied & Industrial Microbiology Nanoscience selenium biotransformation lactic acid bacteria glutathione reductase proteomic analysis cell wall adaptation Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Introduction Selenium (Se) is an essential micronutrient with health-related properties, primarily due to its presence in antioxidant proteins, such as selenocysteine (SeCys). However, Se consumption in humans is often below the recommended daily intake (RDI), and Se supplementation has been recommended. An alternative is to use selenized lactic acid bacteria (LAB) to ferment foods or supplement foods with low-toxicity Se forms produced by them. In this respect, it has been reported that LAB can bio-transform Se salts into seleno- amino acids (SeMet and/or SeCys) and selenium nanoparticles (SeNPs) (Martínez et al. 2020 ). It has been reported that SeO₃²⁻ biotransformation can occur intra- or extra-cellularly (Wadhwani et al. 2016 ); the SeO₃²⁻ can enter the cell by ABC transporters, porins and membrane proteins (Staicu and Barton 2017 ; Yang et al. 2021 ; Qiao et al. 2023 ) and be reduced by redox enzymes such as thioredoxin reductase (TrxR) and glutathione reductase (GshR), which use electron donors as NADH, or reduced glutathione (GR) to produce selenide (Se 2− ), which can be used by selenocysteine lyase (SCL) to synthesize SeCys (Escobar et al. 2023). On the other hand, SeO₃²⁻ can oxidize GSH to form the unstable complex GS-Se-GS, which is decomposed to elemental Se (Se 0 ) to form SeNPs, which are stabilized by bacterial molecules such as proteins, lipids, nucleic acids, and/or polysaccharides (Nikam et al. 2022 ; Qiao et al. 2023 ), conferring them specific characteristics, which determine their colloidal stability and functional properties (Piacenza et al. 2018 ; Rodriguez-Loya et al. 2023 ). Biogenic SeNPs production is considered to be cost-effective and less toxic than those obtained chemically using reducing agents and stabilizing agents, thus having a higher biocompatibility (Piacenza et al. 2018 ; Shahbaz et al. 2022 ). These types of SeNPs are interesting candidates to be used in nutrition and biomedicine. Indeed, SeNPs have been used alongside with conventional anticancer treatments with promising effects (Puspitasari et al. 2014 ). Also, their effectiveness as antioxidants, for controlling blood sugar levels, and as antimicrobials has been demonstrated. However, SeNPs produced by different bacteria usually differ in their size and coating molecules and thus in their biological/ technological properties. On the other hand, selenized LAB have been reported to have a positive effect on metastatic cancer and to increase levels of INF- γ, TNF-α, and IL-2 and enhance natural killer cell activity in mouse breast cancer models (Yazdi et al. 2013 ). Moreover, Se-enriched Lactobacillus rhamnosus GG alleviated the symptoms of alcohol induced liver injury in mice (Yang et al. 2025 ). Furthermore, selenized LAB cells showed higher resistance to the conditions of food preservation (Martínez et al. 2024 ; Crespo et al. 2025 ). These results could be due to the presence of Se species, to the relative expression of antioxidant enzymes by the studied LAB, or to the membrane adhesion properties of the selenized cells, which are different from the non-selenized ones (Gómez-Gómez et al. 2019 ; Martínez et al. 2023 ). In previous works, we demonstrated that Lactiplantibacillus plantarum CRL2051 and Fructobacillus tropaeoli CRL2034 can reduce SeO₃²⁻ to Se⁰ and form SeNPs and produce SeCys (Martínez et al. 2020 ). However, these biogenic SeNPs were not characterized regarding their stability, charge, and coating molecules. On the other hand, although the activity of the enzymes possibly involved in SeO₃²⁻ reduction was studied, the relative expression of the genes coding for these enzymes during selenization was not determined. The aims of this work were to: 1. Characterize the SeNPs produced by the studied LAB strains, 2. Determine the relative expression of genes possibly involved in Se biotransformation after LAB growth in the presence of Na 2 SeO 3 and, 3. Analyze the relative protein and gene (related to Se metabolism) expression of selenized LAB cells grown in MRS to determine if selenized LAB continue to express antioxidant enzymes and/or proteins related to bacterial stress response and membrane hydrophobicity when not being exposed to the presence of Na 2 SeO 3 . This last objective could provide deeper insights into the selenized cells’ resistance to stress compared to non-selenized cells which could be related to LAB technological or health promoting properties. Materials and methods Bacterial culture conditions and selenization Active cultures of F. tropaeoli CRL2034 and L. plantarum CRL2051 belonging to the Culture Collection of the Centro de Referencia para Lactobacilos, Tucumán, Argentina, were grown in MRS (Laboratorios Britania S.A., Buenos Aires, Argentina) with added 2% v/v fructose (MRSf) and 10 mg/L of Na 2 SeO 3 (selenized cells) or without Se (non-señlenized cells) at 30°C for 24 h. Selenized and non-selenized cells of the studied LAB strains were incubated in MRSf at 30°C for 24 h. Cell growth was monitored spectrophotometrically at 600 nm and by plate cell counts (CFU/mL) to determine the exponential microbial growth phase, where the cells showed maximum differences in their growth rates. Detection of SeNPs by Transmission Electron Microscopy (TEM) Samples were prepared by placing a drop of the cell cultures onto a 300-mesh lacey carbon copper TEM grid. The film on the TEM grids was allowed to dry for 5 min at room temperature before analysis. Transmission electron micrographs were recorded using a high-resolution transmission electron microscope (JEM-2100, JEOL USA, CA, USA) equipped with an X-ray energy dispersive spectroscopy (XEDS) microanalysis composition system (Oxford Inc.). Analysis of SeNPs composition was carried out by XEDS microanalysis. SeNPs isolation and characterization Selenized cells were recovered by centrifugation (10000 x g , 5 min, 4°C), washed three times with sterile Milli-Q water, and cells were disrupted by using a Mini-bead Beater-8 (Biospec Products Inc., Bartlesville, OK, USA) in 5 cycles of 2 min with intermittent cooling on the ice bath. SeNPs were recovered by centrifugation (2000 x g , 2 min, 4°C), washed twice with Milli-Q water, and suspended in 1 mL of Milli-Q water for further analysis. Dynamic light scattering analysis was carried out at the Magnetic Resonance Laboratory facilities (LiZys, S.C. de Bariloche, Argentina). Analysis was performed according to the methodology described by Pescuma et al. ( 2023 ). SeNP samples were analyzed using a Zetasizer Nano ZS90 (Malvern Instruments Ltd., Malvern, UK) equipped with a 633 nm helium-neon laser source. SeNPs were diluted in Milli-Q water (10 µL in 2 mL) until a colorless solution was obtained, then stabilized for 30 min and analyzed at 25°C. Each sample was measured three times, using a 90° detection angle, over a size range between 0.4 and 1000 nm. Zeta potential measurements were performed using the data obtained for the hydrodynamic diameter using an electrolytic cuvette and applying a potential of 150 V. Fourier transform infrared spectroscopy (ATR-FTIR) on lyophilized SeNPs samples was analyzed without additional treatments by attenuated total reflectance using a Nicolet iS50 Advanced spectrometer (Thermo Scientific). ATR-FTIR spectra were recorded with a spectral resolution of 4 cm⁻¹, averaging 400 scans per sample, over a scanning range between 4000 and 500 cm⁻¹. Raman analysis was carried out using the specific Raman spectroscopy accessory of the Nicolet iS50 system (Thermo Scientific), equipped with a Nd:YAG laser with a wavelength of 1064 nm. The spectral resolution employed was 8 cm⁻¹, and the acquisition range spanned from 60 to 4000 cm⁻¹, with an average of 100 scans per sample. RNA Extraction and Real-Time quantitative PCR (RT-qPCR) analysis Total RNA was extracted from cell pellets of cells grown in the presence of Na 2 SeO 3 at 30°C for 24 h, and from selenized and non-selenized cells grown in fresh MRSf at 30°C for 6 h. The pellets were centrifuged (8000 x g at 4°C for 10 min), and washed 3 times with TE buffer (10 mM Tris-HCl, 1 mM EDTA, pH 8). RNA was extracted using the Nucleospin® RNA II kit (Macherey-Nagel GmbH and Co. KG, Düren, Germany) according to the manufacturer´s protocol, with the following modifications. Cell pellets were resuspended in 100 µL of TE buffer containing 2 mg/mL of lysozyme (Sigma-Alrich Chemical Co.). Residual DNA was removed using the DNase kit from the TURBO DNA-Free™ kit (Invitrogen, USA), and its absence was confirmed by conventional PCR. The concentration and purity of the purified RNA were determined using a NABI nano-spectrophotometer (MicroDigital Co., Korea). RNA integrity was assessed by 1% (w/v) agarose gel electrophoresis. Single-stranded cDNA synthesis was performed by reverse transcription in a DLAB TC1000-G gradient thermal cycler (DLAB Scientific Inc.), using 0.4 µg of purified RNA and the SuperScript® III First-Strand Synthesis System (Invitrogen, USA) according to the manufacturer's instructions. cDNA synthesis was confirmed by conventional PCR. RT-qPCR assays were performed on an iQ5 Multicolor Real-Time PCR Inspection System iCycler (Bio-Rad Laboratories Inc.) using previously obtained cDNA samples as template. Amplification products were detected using the SYBR Green fluorophore contained in the iQ SYBR® Green Supermix kit (Bio Rad Laboratories Inc.). Each reaction was performed in duplicate in a final volume of 20 µL containing 10 µL of iQ SYBR® Green Supermix 2X, 7 µL of a mix containing 1 µM of each primer, and 3 µL of 2 ng/µL cDNA. The conditions used were: 94°C for 5 min and 40 cycles of 94°C for 1 min, 50°C for 1 min, and 72°C for 30 s, followed by a melting curve (81 cycles of 60°C for 10 s) to rule out the formation of non-specific products. No template control (NTC) was performed. To interpret the results of relative expression of the genes of interest under the different conditions with respect to the normalizing gene, the 2 −ΔΔCT method (Schmittgen and Livak, 2008 ) was used, and the gene expression in non-selenized cells grown in MRSf was used as a calibrator condition (2 −ΔΔCt = 1). A value > 1 indicated higher expression compared to non-selenized cells, while a value < 1 reflects lower expression. The primers used for F. tropaeoli CRL2034 were designed using this strains genome (WNLV00000000.1), while for L. plantarum CRL2051, available sequences of this species in the NCBI (National Center for Biotechnology Information) database were used. Primers were designed using the bioinformatics tool PrimerQuest ( https://www.idtdna.com/PrimerQuest/Home/Index ) and verified in silico with OligoAnalyzer ( https://www.idtdna.com/calc/analyzer ) and ClustalOmega ( https://www.ebi.ac.uk/Tools/msa/clustalo/ ). All primer pairs were designed to obtain fragments between 100 and 150 bp and with similar Tm (melting temperature). The primers were synthesized by Genbiotech (Buenos Aires, Argentina). The primer sequences used are detailed in Table 1 . The specificity of each primer pair and the fragment sizes were verified by conventional PCR and agarose gel electrophoresis. Table 1 Primer sequences used for RT-qPCR analysis of probable selenium related metabolism genes expression in LAB cells Strain Gene Primer Sequence 5’-3’ Number of bases Protein L. plantarum CRL2051 gshR gshR-Fw CACACCAGCAGCCTACTTT 19 Glutathione reductase gshR-Rv GTGAAGACGACCGATGGAATTA 22 trxR trxR-Fw TGCTGATAAGGTCACGGTTATT 22 Thioredoxin reductase trxR-Rv GCTGTTCCAGACAAATTCCATC 22 16s ARNr 16s rRNA-Fw GTGGCGAACTGGTGAGTAA 19 16S rRNA 16s rRNA-Rv CATGCGGTCCAAGTTGTTATG 21 F. tropaeoli CRL2034 gshR (1) gshR_1-Fw CACGCAGAGGACATCATCAA 20 Glutathione reductase gshR_1-Rv GGTCGCCGATAGCAGAATAA 20 gshR (2) gshR_2-Fw CCCAATCGTCTATCCAGCTATTT 23 Glutathione reductase gshR_2-Rv AGGCTTCCGTGACTTCATAAC 21 scl scl-Fw ATCGCAGACAAAGAGGAAGAG 21 Selenocysteine lyase scl-Rv TGAACACCCGCTAGGTTAAAG 21 trx trx-Fw CTCACGGGCGGATTTAAAGA 20 Thioredoxin trx-Rv GGCCAAATCAGGACCCATAA 20 recA recA-Fw CGTGAGAAGGCCAAGGAATAC 21 RecA recA-Rv GGCTCGTCACCAATACCATAAG 22 Differential protein expression of selenized and non-selenized cells grown in MRSf Selenized and non-selenized cells of F. tropaeoli CRL2034 and L. plantarum CRL2051 were grown in MRSf at 30°C for 6 h (exponential growth phase). Cells were washed twice with 50 mM Tris-HCl, pH 7.5, and resuspended in the same buffer supplemented with 1 mM PMSF and 10 mM EDTA. Subsequently, they were lysed using a Mini-bead Beater-8 in 5 cycles of 2 min with intermittent cooling in an ice bath. Thirty micrograms of proteins were loaded onto a 10% (w/v) SDS-PAGE gel and stained with Bio-Safe™ Coomassie Stain (Bio-Rad Laboratories) after 1 cm of migration from the start of the resolving gel. The assay was performed in triplicate in three independent runs. The bands from the gels were cut and sent for analysis to the Center for Chemical and Biological Studies by Mass Spectrometry (CEQUIBIEM)-CONICET, University of Buenos Aires, Argentina ( http://cequibiem.qb.fcen.uba.ar/ ), and analyzed as described by Ontañon et al. ( 2021 ). The analysis was carried out using the Proteome Discoverer 2.2 search engine (Thermo Scientific) through SEQUEST HT, performing peptide-spectrum mapping (PSM) against the sequenced genome of F. tropaeoli CRL2034 available in GenBank (accession number WNLV00000000.1). For the proteomic studies of L. plantarum CRL2051, the available sequences of the L. plantarum WCFS1 strain (Taxon ID: 220668) were used as reference, since the sequenced genome of strain CRL2051 was not available. The search parameters used were as fixed modifications: cysteine carbamidomethylation (C) and as variable ones, methionine oxidation (M) and SeCys carbamidomethylation (C). Up to two non-specific cleavage sites were allowed; monoisotopic masses were used. The mass tolerance for the precursor was 10 ppm, and that for fragments 0.05 Da. MS2 spectra were analyzed with Proteome Discoverer 2.2 software (Thermo Scientific) using a 95% confidence interval threshold ( p < 0.05). Perseus software (Max Planck Institute of Biochemistry, version 1.6.6.0, freely available) was used for proteomic analysis. Since each treatment was performed in triplicate, proteins identified in at least two of the three replicates were included in this analysis. Scatter plots were performed to determine the correlation between replicates. Log2FC values (Student's t-test difference between the Log2 intensities of the samples) and –Log 10 p -values were used to generate volcano plots. Significant differential expression was defined as p ≤ 0.05 (-Log p ≥ 1.3) and Log2 ≥ 1.5 (values greater than 0.58 for upregulated proteins and less than − 0.58 for downregulated proteins). Functional analysis of the deregulated proteins was performed using the COG, KEGG, and STRING databases to identify their functional categories, metabolic pathways, and interaction networks, respectively. Statistical analysis All assays were performed in triplicate, and results of at least three measurements were expressed as mean ± standard deviation (SD). TEM images (at least tree) were obtained from three independent assays for each strain. Statistical analyses were conducted using one-way analysis of variance (ANOVA) followed by Tukey’s post hoc test, with the significance level set at p < 0.05. Analyses were performed using MINITAB 16 Statistical Software (Minitab, State College, PA, USA). Proteomic data were statistically analyzed using Perseus software (version 1.6.6.0), applying Student’s t-test and the significance thresholds described above. Results Detection of SeNPs in LAB grown in the presence of Se by TEM The TEM images showed the presence of spherical SeNPs in the cultures of L. plantarum CRL2051 and F. tropaeoli CRL2034. Elemental analysis by XEDS confirmed the presence of Se with the characteristic peaks SeLα (1.4 keV), SeKα (11.22 keV) and SeKβ (12.49 keV) (Fig. 1 a, b). Characterization of the SeNPs produced by LAB grown in the presence of Se The SeNPs produced by L. plantarum CRL2051 were analyzed by DLS at a detection angle of 90 °. The particle size with the highest relative contribution to the DLS (main peak) was 286.14 ± 44 nm, while the average hydrodynamic size (Z-average) reached 313.20 ± 6 nm (Fig. 2 a). The polydispersity index (PdI = 0.28 ± 0.04) indicated a moderately homogeneous size distribution, with a minor fraction of larger particles affecting the average value. The average ζ potential was − 56.77 ± 7 mV, reflecting high colloidal stability of the SeNPs. The FT-IR spectra of the SeNPs produced by L. plantarum CRL2051 and F. tropaeoli CRL2034 exhibited characteristic absorption bands at 400–500 cm⁻¹, attributed to Se–Se stretching vibrations, 1000–1200 cm⁻¹ corresponding to C–O stretching, and 1600–1700 cm⁻¹ associated with C = O stretching of carbonyl and amide groups. A broad band at 3200–3500 cm⁻¹ was assigned to O–H and N–H stretching, indicating the presence of hydroxyl and amide functional groups (Fig. 2 c-d). The Raman spectra showed a prominent peak around 250 cm⁻¹, corresponding to Se–Se stretching typical of amorphous Se (Table 2 ), and weaker bands between 143 and 176 cm⁻¹ attributed to lattice vibrations (Fig. 2 e, f). Additional features at 300–350 cm⁻¹ could be associated with Se–O stretching. Peaks around 1000–1200 cm⁻¹ (C–O, C–N), 1450 cm⁻¹ (CH₂, CH₃), and 1600–1650 cm⁻¹ (C = O) confirmed the presence of organic functional groups—mainly proteins, polysaccharides, and lipids—capping the nanoparticle surface (Table 2 ). Detailed vibrational band assignments and corresponding references are summarized in Supplementary Table 2. Table 2 FTIR and Raman vibrational band assignments of SeNPs produced by lactic acid bacteria strains Range (cm⁻¹) Technique Vibrational assignment Functional group / compound Evidence in spectra References 3400–3500 FTIR ν(O–H), ν(N–H) Residual water, proteins, polysaccharides Broad band clearly visible in both FTIR spectra Ashengroph and Hosseini ( 2021 ); Wang et al. ( 2023 ) 1650–1600 FTIR / Raman ν(C = O) (Amide I), ν(C = C) Proteins, lipids, carboxylic groups Strong, well-defined band in both strains Skuodaitė and Krylova ( 2023 ); Edwards ( 2006 ) 1450–1430 Raman δ(CH₂), δ(CH₃) Lipids, amino acids Clear peak in violet spectrum ( L. plantarum CRL2051) Edwards ( 2006 ) 1200–1000 FTIR / Raman ν(C–O), ν(C–N), ν(C–C) Polysaccharides, proteins Moderate peak in both spectra Ashengroph and Hosseini ( 2021 ); Piacenza et al. ( 2021 ) 500–400 FTIR ν(Se–Se) Se–Se bonds (core structure of nanoparticles) Weak but noticeable band (~ 470 cm⁻¹) Tugarova et al. ( 2018 ); Skuodaitė and Krylova ( 2023 ) 270–230 Raman ν(Se–Se) Se–Se bonds (amorphous/crystalline structure) Dominant peak (~ 250 cm⁻¹) Tugarova et al. ( 2018 ); Anderson et al. ( 2000 ) 350–300 Raman ν(Se–O) Surface interaction with oxygen Small shoulder, more evident in F. tropaeoli CRL2034 Anderson et al. ( 2000 ) 180–140 Raman Lattice vibration modes of Se or partial crystalline phases Indicator of local crystallinity Weak signal in F. tropaeoli CRL2034 Simakin et al. ( 2024 ) Differential gene expression of LAB cells grown in the presence of Se The relative expression of the genes possibly involved in Se metabolism were analyzed after 24 h incubation, in cells grown in MRSf in the presence of Se comparing with control ones (those grown in MRSf without adding Se). In L. plantarum CRL2051, the relative expression of the genes gshR and trxR , possibly involved in Se metabolism, was downregulated (0.35 ± 0.09) when the strain grew in MRSf supplemented with 10 mg/L of Se (as Na 2 SeO 3 ) compared to their expression in the control MRSf medium (0.50 ± 0.10) after 24 h incubation (Fig. 3 a). On the contrary, when F. tropaeoli was grown in the presence of Se, gshR(1) , gshR(2) and trx were up regulated (1.22 ± 0.14; 1.25 ± 0.18 and 1.14 ± 0.09, respectively), while no changes on the expression of scl was detected when this strain grew in the presence of Se respect to the control medium (Fig. 3 b). Differential gene and protein expression of LAB selenized and non-selenized cells grown in MRSf The selenized and non-selenized cells of the studied strains (grown in MRSf with or without Se, respectively as escribed above) were grown in MRSf to determine the time at which the cells were in their exponential growth phase and to establish the time were the differences in their growth were greater (Fig. 4 a, b). Differences in the growth of L. plantarum CRL2051 between selenized and non-selenized cells were observed at 4 h incubation, as non-selenized cells grew and reduced the pH of MRSf more than selenized cells (0.43 ± 0.04 ΔCFU/mL and 0.18 ± 0.01 ΔpH). Although no significant differences were observed in the growth and acidification of F. tropaeoli CRL2034 between selenized and non-selenized cells grown in MRSf, a tendency indicating better growth of selenized cells was observed at 6 hours of incubation. Thus, cells of both strains were harvested at the exponential growth phase (6 h incubation) for RNA and protein extraction. Selenized cells of L. plantarum CRL2051 differentially expressed 18 proteins with respect to the non-selenized cells (Table 3 ); these proteins were assigned by EggNOG to the categories COGC (energy production and maintenance), COGJ (genetic information and processing), and the overexpressed protein lysozyme/muramidase, which belonged to the COGM (cell membrane/wall/envelope biogenesis) (Fig. 5 a). Five of the nine downregulated proteins were grouped in the same cluster by STRING and corresponded to proteins related to fatty acid metabolism (Supplementary Fig. S1). Consistently with these results L. plantarum CRL2051 showed a 5% increase in membrane hydrophobicity when an increasing Se concentration was added to the culture medium (Figure S2). On the other hand, selenized cells of F. tropaeoli CRL2034 differentially expressed 11 proteins belonging to the COGC, COGJ, post-translational modifications, chaperones, and protein turnover (COGO), and unknown function (COGS) (Table 3 and Fig. 5 a). When the proteomic profiles of selenized and non-selenized cells of L. plantarum CRL2051 and F. tropaeoli CRL2034 (grown in MRSf, 30°C, 6 h) were analyzed, no differences in the expression of proteins related to Se metabolism were detected. However, when the selenized cells of L. plantarum CRL2051 were grown in MRSf (6 h), the relative expression of gshR was downregulated with respect to the expression of this gene in the non-selenized cells (0.29 ± 0.04 times), while no differences in the expression of trx was observed (Fig. 5 b). On the other hand, when selenized cells of F. tropaeoli CRL2034 were grown in MRSf, the expression of gshR (1), gshR (2), and scl were downregulated respect to these genes’ expression in the non-selenized cells (0.61 ± 0.09, 0.75 ± 0.15, 0.48 ± 0.01, respectively), while the expression of trx was up regulated (1.09 ± 0.02) in the selenized cells (Fig. 5 b). Table 3. Differentially expressed proteins in selenized LAB cells respect to non-selenized ones when grown in MRSf at 30°C during 6 h Strain Protein Name Accession Fold change COG Category Subcategory COG Description L. plantarum CRL2051 Lysozyme/muramidase, glycoside hydrolase family 25 F9USK7 2.08 Cellular processes and signaling M Cell wall/membrane/envelope biogenesis Transcription regulator, MarR family F9UNC5 1.52 Information storage and processing K Transcription Prophage P1 protein 2, mitogenic factor, cell surface lipoprotein F9UL89 1.59 Function unknown S Function unknown Alpha-acetolactate decarboxylase F9UPY7 1.66 Metabolism Q Secondary metabolites biosynthesis, transport, and catabolism Uncharacterized protein F9UT36 1.82 N/A N/A N/A Phosphate transport system permease protein PstA F9ULX5 1.95 Metabolism P Inorganic ion transport and metabolism Transcription regulator, GntR family F9USW7 1.88 Information storage and processing K Transcription 7,8-dihydroneopterin aldolase F9UTI7 2.49 Metabolism H Coenzyme transport and metabolism tRNA binding domain protein F9UNK1 3.16 Information storage and processing J Translation, ribosomal structure and biogenesis Enoyl-[acyl-carrier-protein] reductase [NADH] F9UP45 0.46 Metabolism I Lipid transport and metabolism 3-oxoacyl-[acyl-carrier-protein] synthase 2 F9UP39 0.59 Metabolism I Lipid transport and metabolism NADH dehydrogenase F9UTR7 0.66 Metabolism C Energy production and conversion Malonyl CoA-acyl carrier protein transacylase F9UP37 0.38 Metabolism I Lipid transport and metabolism Acetyl-CoA carboxytransferase F9UP44 0.26 Metabolism I Lipid transport and metabolism Aminopeptidase F9ULL7 0.67 Metabolism E Amino acid transport and metabolism Acetyl-CoA carboxylase, biotin carboxylase subunit F9UP42 0.23 Metabolism I Lipid transport and metabolism Citrate lyase alpha chain F9UMS0 0.56 Metabolism H Coenzyme transport and metabolism Pyruvate dehydrogenase E1 component subunit alpha F9UQ93 0.54 Metabolism C Energy production and conversion F. tropaeoli CRL2034 Hypothetical protein WP_148666526.1 5.86 N/A N/A N/A 3'-to-5' oligoribonuclease A WP_168778561.1 1.79 Function unknown S Function unknown DNA repair protein RadA WP_168778582.1 3.24 Cellular processes and signaling O Post-translational modification, protein turnover, and chaperones DNA-directed RNA polymerase alpha subunit WP_047975004.1 0.63 Information storage and processing K Transcription Phosphate acetyltransferase WP_168778506.1 0.59 Metabolism C Energy production and conversion Phenylalanyl-tRNA synthetase alpha chain WP_168779079.1 0.43 Information storage and processing J Translation, ribosomal structure and biogenesis Phenazine biosynthesis protein PhzF WP_206672724.1 0.66 Function unknown S Function unknown L-lactate dehydrogenase WP_168778839.1 0.60 Metabolism C Energy production and conversion ATP-binding cassette domain-containing protein WP_168778386.1 0.50 Function unknown S Function unknown DNA primase WP_168778471.1 0.30 Information storage and processing L Replication, recombination and repair Uncharacterized conserved protein WP_168777990.1 0.44 Information storage and processing L Replication, recombination and repair Discussion SeNPs possess antioxidant, antimicrobial, and anticancerogenic properties (Bisht et al. 2022 ; Marfetán et al. 2023 ; Satarzadeh et al. 2023 ). The synthesis of biogenic SeNPs using generally accepted as safe (GRAS) microorganisms is a sustainable strategy for producing biocompatible NPs for biomedical and/or food production applications (Tatari et al. 2026 ). The studied LAB strains L. plantarum CRL2051 and F. tropaeoli CRL2034 were able to produce SeNPs with a hydrodynamic diameter of 286.14 ± 44 nm and 216.05 ± 19 nm, respectively. Similar results were observed for Lactobacillus reuteri CRL 1101, which produced SeNPs of a hydrodynamic diameter of 258 ± 4 nm as determined by DLS (Moreno-Martin et al. 2017). The size of NPs determines their biodistribution, and it is generally accepted that small-sized NPs (< 50 nm) have the highest biological effect (Ajdary et al. 2018 ). However, Li et al. ( 2024 ) observed that polyvinyl pyrrolidone-modified SeNPs with a hydrodynamic diameter of 278.4 ± 124.8 nm could be intraperitoneally administered in rats at doses of 320 µg/kg with an efficient biodistribution and without damaging the kidney tissues and showing good excretion and no accumulation. Moreover, Luo et al. ( 2024 ) reported that CD44-targeting hyaluronic acid-SeNPs with an approximate diameter of 250 nm showed a positive effect on spinal cord injury recovery. The polydispersity index (PDI) is a characteristic of the SeNPs that gives information about their heterogeneity. In this work, the SeNPs synthesized by L. plantarum CRL2051 showed PDI values ​​of 0.28 ± 0.04, indicating that the sample was heterogeneous but with good consistency between measurements. Meanwhile, the SeNPs produced by F. tropaeoli CRL2034 showed a PDI of 0.52 ± 0.15, suggesting a high heterogeneity in the particle size distribution. The heterogeneity observed could be considered a limitation, since a broad size distribution is often associated with variability in the physicochemical and biological properties of NPs, especially in applications where size uniformity is critical (Aminisough et al. 2024 ). Indeed, microbial SeNPs can be influenced by multiple biological variables that determine their size and stability (Spyridopoulou et al. 2021 ). The superficial charge measured as ζ potential is an important characteristic that determines SeNPs’ stability. This charge is influenced by coating agents, such as proteins, polysaccharides, and lipids, produced by microorganisms during the SeNPs synthesis. For NPs to be stable, the ζ potential must be close to absolute values greater than 30 mV. Ideally, for good or excellent stability, the charge should be between 40 mV and 60 mV (Kamble et al. 2022 ). The SeNPs synthesized by L. plantarum CRL2051 and F. tropaeoli CRL2034 exhibited ζ potentials of -56.77 mV and − 59.41 mV, respectively, indicating that these SeNPs have an excellent colloidal stability, significantly higher than those previously reported for SeNPs produced by other LAB. In this respect, Rao and Poonia ( 2024 ) observed ζ potential values between − 27.9 mV and − 23.1 mV for SeNPs produced by Lactobacillus delbrueckii subsp. bulgaricus , L. rhamnosus , and Streptococcus thermophilus , and a mixed culture of these strains. Similarly, Aminisough et al. ( 2024 ) observed that SeNPs produced by a cell-free supernatant of L. fermentum had a ζ potential of -32.2 mV. It is important to note that a larger particle size does not always result in a high surface charge and does not necessarily correlate with a poor size distribution. Indeed, the SeNPs produced by Pediococcus acidilactici DSM20284, had a hydrodynamic size of 239.6 nm, a charge of − 26.9 mV, but at the same time a PDI of only 0.096, indicating a relatively uniform size distribution (Wang et al. 2023 ). The results observed in this work indicate that the high PDI observed for the SeNPs produced by L. plantarum CRL2051 and F. tropaeoli CRL2034 is not due to agglomeration of the synthesized SeNPs (since they have a high ζ potential) but to the production of highly heterogeneous SeNPs. The spectroscopic analysis of SeNPs are consistent with recent studies reporting the coexistence of amorphous and crystalline Se phases in biogenic SeNPs (Simakin et al. 2024 ; Li et al. 2024 ; Luo et al. 2024 ; Wen et al. 2025 ). In this work, the higher intensity of the Se–Se Raman band observed in F. tropaeoli CRL2034 suggests a greater degree of structural ordering compared to that of L. plantarum CRL2051. This dual structural nature may arise from distinct biosynthetic mechanisms: protein-rich capping layers in L. plantarum favor the formation of amorphous Se, while polysaccharide-dominated coatings in F. tropaeoli promote nucleation and partial crystallization. Such biochemical differences indicate that the molecular composition of the capping biomolecules governs not only the structural organization of SeNPs but also their physicochemical stability and potential bioactivity. The presence of bands associated with C–O, C–N, C = O, O–H, N–H and CH₂/CH₃ bonds in the FT-IR and Raman spectra suggests that the SeNPs synthesized by both strains are coated by a complex organic matrix composed of biomolecules such as polysaccharides, proteins, and lipids. The formation of a natural protective layer is a key advantage of biogenic synthesis. This "natural coating" distinguishes biogenic NPs from those synthesized by physical or chemical methods, which often lack this intrinsic stability or require additional coating agents (Wang et al. 2023 ). The biological coating provides electrostatic repulsive interactions, which help prevent SeNP aggregation (Nikam et al. 2022 ). Moreover, several authors have shown that when chemically synthesized SeNPs are stabilized with polysaccharides or peptides, their resistance to the acidic conditions of the gastrointestinal tract in vitro is significantly improved (Zhang et al. 2022 ; Zeng et al. 2023 ; Wen et al. 2025 ). The presence of SeNPs produced by the studied strains in this work, but in a fermented beverage with orange-mango juice and milk, and in a mango passion fruit juice after their submission to the in vitro gastrointestinal tract, suggested their resistance to harsh environmental conditions (Martínez et al. 2019 ; Crespo et al., 2025 ). Indeed, the SeNPs produced by the studied strains exhibit a high degree of colloidal stability probably due to their coating with biological macromolecules enhancing their performance in complex physiological environments. The SeNPs showed dual Se nature (amorphous and crystalline), with a versatile functional profile which can be applied in multiple technological applications expanding their potential application in biomedicine (biocompatibility), food, and other areas of nanotechnology. Although the SeNPs produced by the studied strains showed promising characteristics; in order to produce them in an efficient and scalable manner, it is necessary to know the metabolic pathways involved in their synthesis. Thus, in this work, we analyzed the relative expression of genes probably involved in selenite reduction to SeNPs and/or seleno-amino acids. Unexpectedly, we observed that in L. plantarum CRL2051, the expression of gsh and trx was downregulated when grown in the presence of Se although the glutathione reductase (Gsh) activity was increased two-fold when this strain was grown in the presence of Se (Martínez et al. 2020 ). Our results demonstrate that the increase in the enzymatic activity does not correlate with an increased gene transcription. The higher activity of Gsh could be due to structural modifications in the enzyme, such as the incorporation of SeCys, which is produced by this strain. In this regard, Galano et al. ( 2013 ) reported that in a Lactobacillus reuteri strain, certain enzymes involved in Se metabolism exhibited specific incorporation of SeCys into the active site when cells grew in the presence of this metalloid. On the other hand, no differences in the expression of trx was observed, suggesting the involvement of a different pathway for SeNPs synthesis. In this regard, Qiao et al ( 2023 ) suggested that the nitrate reductase enzyme was involved in the reduction of selenite to Se 0 in L. casei ATCC 393, as they observed that the addition of potassium nitrate (nitrate reductase enzyme activator) increased the rate of selenite reduction, while the addition of an inhibitor of this enzyme significantly decreased its reduction. In F. tropaeoli CRL2034, overexpression of the gshR genes could indicate that the cell is actively requiring this protein in the presence of Se. In this strain, contrary to what was observed in L. plantarum CRL2051, GshR activity decreased threefold when F. tropaeoli CRL2034 was previously grown in the presence of Se (Martínez et al. 2020 ). Therefore, if this enzyme is involved in Se reduction and its activity is lower when grown in the presence of this metalloid, it is possible that F. tropaeoli CRL2034 induced its overexpression. The thioredoxin system is composed of thioredoxin reductase (TrxR), thioredoxin (Trx), and NADPH. This system, present in many bacteria, participates in various redox reactions, where Trx reduces oxidized substrates or compounds, and the oxidized Trx is regenerated by the action of TrxR, which utilizes NADPH in the process (Shimizu et al. 2021 ). Although TrxR has been linked to selenite reduction in F. tropaeoli CRL2034, a moderate increase in trx expression was observed in this work (Martínez et al. 2020 ). On the other hand, although the presence of SeCys was detected in the protein extract of F. tropaeoli CRL2034, the expression of scl was not modified when this strain was grown in the presence of selenite. When the selenized cells of L. plantarum CRL2051 and F. tropaeoli CRL2034 were grown in MRSf, the relative expression of the genes coding for Gsh was downregulated with respect to the expression of this gene in the non-selenized cells. Moreover, in F. tropaeoli CRL2034, the expression of trx and scl , which were overexpressed when the cells were grown in the presence of selenite, was downregulated in the selenized cells with respect to the non-selenized ones. This fact could be due to the absence of selenite in the culture medium were the selenized cells were grown and to the synthesis of SeNPs (during selenization) reducing the Se toxicity as it is known that bacteria produce SeNPs as a detoxifying mechanism. The effect of selenization on the relative protein and gene expression of the LAB strains was studied to determine if the properties of the selenized cells remained, even when selenite was no longer present in the culture medium, which could be the case when selenized cells are used for food fermentation and/or as probiotics (capsules, suspensions). Changes in the protein expression could affect cell stress resistance and/or the expression of antioxidant enzymes or those related to cell hydrophobicity, which could have a positive effect on the host health. The proteomic analysis of L. plantarum CRL2051 showed the downregulation of proteins related to fatty acid metabolism, which could be related to the cellular response to the presence of Se species. Consistently, Wang et al. ( 2024 ) suggested that changes in the relative content of membrane lipids could protect the cells from Se-induced stress or could prevent the attachment of SeNPs to the cell membranes. On the other hand, Yang et al. ( 2021 ) observed that Levillactobacillus brevis JLD715 differentially expressed genes related to fatty acid metabolism in response to selenite. The repression of proteins related to the modulation of lipid metabolism could constitute a key mechanism of cellular response, possibly linked to membrane adaptation to oxidative stress induced by Se during selenization. Consistently, with these results, an increase in the membrane hydrophobicity of selenized cells of L. plantarum CRL2051 was observed, which would improve the interaction between the LAB cells and those of the host, enhancing the LAB ability to exert health-beneficial effects. Furthermore, L. plantarum CRL2051 overexpressed a lysozyme/muramidase (lp_3093) protein, which can hydrolyze peptidoglycan in Gram-positive bacteria, inducing peptidoglycan remodeling during growth and/or in response to stress. This enzyme is carefully regulated to maintain cellular integrity, and its activity can generate peptidoglycan fragments that act as signaling molecules to activate genes involved in cell wall repair and maintenance (Vermassen et al. 2019 ). The selenized cells of L. plantarum CRL2051 over-expressed the transcriptional regulator GntR (lp_0152), which is commonly upregulated in response to oxidative stress. This protein belongs to a group involved in the regulation of sugar, fatty acids, and amino acids metabolism (Capdevila et al. 2024 ). Thus, its expression could be related to the repression of proteins related to the synthesis of fatty acid metabolism. On the other hand, the repression of the alpha subunit of the E1 component of the pyruvate dehydrogenase complex (PdhA) and the alpha subunit of citrate lyase (CitF) (both enzymes that converge in the generation of acetyl-CoA) could represent a metabolic strategy to redirect carbon flow toward alternative routes. Moreover, alpha-acetolactate decarboxylase (AldB) was overexpressed. This enzyme catalyzes the formation of acetoin and 2,3-butanediol from pyruvate. Acetoin is a neutral compound from a fermentative perspective due to its low contribution to medium acidification. This metabolic shift would not only help to reduce the accumulation of acidic metabolites but could also facilitate the regeneration of NAD⁺ from NADH. This process could be beneficial for the cell, since NAD⁺ is essential for maintaining redox balance. Furthermore, the regenerated NAD⁺ could participate in antioxidant mechanisms, helping the cell cope with redox stress induced by the presence of Se. Selenized cells of L. plantarum CRL2051 also overexpressed a permease of the phosphate transport system (PstC); phosphate transport can be affected by the presence of SeO₃²⁻, since this anion competes with phosphate for the same transporters (Zhu et al. 2020 ). Therefore, it could be inferred that this permease could have been involved in the incorporation/release of selenite into the cell. The proteomic analysis of the selenized cells of F. tropaeoli CRL2034 showed that the alpha subunit of RNA polymerase and the alpha chain of phenylalanyl-tRNA synthetase were up-regulated with respect to their expression by non-selenized cells. Both proteins are involved in transcription and translation, suggesting a general decrease in biosynthetic activity. Furthermore, the repression of energy metabolism enzymes such as phosphate acetyltransferase and L-lactate dehydrogenase indicates a metabolic adaptation. On the other hand, repressed proteins linked to the initiation of DNA replication, such as DNA primase, were observed in selenized cells, suggesting a possible cell cycle arrest to prioritize genetic repair. Moreover, repression of the phenazine biosynthesis protein (PhzF), was observed. Phenazines constitute a family of more than 150 bacterial secondary metabolites with redox properties, which give them broad-spectrum antibiotic activity (Diederich et al. 2017 ). The redox activity of phenazines can generate reactive oxygen species (ROS), contributing to intracellular oxidative stress. In this sense, the repression of PhzF could be interpreted as a self-protective strategy against an already oxidizing environment due to the presence of Se species. Declarations Author Contributions All authors contributed to the study conception and design. Material preparation, data collection and analysis were performed by Laura Crespo, María Victoria Tuttolomondo and Fernando Martínez. The first draft of the manuscript was written by Laura Crespo and all authors commented on previous versions of the manuscript. All authors read and approved the final manuscript. Funding This work was supported by grants PIP 2021-0691 from CONICET and PICT 2019-0037 from FONCyT, Argentina Data availability The mass spectrometry data have been deposited to the Proteome Xchange Consortium via the PRIDE (Perez-Riverol et al. 2025) partner repository with the dataset identifier PXD074180 submitted on February 7, 2026 Competing interest The authors declare no competing interest. References Ajdary M, Moosavi M A, Rahmati M, Falahati M, Mahboubi M, Mandegary A, Jangjoo S, Mohammadinejad R, Varma RS (2018) Health concerns of various nanoparticles: A review of their in vitro and in vivo toxicity. Nanomaterials (Basel). 8:634. https://doi.org/10.3390/nano8090634 Aminisough, SA, Daneshjou S, Khajeh K (2024) Biosynthesis, characterization, and investigation of cytotoxic activities of selenium nanoparticles utilizing Limosilactobacillus fermentum . Green Process Synth 13:20240030. https://doi.org/10.1515/gps-2024-0030 Anderson A, Sanders A, Smith W (2000) Raman spectra of selenium dioxide at low temperatures. J Raman Spectrosc 31(5):403-406. https://doi.org/10.1002/10974555(200005)31:5%3C403::AIDJRS529%3E3.0.CO;2-K Ashengroph M, Hosseini SR (2021) A newly isolated Bacillus amyloliquefaciens SRB04 for the synthesis of selenium nanoparticles with potential antibacterial properties. Int Microbiol 24:103-114. https://doi.org/10.1007/s10123-020-00147-9 Bisht N, Phalswal P, Khanna, PK (2022) Selenium nanoparticles: A review on synthesis and biomedical applications. Mater Adv 3(3):1415-1431. https://doi.org/10.1039/D1MA00639H Capdevila D, Rondón JJ, Edmonds KA, Rocchio JS, Dujovne MV, Giedroc DPJCR, (2024) Bacterial metallostasis: metal sensing, metalloproteome remodeling, and metal trafficking. Chem Rev 124(24):13574-13659. https://doi.org/10.1021/acs.chemrev.4c00264 Crespo L, Della Fontana FD, Sede Lucena B, Lotufo Haddad AM, Goldner MC, Mozzi F, Pescuma M (2025) Microbial selenization as a strategy to deliver selenium and selenium nanoparticles in mango-passion fruit juice fermented by indigenous lactic acid bacteria. Curr Microbiol 82(7):318. https://doi.org/10.1007/s00284-025-04255-5 Diederich C, Leypold M, Culka M, Weber H, Breinbauer R, Ullmann G M, Blankenfeldt W, (2017) Mechanisms and specificity of phenazine biosynthesis protein PhzF. Sci Rep 7(1):6272. https://doi.org/10.1038/s41598-017-06278-w Edwards HGM (2006) Spectra-structure correlations in Raman spectroscopy. HVS 3:1838-1871. https://doi.org/10.1002/0470027320.s4103 Escobar-Ramírez MC, Rodríguez-Serrano GM, Zúñiga-León E, García-Montes MA, Pérez-Escalante E, González-Olivares LG (2023) Selenocysteine formation by Enterococcus faecium ABMC-05 follows a mechanism that is not dependent on genes sel A and sel D but on gene cys K. Fermentation 9(7):684. https://doi.org/10.3390/fermentation9070684 Galano E, Mangiapane E, Bianga J, Palmese A, Pessione E, Szpunar J, Lobinski R, Amoresano A (2013) Privileged incorporation of selenium as selenocysteine in Lactobacillus reuteri proteins demonstrated by selenium-specific imaging and proteomics. Mol Cell Proteomics 12:2196-2204. https://doi.org/10.1074/mcp.M113.027607 Gómez-Gómez, B, Pérez-Corona T, Mozzi F, Pescuma M, Madrid Y (2019) Silac-based quantitative proteomic analysis of Lactobacillus reuteri CRL 1101 response to the presence of selenite and selenium nanoparticles. J Proteomics 195:53-65. https://doi.org/10.1016/j.jprot.2018.12.025 Kamble S, Agrawal S, Cherumukkil S, Sharma V, Jasra RV, Munshi P (2022) Revisiting zeta potential, the key feature of interfacial phenomena, with applications and recent advancements. ChemistrySelect 7(1):e202103084. https://doi.org/10.1002/slct.202103084 Li W, Lu X, Jiang L, Wang X (2024) Biosafety and pharmacokinetic characteristics of polyethylene pyrrolidone modified nano selenium in rats. BMC Biotechnol 24(1):98. https://doi.org/10.1186/s12896-024-00915-9 Luo W, Li,Y, Zhao J, Niu R, Xiang C, Zhang M, Xiao C, Liu W, Gu R (2024) CD44-targeting hyaluronic acid-selenium nanoparticles boost functional recovery following spinal cord injury. J Nanobiotechnol 22(1):37. https://doi.org/10.1186/s12951-024-02302-0 Marfetán JA, Gallo AL, Farias ME, Vélez ML, Pescuma M, Ordoñez OF (2023) Exiguobacterium sp. as a bioinoculant for plant-growth promotion and Selenium biofortification strategies in horticultural plants. World J Microbiol Biotechnol 39(5):134. https://doi.org/10.1007/s11274-023-03571-x Martínez FG, Cuencas Barrientos ME, Mozzi F, Pescuma M (2019) Survival of selenium-enriched lactic acid bacteria in a fermented drink under storage and simulated gastrointestinal digestion. Food Res Int 123:115-124. https://doi.org/10.1016/j.foodres.2019.04.057 Martínez FG, Martin-Moreno G, Pescuma M, Madrid-Albarran Y, Mozzi F (2020) Biotransformation of selenium by lactic acid bacteria: Formation of seleno- nanoparticles and seleno-amino acids. Front Bioeng Biotechnol 8:506. https://doi.org/10.3389/fbioe.2020.00506 Martínez FG, Moreno-Martin G, Mozzi F, Madrid Albarrán Y, Pescuma M (2023) Selenium stress response of the fruit origin strain Fructobacillus tropaeoli CRL 2034. Appl Microbiol Biotechnol 107(4):1329-1339. https://doi.org/10.1007/s00253-023-12379-6 Martínez FG, Moreno-Martín G, Mohamed F, Pescuma M, Madrid Albarrán Y, Mozzi F (2024) Selenium-enriched fermented beverage with improved sensorial properties using lactic acid bacteria. J Food Sci Technol 61(11):2133-2144. https://doi.org/10.1007/s13197-024-05984-4 Moreno-Martín G, Pescuma M, Pérez-Corona T, Mozzi, F, Madrid Y, (2017) Determination of size and mass-and number-based concentration of biogenic SeNPs synthesized by lactic acid bacteria by using a multimethod approach. Anal Chim Acta 992:34-41. https://doi.org/10.1016/j.aca.2017.09.033 Nikam PB, Salunkhe JD, Minkina T, Rajput VD, Kim BS, Patil SV (2022) A review on green synthesis and recent applications of red nano Selenium. Results Chem 4:100581. https://doi.org/10.1016/j.rechem.2022.100581 Ontañon OM, Bedő S, Ghio S, Garrido MM, Topalian J, Jahola D, Fehér A, Valacco MP, Campos El, Fehér C (2021) Optimization of xylanases production by two Cellulomonas strains and their use for biomass deconstruction. Appl Microbiol Biotechnol 105(11):4577-4588. https://doi.org/10.1007/s00253-021-11305-y Pescuma M, Aparicio F, Zysler RD, Lima E, Zapata C, Marfetán JA, Vélez ML, Ordoñez OF (2023) Biogenic selenium nanoparticles with antifungal activity against the wood-rotting fungus Oligoporus pelliculosus . Biotechnol Reports 37:e00787. https://doi.org/10.1016/j.btre.2023.e00787 Pescuma M, Gómez-Gómez B, Perez-Corona T, Madrid Y, Mozzi F (2017) Food prospects of selenium enriched Lactobacillus acidophilus CRL 636 and Lactobacillus reuteri CRL 1101. J Funct Foods 35:466-473. https://doi.org/10.1016/j.jff.2017.06.009 Perez-Riverol Y, Bandla C, Kundu DJ, Kamatchinathan S, Bai J, Hewapathirana S, John NS, Prakash A, Walzer M, Wang S, Vizcaíno JA (2025) The PRIDE database at 20 years: 2025 update. Nucleic Acids Res 53:543-553. https://doi.org/10.1093/nar/gkae1011 Piacenza E, Presentato A, Turner RJ (2018) Stability of biogenic metal (loid) nanomaterials related to the colloidal stabilization theory of chemical nanostructures. Crit Rev Biotechnol 38(8):1137-1156. https://doi.org/10.1080/07388551.2018.1440525 Piacenza E, Presentato, A, Ferrante F, Cavallaro G, Alduina R, Chillura Martino, DF (2021) Biogenic selenium nanoparticles: a fine characterization to unveil their thermodynamic stability. Nanomaterials 11(5):1195. https://doi.org/10.3390/nano11051195 Puspitasari IM, Abdulah R, Yamazaki C, Kameo S, Nakano T, Koyama H (2014) Updates on clinical studies of selenium supplementation in radiotherapy. Radiat Oncol 9(1):125. https://doi.org/10.1186/1748-717X-9-125 Qiao L, Dou X, Song X, Chang J, Zeng X, Zhu L, Xu C (2023) Selenite bioremediation by food-grade probiotic Lactobacillus casei ATCC 393: insights from proteomics analysis. Microbiol Spectr 11(3):e00659-00623. https://doi.org/10.1128/spectrum.00659-23 Rao V, Poonia, A (2024) Microbial biosynthesis of selenium nanoparticles using probiotic strain and its characterization. Food Measure. 18(7):5477-5488. https://doi.org/10.1007/s11694-024-02581-z Rodriguez-Loya J, Lerma M, Gardea-Torresdey JL (2023) Dynamic light scattering and its application to control nanoparticle aggregation in colloidal systems: a review. Micromachines 15(1):24. https://doi.org/10.3390/mi15010024 Satarzadeh N, Sadeghi Dousari A, Amirheidari B, Shakibaie M, Ramezani Sarbandi A, Forootanfar H (2023) An insight into biofabrication of selenium nanostructures and their biomedical application. 3 Biotech 13(3):79. https://doi.org/10.1007/s13205-023-03476-4 Schmittgen TD, Livak KJ (2008) Analyzing real-time PCR data by the comparative CT method. Nat Protoc 3(6):1101-1108. https://doi.org/10.1038/nprot.2008.73 Shahbaz M, Akram A, Raja NI, Mukhtar T, Mashwani ZUR, Mehak A, Fatima N, Sarwar S, Haq EU, Yousaf T (2022) Green synthesis and characterization of selenium nanoparticles and its application in plant disease management: a review. Pak J Phytopathol 34(1):189-202. http://dx.doi.org/10.33866/phytopathol.034.01.0739 Shimizu A, Tobe R, Aono R, Inoue M, Hagita S, Kiriyama K, Toyotake Y, Ogawa T, Kurihara T, Goto K, Prakash NT, Mihara H (2021) Initial step of selenite reduction via thioredoxin for bacterial selenoprotein biosynthesis. Int J Mol Sci 22(20):10965. https://doi.org/10.3390/ijms222010965 Simakin AV, Baimler IV, Dikovskaya AO, Kazantseva DV, Yanykin DV, Voronov VV, Uvarov OV, Astashev ME, Sarimov RM, Ivanov VE, Bruskov VI, Kozlov VA, (2024) Laser fragmentation of amorphous and crystalline selenium of various morphologies and assessment of their antioxidant and protection properties. Front Chem 12:1459477. https://doi.org/10.3389/fchem.2024.1459477 Skuodaitė E, Krylova V (2023) Synthesis and characterization of amorphous selenium, cadmium and silver selenide thin films on polyamide-6. Coatings 13(10):1661. https://doi.org/10.3390/coatings13101661 Spyridopoulou K, Tryfonopoulou E, Aindelis G, Ypsilantis P, Sarafidis C, Kalogirou O, Chlichlia K (2021) Biogenic selenium nanoparticles produced by Lactobacillus casei ATCC 393 inhibit colon cancer cell growth in vitro and in vivo . Nanoscale Adv 3(9):2516-2528. https://doi.org/10.1039/d0na00984a Staicu LC, Barton LL (2017) Bacterial Metabolism of Selenium—For Survival or Profit. In: van Hullebusch, E. (eds) Bioremediation of Selenium Contaminated Wastewater. Springer, Cham. https://doi.org/10.1007/978-3-319-57831-6_1 Tatari A, Salimi F, Aghazadeh S, Amini S (2026) Flower-shaped ZnO nanoparticles from Lactococcus lactis LAB2: potential selective anti-cancer activity via oxidative stress modulation. World J Microbiol Biotechnol 42:43. https://doi.org/10.1007/s11274-025-04691-2 Tugarova AV, Mamchenkova PV, Dyatlova YA, Kamnev AA (2018) FTIR and Raman spectroscopic studies of selenium nanoparticles synthesised by the bacterium Azospirillum thiophilum . Spectrochim. Acta A Mol Biomol Spectrosc 192:458-463. https://doi.org/10.1016/j.saa.2017.11.050 Vermassen A, Leroy S, Talon R, Provot C, Popowska M, Desvaux M (2019) Cell wall hydrolases in bacteria: insight on the diversity of cell wall amidases, glycosidases and peptidases toward peptidoglycan. Front Microbiol 10:331. https://doi.org/10.3389/fmicb.2019.00331 Wadhwani SA, Shedbalkar UU, Singh R, Chopade BA (2016) Biogenic selenium nanoparticles: Current status and future prospects. Appl Microbiol Biotechnol 100(6):2555-2566. https://doi.org/10.1007/s00253-016-7300-7 Wang L, Ju J, Xie H, Qiao F, Luo Q, Zhou L (2024) Comparative study on growth and metabolomic profiles of six Lactobacilli strains by sodium selenite. Microorganisms 12(10):1937. https://doi.org/10.3390/microorganisms12101937 Wang Q, Wang C, Kuang S, Wang D, Shi Y (2023) Biological selenite reduction, characterization and bioactivities of selenium nanoparticles biosynthesised by Pediococcus acidilactici DSM20284. Molecules 28(9):3793. https://doi.org/10.3390/molecules28093793 Wen C, Tang J, Liu D, Fan M, Lin X, Liu G, Liang L, Liu X, Zhang J, Li Y, Duan Y, Xu X (2025) Selenium release during the simulated gastrointestinal digestion and antioxidant activity of selenium nanoparticles stabilized by Grifola frondosa polysaccharides and gallic acid conjugates. Int J Biol Macromol 144620. https://doi.org/10.1016/j.ijbiomac.2025.144620 Yang X, Dai X, Jin H, Lin G, Wang Z, Song Y, Zhang W, Man C, Jiang Y (2021) Physicochemical and transcriptomic responses of Lactobacillus brevis JLD715 to sodium selenite. J Sci Food Agric 101(10):4332-4341. https://doi.org/10.1002/jsfa.11073 Yang Z, Lian J, Yang Y, Li J, Guo W, Lv X, Ni L, Chen Y (2025) Selenium enrichment enhances the alleviating effect of Lactobacillus rhamnosus GG on alcoholic liver injury in mice. Curr Res Food Sci 10:100964. https://doi.org/10.1016/j.crfs.2024.100964 Yazdi MH, Mahdavi M, Setayesh N, Esfandyar M, Shahverdi AR (2013) Selenium nanoparticle-enriched Lactobacillus brevis causes more efficient immune responses in vivo and reduces the liver metastasis in metastatic form of mouse breast cancer. DARU 21(1):33. https://doi.org/10.1186/2008-2231-21-33 Zeng L, Peng Q, Li Q, Bi Y, Kong F, Wang Z, Tan S (2023) Synthesis, characterization, biological activity, and in vitro digestion of selenium nanoparticles stabilized by Antarctic ice microalgae polypeptide. Bioorg Chem 141:106884. https://doi.org/10.1016/j.bioorg.2023.106884 Zhang J, Yang X, Ji T, Wen C, Ye Z, Liu X, Liang L, Liu G, Xu X (2022) Digestion and absorption properties of Lycium barbarum polysaccharides stabilized selenium nanoparticles. Food Chem 373:131637. https://doi.org/10.1016/j.foodchem.2021.131637 Zhu TT, Tian LJ, Yu HQ (2020) Phosphate-suppressed selenite biotransformation by Escherichia coli . Environ Sci Technol 54(17):10713-10721. https://doi.org/10.1021/acs.est.0c02175 Additional Declarations The authors declare no competing interests. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-9023036","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":600173059,"identity":"8e7f5ff0-a709-466a-9df6-35e5dc78e3ca","order_by":0,"name":"Laura Crespo","email":"","orcid":"","institution":"CERELA-CONICET","correspondingAuthor":false,"prefix":"","firstName":"Laura","middleName":"","lastName":"Crespo","suffix":""},{"id":600173060,"identity":"4db235fb-9d51-43c4-b7a5-dd8636557d5f","order_by":1,"name":"Maria Victoria Tuttolomondo","email":"","orcid":"https://orcid.org/0000-0003-3083-2919","institution":"Universidad de Buenos Aires","correspondingAuthor":false,"prefix":"","firstName":"Maria","middleName":"Victoria","lastName":"Tuttolomondo","suffix":""},{"id":600173061,"identity":"635273d6-cd46-4aab-abe4-fda15483db97","order_by":2,"name":"Fernando Gabriel Martínez","email":"","orcid":"https://orcid.org/0000-0001-5174-2125","institution":"CERELA-CONICET","correspondingAuthor":false,"prefix":"","firstName":"Fernando","middleName":"Gabriel","lastName":"Martínez","suffix":""},{"id":600173062,"identity":"7c682d91-8494-4589-9cc9-050da0e8ac42","order_by":3,"name":"Fernanda Mozzi","email":"","orcid":"https://orcid.org/0000-0002-2661-7661","institution":"CERELA-CONICET","correspondingAuthor":false,"prefix":"","firstName":"Fernanda","middleName":"","lastName":"Mozzi","suffix":""},{"id":600173063,"identity":"12c55fe7-6606-41ce-b851-5350b65b9993","order_by":4,"name":"Micaela Pescuma","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAsUlEQVRIiWNgGAWjYPACGyBmbDxAipY0kJYGkrQcBpPEadGd3Xz4w8+283Zr2w8DbamxiSaoxezOsTTJ3rbbydvOJAK1HEvLbSCo5UaOGTMjUIvZAaAWxobDxGjJ//yZse1cstn5h0RryWGQZmw7YGd2g2hb7hwzk+w5l5xgdgNoSwJRfrnd/PjDjzI7e7Pz6Q8ffKixIayFQQJCJYJVJhBUjqTFnijFo2AUjIJRMDIBANekSb29WPhpAAAAAElFTkSuQmCC","orcid":"https://orcid.org/0000-0003-2119-6455","institution":"CIEFAP-CONICET","correspondingAuthor":true,"prefix":"","firstName":"Micaela","middleName":"","lastName":"Pescuma","suffix":""}],"badges":[],"createdAt":"2026-03-03 18:27:18","currentVersionCode":1,"declarations":{"humanSubjects":false,"vertebrateSubjects":false,"conflictsOfInterestStatement":false,"humanSubjectEthicalGuidelines":false,"humanSubjectConsent":false,"humanSubjectClinicalTrial":false,"humanSubjectCaseReport":false,"vertebrateSubjectEthicalGuidelines":false},"doi":"10.21203/rs.3.rs-9023036/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-9023036/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":103983433,"identity":"a39269d0-1f06-4d0f-b40c-13d07a1da9fe","added_by":"auto","created_at":"2026-03-05 09:57:22","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":309944,"visible":true,"origin":"","legend":"\u003cp\u003eTEM images and XEDS analysis for samples of the LAB strains grown in MRSf with Se, a) \u003cem\u003eL. plantarum\u003c/em\u003e CRL2051, and b) \u003cem\u003eF. tropaeoli\u003c/em\u003e CRL2034. The arrows show the presence of SeNPs.\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-9023036/v1/06effd466036b55bc7d7c14e.png"},{"id":103983368,"identity":"48d356fb-7c88-40bf-b1bd-c759634b4646","added_by":"auto","created_at":"2026-03-05 09:57:13","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":256912,"visible":true,"origin":"","legend":"\u003cp\u003eCharacterization of the SeNPs produced by \u003cem\u003eL. plantarum\u003c/em\u003e CRL2051 and \u003cem\u003eF. tropaeoli\u003c/em\u003eCRL2034. a-b) Dynamic light scattering (DLS), c-d) Fourier Transform Infrared (FTIR), e-f) Raman spectroscopy. a, c, and e correspond to the analysis of SeNPs produced by \u003cem\u003eL. plantarum\u003c/em\u003e CRL2051, and b, d, and f to the analysis of SeNPs produced by \u003cem\u003eF. tropaeoli\u003c/em\u003e CRL2034.\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-9023036/v1/4f9db1e59250d51645c292e9.png"},{"id":103983455,"identity":"dcb7b229-e196-4911-b1b3-da50cc8bb250","added_by":"auto","created_at":"2026-03-05 09:57:25","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":71848,"visible":true,"origin":"","legend":"\u003cp\u003eqPCR results showing the relative expression of the genes potentially involved in Se metabolism. a) \u003cem\u003eL. plantarum\u003c/em\u003e CRL2051 and b) \u003cem\u003eF. tropaeoli\u003c/em\u003e CRL2034.\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-9023036/v1/5cadafdcfa72497f6e732b2d.png"},{"id":103983353,"identity":"e85add17-a366-4fe5-9ba6-6235300a50ee","added_by":"auto","created_at":"2026-03-05 09:57:03","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":185652,"visible":true,"origin":"","legend":"\u003cp\u003eGrowth (DO\u003csub\u003e600\u003c/sub\u003e and cfu/ml) and pH during growth of selenized and non-selenized LAB cells in MRSf at 30 °C for 24 h. a) \u003cem\u003eL. plantarum\u003c/em\u003e CRL2051 and b) \u003cem\u003eF. tropaeoli\u003c/em\u003e CRL2034.\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-9023036/v1/3bb61842346a659e6f9fb127.png"},{"id":103983372,"identity":"889e4228-7d19-4d0f-89fa-5d051768251e","added_by":"auto","created_at":"2026-03-05 09:57:15","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":227260,"visible":true,"origin":"","legend":"\u003cp\u003eProteins and genes relative expression in selenized LAB cells a) COG classification of differentially expressed proteins in selenized cells with respect to non-selenized of \u003cem\u003eL. plantarum\u003c/em\u003e CRL2051 (solid bars) and \u003cem\u003eF. tropaeoli\u003c/em\u003eCRL2034 (striped bars) grown in MRSf at 30°C for 6 h. The color code represents the category to which each protein differentially expressed COG belongs. Differential expression of proteins (volcano plot) and genes of selenized cells (stripes bars) compared to non-selenized cells (solid bars) of \u003cem\u003eL. plantarum\u003c/em\u003eCRL2051 b) and \u003cem\u003eF. tropaeoli\u003c/em\u003e CRL2034 C), grown in MRSf. Colors in the volcano plot correspond to the analyzed genes: \u003cem\u003etrx\u003c/em\u003eR (violet), \u003cem\u003egsh\u003c/em\u003eR (light blue or yellow), \u003cem\u003etrx\u003c/em\u003e (green) and \u003cem\u003escl\u003c/em\u003e (orange). Different letters indicate significant differences between selenized and non-selenized gene expression (\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05).\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-9023036/v1/77fe49350b1e99c60867ba5b.png"},{"id":104402095,"identity":"188e55f7-ae3d-47f6-8acd-dc2d17642cab","added_by":"auto","created_at":"2026-03-11 12:14:16","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2146405,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-9023036/v1/7ba9a347-9c34-495d-92ce-bb1ee61729b0.pdf"}],"financialInterests":"The authors declare no competing interests.","formattedTitle":"\u003cp\u003e\u003cstrong\u003eComparative molecular insights into selenium metabolism and nanoparticle biogenesis by \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eFructobacillus tropaeoli\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e CRL2034 and \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eLactiplantibacillus plantarum\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e CRL2051\u003c/strong\u003e\u003c/p\u003e","fulltext":[{"header":"Introduction","content":"\u003cp\u003eSelenium (Se) is an essential micronutrient with health-related properties, primarily due to its presence in antioxidant proteins, such as selenocysteine (SeCys). However, Se consumption in humans is often below the recommended daily intake (RDI), and Se supplementation has been recommended. An alternative is to use selenized lactic acid bacteria (LAB) to ferment foods or supplement foods with low-toxicity Se forms produced by them. In this respect, it has been reported that LAB can bio-transform Se salts into seleno- amino acids (SeMet and/or SeCys) and selenium nanoparticles (SeNPs) (Mart\u0026iacute;nez et al. \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). It has been reported that SeO₃\u0026sup2;⁻ biotransformation can occur intra- or extra-cellularly (Wadhwani et al. \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e2016\u003c/span\u003e); the SeO₃\u0026sup2;⁻ can enter the cell by ABC transporters, porins and membrane proteins (Staicu and Barton \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e2017\u003c/span\u003e; Yang et al. \u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Qiao et al. \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2023\u003c/span\u003e) and be reduced by redox enzymes such as thioredoxin reductase (TrxR) and glutathione reductase (GshR), which use electron donors as NADH, or reduced glutathione (GR) to produce selenide (Se\u003csup\u003e2\u0026minus;\u003c/sup\u003e), which can be used by selenocysteine lyase (SCL) to synthesize SeCys (Escobar et al. 2023). On the other hand, SeO₃\u0026sup2;⁻ can oxidize GSH to form the unstable complex GS-Se-GS, which is decomposed to elemental Se (Se\u003csup\u003e0\u003c/sup\u003e) to form SeNPs, which are stabilized by bacterial molecules such as proteins, lipids, nucleic acids, and/or polysaccharides (Nikam et al. \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2022\u003c/span\u003e; Qiao et al. \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2023\u003c/span\u003e), conferring them specific characteristics, which determine their colloidal stability and functional properties (Piacenza et al. \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; Rodriguez-Loya et al. \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). Biogenic SeNPs production is considered to be cost-effective and less toxic than those obtained chemically using reducing agents and stabilizing agents, thus having a higher biocompatibility (Piacenza et al. \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; Shahbaz et al. \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). These types of SeNPs are interesting candidates to be used in nutrition and biomedicine. Indeed, SeNPs have been used alongside with conventional anticancer treatments with promising effects (Puspitasari et al. \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). Also, their effectiveness as antioxidants, for controlling blood sugar levels, and as antimicrobials has been demonstrated. However, SeNPs produced by different bacteria usually differ in their size and coating molecules and thus in their biological/ technological properties.\u003c/p\u003e \u003cp\u003eOn the other hand, selenized LAB have been reported to have a positive effect on metastatic cancer and to increase levels of INF- γ, TNF-α, and IL-2 and enhance natural killer cell activity in mouse breast cancer models (Yazdi et al. \u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). Moreover, Se-enriched \u003cem\u003eLactobacillus rhamnosus\u003c/em\u003e GG alleviated the symptoms of alcohol induced liver injury in mice (Yang et al. \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e2025\u003c/span\u003e). Furthermore, selenized LAB cells showed higher resistance to the conditions of food preservation (Mart\u0026iacute;nez et al. \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2024\u003c/span\u003e; Crespo et al. \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2025\u003c/span\u003e). These results could be due to the presence of Se species, to the relative expression of antioxidant enzymes by the studied LAB, or to the membrane adhesion properties of the selenized cells, which are different from the non-selenized ones (G\u0026oacute;mez-G\u0026oacute;mez et al. \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Mart\u0026iacute;nez et al. \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). In previous works, we demonstrated that \u003cem\u003eLactiplantibacillus plantarum\u003c/em\u003e CRL2051 and \u003cem\u003eFructobacillus tropaeoli\u003c/em\u003e CRL2034 can reduce SeO₃\u0026sup2;⁻ to Se⁰ and form SeNPs and produce SeCys (Mart\u0026iacute;nez et al. \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). However, these biogenic SeNPs were not characterized regarding their stability, charge, and coating molecules. On the other hand, although the activity of the enzymes possibly involved in SeO₃\u0026sup2;⁻ reduction was studied, the relative expression of the genes coding for these enzymes during selenization was not determined. The aims of this work were to: 1. Characterize the SeNPs produced by the studied LAB strains, 2. Determine the relative expression of genes possibly involved in Se biotransformation after LAB growth in the presence of Na\u003csub\u003e2\u003c/sub\u003eSeO\u003csub\u003e3\u003c/sub\u003e and, 3. Analyze the relative protein and gene (related to Se metabolism) expression of selenized LAB cells grown in MRS to determine if selenized LAB continue to express antioxidant enzymes and/or proteins related to bacterial stress response and membrane hydrophobicity when not being exposed to the presence of Na\u003csub\u003e2\u003c/sub\u003eSeO\u003csub\u003e3\u003c/sub\u003e. This last objective could provide deeper insights into the selenized cells\u0026rsquo; resistance to stress compared to non-selenized cells which could be related to LAB technological or health promoting properties.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eBacterial culture conditions and selenization\u003c/h2\u003e \u003cp\u003eActive cultures of \u003cem\u003eF. tropaeoli\u003c/em\u003e CRL2034 and \u003cem\u003eL. plantarum\u003c/em\u003e CRL2051 belonging to the Culture Collection of the Centro de Referencia para Lactobacilos, Tucum\u0026aacute;n, Argentina, were grown in MRS (Laboratorios Britania S.A., Buenos Aires, Argentina) with added 2% v/v fructose (MRSf) and 10 mg/L of Na\u003csub\u003e2\u003c/sub\u003eSeO\u003csub\u003e3\u003c/sub\u003e (selenized cells) or without Se (non-se\u0026ntilde;lenized cells) at 30\u0026deg;C for 24 h. Selenized and non-selenized cells of the studied LAB strains were incubated in MRSf at 30\u0026deg;C for 24 h. Cell growth was monitored spectrophotometrically at 600 nm and by plate cell counts (CFU/mL) to determine the exponential microbial growth phase, where the cells showed maximum differences in their growth rates.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eDetection of SeNPs by Transmission Electron Microscopy (TEM)\u003c/h3\u003e\n\u003cp\u003eSamples were prepared by placing a drop of the cell cultures onto a 300-mesh lacey carbon copper TEM grid. The film on the TEM grids was allowed to dry for 5 min at room temperature before analysis. Transmission electron micrographs were recorded using a high-resolution transmission electron microscope (JEM-2100, JEOL USA, CA, USA) equipped with an X-ray energy dispersive spectroscopy (XEDS) microanalysis composition system (Oxford Inc.). Analysis of SeNPs composition was carried out by XEDS microanalysis.\u003c/p\u003e\n\u003ch3\u003eSeNPs isolation and characterization\u003c/h3\u003e\n\u003cp\u003eSelenized cells were recovered by centrifugation (10000 x \u003cem\u003eg\u003c/em\u003e, 5 min, 4\u0026deg;C), washed three times with sterile Milli-Q water, and cells were disrupted by using a Mini-bead Beater-8 (Biospec Products Inc., Bartlesville, OK, USA) in 5 cycles of 2 min with intermittent cooling on the ice bath. SeNPs were recovered by centrifugation (2000 x \u003cem\u003eg\u003c/em\u003e, 2 min, 4\u0026deg;C), washed twice with Milli-Q water, and suspended in 1 mL of Milli-Q water for further analysis.\u003c/p\u003e \u003cp\u003eDynamic light scattering analysis was carried out at the Magnetic Resonance Laboratory facilities (LiZys, S.C. de Bariloche, Argentina). Analysis was performed according to the methodology described by Pescuma et al. (\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). SeNP samples were analyzed using a Zetasizer Nano ZS90 (Malvern Instruments Ltd., Malvern, UK) equipped with a 633 nm helium-neon laser source. SeNPs were diluted in Milli-Q water (10 \u0026micro;L in 2 mL) until a colorless solution was obtained, then stabilized for 30 min and analyzed at 25\u0026deg;C. Each sample was measured three times, using a 90\u0026deg; detection angle, over a size range between 0.4 and 1000 nm. Zeta potential measurements were performed using the data obtained for the hydrodynamic diameter using an electrolytic cuvette and applying a potential of 150 V.\u003c/p\u003e \u003cp\u003eFourier transform infrared spectroscopy (ATR-FTIR) on lyophilized SeNPs samples was analyzed without additional treatments by attenuated total reflectance using a Nicolet iS50 Advanced spectrometer (Thermo Scientific). ATR-FTIR spectra were recorded with a spectral resolution of 4 cm⁻\u0026sup1;, averaging 400 scans per sample, over a scanning range between 4000 and 500 cm⁻\u0026sup1;. Raman analysis was carried out using the specific Raman spectroscopy accessory of the Nicolet iS50 system (Thermo Scientific), equipped with a Nd:YAG laser with a wavelength of 1064 nm. The spectral resolution employed was 8 cm⁻\u0026sup1;, and the acquisition range spanned from 60 to 4000 cm⁻\u0026sup1;, with an average of 100 scans per sample.\u003c/p\u003e\n\u003ch3\u003eRNA Extraction and Real-Time quantitative PCR (RT-qPCR) analysis\u003c/h3\u003e\n\u003cp\u003eTotal RNA was extracted from cell pellets of cells grown in the presence of Na\u003csub\u003e2\u003c/sub\u003eSeO\u003csub\u003e3\u003c/sub\u003e at 30\u0026deg;C for 24 h, and from selenized and non-selenized cells grown in fresh MRSf at 30\u0026deg;C for 6 h. The pellets were centrifuged (8000 x \u003cem\u003eg\u003c/em\u003e at 4\u0026deg;C for 10 min), and washed 3 times with TE buffer (10 mM Tris-HCl, 1 mM EDTA, pH 8). RNA was extracted using the Nucleospin\u0026reg; RNA II kit (Macherey-Nagel GmbH and Co. KG, D\u0026uuml;ren, Germany) according to the manufacturer\u0026acute;s protocol, with the following modifications. Cell pellets were resuspended in 100 \u0026micro;L of TE buffer containing 2 mg/mL of lysozyme (Sigma-Alrich Chemical Co.). Residual DNA was removed using the DNase kit from the TURBO DNA-Free\u0026trade; kit (Invitrogen, USA), and its absence was confirmed by conventional PCR. The concentration and purity of the purified RNA were determined using a NABI nano-spectrophotometer (MicroDigital Co., Korea). RNA integrity was assessed by 1% (w/v) agarose gel electrophoresis. Single-stranded cDNA synthesis was performed by reverse transcription in a DLAB TC1000-G gradient thermal cycler (DLAB Scientific Inc.), using 0.4 \u0026micro;g of purified RNA and the SuperScript\u0026reg; III First-Strand Synthesis System (Invitrogen, USA) according to the manufacturer's instructions. cDNA synthesis was confirmed by conventional PCR. RT-qPCR assays were performed on an iQ5 Multicolor Real-Time PCR Inspection System iCycler (Bio-Rad Laboratories Inc.) using previously obtained cDNA samples as template. Amplification products were detected using the SYBR Green fluorophore contained in the iQ SYBR\u0026reg; Green Supermix kit (Bio Rad Laboratories Inc.). Each reaction was performed in duplicate in a final volume of 20 \u0026micro;L containing 10 \u0026micro;L of iQ SYBR\u0026reg; Green Supermix 2X, 7 \u0026micro;L of a mix containing 1 \u0026micro;M of each primer, and 3 \u0026micro;L of 2 ng/\u0026micro;L cDNA. The conditions used were: 94\u0026deg;C for 5 min and 40 cycles of 94\u0026deg;C for 1 min, 50\u0026deg;C for 1 min, and 72\u0026deg;C for 30 s, followed by a melting curve (81 cycles of 60\u0026deg;C for 10 s) to rule out the formation of non-specific products. No template control (NTC) was performed. To interpret the results of relative expression of the genes of interest under the different conditions with respect to the normalizing gene, the 2\u003csup\u003e\u0026minus;ΔΔCT\u003c/sup\u003e method (Schmittgen and Livak, \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2008\u003c/span\u003e) was used, and the gene expression in non-selenized cells grown in MRSf was used as a calibrator condition (2\u003csup\u003e\u0026minus;ΔΔCt\u003c/sup\u003e = 1). A value\u0026thinsp;\u0026gt;\u0026thinsp;1 indicated higher expression compared to non-selenized cells, while a value\u0026thinsp;\u0026lt;\u0026thinsp;1 reflects lower expression. The primers used for \u003cem\u003eF. tropaeoli\u003c/em\u003e CRL2034 were designed using this strains genome (WNLV00000000.1), while for \u003cem\u003eL. plantarum\u003c/em\u003e CRL2051, available sequences of this species in the NCBI (National Center for Biotechnology Information) database were used. Primers were designed using the bioinformatics tool PrimerQuest (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.idtdna.com/PrimerQuest/Home/Index\u003c/span\u003e\u003cspan address=\"https://www.idtdna.com/PrimerQuest/Home/Index\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) and verified \u003cem\u003ein silico\u003c/em\u003e with OligoAnalyzer (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.idtdna.com/calc/analyzer\u003c/span\u003e\u003cspan address=\"https://www.idtdna.com/calc/analyzer\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) and ClustalOmega (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.ebi.ac.uk/Tools/msa/clustalo/\u003c/span\u003e\u003cspan address=\"https://www.ebi.ac.uk/Tools/msa/clustalo/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). All primer pairs were designed to obtain fragments between 100 and 150 bp and with similar Tm (melting temperature). The primers were synthesized by Genbiotech (Buenos Aires, Argentina). The primer sequences used are detailed in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. The specificity of each primer pair and the fragment sizes were verified by conventional PCR and agarose gel electrophoresis.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimer sequences used for RT-qPCR analysis of probable selenium related metabolism genes expression in LAB cells\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"6\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eStrain\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGene\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003ePrimer\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eSequence 5\u0026rsquo;-3\u0026rsquo;\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eNumber of bases\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eProtein\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"5\" rowspan=\"6\"\u003e \u003cp\u003e\u003cem\u003eL. plantarum\u003c/em\u003e CRL2051\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003egshR\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003egshR-Fw\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCACACCAGCAGCCTACTTT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e19\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eGlutathione reductase\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003egshR-Rv\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eGTGAAGACGACCGATGGAATTA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e22\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003etrxR\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003etrxR-Fw\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eTGCTGATAAGGTCACGGTTATT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e22\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eThioredoxin reductase\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003etrxR-Rv\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eGCTGTTCCAGACAAATTCCATC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e22\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003e16s ARNr\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e16s rRNA-Fw\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eGTGGCGAACTGGTGAGTAA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e19\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e16S rRNA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e16s rRNA-Rv\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCATGCGGTCCAAGTTGTTATG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e21\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"9\" rowspan=\"10\"\u003e \u003cp\u003e\u003cem\u003eF. tropaeoli\u003c/em\u003e CRL2034\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003egshR (1)\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003egshR_1-Fw\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCACGCAGAGGACATCATCAA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eGlutathione reductase\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003egshR_1-Rv\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eGGTCGCCGATAGCAGAATAA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e20\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003egshR (2)\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003egshR_2-Fw\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCCCAATCGTCTATCCAGCTATTT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e23\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eGlutathione reductase\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003egshR_2-Rv\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eAGGCTTCCGTGACTTCATAAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e21\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003escl\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003escl-Fw\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eATCGCAGACAAAGAGGAAGAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e21\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eSelenocysteine lyase\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003escl-Rv\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eTGAACACCCGCTAGGTTAAAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e21\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003etrx\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003etrx-Fw\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCTCACGGGCGGATTTAAAGA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eThioredoxin\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003etrx-Rv\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eGGCCAAATCAGGACCCATAA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e20\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003erecA\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003erecA-Fw\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCGTGAGAAGGCCAAGGAATAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e21\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eRecA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003erecA-Rv\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eGGCTCGTCACCAATACCATAAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e22\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e\n\u003ch3\u003eDifferential protein expression of selenized and non-selenized cells grown in MRSf\u003c/h3\u003e\n\u003cp\u003eSelenized and non-selenized cells of \u003cem\u003eF. tropaeoli\u003c/em\u003e CRL2034 and \u003cem\u003eL. plantarum\u003c/em\u003e CRL2051 were grown in MRSf at 30\u0026deg;C for 6 h (exponential growth phase). Cells were washed twice with 50 mM Tris-HCl, pH 7.5, and resuspended in the same buffer supplemented with 1 mM PMSF and 10 mM EDTA. Subsequently, they were lysed using a Mini-bead Beater-8 in 5 cycles of 2 min with intermittent cooling in an ice bath. Thirty micrograms of proteins were loaded onto a 10% (w/v) SDS-PAGE gel and stained with Bio-Safe\u0026trade; Coomassie Stain (Bio-Rad Laboratories) after 1 cm of migration from the start of the resolving gel. The assay was performed in triplicate in three independent runs. The bands from the gels were cut and sent for analysis to the Center for Chemical and Biological Studies by Mass Spectrometry (CEQUIBIEM)-CONICET, University of Buenos Aires, Argentina (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://cequibiem.qb.fcen.uba.ar/\u003c/span\u003e\u003cspan address=\"http://cequibiem.qb.fcen.uba.ar/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e), and analyzed as described by Onta\u0026ntilde;on et al. (\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). The analysis was carried out using the Proteome Discoverer 2.2 search engine (Thermo Scientific) through SEQUEST HT, performing peptide-spectrum mapping (PSM) against the sequenced genome of \u003cem\u003eF. tropaeoli\u003c/em\u003e CRL2034 available in GenBank (accession number WNLV00000000.1). For the proteomic studies of \u003cem\u003eL. plantarum\u003c/em\u003e CRL2051, the available sequences of the \u003cem\u003eL. plantarum\u003c/em\u003e WCFS1 strain (Taxon ID: 220668) were used as reference, since the sequenced genome of strain CRL2051 was not available. The search parameters used were as fixed modifications: cysteine carbamidomethylation (C) and as variable ones, methionine oxidation (M) and SeCys carbamidomethylation (C). Up to two non-specific cleavage sites were allowed; monoisotopic masses were used. The mass tolerance for the precursor was 10 ppm, and that for fragments 0.05 Da. MS2 spectra were analyzed with Proteome Discoverer 2.2 software (Thermo Scientific) using a 95% confidence interval threshold (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05). Perseus software (Max Planck Institute of Biochemistry, version 1.6.6.0, freely available) was used for proteomic analysis. Since each treatment was performed in triplicate, proteins identified in at least two of the three replicates were included in this analysis. Scatter plots were performed to determine the correlation between replicates. Log2FC values (Student's t-test difference between the Log2 intensities of the samples) and \u0026ndash;Log 10 \u003cem\u003ep\u003c/em\u003e-values were used to generate volcano plots. Significant differential expression was defined as \u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026le;\u0026thinsp;0.05 (-Log p\u0026thinsp;\u0026ge;\u0026thinsp;1.3) and Log2\u0026thinsp;\u0026ge;\u0026thinsp;1.5 (values greater than 0.58 for upregulated proteins and less than \u0026minus;\u0026thinsp;0.58 for downregulated proteins). Functional analysis of the deregulated proteins was performed using the COG, KEGG, and STRING databases to identify their functional categories, metabolic pathways, and interaction networks, respectively.\u003c/p\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eAll assays were performed in triplicate, and results of at least three measurements were expressed as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation (SD). TEM images (at least tree) were obtained from three independent assays for each strain. Statistical analyses were conducted using one-way analysis of variance (ANOVA) followed by Tukey\u0026rsquo;s post hoc test, with the significance level set at \u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05. Analyses were performed using MINITAB 16 Statistical Software (Minitab, State College, PA, USA). Proteomic data were statistically analyzed using Perseus software (version 1.6.6.0), applying Student\u0026rsquo;s t-test and the significance thresholds described above.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec10\" class=\"Section2\"\u003e\n \u003ch2\u003eDetection of SeNPs in LAB grown in the presence of Se by TEM\u003c/h2\u003e\n \u003cp\u003eThe TEM images showed the presence of spherical SeNPs in the cultures of \u003cem\u003eL. plantarum\u003c/em\u003e CRL2051 and \u003cem\u003eF. tropaeoli\u003c/em\u003e CRL2034. Elemental analysis by XEDS confirmed the presence of Se with the characteristic peaks SeL\u0026alpha; (1.4 keV), SeK\u0026alpha; (11.22 keV) and SeK\u0026beta; (12.49 keV) (Fig. \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003ea, b).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\n \u003ch2\u003eCharacterization of the SeNPs produced by LAB grown in the presence of Se\u003c/h2\u003e\n \u003cp\u003eThe SeNPs produced by \u003cem\u003eL. plantarum\u003c/em\u003e CRL2051 were analyzed by DLS at a detection angle of 90 \u0026deg;. The particle size with the highest relative contribution to the DLS (main peak) was 286.14\u0026thinsp;\u0026plusmn;\u0026thinsp;44 nm, while the average hydrodynamic size (Z-average) reached 313.20\u0026thinsp;\u0026plusmn;\u0026thinsp;6 nm (Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003ea). The polydispersity index (PdI\u0026thinsp;=\u0026thinsp;0.28\u0026thinsp;\u0026plusmn;\u0026thinsp;0.04) indicated a moderately homogeneous size distribution, with a minor fraction of larger particles affecting the average value. The average \u0026zeta; potential was \u0026minus;\u0026thinsp;56.77\u0026thinsp;\u0026plusmn;\u0026thinsp;7 mV, reflecting high colloidal stability of the SeNPs.\u003c/p\u003e\n \u003cp\u003eThe FT-IR spectra of the SeNPs produced by \u003cem\u003eL. plantarum\u003c/em\u003e CRL2051 and \u003cem\u003eF. tropaeoli\u003c/em\u003e CRL2034 exhibited characteristic absorption bands at 400\u0026ndash;500 cm⁻\u0026sup1;, attributed to Se\u0026ndash;Se stretching vibrations, 1000\u0026ndash;1200 cm⁻\u0026sup1; corresponding to C\u0026ndash;O stretching, and 1600\u0026ndash;1700 cm⁻\u0026sup1; associated with C\u0026thinsp;=\u0026thinsp;O stretching of carbonyl and amide groups. A broad band at 3200\u0026ndash;3500 cm⁻\u0026sup1; was assigned to O\u0026ndash;H and N\u0026ndash;H stretching, indicating the presence of hydroxyl and amide functional groups (Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003ec-d). The Raman spectra showed a prominent peak around 250 cm⁻\u0026sup1;, corresponding to Se\u0026ndash;Se stretching typical of amorphous Se (Table \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e), and weaker bands between 143 and 176 cm⁻\u0026sup1; attributed to lattice vibrations (Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003ee, f). Additional features at 300\u0026ndash;350 cm⁻\u0026sup1; could be associated with Se\u0026ndash;O stretching. Peaks around 1000\u0026ndash;1200 cm⁻\u0026sup1; (C\u0026ndash;O, C\u0026ndash;N), 1450 cm⁻\u0026sup1; (CH₂, CH₃), and 1600\u0026ndash;1650 cm⁻\u0026sup1; (C\u0026thinsp;=\u0026thinsp;O) confirmed the presence of organic functional groups\u0026mdash;mainly proteins, polysaccharides, and lipids\u0026mdash;capping the nanoparticle surface (Table\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e). Detailed vibrational band assignments and corresponding references are summarized in Supplementary Table 2.\u003c/p\u003e\n \u003cdiv class=\"gridtable\"\u003e\u0026nbsp;\u0026nbsp;\u003ctable id=\"Tab2\" border=\"1\"\u003e\n \u003ccaption language=\"En\"\u003e\n \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e\n \u003cdiv class=\"CaptionContent\"\u003e\n \u003cp\u003eFTIR and Raman vibrational band assignments of SeNPs produced by lactic acid bacteria strains\u003c/p\u003e\n \u003c/div\u003e\n \u003c/caption\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eRange (cm⁻\u0026sup1;)\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eTechnique\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eVibrational assignment\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eFunctional group / compound\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eEvidence in spectra\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eReferences\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e3400\u0026ndash;3500\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eFTIR\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u0026nu;(O\u0026ndash;H), \u0026nu;(N\u0026ndash;H)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eResidual water, proteins, polysaccharides\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eBroad band clearly visible in both FTIR spectra\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eAshengroph and Hosseini (\u003cspan class=\"CitationRef\"\u003e2021\u003c/span\u003e); Wang et al. (\u003cspan class=\"CitationRef\"\u003e2023\u003c/span\u003e)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1650\u0026ndash;1600\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eFTIR / Raman\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u0026nu;(C\u0026thinsp;=\u0026thinsp;O) (Amide I), \u0026nu;(C\u0026thinsp;=\u0026thinsp;C)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eProteins, lipids, carboxylic groups\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eStrong, well-defined band in both strains\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eSkuodaitė and Krylova (\u003cspan class=\"CitationRef\"\u003e2023\u003c/span\u003e); Edwards (\u003cspan class=\"CitationRef\"\u003e2006\u003c/span\u003e)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1450\u0026ndash;1430\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eRaman\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u0026delta;(CH₂), \u0026delta;(CH₃)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eLipids, amino acids\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eClear peak in violet spectrum (\u003cem\u003eL. plantarum\u003c/em\u003e CRL2051)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eEdwards (\u003cspan class=\"CitationRef\"\u003e2006\u003c/span\u003e)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1200\u0026ndash;1000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eFTIR / Raman\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u0026nu;(C\u0026ndash;O), \u0026nu;(C\u0026ndash;N), \u0026nu;(C\u0026ndash;C)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003ePolysaccharides, proteins\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eModerate peak in both spectra\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eAshengroph and Hosseini (\u003cspan class=\"CitationRef\"\u003e2021\u003c/span\u003e); Piacenza et al. (\u003cspan class=\"CitationRef\"\u003e2021\u003c/span\u003e)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e500\u0026ndash;400\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eFTIR\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u0026nu;(Se\u0026ndash;Se)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eSe\u0026ndash;Se bonds (core structure of nanoparticles)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eWeak but noticeable band (~\u0026thinsp;470 cm⁻\u0026sup1;)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTugarova et al. (\u003cspan class=\"CitationRef\"\u003e2018\u003c/span\u003e); Skuodaitė and Krylova (\u003cspan class=\"CitationRef\"\u003e2023\u003c/span\u003e)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e270\u0026ndash;230\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eRaman\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u0026nu;(Se\u0026ndash;Se)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eSe\u0026ndash;Se bonds (amorphous/crystalline structure)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eDominant peak (~\u0026thinsp;250 cm⁻\u0026sup1;)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTugarova et al. (\u003cspan class=\"CitationRef\"\u003e2018\u003c/span\u003e); Anderson et al. (\u003cspan class=\"CitationRef\"\u003e2000\u003c/span\u003e)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e350\u0026ndash;300\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eRaman\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u0026nu;(Se\u0026ndash;O)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eSurface interaction with oxygen\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eSmall shoulder, more evident in \u003cem\u003eF. tropaeoli\u003c/em\u003e CRL2034\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eAnderson et al. (\u003cspan class=\"CitationRef\"\u003e2000\u003c/span\u003e)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e180\u0026ndash;140\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eRaman\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eLattice vibration modes of Se or partial crystalline phases\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eIndicator of local crystallinity\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eWeak signal in \u003cem\u003eF. tropaeoli\u003c/em\u003e CRL2034\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eSimakin et al. (\u003cspan class=\"CitationRef\"\u003e2024\u003c/span\u003e)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n \u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\n \u003ch2\u003eDifferential gene expression of LAB cells grown in the presence of Se\u003c/h2\u003e\n \u003cp\u003eThe relative expression of the genes possibly involved in Se metabolism were analyzed after 24 h incubation, in cells grown in MRSf in the presence of Se comparing with control ones (those grown in MRSf without adding Se). In \u003cem\u003eL. plantarum\u003c/em\u003e CRL2051, the relative expression of the genes \u003cem\u003egshR\u003c/em\u003e and \u003cem\u003etrxR\u003c/em\u003e, possibly involved in Se metabolism, was downregulated (0.35\u0026thinsp;\u0026plusmn;\u0026thinsp;0.09) when the strain grew in MRSf supplemented with 10 mg/L of Se (as Na\u003csub\u003e2\u003c/sub\u003eSeO\u003csub\u003e3\u003c/sub\u003e) compared to their expression in the control MRSf medium (0.50\u0026thinsp;\u0026plusmn;\u0026thinsp;0.10) after 24 h incubation (Fig. \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003ea). On the contrary, when \u003cem\u003eF. tropaeoli\u003c/em\u003e was grown in the presence of Se, \u003cem\u003egshR(1)\u003c/em\u003e, \u003cem\u003egshR(2)\u003c/em\u003e and \u003cem\u003etrx\u003c/em\u003e were up regulated (1.22\u0026thinsp;\u0026plusmn;\u0026thinsp;0.14; 1.25\u0026thinsp;\u0026plusmn;\u0026thinsp;0.18 and 1.14\u0026thinsp;\u0026plusmn;\u0026thinsp;0.09, respectively), while no changes on the expression of \u003cem\u003escl\u003c/em\u003e was detected when this strain grew in the presence of Se respect to the control medium (Fig. \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eb).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e\n \u003ch2\u003eDifferential gene and protein expression of LAB selenized and non-selenized cells grown in MRSf\u003c/h2\u003e\n \u003cp\u003eThe selenized and non-selenized cells of the studied strains (grown in MRSf with or without Se, respectively as escribed above) were grown in MRSf to determine the time at which the cells were in their exponential growth phase and to establish the time were the differences in their growth were greater (Fig. \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003ea, b). Differences in the growth of \u003cem\u003eL. plantarum\u003c/em\u003e CRL2051 between selenized and non-selenized cells were observed at 4 h incubation, as non-selenized cells grew and reduced the pH of MRSf more than selenized cells (0.43\u0026thinsp;\u0026plusmn;\u0026thinsp;0.04 \u0026Delta;CFU/mL and 0.18\u0026thinsp;\u0026plusmn;\u0026thinsp;0.01 \u0026Delta;pH). Although no significant differences were observed in the growth and acidification of \u003cem\u003eF. tropaeoli\u003c/em\u003e CRL2034 between selenized and non-selenized cells grown in MRSf, a tendency indicating better growth of selenized cells was observed at 6 hours of incubation. Thus, cells of both strains were harvested at the exponential growth phase (6 h incubation) for RNA and protein extraction.\u003c/p\u003e\n \u003cp\u003eSelenized cells of \u003cem\u003eL. plantarum\u003c/em\u003e CRL2051 differentially expressed 18 proteins with respect to the non-selenized cells (Table \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003e); these proteins were assigned by EggNOG to the categories COGC (energy production and maintenance), COGJ (genetic information and processing), and the overexpressed protein lysozyme/muramidase, which belonged to the COGM (cell membrane/wall/envelope biogenesis) (Fig. \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003ea). Five of the nine downregulated proteins were grouped in the same cluster by STRING and corresponded to proteins related to fatty acid metabolism (Supplementary Fig. S1). Consistently with these results \u003cem\u003eL. plantarum\u003c/em\u003e CRL2051 showed a 5% increase in membrane hydrophobicity when an increasing Se concentration was added to the culture medium (Figure S2). On the other hand, selenized cells of \u003cem\u003eF. tropaeoli\u003c/em\u003e CRL2034 differentially expressed 11 proteins belonging to the COGC, COGJ, post-translational modifications, chaperones, and protein turnover (COGO), and unknown function (COGS) (Table \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003e and Fig. \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003ea). When the proteomic profiles of selenized and non-selenized cells of \u003cem\u003eL. plantarum\u003c/em\u003e CRL2051 and \u003cem\u003eF. tropaeoli\u003c/em\u003e CRL2034 (grown in MRSf, 30\u0026deg;C, 6 h) were analyzed, no differences in the expression of proteins related to Se metabolism were detected. However, when the selenized cells of \u003cem\u003eL. plantarum\u003c/em\u003e CRL2051 were grown in MRSf (6 h), the relative expression of \u003cem\u003egshR\u003c/em\u003e was downregulated with respect to the expression of this gene in the non-selenized cells (0.29\u0026thinsp;\u0026plusmn;\u0026thinsp;0.04 times), while no differences in the expression of \u003cem\u003etrx\u003c/em\u003e was observed (Fig. \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003eb). On the other hand, when selenized cells of \u003cem\u003eF. tropaeoli\u003c/em\u003e CRL2034 were grown in MRSf, the expression of \u003cem\u003egshR\u003c/em\u003e (1), \u003cem\u003egshR\u003c/em\u003e (2), and \u003cem\u003escl\u003c/em\u003e were downregulated respect to these genes\u0026rsquo; expression in the non-selenized cells (0.61\u0026thinsp;\u0026plusmn;\u0026thinsp;0.09, 0.75\u0026thinsp;\u0026plusmn;\u0026thinsp;0.15, 0.48\u0026thinsp;\u0026plusmn;\u0026thinsp;0.01, respectively), while the expression of \u003cem\u003etrx\u003c/em\u003e was up regulated (1.09\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02) in the selenized cells (Fig. \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003eb).\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003eTable 3.\u003c/strong\u003e Differentially expressed proteins in selenized LAB cells respect to non-selenized ones when grown in MRSf at 30\u0026deg;C during 6 h\u0026nbsp;\u003c/p\u003e\n \u003ctable border=\"0\" cellspacing=\"0\" cellpadding=\"0\" width=\"1020\" class=\"fr-table-selection-hover\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 84px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eStrain\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 320px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eProtein Name\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 120px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eAccession\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 59px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eFold change\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 108px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eCOG Category\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eSubcategory COG\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 244px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eDescription\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"18\" style=\"width: 84px;\"\u003e\n \u003cp\u003e\u003cem\u003eL. plantarum\u003c/em\u003e CRL2051\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 320px;\"\u003e\n \u003cp\u003eLysozyme/muramidase, glycoside hydrolase family 25\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 120px;\"\u003e\n \u003cp\u003eF9USK7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 59px;\"\u003e\n \u003cp\u003e2.08\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 108px;\"\u003e\n \u003cp\u003eCellular processes and signaling\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003eM\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 244px;\"\u003e\n \u003cp\u003eCell wall/membrane/envelope biogenesis\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 320px;\"\u003e\n \u003cp\u003eTranscription regulator, MarR family\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 120px;\"\u003e\n \u003cp\u003eF9UNC5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 59px;\"\u003e\n \u003cp\u003e1.52\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 108px;\"\u003e\n \u003cp\u003eInformation storage and processing\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003eK\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 244px;\"\u003e\n \u003cp\u003eTranscription\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 320px;\"\u003e\n \u003cp\u003eProphage P1 protein 2, mitogenic factor, cell surface lipoprotein\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 120px;\"\u003e\n \u003cp\u003eF9UL89\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 59px;\"\u003e\n \u003cp\u003e1.59\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 108px;\"\u003e\n \u003cp\u003eFunction unknown\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003eS\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 244px;\"\u003e\n \u003cp\u003eFunction unknown\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 320px;\"\u003e\n \u003cp\u003eAlpha-acetolactate decarboxylase\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 120px;\"\u003e\n \u003cp\u003eF9UPY7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 59px;\"\u003e\n \u003cp\u003e1.66\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 108px;\"\u003e\n \u003cp\u003eMetabolism\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003eQ\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 244px;\"\u003e\n \u003cp\u003eSecondary metabolites biosynthesis, transport, and catabolism\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 320px;\"\u003e\n \u003cp\u003eUncharacterized protein\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 120px;\"\u003e\n \u003cp\u003eF9UT36\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 59px;\"\u003e\n \u003cp\u003e1.82\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 108px;\"\u003e\n \u003cp\u003eN/A\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003eN/A\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 244px;\"\u003e\n \u003cp\u003eN/A\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 320px;\"\u003e\n \u003cp\u003ePhosphate transport system permease protein PstA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 120px;\"\u003e\n \u003cp\u003eF9ULX5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 59px;\"\u003e\n \u003cp\u003e1.95\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 108px;\"\u003e\n \u003cp\u003eMetabolism\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003eP\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 244px;\"\u003e\n \u003cp\u003eInorganic ion transport and metabolism\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 320px;\"\u003e\n \u003cp\u003eTranscription regulator, GntR family\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 120px;\"\u003e\n \u003cp\u003eF9USW7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 59px;\"\u003e\n \u003cp\u003e1.88\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 108px;\"\u003e\n \u003cp\u003eInformation storage and processing\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003eK\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 244px;\"\u003e\n \u003cp\u003eTranscription\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 320px;\"\u003e\n \u003cp\u003e7,8-dihydroneopterin aldolase\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 120px;\"\u003e\n \u003cp\u003eF9UTI7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 59px;\"\u003e\n \u003cp\u003e2.49\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 108px;\"\u003e\n \u003cp\u003eMetabolism\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003eH\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 244px;\"\u003e\n \u003cp\u003eCoenzyme transport and metabolism\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 320px;\"\u003e\n \u003cp\u003etRNA binding domain protein\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 120px;\"\u003e\n \u003cp\u003eF9UNK1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 59px;\"\u003e\n \u003cp\u003e3.16\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 108px;\"\u003e\n \u003cp\u003eInformation storage and processing\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003eJ\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 244px;\"\u003e\n \u003cp\u003eTranslation, ribosomal structure and biogenesis\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 320px;\"\u003e\n \u003cp\u003eEnoyl-[acyl-carrier-protein] reductase [NADH]\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 120px;\"\u003e\n \u003cp\u003eF9UP45\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 59px;\"\u003e\n \u003cp\u003e0.46\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 108px;\"\u003e\n \u003cp\u003eMetabolism\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003eI\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 244px;\"\u003e\n \u003cp\u003eLipid transport and metabolism\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 320px;\"\u003e\n \u003cp\u003e3-oxoacyl-[acyl-carrier-protein] synthase 2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 120px;\"\u003e\n \u003cp\u003eF9UP39\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 59px;\"\u003e\n \u003cp\u003e0.59\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 108px;\"\u003e\n \u003cp\u003eMetabolism\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003eI\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 244px;\"\u003e\n \u003cp\u003eLipid transport and metabolism\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 320px;\"\u003e\n \u003cp\u003eNADH dehydrogenase\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 120px;\"\u003e\n \u003cp\u003eF9UTR7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 59px;\"\u003e\n \u003cp\u003e0.66\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 108px;\"\u003e\n \u003cp\u003eMetabolism\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003eC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 244px;\"\u003e\n \u003cp\u003e\u0026nbsp;Energy production and conversion\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 320px;\"\u003e\n \u003cp\u003eMalonyl CoA-acyl carrier protein transacylase\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 120px;\"\u003e\n \u003cp\u003eF9UP37\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 59px;\"\u003e\n \u003cp\u003e0.38\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 108px;\"\u003e\n \u003cp\u003eMetabolism\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003eI\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 244px;\"\u003e\n \u003cp\u003eLipid transport and metabolism\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 320px;\"\u003e\n \u003cp\u003eAcetyl-CoA carboxytransferase\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 120px;\"\u003e\n \u003cp\u003eF9UP44\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 59px;\"\u003e\n \u003cp\u003e0.26\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 108px;\"\u003e\n \u003cp\u003eMetabolism\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003eI\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 244px;\"\u003e\n \u003cp\u003eLipid transport and metabolism\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 320px;\"\u003e\n \u003cp\u003eAminopeptidase\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 120px;\"\u003e\n \u003cp\u003eF9ULL7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 59px;\"\u003e\n \u003cp\u003e0.67\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 108px;\"\u003e\n \u003cp\u003eMetabolism\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003eE\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 244px;\"\u003e\n \u003cp\u003eAmino acid transport and metabolism\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 320px;\"\u003e\n \u003cp\u003eAcetyl-CoA carboxylase, biotin carboxylase subunit\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 120px;\"\u003e\n \u003cp\u003eF9UP42\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 59px;\"\u003e\n \u003cp\u003e0.23\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 108px;\"\u003e\n \u003cp\u003eMetabolism\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003eI\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 244px;\"\u003e\n \u003cp\u003eLipid transport and metabolism\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 320px;\"\u003e\n \u003cp\u003eCitrate lyase alpha chain\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 120px;\"\u003e\n \u003cp\u003eF9UMS0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 59px;\"\u003e\n \u003cp\u003e0.56\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 108px;\"\u003e\n \u003cp\u003eMetabolism\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003eH\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 244px;\"\u003e\n \u003cp\u003eCoenzyme transport and metabolism\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 320px;\"\u003e\n \u003cp\u003ePyruvate dehydrogenase E1 component subunit alpha\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 120px;\"\u003e\n \u003cp\u003eF9UQ93\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 59px;\"\u003e\n \u003cp\u003e0.54\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 108px;\"\u003e\n \u003cp\u003eMetabolism\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003eC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 244px;\"\u003e\n \u003cp\u003e\u0026nbsp;Energy production and conversion\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"11\" style=\"width: 84px;\"\u003e\n \u003cp\u003e\u003cem\u003eF. tropaeoli\u0026nbsp;\u003c/em\u003eCRL2034\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 320px;\"\u003e\n \u003cp\u003eHypothetical protein\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 120px;\"\u003e\n \u003cp\u003eWP_148666526.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 59px;\"\u003e\n \u003cp\u003e5.86\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 108px;\"\u003e\n \u003cp\u003eN/A\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003eN/A\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 244px;\"\u003e\n \u003cp\u003eN/A\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 320px;\"\u003e\n \u003cp\u003e3\u0026apos;-to-5\u0026apos; oligoribonuclease A\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 120px;\"\u003e\n \u003cp\u003eWP_168778561.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 59px;\"\u003e\n \u003cp\u003e1.79\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 108px;\"\u003e\n \u003cp\u003eFunction unknown\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003eS\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 244px;\"\u003e\n \u003cp\u003eFunction unknown\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 320px;\"\u003e\n \u003cp\u003eDNA repair protein RadA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 120px;\"\u003e\n \u003cp\u003eWP_168778582.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 59px;\"\u003e\n \u003cp\u003e3.24\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 108px;\"\u003e\n \u003cp\u003eCellular processes and signaling\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003eO\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 244px;\"\u003e\n \u003cp\u003ePost-translational modification, protein turnover, and chaperones\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 320px;\"\u003e\n \u003cp\u003eDNA-directed RNA polymerase alpha subunit\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 120px;\"\u003e\n \u003cp\u003eWP_047975004.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 59px;\"\u003e\n \u003cp\u003e0.63\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 108px;\"\u003e\n \u003cp\u003eInformation storage and processing\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003eK\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 244px;\"\u003e\n \u003cp\u003eTranscription\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 320px;\"\u003e\n \u003cp\u003ePhosphate acetyltransferase\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 120px;\"\u003e\n \u003cp\u003eWP_168778506.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 59px;\"\u003e\n \u003cp\u003e0.59\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 108px;\"\u003e\n \u003cp\u003eMetabolism\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003eC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 244px;\"\u003e\n \u003cp\u003eEnergy production and conversion\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 320px;\"\u003e\n \u003cp\u003ePhenylalanyl-tRNA synthetase alpha chain\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 120px;\"\u003e\n \u003cp\u003eWP_168779079.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 59px;\"\u003e\n \u003cp\u003e0.43\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 108px;\"\u003e\n \u003cp\u003eInformation storage and processing\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003eJ\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 244px;\"\u003e\n \u003cp\u003eTranslation, ribosomal structure and biogenesis\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 320px;\"\u003e\n \u003cp\u003ePhenazine biosynthesis protein PhzF\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 120px;\"\u003e\n \u003cp\u003eWP_206672724.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 59px;\"\u003e\n \u003cp\u003e0.66\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 108px;\"\u003e\n \u003cp\u003eFunction unknown\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003eS\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 244px;\"\u003e\n \u003cp\u003eFunction unknown\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 320px;\"\u003e\n \u003cp\u003eL-lactate dehydrogenase\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 120px;\"\u003e\n \u003cp\u003eWP_168778839.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 59px;\"\u003e\n \u003cp\u003e0.60\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 108px;\"\u003e\n \u003cp\u003eMetabolism\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003eC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 244px;\"\u003e\n \u003cp\u003eEnergy production and conversion\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 320px;\"\u003e\n \u003cp\u003eATP-binding cassette domain-containing protein\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 120px;\"\u003e\n \u003cp\u003eWP_168778386.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 59px;\"\u003e\n \u003cp\u003e0.50\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 108px;\"\u003e\n \u003cp\u003eFunction unknown\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003eS\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 244px;\"\u003e\n \u003cp\u003eFunction unknown\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 320px;\"\u003e\n \u003cp\u003eDNA primase\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 120px;\"\u003e\n \u003cp\u003eWP_168778471.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 59px;\"\u003e\n \u003cp\u003e0.30\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 108px;\"\u003e\n \u003cp\u003eInformation storage and processing\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003eL\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 244px;\"\u003e\n \u003cp\u003eReplication, recombination and repair\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 320px;\"\u003e\n \u003cp\u003eUncharacterized conserved protein\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 120px;\"\u003e\n \u003cp\u003eWP_168777990.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 59px;\"\u003e\n \u003cp\u003e0.44\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 108px;\"\u003e\n \u003cp\u003eInformation storage and processing\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003eL\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 244px;\"\u003e\n \u003cp\u003eReplication, recombination and repair\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n \u003cdiv class=\"gridtable\"\u003e\n \u003ctable id=\"Tab3\" border=\"1\"\u003e\u003c/table\u003e\n \u003c/div\u003e\n\u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eSeNPs possess antioxidant, antimicrobial, and anticancerogenic properties (Bisht et al. \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2022\u003c/span\u003e; Marfet\u0026aacute;n et al. \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2023\u003c/span\u003e; Satarzadeh et al. \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). The synthesis of biogenic SeNPs using generally accepted as safe (GRAS) microorganisms is a sustainable strategy for producing biocompatible NPs for biomedical and/or food production applications (Tatari et al. \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e2026\u003c/span\u003e). The studied LAB strains \u003cem\u003eL. plantarum\u003c/em\u003e CRL2051 and \u003cem\u003eF. tropaeoli\u003c/em\u003e CRL2034 were able to produce SeNPs with a hydrodynamic diameter of 286.14\u0026thinsp;\u0026plusmn;\u0026thinsp;44 nm and 216.05\u0026thinsp;\u0026plusmn;\u0026thinsp;19 nm, respectively. Similar results were observed for \u003cem\u003eLactobacillus reuteri\u003c/em\u003e CRL 1101, which produced SeNPs of a hydrodynamic diameter of 258\u0026thinsp;\u0026plusmn;\u0026thinsp;4 nm as determined by DLS (Moreno-Martin et al. 2017). The size of NPs determines their biodistribution, and it is generally accepted that small-sized NPs (\u0026lt;\u0026thinsp;50 nm) have the highest biological effect (Ajdary et al. \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). However, Li et al. (\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2024\u003c/span\u003e) observed that polyvinyl pyrrolidone-modified SeNPs with a hydrodynamic diameter of 278.4\u0026thinsp;\u0026plusmn;\u0026thinsp;124.8 nm could be intraperitoneally administered in rats at doses of 320 \u0026micro;g/kg with an efficient biodistribution and without damaging the kidney tissues and showing good excretion and no accumulation. Moreover, Luo et al. (\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2024\u003c/span\u003e) reported that CD44-targeting hyaluronic acid-SeNPs with an approximate diameter of 250 nm showed a positive effect on spinal cord injury recovery. The polydispersity index (PDI) is a characteristic of the SeNPs that gives information about their heterogeneity. In this work, the SeNPs synthesized by \u003cem\u003eL. plantarum\u003c/em\u003e CRL2051 showed PDI values ​​of 0.28\u0026thinsp;\u0026plusmn;\u0026thinsp;0.04, indicating that the sample was heterogeneous but with good consistency between measurements. Meanwhile, the SeNPs produced by \u003cem\u003eF. tropaeoli\u003c/em\u003e CRL2034 showed a PDI of 0.52\u0026thinsp;\u0026plusmn;\u0026thinsp;0.15, suggesting a high heterogeneity in the particle size distribution. The heterogeneity observed could be considered a limitation, since a broad size distribution is often associated with variability in the physicochemical and biological properties of NPs, especially in applications where size uniformity is critical (Aminisough et al. \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). Indeed, microbial SeNPs can be influenced by multiple biological variables that determine their size and stability (Spyridopoulou et al. \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). The superficial charge measured as ζ potential is an important characteristic that determines SeNPs\u0026rsquo; stability. This charge is influenced by coating agents, such as proteins, polysaccharides, and lipids, produced by microorganisms during the SeNPs synthesis. For NPs to be stable, the ζ potential must be close to absolute values greater than 30 mV. Ideally, for good or excellent stability, the charge should be between 40 mV and 60 mV (Kamble et al. \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). The SeNPs synthesized by \u003cem\u003eL. plantarum\u003c/em\u003e CRL2051 and \u003cem\u003eF. tropaeoli\u003c/em\u003e CRL2034 exhibited ζ potentials of -56.77 mV and \u0026minus;\u0026thinsp;59.41 mV, respectively, indicating that these SeNPs have an excellent colloidal stability, significantly higher than those previously reported for SeNPs produced by other LAB. In this respect, Rao and Poonia (\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2024\u003c/span\u003e) observed ζ potential values between \u0026minus;\u0026thinsp;27.9 mV and \u0026minus;\u0026thinsp;23.1 mV for SeNPs produced by \u003cem\u003eLactobacillus delbrueckii\u003c/em\u003e subsp. \u003cem\u003ebulgaricus\u003c/em\u003e, \u003cem\u003eL. rhamnosus\u003c/em\u003e, and \u003cem\u003eStreptococcus thermophilus\u003c/em\u003e, and a mixed culture of these strains. Similarly, Aminisough et al. (\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2024\u003c/span\u003e) observed that SeNPs produced by a cell-free supernatant of \u003cem\u003eL. fermentum\u003c/em\u003e had a ζ potential of -32.2 mV. It is important to note that a larger particle size does not always result in a high surface charge and does not necessarily correlate with a poor size distribution. Indeed, the SeNPs produced by \u003cem\u003ePediococcus acidilactici\u003c/em\u003e DSM20284, had a hydrodynamic size of 239.6 nm, a charge of \u0026minus;\u0026thinsp;26.9 mV, but at the same time a PDI of only 0.096, indicating a relatively uniform size distribution (Wang et al. \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). The results observed in this work indicate that the high PDI observed for the SeNPs produced by \u003cem\u003eL. plantarum\u003c/em\u003e CRL2051 and \u003cem\u003eF. tropaeoli\u003c/em\u003e CRL2034 is not due to agglomeration of the synthesized SeNPs (since they have a high ζ potential) but to the production of highly heterogeneous SeNPs.\u003c/p\u003e \u003cp\u003eThe spectroscopic analysis of SeNPs are consistent with recent studies reporting the coexistence of amorphous and crystalline Se phases in biogenic SeNPs (Simakin et al. \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2024\u003c/span\u003e; Li et al. \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2024\u003c/span\u003e; Luo et al. \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2024\u003c/span\u003e; Wen et al. \u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e2025\u003c/span\u003e). In this work, the higher intensity of the Se\u0026ndash;Se Raman band observed in \u003cem\u003eF. tropaeoli\u003c/em\u003e CRL2034 suggests a greater degree of structural ordering compared to that of \u003cem\u003eL. plantarum\u003c/em\u003e CRL2051. This dual structural nature may arise from distinct biosynthetic mechanisms: protein-rich capping layers in \u003cem\u003eL. plantarum\u003c/em\u003e favor the formation of amorphous Se, while polysaccharide-dominated coatings in \u003cem\u003eF. tropaeoli\u003c/em\u003e promote nucleation and partial crystallization. Such biochemical differences indicate that the molecular composition of the capping biomolecules governs not only the structural organization of SeNPs but also their physicochemical stability and potential bioactivity. The presence of bands associated with C\u0026ndash;O, C\u0026ndash;N, C\u0026thinsp;=\u0026thinsp;O, O\u0026ndash;H, N\u0026ndash;H and CH₂/CH₃ bonds in the FT-IR and Raman spectra suggests that the SeNPs synthesized by both strains are coated by a complex organic matrix composed of biomolecules such as polysaccharides, proteins, and lipids. The formation of a natural protective layer is a key advantage of biogenic synthesis. This \"natural coating\" distinguishes biogenic NPs from those synthesized by physical or chemical methods, which often lack this intrinsic stability or require additional coating agents (Wang et al. \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). The biological coating provides electrostatic repulsive interactions, which help prevent SeNP aggregation (Nikam et al. \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Moreover, several authors have shown that when chemically synthesized SeNPs are stabilized with polysaccharides or peptides, their resistance to the acidic conditions of the gastrointestinal tract \u003cem\u003ein vitro\u003c/em\u003e is significantly improved (Zhang et al. \u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e2022\u003c/span\u003e; Zeng et al. \u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e2023\u003c/span\u003e; Wen et al. \u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e2025\u003c/span\u003e). The presence of SeNPs produced by the studied strains in this work, but in a fermented beverage with orange-mango juice and milk, and in a mango passion fruit juice after their submission to the \u003cem\u003ein vitro\u003c/em\u003e gastrointestinal tract, suggested their resistance to harsh environmental conditions (Mart\u0026iacute;nez et al. \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Crespo et al., \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2025\u003c/span\u003e). Indeed, the SeNPs produced by the studied strains exhibit a high degree of colloidal stability probably due to their coating with biological macromolecules enhancing their performance in complex physiological environments. The SeNPs showed dual Se nature (amorphous and crystalline), with a versatile functional profile which can be applied in multiple technological applications expanding their potential application in biomedicine (biocompatibility), food, and other areas of nanotechnology.\u003c/p\u003e \u003cp\u003eAlthough the SeNPs produced by the studied strains showed promising characteristics; in order to produce them in an efficient and scalable manner, it is necessary to know the metabolic pathways involved in their synthesis. Thus, in this work, we analyzed the relative expression of genes probably involved in selenite reduction to SeNPs and/or seleno-amino acids. Unexpectedly, we observed that in \u003cem\u003eL. plantarum\u003c/em\u003e CRL2051, the expression of \u003cem\u003egsh\u003c/em\u003e and \u003cem\u003etrx\u003c/em\u003e was downregulated when grown in the presence of Se although the glutathione reductase (Gsh) activity was increased two-fold when this strain was grown in the presence of Se (Mart\u0026iacute;nez et al. \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Our results demonstrate that the increase in the enzymatic activity does not correlate with an increased gene transcription. The higher activity of Gsh could be due to structural modifications in the enzyme, such as the incorporation of SeCys, which is produced by this strain. In this regard, Galano et al. (\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2013\u003c/span\u003e) reported that in a \u003cem\u003eLactobacillus reuteri\u003c/em\u003e strain, certain enzymes involved in Se metabolism exhibited specific incorporation of SeCys into the active site when cells grew in the presence of this metalloid. On the other hand, no differences in the expression of \u003cem\u003etrx\u003c/em\u003e was observed, suggesting the involvement of a different pathway for SeNPs synthesis. In this regard, Qiao et al (\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2023\u003c/span\u003e) suggested that the nitrate reductase enzyme was involved in the reduction of selenite to Se\u003csup\u003e0\u003c/sup\u003e in \u003cem\u003eL. casei\u003c/em\u003e ATCC 393, as they observed that the addition of potassium nitrate (nitrate reductase enzyme activator) increased the rate of selenite reduction, while the addition of an inhibitor of this enzyme significantly decreased its reduction.\u003c/p\u003e \u003cp\u003eIn \u003cem\u003eF. tropaeoli\u003c/em\u003e CRL2034, overexpression of the \u003cem\u003egshR\u003c/em\u003e genes could indicate that the cell is actively requiring this protein in the presence of Se. In this strain, contrary to what was observed in \u003cem\u003eL. plantarum\u003c/em\u003e CRL2051, GshR activity decreased threefold when \u003cem\u003eF. tropaeoli\u003c/em\u003e CRL2034 was previously grown in the presence of Se (Mart\u0026iacute;nez et al. \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Therefore, if this enzyme is involved in Se reduction and its activity is lower when grown in the presence of this metalloid, it is possible that \u003cem\u003eF. tropaeoli\u003c/em\u003e CRL2034 induced its overexpression. The thioredoxin system is composed of thioredoxin reductase (TrxR), thioredoxin (Trx), and NADPH. This system, present in many bacteria, participates in various redox reactions, where Trx reduces oxidized substrates or compounds, and the oxidized Trx is regenerated by the action of TrxR, which utilizes NADPH in the process (Shimizu et al. \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Although TrxR has been linked to selenite reduction in \u003cem\u003eF. tropaeoli\u003c/em\u003e CRL2034, a moderate increase in \u003cem\u003etrx\u003c/em\u003e expression was observed in this work (Mart\u0026iacute;nez et al. \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). On the other hand, although the presence of SeCys was detected in the protein extract of \u003cem\u003eF. tropaeoli\u003c/em\u003e CRL2034, the expression of \u003cem\u003escl\u003c/em\u003e was not modified when this strain was grown in the presence of selenite.\u003c/p\u003e \u003cp\u003eWhen the selenized cells of \u003cem\u003eL. plantarum\u003c/em\u003e CRL2051 and \u003cem\u003eF. tropaeoli\u003c/em\u003e CRL2034 were grown in MRSf, the relative expression of the genes coding for Gsh was downregulated with respect to the expression of this gene in the non-selenized cells. Moreover, in \u003cem\u003eF. tropaeoli\u003c/em\u003e CRL2034, the expression of \u003cem\u003etrx\u003c/em\u003e and \u003cem\u003escl\u003c/em\u003e, which were overexpressed when the cells were grown in the presence of selenite, was downregulated in the selenized cells with respect to the non-selenized ones. This fact could be due to the absence of selenite in the culture medium were the selenized cells were grown and to the synthesis of SeNPs (during selenization) reducing the Se toxicity as it is known that bacteria produce SeNPs as a detoxifying mechanism.\u003c/p\u003e \u003cp\u003eThe effect of selenization on the relative protein and gene expression of the LAB strains was studied to determine if the properties of the selenized cells remained, even when selenite was no longer present in the culture medium, which could be the case when selenized cells are used for food fermentation and/or as probiotics (capsules, suspensions). Changes in the protein expression could affect cell stress resistance and/or the expression of antioxidant enzymes or those related to cell hydrophobicity, which could have a positive effect on the host health.\u003c/p\u003e \u003cp\u003eThe proteomic analysis of \u003cem\u003eL. plantarum\u003c/em\u003e CRL2051 showed the downregulation of proteins related to fatty acid metabolism, which could be related to the cellular response to the presence of Se species. Consistently, Wang et al. (\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e2024\u003c/span\u003e) suggested that changes in the relative content of membrane lipids could protect the cells from Se-induced stress or could prevent the attachment of SeNPs to the cell membranes. On the other hand, Yang et al. (\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e2021\u003c/span\u003e) observed that \u003cem\u003eLevillactobacillus brevis\u003c/em\u003e JLD715 differentially expressed genes related to fatty acid metabolism in response to selenite. The repression of proteins related to the modulation of lipid metabolism could constitute a key mechanism of cellular response, possibly linked to membrane adaptation to oxidative stress induced by Se during selenization. Consistently, with these results, an increase in the membrane hydrophobicity of selenized cells of \u003cem\u003eL. plantarum\u003c/em\u003e CRL2051 was observed, which would improve the interaction between the LAB cells and those of the host, enhancing the LAB ability to exert health-beneficial effects. Furthermore, \u003cem\u003eL. plantarum\u003c/em\u003e CRL2051 overexpressed a lysozyme/muramidase (lp_3093) protein, which can hydrolyze peptidoglycan in Gram-positive bacteria, inducing peptidoglycan remodeling during growth and/or in response to stress. This enzyme is carefully regulated to maintain cellular integrity, and its activity can generate peptidoglycan fragments that act as signaling molecules to activate genes involved in cell wall repair and maintenance (Vermassen et al. \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). The selenized cells of \u003cem\u003eL. plantarum\u003c/em\u003e CRL2051 over-expressed the transcriptional regulator GntR (lp_0152), which is commonly upregulated in response to oxidative stress. This protein belongs to a group involved in the regulation of sugar, fatty acids, and amino acids metabolism (Capdevila et al. \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). Thus, its expression could be related to the repression of proteins related to the synthesis of fatty acid metabolism.\u003c/p\u003e \u003cp\u003eOn the other hand, the repression of the alpha subunit of the E1 component of the pyruvate dehydrogenase complex (PdhA) and the alpha subunit of citrate lyase (CitF) (both enzymes that converge in the generation of acetyl-CoA) could represent a metabolic strategy to redirect carbon flow toward alternative routes. Moreover, alpha-acetolactate decarboxylase (AldB) was overexpressed. This enzyme catalyzes the formation of acetoin and 2,3-butanediol from pyruvate. Acetoin is a neutral compound from a fermentative perspective due to its low contribution to medium acidification. This metabolic shift would not only help to reduce the accumulation of acidic metabolites but could also facilitate the regeneration of NAD⁺ from NADH. This process could be beneficial for the cell, since NAD⁺ is essential for maintaining redox balance. Furthermore, the regenerated NAD⁺ could participate in antioxidant mechanisms, helping the cell cope with redox stress induced by the presence of Se.\u003c/p\u003e \u003cp\u003eSelenized cells of \u003cem\u003eL. plantarum\u003c/em\u003e CRL2051 also overexpressed a permease of the phosphate transport system (PstC); phosphate transport can be affected by the presence of SeO₃\u0026sup2;⁻, since this anion competes with phosphate for the same transporters (Zhu et al. \u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Therefore, it could be inferred that this permease could have been involved in the incorporation/release of selenite into the cell.\u003c/p\u003e \u003cp\u003eThe proteomic analysis of the selenized cells of \u003cem\u003eF. tropaeoli\u003c/em\u003e CRL2034 showed that the alpha subunit of RNA polymerase and the alpha chain of phenylalanyl-tRNA synthetase were up-regulated with respect to their expression by non-selenized cells. Both proteins are involved in transcription and translation, suggesting a general decrease in biosynthetic activity. Furthermore, the repression of energy metabolism enzymes such as phosphate acetyltransferase and L-lactate dehydrogenase indicates a metabolic adaptation. On the other hand, repressed proteins linked to the initiation of DNA replication, such as DNA primase, were observed in selenized cells, suggesting a possible cell cycle arrest to prioritize genetic repair. Moreover, repression of the phenazine biosynthesis protein (PhzF), was observed. Phenazines constitute a family of more than 150 bacterial secondary metabolites with redox properties, which give them broad-spectrum antibiotic activity (Diederich et al. \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). The redox activity of phenazines can generate reactive oxygen species (ROS), contributing to intracellular oxidative stress. In this sense, the repression of PhzF could be interpreted as a self-protective strategy against an already oxidizing environment due to the presence of Se species.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAuthor Contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll authors contributed to the study conception and design. Material preparation, data collection and analysis were performed by Laura Crespo, Mar\u0026iacute;a Victoria Tuttolomondo and Fernando Mart\u0026iacute;nez. The first draft of the manuscript was written by Laura Crespo and all authors commented on previous versions of the manuscript. All authors read and approved the final manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by grants PIP 2021-0691 from CONICET and PICT 2019-0037 from FONCyT, Argentina\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe mass spectrometry data have been deposited to the Proteome Xchange Consortium via the PRIDE (Perez-Riverol et al. 2025) partner repository with the dataset identifier PXD074180 submitted on February 7, 2026\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interest\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no competing interest.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n \u003cli\u003eAjdary M, Moosavi M A, Rahmati M, Falahati M, Mahboubi M, Mandegary A, Jangjoo S, Mohammadinejad R, Varma RS (2018) Health concerns of various nanoparticles: A review of their \u003cem\u003ein vitro\u003c/em\u003e and \u003cem\u003ein vivo\u003c/em\u003e toxicity. Nanomaterials (Basel). 8:634. https://doi.org/10.3390/nano8090634\u003c/li\u003e\n \u003cli\u003eAminisough, SA, Daneshjou S, Khajeh K (2024) Biosynthesis, characterization, and investigation of cytotoxic activities of selenium nanoparticles utilizing \u003cem\u003eLimosilactobacillus fermentum\u003c/em\u003e. Green Process Synth 13:20240030. https://doi.org/10.1515/gps-2024-0030\u003c/li\u003e\n \u003cli\u003eAnderson A, Sanders A, Smith W (2000) Raman spectra of selenium dioxide at low temperatures. J Raman Spectrosc 31(5):403-406. https://doi.org/10.1002/10974555(200005)31:5%3C403::AIDJRS529%3E3.0.CO;2-K\u003c/li\u003e\n \u003cli\u003eAshengroph M, Hosseini SR (2021) A newly isolated \u003cem\u003eBacillus amyloliquefaciens\u003c/em\u003e SRB04 for the synthesis of selenium nanoparticles with potential antibacterial properties. Int Microbiol 24:103-114. https://doi.org/10.1007/s10123-020-00147-9\u003c/li\u003e\n \u003cli\u003eBisht N, Phalswal P, Khanna, PK (2022) Selenium nanoparticles: A review on synthesis and biomedical applications. Mater Adv 3(3):1415-1431. https://doi.org/10.1039/D1MA00639H\u003c/li\u003e\n \u003cli\u003eCapdevila D, Rond\u0026oacute;n JJ, Edmonds KA, Rocchio JS, Dujovne MV, Giedroc DPJCR, (2024) Bacterial metallostasis: metal sensing, metalloproteome remodeling, and metal trafficking. Chem Rev 124(24):13574-13659. https://doi.org/10.1021/acs.chemrev.4c00264\u003c/li\u003e\n \u003cli\u003eCrespo L, Della Fontana FD, Sede Lucena B, Lotufo Haddad AM, Goldner MC, Mozzi F, Pescuma M (2025) Microbial selenization as a strategy to deliver selenium and selenium nanoparticles in mango-passion fruit juice fermented by indigenous lactic acid bacteria. Curr Microbiol 82(7):318. https://doi.org/10.1007/s00284-025-04255-5\u003c/li\u003e\n \u003cli\u003eDiederich C, Leypold M, Culka M, Weber H, Breinbauer R, Ullmann G M, Blankenfeldt W, (2017) Mechanisms and specificity of phenazine biosynthesis protein PhzF. Sci Rep 7(1):6272. https://doi.org/10.1038/s41598-017-06278-w\u003c/li\u003e\n \u003cli\u003eEdwards HGM (2006) Spectra-structure correlations in Raman spectroscopy. HVS 3:1838-1871. https://doi.org/10.1002/0470027320.s4103\u003c/li\u003e\n \u003cli\u003eEscobar-Ram\u0026iacute;rez MC, Rodr\u0026iacute;guez-Serrano GM, Z\u0026uacute;\u0026ntilde;iga-Le\u0026oacute;n E, Garc\u0026iacute;a-Montes MA, P\u0026eacute;rez-Escalante E, Gonz\u0026aacute;lez-Olivares LG (2023) Selenocysteine formation by \u003cem\u003eEnterococcus faecium\u003c/em\u003e ABMC-05 follows a mechanism that is not dependent on genes \u003cem\u003esel\u003c/em\u003e A and \u003cem\u003esel\u003c/em\u003e D but on gene \u003cem\u003ecys\u003c/em\u003e K. Fermentation 9(7):684. https://doi.org/10.3390/fermentation9070684\u003c/li\u003e\n \u003cli\u003eGalano E, Mangiapane E, Bianga J, Palmese A, Pessione E, Szpunar J, Lobinski R, Amoresano A (2013) Privileged incorporation of selenium as selenocysteine in \u003cem\u003eLactobacillus reuteri\u003c/em\u003e proteins demonstrated by selenium-specific imaging and proteomics. Mol Cell Proteomics 12:2196-2204. https://doi.org/10.1074/mcp.M113.027607\u003c/li\u003e\n \u003cli\u003eG\u0026oacute;mez-G\u0026oacute;mez, B, P\u0026eacute;rez-Corona T, Mozzi F, Pescuma M, Madrid Y (2019) Silac-based quantitative proteomic analysis of \u003cem\u003eLactobacillus reuteri\u003c/em\u003e CRL 1101 response to the presence of selenite and selenium nanoparticles. J Proteomics 195:53-65. https://doi.org/10.1016/j.jprot.2018.12.025\u003c/li\u003e\n \u003cli\u003eKamble S, Agrawal S, Cherumukkil S, Sharma V, Jasra RV, Munshi P (2022) Revisiting zeta potential, the key feature of interfacial phenomena, with applications and recent advancements. ChemistrySelect 7(1):e202103084. https://doi.org/10.1002/slct.202103084\u003c/li\u003e\n \u003cli\u003eLi W, Lu X, Jiang L, Wang X (2024) Biosafety and pharmacokinetic characteristics of polyethylene pyrrolidone modified nano selenium in rats. BMC Biotechnol 24(1):98. https://doi.org/10.1186/s12896-024-00915-9\u003c/li\u003e\n \u003cli\u003eLuo W, Li,Y, Zhao J, Niu R, Xiang C, Zhang M, Xiao C, Liu W, Gu R (2024) CD44-targeting hyaluronic acid-selenium nanoparticles boost functional recovery following spinal cord injury. J Nanobiotechnol 22(1):37. https://doi.org/10.1186/s12951-024-02302-0\u003c/li\u003e\n \u003cli\u003eMarfet\u0026aacute;n JA, Gallo AL, Farias ME, V\u0026eacute;lez ML, Pescuma M, Ordo\u0026ntilde;ez OF (2023) \u003cem\u003eExiguobacterium\u003c/em\u003e sp. as a bioinoculant for plant-growth promotion and Selenium biofortification strategies in horticultural plants. World J Microbiol Biotechnol 39(5):134. https://doi.org/10.1007/s11274-023-03571-x\u003c/li\u003e\n \u003cli\u003eMart\u0026iacute;nez FG, Cuencas Barrientos ME, Mozzi F, Pescuma M (2019) Survival of selenium-enriched lactic acid bacteria in a fermented drink under storage and simulated gastrointestinal digestion. Food Res Int 123:115-124. https://doi.org/10.1016/j.foodres.2019.04.057\u003c/li\u003e\n \u003cli\u003eMart\u0026iacute;nez FG, Martin-Moreno G, Pescuma M, Madrid-Albarran Y, Mozzi F (2020) Biotransformation of selenium by lactic acid bacteria: Formation of seleno- nanoparticles and seleno-amino acids. Front Bioeng Biotechnol 8:506. https://doi.org/10.3389/fbioe.2020.00506\u003c/li\u003e\n \u003cli\u003eMart\u0026iacute;nez FG, Moreno-Martin G, Mozzi F, Madrid Albarr\u0026aacute;n Y, Pescuma M (2023) Selenium stress response of the fruit origin strain \u003cem\u003eFructobacillus tropaeoli\u003c/em\u003e CRL 2034. Appl Microbiol Biotechnol 107(4):1329-1339. https://doi.org/10.1007/s00253-023-12379-6\u003c/li\u003e\n \u003cli\u003eMart\u0026iacute;nez FG, Moreno-Mart\u0026iacute;n G, Mohamed F, Pescuma M, Madrid Albarr\u0026aacute;n Y, Mozzi F (2024) Selenium-enriched fermented beverage with improved sensorial properties using lactic acid bacteria. J Food Sci Technol 61(11):2133-2144. https://doi.org/10.1007/s13197-024-05984-4\u003c/li\u003e\n \u003cli\u003eMoreno-Mart\u0026iacute;n G, Pescuma M, P\u0026eacute;rez-Corona T, Mozzi, F, Madrid Y, (2017) Determination of size and mass-and number-based concentration of biogenic SeNPs synthesized by lactic acid bacteria by using a multimethod approach. Anal Chim Acta 992:34-41. https://doi.org/10.1016/j.aca.2017.09.033\u003c/li\u003e\n \u003cli\u003eNikam PB, Salunkhe JD, Minkina T, Rajput VD, Kim BS, Patil SV (2022) A review on green synthesis and recent applications of red nano Selenium. Results Chem 4:100581. https://doi.org/10.1016/j.rechem.2022.100581\u003c/li\u003e\n \u003cli\u003eOnta\u0026ntilde;on OM, Bedő S, Ghio S, Garrido MM, Topalian J, Jahola D, Feh\u0026eacute;r A, Valacco MP, Campos El, Feh\u0026eacute;r C (2021) Optimization of xylanases production by two \u003cem\u003eCellulomonas\u003c/em\u003e strains and their use for biomass deconstruction. Appl Microbiol Biotechnol 105(11):4577-4588. https://doi.org/10.1007/s00253-021-11305-y\u003c/li\u003e\n \u003cli\u003ePescuma M, Aparicio F, Zysler RD, Lima E, Zapata C, Marfet\u0026aacute;n JA, V\u0026eacute;lez ML, Ordo\u0026ntilde;ez OF (2023) Biogenic selenium nanoparticles with antifungal activity against the wood-rotting fungus \u003cem\u003eOligoporus pelliculosus\u003c/em\u003e. Biotechnol Reports 37:e00787. https://doi.org/10.1016/j.btre.2023.e00787\u003c/li\u003e\n \u003cli\u003ePescuma M, G\u0026oacute;mez-G\u0026oacute;mez B, Perez-Corona T, Madrid Y, Mozzi F (2017) Food prospects of selenium enriched \u003cem\u003eLactobacillus acidophilus\u003c/em\u003e CRL 636 and \u003cem\u003eLactobacillus reuteri\u003c/em\u003e CRL 1101. J Funct Foods 35:466-473. https://doi.org/10.1016/j.jff.2017.06.009\u003c/li\u003e\n \u003cli\u003ePerez-Riverol Y, Bandla C, Kundu DJ, Kamatchinathan S, Bai J, Hewapathirana S, John NS, Prakash A, Walzer M, Wang S, Vizca\u0026iacute;no JA (2025) The PRIDE database at 20 years: 2025 update. Nucleic Acids Res 53:543-553. https://doi.org/10.1093/nar/gkae1011\u003c/li\u003e\n \u003cli\u003ePiacenza E, Presentato A, Turner RJ (2018) Stability of biogenic metal (loid) nanomaterials related to the colloidal stabilization theory of chemical nanostructures. Crit Rev Biotechnol 38(8):1137-1156. https://doi.org/10.1080/07388551.2018.1440525\u003c/li\u003e\n \u003cli\u003ePiacenza E, Presentato, A, Ferrante F, Cavallaro G, Alduina R, Chillura Martino, DF (2021) Biogenic selenium nanoparticles: a fine characterization to unveil their thermodynamic stability. Nanomaterials 11(5):1195. https://doi.org/10.3390/nano11051195\u003c/li\u003e\n \u003cli\u003ePuspitasari IM, Abdulah R, Yamazaki C, Kameo S, Nakano T, Koyama H (2014) Updates on clinical studies of selenium supplementation in radiotherapy. Radiat Oncol 9(1):125. https://doi.org/10.1186/1748-717X-9-125\u003c/li\u003e\n \u003cli\u003eQiao L, Dou X, Song X, Chang J, Zeng X, Zhu L, Xu C (2023) Selenite bioremediation by food-grade probiotic \u003cem\u003eLactobacillus casei\u003c/em\u003e ATCC 393: insights from proteomics analysis. Microbiol Spectr 11(3):e00659-00623. https://doi.org/10.1128/spectrum.00659-23\u003c/li\u003e\n \u003cli\u003eRao V, Poonia, A (2024) Microbial biosynthesis of selenium nanoparticles using probiotic strain and its characterization. Food Measure. 18(7):5477-5488. https://doi.org/10.1007/s11694-024-02581-z\u003c/li\u003e\n \u003cli\u003eRodriguez-Loya J, Lerma M, Gardea-Torresdey JL (2023) Dynamic light scattering and its application to control nanoparticle aggregation in colloidal systems: a review. Micromachines 15(1):24. https://doi.org/10.3390/mi15010024\u003c/li\u003e\n \u003cli\u003eSatarzadeh N, Sadeghi Dousari A, Amirheidari B, Shakibaie M, Ramezani Sarbandi A, Forootanfar H (2023) An insight into biofabrication of selenium nanostructures and their biomedical application. 3 Biotech 13(3):79. https://doi.org/10.1007/s13205-023-03476-4\u003c/li\u003e\n \u003cli\u003eSchmittgen TD, Livak KJ (2008) Analyzing real-time PCR data by the comparative CT method. Nat Protoc 3(6):1101-1108. https://doi.org/10.1038/nprot.2008.73\u003c/li\u003e\n \u003cli\u003eShahbaz M, Akram A, Raja NI, Mukhtar T, Mashwani ZUR, Mehak A, Fatima N, Sarwar S, Haq EU, Yousaf T (2022) Green synthesis and characterization of selenium nanoparticles and its application in plant disease management: a review. Pak J Phytopathol 34(1):189-202. http://dx.doi.org/10.33866/phytopathol.034.01.0739\u003c/li\u003e\n \u003cli\u003eShimizu A, Tobe R, Aono R, Inoue M, Hagita S, Kiriyama K, Toyotake Y, Ogawa T, Kurihara T, Goto K, Prakash NT, Mihara H (2021) Initial step of selenite reduction via thioredoxin for bacterial selenoprotein biosynthesis. Int J Mol Sci 22(20):10965. https://doi.org/10.3390/ijms222010965\u003c/li\u003e\n \u003cli\u003eSimakin AV, Baimler IV, Dikovskaya AO, Kazantseva DV, Yanykin DV, Voronov VV, Uvarov OV, Astashev ME, Sarimov RM, Ivanov VE, Bruskov VI, Kozlov VA, (2024) Laser fragmentation of amorphous and crystalline selenium of various morphologies and assessment of their antioxidant and protection properties. Front Chem 12:1459477. https://doi.org/10.3389/fchem.2024.1459477\u003c/li\u003e\n \u003cli\u003eSkuodaitė E, Krylova V (2023) Synthesis and characterization of amorphous selenium, cadmium and silver selenide thin films on polyamide-6. Coatings 13(10):1661. https://doi.org/10.3390/coatings13101661\u003c/li\u003e\n \u003cli\u003eSpyridopoulou K, Tryfonopoulou E, Aindelis G, Ypsilantis P, Sarafidis C, Kalogirou O, Chlichlia K (2021) Biogenic selenium nanoparticles produced by \u003cem\u003eLactobacillus casei\u003c/em\u003e ATCC 393 inhibit colon cancer cell growth in vitro and \u003cem\u003ein vivo\u003c/em\u003e. Nanoscale Adv 3(9):2516-2528. https://doi.org/10.1039/d0na00984a\u003c/li\u003e\n \u003cli\u003eStaicu LC, Barton LL (2017) Bacterial Metabolism of Selenium\u0026mdash;For Survival or Profit. In: van Hullebusch, E. (eds) Bioremediation of Selenium Contaminated Wastewater. Springer, Cham. https://doi.org/10.1007/978-3-319-57831-6_1\u003c/li\u003e\n \u003cli\u003eTatari A, Salimi F, Aghazadeh S, Amini S (2026) Flower-shaped ZnO nanoparticles from \u003cem\u003eLactococcus lactis\u003c/em\u003e LAB2: potential selective anti-cancer activity via oxidative stress modulation. World J Microbiol Biotechnol 42:43. https://doi.org/10.1007/s11274-025-04691-2\u003c/li\u003e\n \u003cli\u003eTugarova AV, Mamchenkova PV, Dyatlova YA, Kamnev AA (2018) FTIR and Raman spectroscopic studies of selenium nanoparticles synthesised by the bacterium \u003cem\u003eAzospirillum thiophilum\u003c/em\u003e. Spectrochim. Acta A Mol Biomol Spectrosc 192:458-463. https://doi.org/10.1016/j.saa.2017.11.050\u003c/li\u003e\n \u003cli\u003eVermassen A, Leroy S, Talon R, Provot C, Popowska M, Desvaux M (2019) Cell wall hydrolases in bacteria: insight on the diversity of cell wall amidases, glycosidases and peptidases toward peptidoglycan. Front Microbiol 10:331. https://doi.org/10.3389/fmicb.2019.00331\u003c/li\u003e\n \u003cli\u003eWadhwani SA, Shedbalkar UU, Singh R, Chopade BA (2016) Biogenic selenium nanoparticles: Current status and future prospects. Appl Microbiol Biotechnol 100(6):2555-2566. https://doi.org/10.1007/s00253-016-7300-7\u003c/li\u003e\n \u003cli\u003eWang L, Ju J, Xie H, Qiao F, Luo Q, Zhou L (2024) Comparative study on growth and metabolomic profiles of six Lactobacilli strains by sodium selenite. Microorganisms 12(10):1937. https://doi.org/10.3390/microorganisms12101937\u003c/li\u003e\n \u003cli\u003eWang Q, Wang C, Kuang S, Wang D, Shi Y (2023) Biological selenite reduction, characterization and bioactivities of selenium nanoparticles biosynthesised by \u003cem\u003ePediococcus acidilactici\u003c/em\u003e DSM20284. Molecules 28(9):3793. https://doi.org/10.3390/molecules28093793\u003c/li\u003e\n \u003cli\u003eWen C, Tang J, Liu D, Fan M, Lin X, Liu G, Liang L, Liu X, Zhang J, Li Y, Duan Y, Xu X (2025) Selenium release during the simulated gastrointestinal digestion and antioxidant activity of selenium nanoparticles stabilized by \u003cem\u003eGrifola frondosa\u003c/em\u003e polysaccharides and gallic acid conjugates. Int J Biol Macromol 144620. https://doi.org/10.1016/j.ijbiomac.2025.144620\u003c/li\u003e\n \u003cli\u003eYang X, Dai X, Jin H, Lin G, Wang Z, Song Y, Zhang W, Man C, Jiang Y (2021) Physicochemical and transcriptomic responses of \u003cem\u003eLactobacillus brevis\u0026nbsp;\u003c/em\u003eJLD715 to sodium selenite. J Sci Food Agric\u003cem\u003e\u0026nbsp;\u003c/em\u003e101(10):4332-4341. https://doi.org/10.1002/jsfa.11073\u003c/li\u003e\n \u003cli\u003eYang Z, Lian J, Yang Y, Li J, Guo W, Lv X, Ni L, Chen Y (2025) Selenium enrichment enhances the alleviating effect of \u003cem\u003eLactobacillus rhamnosus\u003c/em\u003e GG on alcoholic liver injury in mice. Curr Res Food Sci 10:100964. https://doi.org/10.1016/j.crfs.2024.100964\u003c/li\u003e\n \u003cli\u003eYazdi MH, Mahdavi M, Setayesh N, Esfandyar M, Shahverdi AR (2013) Selenium nanoparticle-enriched \u003cem\u003eLactobacillus brevis\u003c/em\u003e causes more efficient immune responses \u003cem\u003ein vivo\u003c/em\u003e and reduces the liver metastasis in metastatic form of mouse breast cancer. DARU 21(1):33. https://doi.org/10.1186/2008-2231-21-33\u003c/li\u003e\n \u003cli\u003eZeng L, Peng Q, Li Q, Bi Y, Kong F, Wang Z, Tan S (2023) Synthesis, characterization, biological activity, and in vitro digestion of selenium nanoparticles stabilized by Antarctic ice microalgae polypeptide. Bioorg Chem 141:106884. https://doi.org/10.1016/j.bioorg.2023.106884\u003c/li\u003e\n \u003cli\u003eZhang J, Yang X, Ji T, Wen C, Ye Z, Liu X, Liang L, Liu G, Xu X (2022) Digestion and absorption properties of \u003cem\u003eLycium barbarum\u003c/em\u003e polysaccharides stabilized selenium nanoparticles. Food Chem 373:131637. https://doi.org/10.1016/j.foodchem.2021.131637\u003c/li\u003e\n \u003cli\u003eZhu TT, Tian LJ, Yu HQ (2020) Phosphate-suppressed selenite biotransformation by \u003cem\u003eEscherichia coli\u003c/em\u003e. Environ Sci Technol 54(17):10713-10721. https://doi.org/10.1021/acs.est.0c02175\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":true,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"selenium biotransformation, lactic acid bacteria, glutathione reductase, proteomic analysis, cell wall adaptation","lastPublishedDoi":"10.21203/rs.3.rs-9023036/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-9023036/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eLactic acid bacteria (LAB) produce selenium-nanoparticles (SeNPs). However, the molecular and genetic mechanisms involved in these biotransformation processes are not yet fully understood. This work aimed to physicochemically characterize the SeNPs produced by \u003cem\u003eFructobacillus tropaeoli\u003c/em\u003e CRL2034 and \u003cem\u003eLactiplantibacillus plantarum\u003c/em\u003e CRL2051, study the differential expression of genes related to SeNPs synthesis and to analyze the relative expression of genes and proteins of selenized and non-selenized cells (control). The SeNPs produced by \u003cem\u003eF. tropaeoli\u003c/em\u003eCRL2034 and \u003cem\u003eL. plantarum\u003c/em\u003e CRL2051 showed an average size of 216.05 ± 19 and 286.14 ± 44 nm and ζ of –59.42 ± 5 and –56.77 ± 7 mV, respectively. The SeNPs produced showed spectroscopic signals compatible with Se–Se bonds and functional groups that confirm a biological coating composed of proteins, polysaccharides, and lipids. These SeNPs showed a dual structure, amorphous and crystalline. \u003cem\u003eF. tropaeoli\u003c/em\u003e CRL2034 glutathione reductases and thioredoxin reductase could be involved in Se metabolism and SeNPs synthesis, while in \u003cem\u003eL. plantarum\u003c/em\u003e CRL2051 a different strategy for SeNPs synthesis could be implicated. Selenized cells of \u003cem\u003eL. plantarum\u003c/em\u003e differentially expressed proteins related to fatty acid metabolism and overexpressed a lysozyme/muramidase, which could be related to membrane and cell wall adaptation to Se-induced stress. Selenized cells of both strains repressed energy metabolism-related enzymes, which could be harmful to cell survival. The SeNPs produced by both LAB strains have suitable characteristics to be used in nutrition and/or biomedicinal applications. Moreover, the selenized LAB strains could have improved stress resistance properties and/or better adhesion to intestinal cells.\u003c/p\u003e","manuscriptTitle":"Comparative molecular insights into selenium metabolism and nanoparticle biogenesis by Fructobacillus tropaeoli CRL2034 and Lactiplantibacillus plantarum CRL2051","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2026-03-05 09:55:48","doi":"10.21203/rs.3.rs-9023036/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"d9efc949-ba53-4657-aeb4-4be2b0e6068f","owner":[],"postedDate":"March 5th, 2026","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":63866536,"name":"Biological Chemistry"},{"id":63866537,"name":"Applied \u0026 Industrial Microbiology"},{"id":63866538,"name":"Nanoscience"}],"tags":[],"updatedAt":"2026-03-05T09:55:48+00:00","versionOfRecord":[],"versionCreatedAt":"2026-03-05 09:55:48","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-9023036","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-9023036","identity":"rs-9023036","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}