Liriodendron attenuates intestinal fibrosis and inflammation in mice with radiation proctopathy | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Liriodendron attenuates intestinal fibrosis and inflammation in mice with radiation proctopathy Hao Huang, Junsheng Li, Yanling Zhang, Bin Liu, Guiqing Jia, Gaoping Zhao This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7060441/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 27 Oct, 2025 Read the published version in Chinese Medicine → Version 1 posted 11 You are reading this latest preprint version Abstract Radiotherapy is a routinely therapeutic approach for malignant tumors in the abdomen. Nevertheless, radiation proctopathy is the main side effects that occur during radiotherapy and there are scarce pharmaceutical interventions available. In this study we aimed to investigate the effectiveness of Liriodendron, a primary extract used in traditional Chinese medicine Fibraureae Caulis, on the prevention and treatment of radiation proctopathy. We created a mouse model of radioactive proctopathy by local irradiation and analyzed various clinicopathologic measures for the subsequent eight weeks. We found that Liriodendron gavage group and Liriodendron enema groupwith radiation proctopathy resulted in a reduction in the generation of pro-inflammatory cytokines and an increase in the secretion of anti-inflammatory cytokines by transcriptome sequencing analysis and ELISA examination. Additionally, Liriodendron administration resulted in a reductionin the level of reactive oxygen species (ROS) and apoptotic cells in intestinal tissue of mice. MASSON staining and immunohistochemistry revealed that Liriodendron could reduce the expression of α-SMA in rectal tissue and the level of intestinal fibrosis in mice with radiation proctopathy. In conclusion, this study suggests that Liriodendron has the potential to be used as a medication for treating radiation proctopathy. Radiation proctopathy Liriodendron Oxidative stress Anti-apoptosis Anti-fibrosis Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 1. Introduction Cancer, a prominent worldwide health issue, is currently predominantly treated through surgical procedures, radiotherapy, chemotherapy, immunotherapy, targeted therapy, hormone therapy, and other methods. Radiotherapy is administered to around 70% of cancer patients as a component of their treatment plan, and it is crucial in reaching remission for 25% of cases [1] . Nevertheless, finding solutions to mitigate the adverse effects of radiation on healthy tissues is a significant issue that requires immediate attention. Radiation proctopathy is a persistent inflammatory condition that occurs as a consequence of irradiation treatment for abdominal malignancies, including colorectal cancer, ovarian cancer, cervical cancer, bladder cancer, and others. The manifestation of symptoms usually occurs several months or even years after the completion of radiotherapy [2,3] . The characteristic pathological alterations are progressive mucosal and submucosal obliterative arteriolitis with interstitial fibrosis, which makes the intestinal wall mucosa edematous and fragile, with poor healing capacity [4] . The main clinical manifestations of radiation proctopathy are abdominal pain, diarrhea, intestinal dysfunction, mucopurulent and bloody stools, and fresh blood stools. Severe lesions can cause the intestinal lumen to narrow and form abscesses, which in turn affects the patients' nutritional intake. In advanced stages, some patients may experience intestinal obstruction or even intestinal perforation, posing a threat to their health and life [1,5] . The clinical effectiveness of radiation proctopathy is limited due to the absence of appropriate treatment. Furthermore, the precise mechanisms responsible for the development of radiation proctopathy are still unclear, necessitating further investigation into its pathophysiology, prevention, and treatment strategies. Currently, the prevention and treatment of radiation proctopathy using traditional Chinese medicine and Chinese medicinal preparations is a topic of significant interest in clinical treatment. Chinese medicinal formulas have demonstrated notable efficacy in treating radiation proctopathy thanks to their distinctive approach to evidence-based treatment [6] . According to Chinese medicine, Fibraureae Caulis has anti-inflammatory, antibacterial, and antioxidant properties, making it suitable for treating intestinal inflammation, infection, and other disorders. Liriodendron is the primary extract of traditional Chinese medicine, Fibraureae Caulis [7] . Studies have demonstrated that Liriodendron exhibits a notable antioxidant effect, effectively inhibiting the formation of free radicals and scavenging reactive oxygen species in the body. This antioxidant activity helps protect cells from free radical damage [8–10] . According to Yang et al. [10] , Liriodendron has been shown to effectively mitigate the impact of NF-κB and vascular endothelial growth factor (VEGF) in the lung tissues of mice [11] and improve the illness of animals with radiation-induced acute lung injury. Research has also demonstrated that Liriodendron can effectively cure ulcerative proctopathy by suppressing inflammation and oxidative stress, which is achieved through its action on the NF-κB signaling pathway. Nevertheless, it remains uncertain if Liriodendron will be helpful in treating radiation proctopathy. A mouse model of radiation proctopathy was developed in this study, which was found to be more congruent with the clinical radiotherapy practices compared to the whole abdominal irradiation model described in previous studies [11–13] . Our research revealed that Liriodendron can suppress inflammation and fibrosis in irradiated mice rectum tissues, which means that Liriodendron has the potential to be used as a medication for treating radiation proctopathy. 2. Materials and methods 2.1 Animals Healthy female C57/BL mice, 7–8 weeks old, weighing 18–20 g, were provided by Chengdu Dashuo Technology & Biology Co. Ltd., and divided into blank control group, irradiated-only group, Liriodendron gavage group and Liriodendron enema group, with 16 mice in each group. Mice were housed in a specific pathogen-free facility and provided adequate water and food. All tissue samples were obtained at week 8 post-RT. All the procedures were approved by the Animal Care and Use Committee of the Animal Research Institute of the Sichuan Provincial People's Hospital. The ethical number is Ethics (Research) No. 65 of 2017. 2.2 Irradiation modeling In this experiment, a chronic radiation proctitis model was established by a single high-dose local irradiation of the pelvis of mice. Irradiation was performed using a Rad Source RS2000Pro biological X-ray irradiator at the West China State Key Laboratory of Biotherapeutics, Sichuan University, with the radiation dose and irradiation rate (10 Gy, 1.32 Gy/min) [14] . After anesthetized by intraperitoneal injection of 1% pentobarbital sodium, mice in each group were placed into a 4 mm thick lead box in the supine position to expose the pelvic region (Fig. 2 F), and a single local irradiation of the pelvis was given to the mice in each group by using RS2000Pro biological X-ray irradiator to develop the irradiated model mice. The irradiated mice were given 100 mg/kg by gavage and enema 24 h after irradiation, once a week for 8 weeks, and the blank control group and the irradiated-only group were given gavage with 1% DMSO in water. 2.3 Enzyme-linked immunosorbent assay (ELISA) The mice TNF-α、IFN-γ、IL-10, and TGF-β1 (Ruixinbio, Quanzhou, China) were used to perform double antibody sandwich enzyme-linked immunosorbent assays. After warming and sufficient washing, the unbound components were removed, and a solid-phase antibody-antigen-enzymatic antibody sandwich complex formed on the solid-phase surface of the microtiter plate. Substrates A (0.01% hydrogen peroxide) and B (0.1% TMB) were added, and the substrate catalyzed by HRP to produce a blue product, which was finally converted to yellow in the presence of the terminating solution (2M sulfuric acid). The absorbance (OD) was measured at 450 nm wavelength using an enzyme marker (Rayto, RT-6100). The OD correlated positively with the concentration of the detectors in the samples to be tested. The concentration of the standard was used as the horizontal coordinate (6 standard wells, plus 10-value well, totaling 7 concentration points), and the corresponding OD value was used as the vertical coordinate. Using computer software, a four-parameter logistic curve fit (4-pl) was used to create a standard curve that allowed the concentration value of the sample to be calculated from its OD. The calibration product dose-response curve correlation coefficient, r-value, was ≥ 0.9900. 2.4 Immunoblotting Tissue was obtained from the upper one centimeter of the mouse anus. Harvested mouse rectal tissues were lysed with 200 µL P0013B RIPA strong lysis buffer (Beyotime, Shanghai) and 1 mM PMSF, then homogenized using a glass homogenizer (YJQ0928Q). After centrifugation at 10,000–14,000 g for 3–4 min, the supernatant was used for the BCA protein concentration assay (Therm Scientific, USA). A 1/4 volume of 5* SDS-PAGE loading buffer (P1040 Solarbio) was added to the lysate, followed by 10 min at 100°C. Protein samples were separated on SDS-PAGE gels and transferred to PVDF membranes, which were blocked with a protein-free fast-closing solution (Yarase, Shanghai) for 15–20 min. The membranes were then incubated overnight at 4°C with glucose transporter α-SMA antibody (ER1003 HUABIO Hangzhou) or GAPDH mice mAb (HRP conjugate ZENBIO) and further incubated for 1 hr at room temperature. After washing five times with TBST, membranes were incubated with HRP-conjugated secondary antibody for 2 hr. Following three washes with TBST (BL608A, Biosharp, Guangzhou, China), membranes were treated with ECL solution (Millipore) for 1–3 min, and protein bands were visualized using the Invitrogen imaging system (GoldBand protein marker, YEASEN, Shanghai). 2.5 Real-time RT-PCR According to standard procedures, total RNA was extracted from mice's liver tissue with TRIzol reagent (Invitrogen, Californian, USA). 1 µg of total RNA was used for the reverse transcription reaction, while the SYBR green pro taq HS premix qPCR Kit (AG11701 Accurate Biology, Changsha, China) and the Evo M-MIV reverse transcription premix kit (AG11728 Accurate Biology, China) were used for the real-time qPCR assays. The mRNA expression levels were detected by the CFX Manager system (BioRad, Californian, USA). GAPDH-F ATGATTCCACCCATGGCAAATTC GAPDH-R GACTCCACGACGTACTCAGC JUND-F TCTTGGGCTGCTCAAACTCG JUND-R CCTTCGGGTAGAGGAACTGC AP-1-F TGGGCACATCACCACTACAC AP-1-R TCTGGCTATGCAGTTCAGCC CXCL9-F CCGAGGCACGATCCACTAC CXCL9-R AGGCAGGTTTGATCTCCGTT Smad3-F TGAAGAAGCTCAAGAAGACGGG Smad3-R GAGGGAGCCCCTTCCGAT 2.6 H&E and MASSON staining Tissue was obtained from the upper one centimeter of the mouse anus. The fixed tissues were dehydrated using an automatic dehydration machine and then embedded with the sections dewaxed to water. H&E staining: hematoxylin for 10–20 min, rinse in tap water for 1–3 min, acid alcohol for 5-10s, rinse, warm water until blue, rinse again, then 85% alcohol for 3–5 min; eosin for 3–5 min, rinse, gradient alcohol dehydration, xylene transparency, and seal with neutral gum. MASSON stains: similar sectioning and dewaxing; incubate with potassium dichromate overnight, differentiate hematoxylin back to blue, titrate with Lichun red for 10 min, rinse, treat with phosphomolybdic acid for 1 min, stain with aniline blue for 2 min, dehydrate with alcohol, clear with xylene, and seal with neutral glue. H&E staining images were acquired using a 3DHISTECH (Budapest, Hungary) Panoramic 250 scanner, first at 40x for general observation, then at 100x and 400x for details. The positive expression area was analyzed with Image-Pro Plus 6.0 (Media Cybernetics, Californian, USA), calculating the percentage as positive area/total area (pixel area). SPSS 23.0 was used for t-tests, presenting data as mean ± SD. 2.7 Immunofluorescence The paraffin sections were dewaxed to water; antigen repaired; dropwise addition of goat serum blocking solution; blocked at room temperature for 20 min; dropwise addition of CD4 antibody(ab183685 abcam, Californian, USA); incubated overnight at 4°C; washed 3 times for 5 min each in PBS; dropwise addition of secondary antibody (FITC-labeled goat anti-rabbit) (GB22303 Servicebio, Wuhan, China) and incubation for 30 min at 37°C; washed 3 times for 5 min each in PBS; dropwise addition of DAPI and incubation at room temperature for 10 min; washed 3 times for 5 min each in PBS; and sealing of the slices using anti-fluorescence attenuating sealer. Each section was first observed at 100×, then 100× and 400× microscopic images were acquired for a total of 3 fields of view. The integrated density (IntDen) and area (area) of all the acquired images were measured using the Image-J image analysis system and the mean gray value (mean) of each image was then calculated. The mean fluorescence intensity of each sample was calculated using the mean fluorescence intensity of the two images. Similarly, CD8 antibody (ab217344 abcam) and secondary antibody (CY3-labeled goat anti-mice) (GB21301 Servicebio). The DAPI-stained cell nuclei were blue, CD8 positive expression was red, and CD4 expression was green. 2.8 Fecal occult blood test (FOBT) At the 1st, 4th, and 8th weeks after irradiation, fresh feces were collected from each group of mice into sterile EP tubes and mixed with a small amount of saline. Then fecal occult blood test strips were used to detect occult blood in feces of each group of mice with the following scoring criteria: negative: the blue-green color was not observed in 3 min, and the score was 0; weakly positive: the blue color was observed in 30–60 s, and the score was 1; positive: the blue-green color was immediately observed, and the score was 2; strongly positive: blood could be observed by the naked eye, and dark blue color was immediately observed, and the score was 3; strong positive: blood could be seen with the naked eye, and deep blue color was immediately observed, and the score was 3. blood stool can be observed, immediately show dark blue color, scored as 3 points. 2.9 Biochemical analysis Obtain mouse whole blood and centrifuge it at 3000 rpm for 15 min, obtain mouse serum, according to the instruction of the biochemical assay kit (Ruixinbio, Quanzhou, China), preheat the enzyme marker for 30 min, set the temperature at 37 ℃, set the wavelength corresponding to the detection indexes, and then add the sample serum, distilled water, and detection reagents into a 96-well plate, incubate at 37 ℃ for 5 min and then read the corresponding absorbance value. After 5 min incubation at 37 ℃, the absorbance values were read. The serum levels of alanine aminotransferase (ALT), azelaic transaminase (AST), albumin (ALB), creatinine (Cr), and urea nitrogen (BUN) were detected in mice according to the above method. 2.10 Sequencing of mRNA Tissue was obtained from the upper one centimeter of the mouse anus. Sequencing services were provided by Shanghai Bioscience Co. Rectal tissue samples from each mouse group were frozen in liquid nitrogen. We randomly selected 4 samples from the irradiation-only group and 6 samples from the Liriodendron gavage group for RNA extraction and transcriptomics analysis. PolyA mRNA was enriched using Oligo(dT) magnetic beads, and RNA was fragmented to approximately 300 bp. The first strand of cDNA was synthesized using a 6-base random primer, followed by second strand synthesis. Library construction included PCR amplification for fragment enrichment and size selection at 450 bp. Library quality was assessed using an Agilent 2100 Bioanalyzer. Libraries with different Index sequences were mixed proportionally, diluted to 2 nM, and denatured into single strands. Paired-end (PE) sequencing was performed on the Illumina platform using Next-Generation Sequencing (NGS). Gene expression was analyzed based on clean read counts, with differential expression calculated using DESeq2. GO enrichment analysis utilized Goatools, and KEGG pathway analysis was conducted with KOBA, applying Fisher's exact test for both analyses. 2.11 Detection of ROS (reactive oxygen species) in intestinal tissue by flow cytometry Tissue was obtained from the upper one centimeter of the mouse anus. The tissues were rinsed in pre-cooled PBS, cut into small pieces, and ground with a grinder. The cell suspension was collected, filtered through a 200-mesh sieve, and centrifuged at 1200 rpm for 5 min. The supernatant was discarded, and the pellet was washed twice with PBS and centrifuged at 300 g for 5 min to collect the cellular precipitate. DCFH-DA was diluted to 10 µmol/L, with 1 mL added to each tube, and incubated at 37°C for 20 min. After centrifugation at 1500 rpm for 5 min, the supernatant was discarded, and cells were washed three times to remove residual DCFH-DA. Positive controls were prepared using a serum-free medium at a 1:1,000 ratio. After adding probes, Rosup was diluted 1:1000 and added to the positive control. Cells were incubated at 37°C for 30 min, washed three times, and centrifuged at 1500 rpm for 5 min. The supernatant was discarded and resuspended with PBS. CytExpert software analyzed the flow data, and the ROS content in rectal tissues was assessed using an independent sample T-test in GraphPad Prism after exporting the results. 2.12 Detection of apoptosis in intestinal cells by TUNEL staining method The sections were washed 2–3 times with PBST solution and then acted with Triton X-100 solution and BSA solution for 30 min, respectively; the sections were washed repeatedly with PBST solution, the excess sealing solution was removed, the TdT enzyme reaction solution and TMR labeling solution were mixed well and then dripped on the sections, and the sections were incubated at a constant temperature and light protection for 1 hour. The sections were washed 2–3 times with PBST solution and then acted with DAPI solution for 5 min and light protection; the sections were washed twice with PBST solution and sealed using an autofluorescence quencher. The sections were washed 2–3 times with PBST solution, followed by a 5 min wash with DAPI solution, then washed twice with PBST solution before being sealed with anti-fluorescence quencher. The apoptosis of mouse intestinal tissues in each group was observed under a light microscope, photos were taken and stored, and the number of TUNEL-stained positive cells in each field of view was counted and calculated using Image J software. 2.13 Statistical analysis SPSS23.0 statistical analysis software was used to perform independent-sample T tests on the data, with the data expressed as mean ± standard deviation (mean ± SD). Two independent samples t-tests and the Kolmogorov-Smirnov test were used to verify whether the data had a normal distribution. Survival curve data were analyzed using the Log-rank (mantel-cox) test, and Two-way ANOVA in the Prism 9 Program (Graph Pad, San Diego, CA, USA) was used for the statistical analysis. P-values < 0.05 were considered to signify a statistically significant difference. 3. Results 3.1 Liriodendron attenuates irradiation damage in mice A mouse model of radiation proctopathy was created by exposing mice to local radiotherapy with a dose of 10 Gy to the abdomen. Utilizing the GVHD Mouse Clinical Rating Scale [15] , we assessed the clinical disease activity of mice that survived irradiation weekly. Our results indicate that the mice in the irradiation-only group had significantly higher scores compared to the mice in the Liriodendron gavage group. Furthermore, the mice in the Liriodendron gavage group exhibited significantly better evaluations than the irradiation-only group in terms of mobility and postures at rest (Fig. 1 A). By comparing the average body weights of the mice that survived after radiation exposure, we discovered that the mice exposed to radiation but not given Liriodendron treatment had considerably lower body weights and ingested less food during the initial week. However, mice that received Liriodendron treatment after radiation slightly reduced body weight and food consumption compared to the period before radiation exposure, and they are not statistically significant (Fig. 1 B). Furthermore, we noticed that the group exposed only to irradiation showed the loss and whitening of hair in the irradiated region during weeks 5–6 following the irradiation. Conversely, most mice of the Liriodendron gavage group did not exhibit any whitening of the irradiated area by week 8 (Fig. 2 E). We collected fecal samples from mice that survived irradiation and accomplished occult blood tests at weeks 1, 4, and 8 after irradiation. The fecal occult blood test was consistently negative in nonirradiated control mice. However, mice of other groups exhibited varying blood levels in their stool during the first week after irradiation. The fecal occult blood in the irradiated-only group persisted, with no notable improvement observed in the 4th and 8th weeks. Conversely, the mice in the Liriodendron-treated group exhibited a significant decrease in fecal occult blood levels, and there was a statistically significant difference (p < 0.001) compared with that in the irradiation group only (Fig. 1 C). After 8 weeks of observation, we found that the survival rate of the Liriodendron gavage group was about 81.25% (13/16), which was significantly higher than that of the irradiated-only group 56.25% (9/16), and the difference was statistically significant (p < 0.001). In addition, the survival rate in the Liriodendron enema group was about 62.5% (10/16), which was higher than that in the irradiated-only group, but the difference was not statistically significant (Fig. 1 D). 3.2 Liriodendron attenuates rectal inflammation in mice By comparing the total lengths of the rectums in each group of mice at week 8 after irradiation, we observed that the rectums of mice in the irradiated-only group exhibited significant contraction (Fig. 2 A) and were significantly shorter than those of the unirradiated group and the Liriodendron gavage group (p < 0.01) (Fig. 2 B). There was no significant difference in the rectum length between the irradiated-only group and the Liriodendron enema group. No images were included. By HE staining of pathological sections of the rectum of mice one centimeter near the anus, we found that the rectum of mice in the irradiated group had localized mucosal epithelial cell detachment, degeneration and necrosis of the mucosal layer, forming ulcer foci, and the necrotic area was missing or degenerated with necrosis of the intestinal glandular structure, and there were a small number of inflammatory cells infiltrated in the necrotic area, mainly lymphocytes with oval nuclei, and there were a small number of fibrous tissue proliferation, and the nuclei could be seen to be in the form of fibrous tissue, which could be seen as the nucleus of a small number of fibrous tissue. Fibroblasts with long oval nuclei were seen in the necrotic areas, while the mucosal structure of the rectal tissues of the mice treated by gavage with Liriodendron after irradiation was intact, with no obvious tissue degeneration, necrosis, or detachment, the intestinal gland cells in the lamina propria were densely arranged, and the morphology and number of cup cells were normal, the submucosal connective tissues were richly vascularized, and the muscular mucosae and plasma membrane layers were more structurally intact, with no apparent pathologic alterations seen (Fig. 2 C). The pathological scores of each group of mice were assessed using the semi-quantitative rectal radiopathological damage scale [16] . The mice that received Liriodendron treatment after irradiation exhibited significantly less intestinal histopathological damage than those in the irradiated-only group (p < 0.05) and were most pronounced in the intragastric group (p < 0.001) (Fig. 2 D). 3.3 Promotion of anti-inflammatory cytokines and inhibition of pro-inflammatory cytokines release by Liriodendron Since the significant rise in inflammatory cell infiltration in the rectal tissues of mice in the irradiated-only group compared to the Liriodendron gavage group, we further investigated the expression of CD4 + and CD8 + T cells in the irradiated regions of the mice's rectal tissues. This analysis was performed on the irradiated-only group and the Liriodendron gavage group (Fig. 3 A). We found that the mice in the group receiving Liriodendron gavage had a significantly higher number of CD4 + helper T cells in their intestinal tissues than in the irradiated-only group (p < 0.05) (Fig. 3 B). However, no significant difference in the expression of CD8 + effector T cells was observed (Fig. 3 C). Subsequently, we analyzed the concentrations of different pro-inflammatory and anti-inflammatory factors in the mice's serum. We found that the levels of TGF-β1 (p < 0.001) (Fig. 3 D) and IL-10 (p < 0.05) (Fig. 3 E) in the serum were significantly increased in the Liriodendron enema group compared to the irradiated-only group. Moreover, the highest levels of TGF-β1 (p < 0.001) and IL-10 (p < 0.001) in the serum were observed in the Liriodendron gavage group. Also, the levels of IFN-γ (p < 0.01) (Fig. 3 F) and TNF-α (p < 0.001) (Fig. 3 G) in the serum were significantly reduced in the Liriodendron enema group compared to the irradiated-only group, and the mice in the Liriodendron gavage group had the lowest levels of IFN-γ (p < 0.001) and TNF-α (p < 0.001) in their serum. 3.4 Liriodendron reduces the expression of intestinal fibrosis indicators in mice Due to the apparent difference between the Liriodendron gavage group and the irradiation-only group, we performed gene sequencing on the rectum tissues in the irradiated regions of these two groups of mice. A total of 204 genes were found to be up-regulated, while 72 genes were found to be down-regulated (Fig. 4 A). The heatmap analysis revealed a significant decrease in the expression of Jund, Ap-1, Cxcl9, and Smad3 in the rectum tissues of the Liriodendron gavage group after irradiation, as compared to the irradiation-only group (Fig. 4 B). The KEGG analysis demonstrated that the signaling pathway associated with rectal inflammatory bowel disease was down-regulated in the rectum tissues of the Liriodendron gavage group (Fig. 4 C). The GSEA analysis demonstrated that the collagen fibrillogenesis and TGF-β signaling pathways were down-regulated in the Liriodendron gavage group compared to the irradiation-only group (Fig. 4 D). The factors related to inflammation and fibrosis were confirmed using real-time fluorescence quantitative PCR. The results agreed with the sequencing results, showing reduced expression of Jund, Ap-1, Cxcl9, and Smad3 in the rectums of the Liriodendron gavage group (p < 0.05) (Fig. 4 E). 3.5 Liriodendron reduces oxidative damage and apoptosis in irradiated rectal tissues Based on the results of the sequencing analysis, it was observed that the pro-inflammatory pathway in the intestinal tissue of the Liriodendron gavage group was significantly down-regulated compared to the irradiation-only group. We assessed the level of reactive oxygen species (ROS) in the rectum cells of mice in three different groups: the control group, the irradiated group, and the Liriodendron gavage group. This assessment was done using flow cytometry, as shown in Fig. 5 A. The level of ROS in the rectum cells of mice in the Liriodendron gavage group was significantly reduced compared to those in the irradiation-only group (p < 0.05) (Fig. 5 B) (Fig. 5 C). In addition, the TUNEL method was used to measure the number of apoptotic cells in the rectum tissues of the three groups of mice (Fig. 5 D). The results showed that the percentage of apoptotic cells in the Liriodendron gavage group mice was significantly lower than in the irradiation-only group (p < 0.05) (Fig. 5 E). The observed effect may be attributed to the ability of Liriodendron to mitigate oxidative stress in the irradiated intestinal tissues, consequently decreasing apoptosis in the irradiated region of rectum tissue cells. 3.6 Liriodendron attenuates fibrosis in irradiated mouse rectum tissues Based on the above results, we found that gavaged with Liriodendron after irradiation significantly reduced rectal contracture and down-regulated the signaling pathway of collagen fiber organization in the intestinal tissue of mice. Consequently, we analyzed various indicators of intestinal fibrosis. Masson staining revealed that mice in the irradiation-only group exhibited an increased amount of fibronectin compared to mice in the Liriodendron gavage group (Fig. 6 A). This difference was statistically significant (p < 0.01) (Fig. 6 B). The immunohistochemistry analysis (Fig. 6 C) revealed a notable increase in α-SMA expression in the rectum tissue of mice in the irradiation-only group compared to the Liriodendron gavage group. This difference was statistically significant (p < 0.001) (Fig. 6 D). The expression of α-SMA was identified through protein immunoblotting in the irradiated area of mice in both the gavage-treated and irradiation-only groups (Fig. 6 E), and it showed that the expression of α-SMA in the Liriodendron gavage group was significantly lower than that in the irradiation-only group (p < 0.01) (Fig. 6 F). 4. Discussion Ionizing radiation can cause the production of a significant quantity of oxygen-free radicals in tissues in radiation proctopathy. Oxygen-free radicals can induce apoptosis by directly attacking or oxidizing biological macromolecules, including DNA and proteins [17] . This apoptosis can also result in abnormalities in the intestine's mechanical, immune, chemical, and biological barrier functions. Additionally, the intestinal flora's equilibrium is disturbed, resulting in the release of inflammatory factors and ultimate intestinal tissue damage [18] . This is consistent with the observed phenomenon, indicating that Liriodendron extracted from Fibraureae Caulis retained the antioxidant activity of Fibraureae Caulis and could exert a protective effect on the intestine. CD4 + T cells, an essential component of the immune system, can regulate inflammatory responses through multiple mechanisms [19–21] . In anti-inflammatory responses, CD4 + T cells can activate B cells to differentiate into plasma cells, produce specific antibodies to neutralize pathogens, and promote resolution of inflammation. Regulatory T cells (Tregs) can inhibit effector T cells and alleviate unnecessary inflammatory reactions. In addition, CD4 + T cells can secrete cytokines such as IL-4 and IL-10 to suppress the activation of inflammatory cells, reduce the release of inflammatory mediators, and alleviate inflammation. They can also secrete TGF-β to stimulate cell proliferation and the synthesis of extracellular matrix proteins, promoting tissue repair. In this study, we observed an increase in the number of CD4 + T cells in the intestinal tissues of mice after gavage with Liriodendron following irradiation, and the expression of anti-inflammatory factors in serum increased while pro-inflammatory factors decreased. This indicates that Liriodendron may exert anti-inflammatory effects through CD4 + T cells, thereby improving radiation-induced intestinal inflammatory damage. However, we did not investigate the types of CD4 + T cells that may have led to this phenomenon. Chronic intestinal fibrosis following radiotherapy is the primary pathological manifestation of radiation proctopathy, leading to abdominal pain, diarrhea, intestinal obstruction, intestinal perforation, and other symptoms. According to research, intestinal fibrosis is a systemic pathophysiological process characterized by changes in the extracellular matrix (ECM) and cell components of the intestinal wall, leading to the excessive accumulation of ECM and mesenchymal-like cells rich in collagen in the submucosa [22, 23] . Among them, myofibroblasts can secrete extracellular matrix (ECM) and various growth factors. After stimulation by inflammation or other factors, fibroblasts can transform and become activated into myofibroblasts. Activated myofibroblasts migrate to the injured site and continue to generate extracellular matrix (ECM), eventually leading to fibrosis [24] . α-Smooth muscle actin (α-SMA) is a characteristic protein of myofibroblasts. In this study, Masson's staining showed that intestinal fibrosis was significantly increased in irradiated mice, with high collagen fiber content in the submucosa, consistent with the pathological characteristics of clinical patients with radiation proctopathy. However, gavage with Liriodendron significantly reduced intestinal fibrosis in mice. The expression level of α-SMA in the rectum significantly increased after irradiation and decreased after drug administration. To explore the underlying mechanism, we performed differential gene enrichment analysis and observed that compared with irradiated mice alone, the expression of the collagen fiber formation signaling pathway and the TGF-β/Smad signaling pathway were downregulated in irradiated mice treated with Liriodendron. This suggests that Liriodendron may exert anti-fibrotic effects by downregulating the TGF-β/Smad signaling pathway and inhibiting collagen fiber formation, significantly alleviating intestinal fibrosis in mice with radiation proctopathy. Nevertheless, the alleviation of intestinal fibrosis was not apparent following the administration of Liriodendron via enema. The ineffectiveness of the treatment may be due to the impaired ability of the intestines to absorb the drug after radiation exposure, the drug is quickly excreted through the anus after enema administration in mice, and the further harm caused to the mice's intestines by the enema administration. In addition, we found a strange result during the study. We detected by ELISA that the serum TGF-β level of irradiated mice after treatment with Liriodendron was significantly increased. However, the expression level of TGF-β in the intestinal tissue was significantly down-regulated. After many experiments, we finally confirmed this result. TGF-β, as a key cytokine, may play anti-inflammatory and pro-inflammatory roles in different physiological and pathological states. However, it is generally considered an anti-inflammatory factor, so the serum TGF-β level of irradiated mice after treatment with Liriodendron is significantly increased to reduce inflammation. At the same time, in the process of chronic inflammation, TGF-β can promote the activation of fibroblasts and extracellular matrix (ECM) deposition, which leads to fibrosis and plays an important role in chronic inflammation and related diseases (such as liver fibrosis, lung fibrosis, and kidney fibrosis). After treatment with Liriodendron, the fibrosis in intestinal tissue was significantly reduced, so the expression level of TGF-β in intestinal tissue decreased. Nevertheless, its specific mechanism needs to be further explored. During this study, we noticed an intriguing phenomenon: the coat color of the irradiated area of mice showed a transition to white in the sixth week after irradiation. Mice treated with Liriodendron enema after irradiation experienced a similar change in coat color, but it occurred slightly later, in the seventh week. In contrast, most of the mice that received Liriodendron through gavage after radiation did not exhibit this phenomenon during the eighth week (Figure S3 ). These findings indicate that Liriodendron may mitigate tyrosinase damage in the hair follicles of irradiated mice. This effect may be attributed to Liriodendron suppressing NF-κB and TNF-α production [25–28] . These findings suggest that Liriodendron can treat radiation proctopathy by reducing the intestinal inflammatory response, mitigating intestinal oxidative stress, and inhibiting intestinal fibrosis, thereby improving clinical symptoms and survival in irradiated mice. However, further mechanistic and clinical investigations are needed to verify its efficacy and clinical translational value. 5. Conclusion This study investigated the potential therapeutic effects of Liriodendron in mice with radiation proctopathy. Our findings indicate that Liriodendron can effectively alleviate the clinical symptoms caused by irradiation in mice, safeguard the integrity of the intestinal mucosal tissue, and increase survival rates. The mechanism could potentially be attributed to Liriodendron's ability to mitigate intestinal oxidative stress, alleviates inflammation, and inhibit intestinal fibrosis. This demonstrates that Liriodendron possesses a distinct therapeutic impact on radiation proctopathy and warrants additional research. Declarations ETHICS STATEMENT The animal experiments were approved by the Animal Care and Use Committee of the Animal Research Institute of the Sichuan Provincial People's Hospital. The ethical number is Ethics (Research) No. 65 of 2017. SUBJECT INFORMED CONSENT STATEMENT Not applicable. FUNDING This work was supported by the National Natural Science Foundation of China (8200062054, 81771723) and the Department of Science and Technology of Sichuan Province (2022YFS0157,2021YFS0375) and the Grant from the Health Commission of Chengdu (No.2024586). CONFLICT OF INTEREST The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper. AUTHOR CONTRIBUTIONS H.H. and G.Z. designed the study, H.H., J.L.and Y.Z. analyzed the data and wrote the manuscript; H.H., J.L., Y.Z., G.J., and B.L. completed the experimental operation to record the experimental data; Y.Z provided pre-experimental data. H.H., J.L., and G.Z were the guarantors of this work and, as such, had full access to all the data in the study and took responsibility for the integrity of the data and the accuracy of the data analysis. DATA AVAILABILITY STATEMENT The data supporting this study's findings are available from the corresponding author upon reasonable request. References Shadad Abobakr K., Sullivan Frank J., Martin Joseph D., Egan Laurence J. (2013). Gastrointestinal radiation injury: prevention and treatment. World J Gastroenterol, 19(2), 199-208. doi:10.3748/wjg. v19.i2.199 Fan Jinjia., Lin Binwei., Fan Mi., Niu Tintin., Gao Feng., Tan Bangxian., Du Xiaobo. (2022). Research progress on the mechanism of radiation enteritis. Front Oncol, 12, 888962. doi:10.3389/fonc.2022.888962 Ren Huiwen., Wu Qi., Sun Zhiqiang., Fang Mingming., Liu Jun., Luo Judong.(2023). Research progress and treatment of radiation enteritis and gut microbiota. Radiat Oncol J, 41(2), 61-68. doi:10.3857/roj.2023.00346 Akbarali Hamid I., Muchhala Karan H., Jessup Donald K., Cheatham Stanley. (2022). Chemotherapy induced gastrointestinal toxicities. Adv Cancer Res, 155(undefined), 131-166. doi:10.1016/bs.acr.2022.02.007 McCaughan Hannah., Boyle Stephen., McGoran John J.(2021). Update on the management of the gastrointestinal effects of radiation. World J Gastrointest Oncol, 13(5), 400-408. doi:10.4251/wjgo.v13.i5.400 Zhang Li-Ying., Zhou Ting., Zhang Yi-Ming., Xu Xiao-Min., Li Yang-Yang., Wei Kong-Xi., He Jin-Peng., Ding Nan., Zhou Heng., Liu Yong-Qi.(2020). Guiqi Baizhu Decoction Alleviates Radiation Inflammation in Rats by Modulating the Composition of the Gut Microbiota. Evid Based Complement Alternat Med, 2020 9017854. doi:10.1155/2020/9017854 Li Di-Hua., Wang Yan., Lv Yuan-Shan., Liu Jun-Hong., Yang Lei., Zhang Shu-Kun., Zhuo Yu-Zhen.(2015). Preparative Purification of Liriodendron from Sargentodoxa cuneata by Macroporous Resin. Biomed Res Int, 2015(undefined), 861256. doi:10.1155/2015/861256 Cheng Fang., Li Dan., Ma Xijia., Wang Yami., Lu Luyan., Hu Bin., Cui Shuke.(2024). Liriodendron exerts protective effects against chronic endometritis in rats by modulating gut microbiota composition and the arginine/nitric oxide metabolic pathway. Int Immunopharmacol, 126(undefined), 111235. doi:10.1016/j.intimp.2023.111235 Zhang Zhen., Yang Lei., Wang Botao., Zhang Lanqiu., Zhang Qi., Li Dihua., Zhang Shukun., Gao Hongwei., Wang Ximo.(2017). Protective role of Liriodendron in mice with dextran sulphate sodium-induced ulcerative colitis. Int Immunopharmacol, 52(undefined), 203-210. doi:10.1016/j.intimp.2017.09.012 Yang Lei., Li Dihua., Zhuo Yuzhen., Zhang Shukun., Wang Ximo., Gao Hongwei.(2016). Protective Role of Liriodendron in Sepsis-Induced Acute Lung Injury. Inflammation, 39(5), 1805-13. doi:10.1007/s10753-016-0416-1 Song Shunxin., Chen Dianke., Ma Tenghui., Luo Yanxin., Yang Zuli., Wang Daohai., Fan Xinjuan., Qin Qiyuan., Ni Beibei., Guo Xuefeng., Xian Zhenyu., Lan Ping., Cao Xinping., Li Mingtao., Wang Jianping., Wang Lei. (2014). Molecular mechanism of acute radiation enteritis revealed using proteomics and biological signaling network analysis in rats. Dig Dis Sci, 59(11), 2704-13. doi:10.1007/s10620-014-3224-1 Ashcraft Kathleen A., Miles Devin., Sunday Mary E., Choudhury Kingshuk Roy., Young Kenneth H., Palmer Gregory M., Patel Pranalee., Woska Emily C., Zhang Ray., Oldham Mark., Dewhirst Mark W., Koontz Bridget F. (2018). Development and Preliminary Evaluation of a Murine Model of Chronic Radiation-Induced Proctitis. Int J Radiat Oncol Biol Phys, 101(5), 1194-1201. doi:10.1016/j.ijrobp.2018.04.061 Lu Weisi., Xie Yunling., Huang Binjie., Ma Tenghui., Wang Huaiming., Deng Boxiong., Zou Shaomin., Wang Wencong., Tang Qin., Yang Ziqing., Li Xuri., Wang Lei., Fang Lekun.(2021). Platelet-derived growth factor C signaling is a potential therapeutic target for radiation proctopathy. Sci Transl Med, 13(582). doi:10.1126/scitranslmed.abc2344 Booth C, Tudor G, Tudor J, Katz BP, MacVittie TJ. Acute gastrointestinal syndrome in high-dose irradiated mice. Health Phys. 2012 Oct;103(4):383-99. doi: 10.1097/hp.0b013e318266ee13. MacDonald KP, Rowe V, Filippich C, Thomas R, Clouston AD, Welply JK, Hart DN, Ferrara JL, Hill GR. Donor pretreatment with progenipoietin-1 is superior to granulocyte colony-stimulating factor in preventing graft-versus-host disease after allogeneic stem cell transplantation. Blood. 2003 Mar 1;101(5):2033-42. doi: 10.1182/blood-2002-05-1529. Langberg CW, Sauer T, Reitan JB, Hauer-Jensen M. Tolerance of rat small intestine to localized single dose and fractionated irradiation. Acta Oncol. 1992;31(7):781-7. doi: 10.3109/02841869209083871 Wang Weihong., Cui Bota., Nie Yongzhan., Sun Lijuan., Zhang Faming. (2024). Radiation injury and gut microbiota-based treatment. Protein Cell, 15(2), 83-97. doi:10.1093/procel/pwad044 Cagin Yasir Furkan., Parlakpinar Hakan., Vardi Nigar., Aksanyar Salih. (2022). Protective effects of apocynin against ionizing radiation-induced hepatotoxicity in rats. Biotech Histochem, 97(3), 228-235. doi:10.1080/10520295.2021.1936641 Ceeraz Sabrina., Thompson Charlotte R., Beatson Richard., Choy Ernest H. (2021). Harnessing CD8CD28 Regulatory T Cells as a Tool to Treat Autoimmune Disease. Cells, 10(11). doi:10.3390/cells10112973 Niwińska Anna., Olszewski Wojciech P. (2021). The role of stromal immune microenvironment in the progression of ductal carcinoma in situ (DCIS) to invasive breast cancer. Breast Cancer Res, 23(1), 118. doi:10.1186/s13058-021-01494-9 Chamouard Patrick., Monneaux Fanny., Richert Zoe., Voegeli Anne-Claire., Lavaux Thomas., Gaub Marie Pierre., Baumann René., Oudet Pierre., Muller Sylviane. (2009). Diminution of Circulating CD4+CD25 high T cells in naïve Crohn's disease. Dig Dis Sci, 54(10), 2084-93. doi:10.1007/s10620-008-0590-6 D'Alessio Silvia., Ungaro Federica., Noviello Daniele., Lovisa Sara., Peyrin-Biroulet Laurent., Danese Silvio. (2022). Revisiting fibrosis in inflammatory bowel disease: the gut thickens. Nat Rev Gastroenterol Hepatol, 19(3), 169-184. doi:10.1038/s41575-021-00543-0 Okoshi Kae., Kubo Hajime., Nagayama Satoshi., Tabata Chiharu., Kadokawa Yoshio., Hisamori Shigeo., Yonenaga Yoshikuni., Fujimoto Akihisa., Mori Akira., Onodera Hisashi., Watanabe Go., Sakai Yoshiharu. (2008). All-trans-retinoic acid attenuates radiation-induced intestinal fibrosis in mice. J Surg Res, 150(1), 53-9. doi:10.1016/j.jss.2007.12.762 Zhao Dong, Zha Shiqian, Wang Yixuan, Pan Zhou, Yu Wenzhen, HU Ke. Macrophage-to-myofibroblast transition promotes pulmonary fibrosis occurred in LPS-induced acute lung injury of mouse models[J]. Basic & Clinical Medicine, 2024, 44(3): 281-287. doi:10.16352/j.issn.1001-6325.2024.03.0281 Chou Wei Chin., Takeo Makoto., Rabbani Piul., Hu Hai., Lee Wendy., Chung Young Rock., Carucci John., Overbeek Paul., Ito Mayumi. (2013). Direct migration of follicular melanocyte stem cells to the epidermis after wounding or UVB irradiation is dependent on Mc1r signaling. Nat Med, 19(7), 924-9. doi:10.1038/nm.3194 Tobin D J., Paus R. (2001). Graying: gerontobiology of the hair follicle pigmentary unit. Exp Gerontol, 36(1), 29-54. doi:10.1016/s0531-5565(00)00210-2 Schallreuter Karin U., Salem Mohamed M A E L., Hasse Sybille., Rokos Hartmut. (2011). The redox--biochemistry of human hair pigmentation. Pigment Cell Melanoma Res, 24(1), 51-62. doi:10.1111/j.1755-148X.2010.00794.x Slominski Andrzej., Wortsman Jacobo., Plonka Przemyslaw M., Schallreuter Karin U., Paus Ralf., Tobin Desmond J. (2005). Hair follicle pigmentation. J Invest Dermatol, 124(1), 13-21. doi:10.1111/j.0022-202X.2004.23528.x Additional Declarations No competing interests reported. Supplementary Files FigrueS1.tif FigureS2.tif FigureS3.tif Cite Share Download PDF Status: Published Journal Publication published 27 Oct, 2025 Read the published version in Chinese Medicine → Version 1 posted Editorial decision: Revision requested 05 Aug, 2025 Reviewers agreed at journal 05 Aug, 2025 Reviews received at journal 02 Aug, 2025 Reviews received at journal 31 Jul, 2025 Reviewers agreed at journal 31 Jul, 2025 Reviewers agreed at journal 29 Jul, 2025 Reviewers agreed at journal 29 Jul, 2025 Reviewers invited by journal 29 Jul, 2025 Editor assigned by journal 15 Jul, 2025 Submission checks completed at journal 15 Jul, 2025 First submitted to journal 06 Jul, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7060441","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":492839046,"identity":"b27b24b9-ea37-46b2-a7b8-97f24a314879","order_by":0,"name":"Hao Huang","email":"","orcid":"","institution":"Sichuan Academy of Medical Sciences, University of Electronic Science and Technology of China","correspondingAuthor":false,"prefix":"","firstName":"Hao","middleName":"","lastName":"Huang","suffix":""},{"id":492839048,"identity":"9a5b26af-1460-4a24-99e7-c2abd1790835","order_by":1,"name":"Junsheng Li","email":"","orcid":"","institution":"The Afiliated Hospital of Southwest Medical University","correspondingAuthor":false,"prefix":"","firstName":"Junsheng","middleName":"","lastName":"Li","suffix":""},{"id":492839049,"identity":"cb67f6bc-f687-4dd3-9ff4-5281301d5047","order_by":2,"name":"Yanling Zhang","email":"","orcid":"","institution":"Sichuan Academy of Medical Sciences, University of Electronic Science and Technology of China","correspondingAuthor":false,"prefix":"","firstName":"Yanling","middleName":"","lastName":"Zhang","suffix":""},{"id":492839050,"identity":"53c671dd-cb5a-4ead-9667-3d74492642f4","order_by":3,"name":"Bin Liu","email":"","orcid":"","institution":"National Nuclear Corporation 416 Hospital","correspondingAuthor":false,"prefix":"","firstName":"Bin","middleName":"","lastName":"Liu","suffix":""},{"id":492839051,"identity":"c8bb8277-901e-4566-a116-bd90a956e0af","order_by":4,"name":"Guiqing Jia","email":"","orcid":"","institution":"Sichuan Academy of Medical Sciences, University of Electronic Science and Technology of China","correspondingAuthor":false,"prefix":"","firstName":"Guiqing","middleName":"","lastName":"Jia","suffix":""},{"id":492839052,"identity":"e30041a6-c575-4110-89ae-06aa4d024f91","order_by":5,"name":"Gaoping Zhao","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAzklEQVRIiWNgGAWjYFACHiCugHHYiNZyBqaaaC2MbaRokfc/e/DDx3mH5eTnNz9g+FB2mIF/dgN+LYYHziVLztx22NjgGJsB44xzhxkk7hwgoKWxx0Cad9vhxA1sPAzMvG2HGQwkEghoaeYx/s0753D9/Daglr/EaJFn4zGT5m04nMBwDKiFkRgtBjw8ZpYzjqUbbjiWZnCw51w6j8QNQrb0nzG+8aHGWl6++fDDBz/KrOX4ZxCy5QASB8Tmwa8eZEsDQSWjYBSMglEw4gEAxzI+wOr/UwkAAAAASUVORK5CYII=","orcid":"","institution":"Sichuan Academy of Medical Sciences, University of Electronic Science and Technology of China","correspondingAuthor":true,"prefix":"","firstName":"Gaoping","middleName":"","lastName":"Zhao","suffix":""}],"badges":[],"createdAt":"2025-07-07 02:08:06","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7060441/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7060441/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1186/s13020-025-01228-5","type":"published","date":"2025-10-27T15:57:20+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":87998952,"identity":"b10b96fe-ad2d-4efd-9940-c42cae74e458","added_by":"auto","created_at":"2025-07-31 10:03:53","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":1809082,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eLiriodendron attenuates irradiation damage in mice\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A) Comparison of clinical scores of survival mice in different groups after irradiation. (B) Comparison of body weight of survival mice in different groups after irradiation. (C) Comparative analysis of fecal occult blood in survival mice in different groups at weeks 1, 4, and 8 after irradiation. The fecal occult blood test was consistently negative in the blank control mice. (D) Survival curve analysis of mice after irradiation, the irradiated-only group (n=16), the irradiated group treated with enema of Liriodendron once a week (n=16), the irradiated group treated with gavage of Liriodendron once a week (n=16). **: p\u0026lt;0.01, ***: p\u0026lt;0.001.\u003c/p\u003e","description":"","filename":"Figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-7060441/v1/2d3097f4817d8524a74b2589.png"},{"id":87998979,"identity":"e5f2fe13-d9f9-451d-b899-1408be967716","added_by":"auto","created_at":"2025-07-31 10:03:53","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":36407538,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eLiriodendron attenuates rectal inflammation in mice\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A) Comparative images of the whole rectum length of mice in each group at the eighth week after irradiation, including the blank control group without irradiation (n=3), the irradiation-only group (n=5), and the Liriodendron gavage group (n=6). (B) Statistical analysis of the whole rectum length of mice at the eighth week after irradiation. (C) Pathological sections of the irradiated area rectum (one centimeter from the anus) of mice at the eighth week after irradiation, H\u0026amp;E staining. (D) Statistical analysis of pathological scores of the rectum in the irradiated area of mice at the eighth week after irradiation. All tissue samples were obtained at the eighth week after irradiation. The magnifications are 10x and 40x.*: p\u0026lt;0.05, **: p\u0026lt;0.01, ***: p\u0026lt;0.001. (E) Changes of hair color in irradiated mice after treatment with liriodendrin. the group exposed only to irradiation showed the loss and whitening of hair in the irradiated region during weeks 5-6 following the irradiation. Conversely, the majority of mice of the Liriodendron gavage group did not exhibit any whitening of the irradiated area by week 8. (F) Establishment of radiation proctitis mouse model. mice in each group were placed into a 4 mm thick lead box in supine position to expose the pelvic region.\u003c/p\u003e","description":"","filename":"Figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-7060441/v1/73ecad9b1287bdc5dde4d0ff.png"},{"id":87998955,"identity":"b506425f-ec71-4a4c-be02-480a88eedb8e","added_by":"auto","created_at":"2025-07-31 10:03:53","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":5657297,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eLiriodendron modulates the release of inflammatory cytokines\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A) By immunofluorescence detected the expression of the CD4+ and CD8+ T cell in the irradiated area of the rectum (about one centimeter from the anus) in the irradiation-only group (n=8) and the Liriodendron gavage group (n=14) at the eighth week after irradiation. DAPI stained cell nuclei in blue, CD8 positive expression in red, and CD4 positive expression in green. Statistically analyzed the numbers of positive CD4+ T cells (B) and CD8+ T cells (C). Statistically analyzed the levels of TGF-β1 (D), IL-10 (E), IFN-γ (F), and TNF-α (G) in the serum of mice by ELISA at the eighth week after irradiation in the irradiation-only group (n=12), the Liriodendron enema group (n=12) and the Liriodendron gavage group (n=14). All tissue samples were obtained at the eighth week after irradiation. The magnifications are 10x and 40x.*: p\u0026lt;0.05, **: p\u0026lt;0.01, ***: p\u0026lt;0.001\u003c/p\u003e","description":"","filename":"Figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-7060441/v1/f2967168db224c72c3fd2032.png"},{"id":87998957,"identity":"d9c8f69b-f982-4bc7-b272-2298d3193783","added_by":"auto","created_at":"2025-07-31 10:03:53","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":5967590,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eLiriodendron reduces the expression of intestinal fibrosis indicators in mice\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A) Differential gene volcano plot of the Liriodendron gavage group and the irradiation-only group, blue indicating genes with significantly lower expression and red indicating genes with significantly higher expression. (B) Clustering heat map of differentially expressed genes. (C) KEGG pathway map of differentially expressed genes. (D) GSEA signaling pathway expression profile. (E) RT-PCR verified the expression of Jund、Ap-1、Cxcl9, and Smad3 mRNA, with the data expressed as mean±SD. All tissue samples were obtained at the eighth week after irradiation. *: p\u0026lt;0.05\u003c/p\u003e","description":"","filename":"Figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-7060441/v1/49c566dd415573ebbe5b6f60.png"},{"id":87998956,"identity":"cb3ed421-974d-4409-a521-2fa3d4d22cf2","added_by":"auto","created_at":"2025-07-31 10:03:53","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":9632858,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eLiriodendron reduces oxidative damage and apoptosis in irradiated rectal tissues\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A) Flow cytometry for ROS content in rectum tissue cells, bar graph representation. (B) Statistical graph analysis of ROS expression. (C) ROS-positive cells as a percentage of total rectal cells. (D) Tunnel method to detect the number of apoptotic cells in rectum tissue, the green color indicates apoptotic signals, and the blue color indicates cell nucleus. (E) Statistical graph of apoptotic cell expression. All tissue samples were obtained at the eighth week after irradiation. The magnifications are 10x and 40x. *: p\u0026lt;0.05, **: p\u0026lt;0.01.\u003c/p\u003e","description":"","filename":"Figure5.png","url":"https://assets-eu.researchsquare.com/files/rs-7060441/v1/f1fe7cb3332ddbb0a8a470b5.png"},{"id":87999813,"identity":"d69787b1-7b8f-46b8-aa52-993bc0aa8827","added_by":"auto","created_at":"2025-07-31 10:11:53","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":45657016,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eLiriodendron attenuates fibrosis in irradiated mouse rectum tissues\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A) Masson staining is used to detect intestinal fibrous tissue. (B) Statistically analyzed graph of the area was occupied by positive Masson staining. (C) Immunohistochemical detection of α-SMA. (D) Statistical graph of the percentage of positive area by chemiluminescence. (E) Protein immunoblotting for detection of α-SMA expression in intestinal tissues. (F) Statistical analysis graph by comparison of gray values. The mean fluorescence intensity expressions were obtained by Image J and all were expressed as mean±SD. All tissue samples were obtained at the eighth week after irradiation. The magnifications are 10x and 40x.*: p\u0026lt;0.05, **: p\u0026lt;0.01.\u003c/p\u003e","description":"","filename":"Figure6.png","url":"https://assets-eu.researchsquare.com/files/rs-7060441/v1/944803cc679de2fdd5feacd4.png"},{"id":95039979,"identity":"5088ea02-112c-4a07-8ff0-cc7c3e879f66","added_by":"auto","created_at":"2025-11-03 16:06:51","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":97003116,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7060441/v1/17eef9ce-7984-42e4-91b3-6db941f060c0.pdf"},{"id":87999808,"identity":"b7c06dc5-48a1-47f1-b01d-f14dec5b7325","added_by":"auto","created_at":"2025-07-31 10:11:53","extension":"tif","order_by":0,"title":"","display":"","copyAsset":false,"role":"supplement","size":7563568,"visible":true,"origin":"","legend":"","description":"","filename":"FigrueS1.tif","url":"https://assets-eu.researchsquare.com/files/rs-7060441/v1/b04aadd3ffe7716932a9f5cf.tif"},{"id":87999804,"identity":"15011a12-6bf4-42f4-97ad-77162ba07c5c","added_by":"auto","created_at":"2025-07-31 10:11:53","extension":"tif","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":261072,"visible":true,"origin":"","legend":"","description":"","filename":"FigureS2.tif","url":"https://assets-eu.researchsquare.com/files/rs-7060441/v1/55df278a8a62f8ae01405f5c.tif"},{"id":88000376,"identity":"261e62d7-c6d7-428e-a96b-bcbdea27c6df","added_by":"auto","created_at":"2025-07-31 10:19:53","extension":"tif","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":12446840,"visible":true,"origin":"","legend":"","description":"","filename":"FigureS3.tif","url":"https://assets-eu.researchsquare.com/files/rs-7060441/v1/d5ba7bd58c1245a632e088ef.tif"}],"financialInterests":"No competing interests reported.","formattedTitle":"Liriodendron attenuates intestinal fibrosis and inflammation in mice with radiation proctopathy","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eCancer, a prominent worldwide health issue, is currently predominantly treated through surgical procedures, radiotherapy, chemotherapy, immunotherapy, targeted therapy, hormone therapy, and other methods. Radiotherapy is administered to around 70% of cancer patients as a component of their treatment plan, and it is crucial in reaching remission for 25% of cases \u003csup\u003e[1]\u003c/sup\u003e. Nevertheless, finding solutions to mitigate the adverse effects of radiation on healthy tissues is a significant issue that requires immediate attention.\u003c/p\u003e\u003cp\u003eRadiation proctopathy is a persistent inflammatory condition that occurs as a consequence of irradiation treatment for abdominal malignancies, including colorectal cancer, ovarian cancer, cervical cancer, bladder cancer, and others. The manifestation of symptoms usually occurs several months or even years after the completion of radiotherapy \u003csup\u003e[2,3]\u003c/sup\u003e. The characteristic pathological alterations are progressive mucosal and submucosal obliterative arteriolitis with interstitial fibrosis, which makes the intestinal wall mucosa edematous and fragile, with poor healing capacity \u003csup\u003e[4]\u003c/sup\u003e. The main clinical manifestations of radiation proctopathy are abdominal pain, diarrhea, intestinal dysfunction, mucopurulent and bloody stools, and fresh blood stools. Severe lesions can cause the intestinal lumen to narrow and form abscesses, which in turn affects the patients' nutritional intake. In advanced stages, some patients may experience intestinal obstruction or even intestinal perforation, posing a threat to their health and life \u003csup\u003e[1,5]\u003c/sup\u003e.\u003c/p\u003e\u003cp\u003eThe clinical effectiveness of radiation proctopathy is limited due to the absence of appropriate treatment. Furthermore, the precise mechanisms responsible for the development of radiation proctopathy are still unclear, necessitating further investigation into its pathophysiology, prevention, and treatment strategies. Currently, the prevention and treatment of radiation proctopathy using traditional Chinese medicine and Chinese medicinal preparations is a topic of significant interest in clinical treatment. Chinese medicinal formulas have demonstrated notable efficacy in treating radiation proctopathy thanks to their distinctive approach to evidence-based treatment \u003csup\u003e[6]\u003c/sup\u003e. According to Chinese medicine, Fibraureae Caulis has anti-inflammatory, antibacterial, and antioxidant properties, making it suitable for treating intestinal inflammation, infection, and other disorders. Liriodendron is the primary extract of traditional Chinese medicine, Fibraureae Caulis \u003csup\u003e[7]\u003c/sup\u003e. Studies have demonstrated that Liriodendron exhibits a notable antioxidant effect, effectively inhibiting the formation of free radicals and scavenging reactive oxygen species in the body. This antioxidant activity helps protect cells from free radical damage \u003csup\u003e[8\u0026ndash;10]\u003c/sup\u003e. According to Yang et al. \u003csup\u003e[10]\u003c/sup\u003e, Liriodendron has been shown to effectively mitigate the impact of NF-κB and vascular endothelial growth factor (VEGF) in the lung tissues of mice \u003csup\u003e[11]\u003c/sup\u003e and improve the illness of animals with radiation-induced acute lung injury. Research has also demonstrated that Liriodendron can effectively cure ulcerative proctopathy by suppressing inflammation and oxidative stress, which is achieved through its action on the NF-κB signaling pathway.\u003c/p\u003e\u003cp\u003eNevertheless, it remains uncertain if Liriodendron will be helpful in treating radiation proctopathy. A mouse model of radiation proctopathy was developed in this study, which was found to be more congruent with the clinical radiotherapy practices compared to the whole abdominal irradiation model described in previous studies \u003csup\u003e[11\u0026ndash;13]\u003c/sup\u003e. Our research revealed that Liriodendron can suppress inflammation and fibrosis in irradiated mice rectum tissues, which means that Liriodendron has the potential to be used as a medication for treating radiation proctopathy.\u003c/p\u003e"},{"header":"2. Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\u003ch2\u003e2.1 Animals\u003c/h2\u003e\u003cp\u003eHealthy female C57/BL mice, 7\u0026ndash;8 weeks old, weighing 18\u0026ndash;20 g, were provided by Chengdu Dashuo Technology \u0026amp; Biology Co. Ltd., and divided into blank control group, irradiated-only group, Liriodendron gavage group and Liriodendron enema group, with 16 mice in each group. Mice were housed in a specific pathogen-free facility and provided adequate water and food. All tissue samples were obtained at week 8 post-RT. All the procedures were approved by the Animal Care and Use Committee of the Animal Research Institute of the Sichuan Provincial People's Hospital. The ethical number is Ethics (Research) No. 65 of 2017.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec4\" class=\"Section2\"\u003e\u003ch2\u003e2.2 Irradiation modeling\u003c/h2\u003e\u003cp\u003eIn this experiment, a chronic radiation proctitis model was established by a single high-dose local irradiation of the pelvis of mice. Irradiation was performed using a Rad Source RS2000Pro biological X-ray irradiator at the West China State Key Laboratory of Biotherapeutics, Sichuan University, with the radiation dose and irradiation rate (10 Gy, 1.32 Gy/min) \u003csup\u003e[14]\u003c/sup\u003e. After anesthetized by intraperitoneal injection of 1% pentobarbital sodium, mice in each group were placed into a 4 mm thick lead box in the supine position to expose the pelvic region (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e2\u003c/span\u003eF), and a single local irradiation of the pelvis was given to the mice in each group by using RS2000Pro biological X-ray irradiator to develop the irradiated model mice. The irradiated mice were given 100 mg/kg by gavage and enema 24 h after irradiation, once a week for 8 weeks, and the blank control group and the irradiated-only group were given gavage with 1% DMSO in water.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec5\" class=\"Section2\"\u003e\u003ch2\u003e2.3 Enzyme-linked immunosorbent assay (ELISA)\u003c/h2\u003e\u003cp\u003eThe mice TNF-α、IFN-γ、IL-10, and TGF-β1 (Ruixinbio, Quanzhou, China) were used to perform double antibody sandwich enzyme-linked immunosorbent assays. After warming and sufficient washing, the unbound components were removed, and a solid-phase antibody-antigen-enzymatic antibody sandwich complex formed on the solid-phase surface of the microtiter plate. Substrates A (0.01% hydrogen peroxide) and B (0.1% TMB) were added, and the substrate catalyzed by HRP to produce a blue product, which was finally converted to yellow in the presence of the terminating solution (2M sulfuric acid). The absorbance (OD) was measured at 450 nm wavelength using an enzyme marker (Rayto, RT-6100). The OD correlated positively with the concentration of the detectors in the samples to be tested. The concentration of the standard was used as the horizontal coordinate (6 standard wells, plus 10-value well, totaling 7 concentration points), and the corresponding OD value was used as the vertical coordinate. Using computer software, a four-parameter logistic curve fit (4-pl) was used to create a standard curve that allowed the concentration value of the sample to be calculated from its OD. The calibration product dose-response curve correlation coefficient, r-value, was \u0026ge; 0.9900.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec6\" class=\"Section2\"\u003e\u003ch2\u003e2.4 Immunoblotting\u003c/h2\u003e\u003cp\u003eTissue was obtained from the upper one centimeter of the mouse anus. Harvested mouse rectal tissues were lysed with 200 \u0026micro;L P0013B RIPA strong lysis buffer (Beyotime, Shanghai) and 1 mM PMSF, then homogenized using a glass homogenizer (YJQ0928Q). After centrifugation at 10,000\u0026ndash;14,000 g for 3\u0026ndash;4 min, the supernatant was used for the BCA protein concentration assay (Therm Scientific, USA). A 1/4 volume of 5* SDS-PAGE loading buffer (P1040 Solarbio) was added to the lysate, followed by 10 min at 100\u0026deg;C.\u003c/p\u003e\u003cp\u003eProtein samples were separated on SDS-PAGE gels and transferred to PVDF membranes, which were blocked with a protein-free fast-closing solution (Yarase, Shanghai) for 15\u0026ndash;20 min. The membranes were then incubated overnight at 4\u0026deg;C with glucose transporter α-SMA antibody (ER1003 HUABIO Hangzhou) or GAPDH mice mAb (HRP conjugate ZENBIO) and further incubated for 1 hr at room temperature. After washing five times with TBST, membranes were incubated with HRP-conjugated secondary antibody for 2 hr. Following three washes with TBST (BL608A, Biosharp, Guangzhou, China), membranes were treated with ECL solution (Millipore) for 1\u0026ndash;3 min, and protein bands were visualized using the Invitrogen imaging system (GoldBand protein marker, YEASEN, Shanghai).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec7\" class=\"Section2\"\u003e\u003ch2\u003e2.5 Real-time RT-PCR\u003c/h2\u003e\u003cp\u003eAccording to standard procedures, total RNA was extracted from mice's liver tissue with TRIzol reagent (Invitrogen, Californian, USA). 1 \u0026micro;g of total RNA was used for the reverse transcription reaction, while the SYBR green pro taq HS premix qPCR Kit (AG11701 Accurate Biology, Changsha, China) and the Evo M-MIV reverse transcription premix kit (AG11728 Accurate Biology, China) were used for the real-time qPCR assays. The mRNA expression levels were detected by the CFX Manager system (BioRad, Californian, USA).\u003c/p\u003e\u003cp\u003eGAPDH-F ATGATTCCACCCATGGCAAATTC\u003c/p\u003e\u003cp\u003eGAPDH-R GACTCCACGACGTACTCAGC\u003c/p\u003e\u003cp\u003eJUND-F TCTTGGGCTGCTCAAACTCG\u003c/p\u003e\u003cp\u003eJUND-R CCTTCGGGTAGAGGAACTGC\u003c/p\u003e\u003cp\u003eAP-1-F TGGGCACATCACCACTACAC\u003c/p\u003e\u003cp\u003eAP-1-R TCTGGCTATGCAGTTCAGCC\u003c/p\u003e\u003cp\u003eCXCL9-F CCGAGGCACGATCCACTAC\u003c/p\u003e\u003cp\u003eCXCL9-R AGGCAGGTTTGATCTCCGTT\u003c/p\u003e\u003cp\u003eSmad3-F TGAAGAAGCTCAAGAAGACGGG\u003c/p\u003e\u003cp\u003eSmad3-R GAGGGAGCCCCTTCCGAT\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\u003ch2\u003e2.6 H\u0026amp;E and MASSON staining\u003c/h2\u003e\u003cp\u003eTissue was obtained from the upper one centimeter of the mouse anus. The fixed tissues were dehydrated using an automatic dehydration machine and then embedded with the sections dewaxed to water.\u003c/p\u003e\u003cp\u003eH\u0026amp;E staining: hematoxylin for 10\u0026ndash;20 min, rinse in tap water for 1\u0026ndash;3 min, acid alcohol for 5-10s, rinse, warm water until blue, rinse again, then 85% alcohol for 3\u0026ndash;5 min; eosin for 3\u0026ndash;5 min, rinse, gradient alcohol dehydration, xylene transparency, and seal with neutral gum.\u003c/p\u003e\u003cp\u003eMASSON stains: similar sectioning and dewaxing; incubate with potassium dichromate overnight, differentiate hematoxylin back to blue, titrate with Lichun red for 10 min, rinse, treat with phosphomolybdic acid for 1 min, stain with aniline blue for 2 min, dehydrate with alcohol, clear with xylene, and seal with neutral glue.\u003c/p\u003e\u003cp\u003eH\u0026amp;E staining images were acquired using a 3DHISTECH (Budapest, Hungary) Panoramic 250 scanner, first at 40x for general observation, then at 100x and 400x for details. The positive expression area was analyzed with Image-Pro Plus 6.0 (Media Cybernetics, Californian, USA), calculating the percentage as positive area/total area (pixel area). SPSS 23.0 was used for t-tests, presenting data as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec9\" class=\"Section2\"\u003e\u003ch2\u003e2.7 Immunofluorescence\u003c/h2\u003e\u003cp\u003eThe paraffin sections were dewaxed to water; antigen repaired; dropwise addition of goat serum blocking solution; blocked at room temperature for 20 min; dropwise addition of CD4 antibody(ab183685 abcam, Californian, USA); incubated overnight at 4\u0026deg;C; washed 3 times for 5 min each in PBS; dropwise addition of secondary antibody (FITC-labeled goat anti-rabbit) (GB22303 Servicebio, Wuhan, China) and incubation for 30 min at 37\u0026deg;C; washed 3 times for 5 min each in PBS; dropwise addition of DAPI and incubation at room temperature for 10 min; washed 3 times for 5 min each in PBS; and sealing of the slices using anti-fluorescence attenuating sealer. Each section was first observed at 100\u0026times;, then 100\u0026times; and 400\u0026times; microscopic images were acquired for a total of 3 fields of view. The integrated density (IntDen) and area (area) of all the acquired images were measured using the Image-J image analysis system and the mean gray value (mean) of each image was then calculated. The mean fluorescence intensity of each sample was calculated using the mean fluorescence intensity of the two images. Similarly, CD8 antibody (ab217344 abcam) and secondary antibody (CY3-labeled goat anti-mice) (GB21301 Servicebio). The DAPI-stained cell nuclei were blue, CD8 positive expression was red, and CD4 expression was green.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec10\" class=\"Section2\"\u003e\u003ch2\u003e2.8 Fecal occult blood test (FOBT)\u003c/h2\u003e\u003cp\u003eAt the 1st, 4th, and 8th weeks after irradiation, fresh feces were collected from each group of mice into sterile EP tubes and mixed with a small amount of saline. Then fecal occult blood test strips were used to detect occult blood in feces of each group of mice with the following scoring criteria: negative: the blue-green color was not observed in 3 min, and the score was 0; weakly positive: the blue color was observed in 30\u0026ndash;60 s, and the score was 1; positive: the blue-green color was immediately observed, and the score was 2; strongly positive: blood could be observed by the naked eye, and dark blue color was immediately observed, and the score was 3; strong positive: blood could be seen with the naked eye, and deep blue color was immediately observed, and the score was 3. blood stool can be observed, immediately show dark blue color, scored as 3 points.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\u003ch2\u003e2.9 Biochemical analysis\u003c/h2\u003e\u003cp\u003eObtain mouse whole blood and centrifuge it at 3000 rpm for 15 min, obtain mouse serum, according to the instruction of the biochemical assay kit (Ruixinbio, Quanzhou, China), preheat the enzyme marker for 30 min, set the temperature at 37 ℃, set the wavelength corresponding to the detection indexes, and then add the sample serum, distilled water, and detection reagents into a 96-well plate, incubate at 37 ℃ for 5 min and then read the corresponding absorbance value. After 5 min incubation at 37 ℃, the absorbance values were read. The serum levels of alanine aminotransferase (ALT), azelaic transaminase (AST), albumin (ALB), creatinine (Cr), and urea nitrogen (BUN) were detected in mice according to the above method.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\u003ch2\u003e2.10 Sequencing of mRNA\u003c/h2\u003e\u003cp\u003eTissue was obtained from the upper one centimeter of the mouse anus. Sequencing services were provided by Shanghai Bioscience Co. Rectal tissue samples from each mouse group were frozen in liquid nitrogen. We randomly selected 4 samples from the irradiation-only group and 6 samples from the Liriodendron gavage group for RNA extraction and transcriptomics analysis. PolyA mRNA was enriched using Oligo(dT) magnetic beads, and RNA was fragmented to approximately 300 bp. The first strand of cDNA was synthesized using a 6-base random primer, followed by second strand synthesis. Library construction included PCR amplification for fragment enrichment and size selection at 450 bp. Library quality was assessed using an Agilent 2100 Bioanalyzer. Libraries with different Index sequences were mixed proportionally, diluted to 2 nM, and denatured into single strands. Paired-end (PE) sequencing was performed on the Illumina platform using Next-Generation Sequencing (NGS). Gene expression was analyzed based on clean read counts, with differential expression calculated using DESeq2. GO enrichment analysis utilized Goatools, and KEGG pathway analysis was conducted with KOBA, applying Fisher's exact test for both analyses.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e\u003ch2\u003e2.11 Detection of ROS (reactive oxygen species) in intestinal tissue by flow cytometry\u003c/h2\u003e\u003cp\u003eTissue was obtained from the upper one centimeter of the mouse anus. The tissues were rinsed in pre-cooled PBS, cut into small pieces, and ground with a grinder. The cell suspension was collected, filtered through a 200-mesh sieve, and centrifuged at 1200 rpm for 5 min. The supernatant was discarded, and the pellet was washed twice with PBS and centrifuged at 300 g for 5 min to collect the cellular precipitate. DCFH-DA was diluted to 10 \u0026micro;mol/L, with 1 mL added to each tube, and incubated at 37\u0026deg;C for 20 min. After centrifugation at 1500 rpm for 5 min, the supernatant was discarded, and cells were washed three times to remove residual DCFH-DA. Positive controls were prepared using a serum-free medium at a 1:1,000 ratio. After adding probes, Rosup was diluted 1:1000 and added to the positive control. Cells were incubated at 37\u0026deg;C for 30 min, washed three times, and centrifuged at 1500 rpm for 5 min. The supernatant was discarded and resuspended with PBS. CytExpert software analyzed the flow data, and the ROS content in rectal tissues was assessed using an independent sample T-test in GraphPad Prism after exporting the results.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e\u003ch2\u003e2.12 Detection of apoptosis in intestinal cells by TUNEL staining method\u003c/h2\u003e\u003cp\u003eThe sections were washed 2\u0026ndash;3 times with PBST solution and then acted with Triton X-100 solution and BSA solution for 30 min, respectively; the sections were washed repeatedly with PBST solution, the excess sealing solution was removed, the TdT enzyme reaction solution and TMR labeling solution were mixed well and then dripped on the sections, and the sections were incubated at a constant temperature and light protection for 1 hour. The sections were washed 2\u0026ndash;3 times with PBST solution and then acted with DAPI solution for 5 min and light protection; the sections were washed twice with PBST solution and sealed using an autofluorescence quencher. The sections were washed 2\u0026ndash;3 times with PBST solution, followed by a 5 min wash with DAPI solution, then washed twice with PBST solution before being sealed with anti-fluorescence quencher. The apoptosis of mouse intestinal tissues in each group was observed under a light microscope, photos were taken and stored, and the number of TUNEL-stained positive cells in each field of view was counted and calculated using Image J software.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec15\" class=\"Section2\"\u003e\u003ch2\u003e2.13 Statistical analysis\u003c/h2\u003e\u003cp\u003eSPSS23.0 statistical analysis software was used to perform independent-sample T tests on the data, with the data expressed as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation (mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD). Two independent samples t-tests and the Kolmogorov-Smirnov test were used to verify whether the data had a normal distribution. Survival curve data were analyzed using the Log-rank (mantel-cox) test, and Two-way ANOVA in the Prism 9 Program (Graph Pad, San Diego, CA, USA) was used for the statistical analysis. P-values\u0026thinsp;\u0026lt;\u0026thinsp;0.05 were considered to signify a statistically significant difference.\u003c/p\u003e\u003c/div\u003e"},{"header":"3. Results","content":"\u003cdiv id=\"Sec17\" class=\"Section2\"\u003e\u003ch2\u003e3.1 Liriodendron attenuates irradiation damage in mice\u003c/h2\u003e\u003cp\u003eA mouse model of radiation proctopathy was created by exposing mice to local radiotherapy with a dose of 10 Gy to the abdomen. Utilizing the GVHD Mouse Clinical Rating Scale \u003csup\u003e[15]\u003c/sup\u003e, we assessed the clinical disease activity of mice that survived irradiation weekly. Our results indicate that the mice in the irradiation-only group had significantly higher scores compared to the mice in the Liriodendron gavage group. Furthermore, the mice in the Liriodendron gavage group exhibited significantly better evaluations than the irradiation-only group in terms of mobility and postures at rest (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). By comparing the average body weights of the mice that survived after radiation exposure, we discovered that the mice exposed to radiation but not given Liriodendron treatment had considerably lower body weights and ingested less food during the initial week. However, mice that received Liriodendron treatment after radiation slightly reduced body weight and food consumption compared to the period before radiation exposure, and they are not statistically significant (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e1\u003c/span\u003eB). Furthermore, we noticed that the group exposed only to irradiation showed the loss and whitening of hair in the irradiated region during weeks 5\u0026ndash;6 following the irradiation. Conversely, most mice of the Liriodendron gavage group did not exhibit any whitening of the irradiated area by week 8 (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e2\u003c/span\u003eE). We collected fecal samples from mice that survived irradiation and accomplished occult blood tests at weeks 1, 4, and 8 after irradiation. The fecal occult blood test was consistently negative in nonirradiated control mice. However, mice of other groups exhibited varying blood levels in their stool during the first week after irradiation. The fecal occult blood in the irradiated-only group persisted, with no notable improvement observed in the 4th and 8th weeks. Conversely, the mice in the Liriodendron-treated group exhibited a significant decrease in fecal occult blood levels, and there was a statistically significant difference (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001) compared with that in the irradiation group only (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e1\u003c/span\u003eC). After 8 weeks of observation, we found that the survival rate of the Liriodendron gavage group was about 81.25% (13/16), which was significantly higher than that of the irradiated-only group 56.25% (9/16), and the difference was statistically significant (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001). In addition, the survival rate in the Liriodendron enema group was about 62.5% (10/16), which was higher than that in the irradiated-only group, but the difference was not statistically significant (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e1\u003c/span\u003eD).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec18\" class=\"Section2\"\u003e\u003ch2\u003e3.2 Liriodendron attenuates rectal inflammation in mice\u003c/h2\u003e\u003cp\u003eBy comparing the total lengths of the rectums in each group of mice at week 8 after irradiation, we observed that the rectums of mice in the irradiated-only group exhibited significant contraction (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e2\u003c/span\u003eA) and were significantly shorter than those of the unirradiated group and the Liriodendron gavage group (p\u0026thinsp;\u0026lt;\u0026thinsp;0.01) (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e2\u003c/span\u003eB). There was no significant difference in the rectum length between the irradiated-only group and the Liriodendron enema group. No images were included. By HE staining of pathological sections of the rectum of mice one centimeter near the anus, we found that the rectum of mice in the irradiated group had localized mucosal epithelial cell detachment, degeneration and necrosis of the mucosal layer, forming ulcer foci, and the necrotic area was missing or degenerated with necrosis of the intestinal glandular structure, and there were a small number of inflammatory cells infiltrated in the necrotic area, mainly lymphocytes with oval nuclei, and there were a small number of fibrous tissue proliferation, and the nuclei could be seen to be in the form of fibrous tissue, which could be seen as the nucleus of a small number of fibrous tissue. Fibroblasts with long oval nuclei were seen in the necrotic areas, while the mucosal structure of the rectal tissues of the mice treated by gavage with Liriodendron after irradiation was intact, with no obvious tissue degeneration, necrosis, or detachment, the intestinal gland cells in the lamina propria were densely arranged, and the morphology and number of cup cells were normal, the submucosal connective tissues were richly vascularized, and the muscular mucosae and plasma membrane layers were more structurally intact, with no apparent pathologic alterations seen (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e2\u003c/span\u003eC). The pathological scores of each group of mice were assessed using the semi-quantitative rectal radiopathological damage scale \u003csup\u003e[16]\u003c/sup\u003e. The mice that received Liriodendron treatment after irradiation exhibited significantly less intestinal histopathological damage than those in the irradiated-only group (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05) and were most pronounced in the intragastric group (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001) (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e2\u003c/span\u003eD).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec19\" class=\"Section2\"\u003e\u003ch2\u003e3.3 Promotion of anti-inflammatory cytokines and inhibition of pro-inflammatory cytokines release by Liriodendron\u003c/h2\u003e\u003cp\u003eSince the significant rise in inflammatory cell infiltration in the rectal tissues of mice in the irradiated-only group compared to the Liriodendron gavage group, we further investigated the expression of CD4\u0026thinsp;+\u0026thinsp;and CD8\u0026thinsp;+\u0026thinsp;T cells in the irradiated regions of the mice's rectal tissues. This analysis was performed on the irradiated-only group and the Liriodendron gavage group (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA). We found that the mice in the group receiving Liriodendron gavage had a significantly higher number of CD4\u0026thinsp;+\u0026thinsp;helper T cells in their intestinal tissues than in the irradiated-only group (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB). However, no significant difference in the expression of CD8\u0026thinsp;+\u0026thinsp;effector T cells was observed (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC). Subsequently, we analyzed the concentrations of different pro-inflammatory and anti-inflammatory factors in the mice's serum. We found that the levels of TGF-β1 (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001) (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD) and IL-10 (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eE) in the serum were significantly increased in the Liriodendron enema group compared to the irradiated-only group. Moreover, the highest levels of TGF-β1 (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001) and IL-10 (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001) in the serum were observed in the Liriodendron gavage group. Also, the levels of IFN-γ (p\u0026thinsp;\u0026lt;\u0026thinsp;0.01) (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eF) and TNF-α (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001) (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eG) in the serum were significantly reduced in the Liriodendron enema group compared to the irradiated-only group, and the mice in the Liriodendron gavage group had the lowest levels of IFN-γ (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001) and TNF-α (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001) in their serum.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec20\" class=\"Section2\"\u003e\u003ch2\u003e3.4 Liriodendron reduces the expression of intestinal fibrosis indicators in mice\u003c/h2\u003e\u003cp\u003eDue to the apparent difference between the Liriodendron gavage group and the irradiation-only group, we performed gene sequencing on the rectum tissues in the irradiated regions of these two groups of mice. A total of 204 genes were found to be up-regulated, while 72 genes were found to be down-regulated (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA). The heatmap analysis revealed a significant decrease in the expression of Jund, Ap-1, Cxcl9, and Smad3 in the rectum tissues of the Liriodendron gavage group after irradiation, as compared to the irradiation-only group (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB). The KEGG analysis demonstrated that the signaling pathway associated with rectal inflammatory bowel disease was down-regulated in the rectum tissues of the Liriodendron gavage group (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eThe GSEA analysis demonstrated that the collagen fibrillogenesis and TGF-β signaling pathways were down-regulated in the Liriodendron gavage group compared to the irradiation-only group (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD). The factors related to inflammation and fibrosis were confirmed using real-time fluorescence quantitative PCR. The results agreed with the sequencing results, showing reduced expression of Jund, Ap-1, Cxcl9, and Smad3 in the rectums of the Liriodendron gavage group (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eE).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec21\" class=\"Section2\"\u003e\u003ch2\u003e3.5 Liriodendron reduces oxidative damage and apoptosis in irradiated rectal tissues\u003c/h2\u003e\u003cp\u003eBased on the results of the sequencing analysis, it was observed that the pro-inflammatory pathway in the intestinal tissue of the Liriodendron gavage group was significantly down-regulated compared to the irradiation-only group. We assessed the level of reactive oxygen species (ROS) in the rectum cells of mice in three different groups: the control group, the irradiated group, and the Liriodendron gavage group. This assessment was done using flow cytometry, as shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA. The level of ROS in the rectum cells of mice in the Liriodendron gavage group was significantly reduced compared to those in the irradiation-only group (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB) (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC). In addition, the TUNEL method was used to measure the number of apoptotic cells in the rectum tissues of the three groups of mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eD). The results showed that the percentage of apoptotic cells in the Liriodendron gavage group mice was significantly lower than in the irradiation-only group (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eE). The observed effect may be attributed to the ability of Liriodendron to mitigate oxidative stress in the irradiated intestinal tissues, consequently decreasing apoptosis in the irradiated region of rectum tissue cells.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec22\" class=\"Section2\"\u003e\u003ch2\u003e3.6 Liriodendron attenuates fibrosis in irradiated mouse rectum tissues\u003c/h2\u003e\u003cp\u003eBased on the above results, we found that gavaged with Liriodendron after irradiation significantly reduced rectal contracture and down-regulated the signaling pathway of collagen fiber organization in the intestinal tissue of mice. Consequently, we analyzed various indicators of intestinal fibrosis. Masson staining revealed that mice in the irradiation-only group exhibited an increased amount of fibronectin compared to mice in the Liriodendron gavage group (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA). This difference was statistically significant (p\u0026thinsp;\u0026lt;\u0026thinsp;0.01) (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eB). The immunohistochemistry analysis (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eC) revealed a notable increase in α-SMA expression in the rectum tissue of mice in the irradiation-only group compared to the Liriodendron gavage group. This difference was statistically significant (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001) (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eD). The expression of α-SMA was identified through protein immunoblotting in the irradiated area of mice in both the gavage-treated and irradiation-only groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eE), and it showed that the expression of α-SMA in the Liriodendron gavage group was significantly lower than that in the irradiation-only group (p\u0026thinsp;\u0026lt;\u0026thinsp;0.01) (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eF).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e"},{"header":"4. Discussion","content":"\u003cp\u003eIonizing radiation can cause the production of a significant quantity of oxygen-free radicals in tissues in radiation proctopathy. Oxygen-free radicals can induce apoptosis by directly attacking or oxidizing biological macromolecules, including DNA and proteins \u003csup\u003e[17]\u003c/sup\u003e. This apoptosis can also result in abnormalities in the intestine's mechanical, immune, chemical, and biological barrier functions. Additionally, the intestinal flora's equilibrium is disturbed, resulting in the release of inflammatory factors and ultimate intestinal tissue damage \u003csup\u003e[18]\u003c/sup\u003e. This is consistent with the observed phenomenon, indicating that Liriodendron extracted from Fibraureae Caulis retained the antioxidant activity of Fibraureae Caulis and could exert a protective effect on the intestine.\u003c/p\u003e\u003cp\u003eCD4\u0026thinsp;+\u0026thinsp;T cells, an essential component of the immune system, can regulate inflammatory responses through multiple mechanisms \u003csup\u003e[19\u0026ndash;21]\u003c/sup\u003e. In anti-inflammatory responses, CD4\u0026thinsp;+\u0026thinsp;T cells can activate B cells to differentiate into plasma cells, produce specific antibodies to neutralize pathogens, and promote resolution of inflammation. Regulatory T cells (Tregs) can inhibit effector T cells and alleviate unnecessary inflammatory reactions. In addition, CD4\u0026thinsp;+\u0026thinsp;T cells can secrete cytokines such as IL-4 and IL-10 to suppress the activation of inflammatory cells, reduce the release of inflammatory mediators, and alleviate inflammation. They can also secrete TGF-β to stimulate cell proliferation and the synthesis of extracellular matrix proteins, promoting tissue repair. In this study, we observed an increase in the number of CD4\u0026thinsp;+\u0026thinsp;T cells in the intestinal tissues of mice after gavage with Liriodendron following irradiation, and the expression of anti-inflammatory factors in serum increased while pro-inflammatory factors decreased. This indicates that Liriodendron may exert anti-inflammatory effects through CD4\u0026thinsp;+\u0026thinsp;T cells, thereby improving radiation-induced intestinal inflammatory damage. However, we did not investigate the types of CD4\u0026thinsp;+\u0026thinsp;T cells that may have led to this phenomenon.\u003c/p\u003e\u003cp\u003eChronic intestinal fibrosis following radiotherapy is the primary pathological manifestation of radiation proctopathy, leading to abdominal pain, diarrhea, intestinal obstruction, intestinal perforation, and other symptoms. According to research, intestinal fibrosis is a systemic pathophysiological process characterized by changes in the extracellular matrix (ECM) and cell components of the intestinal wall, leading to the excessive accumulation of ECM and mesenchymal-like cells rich in collagen in the submucosa \u003csup\u003e[22, 23]\u003c/sup\u003e. Among them, myofibroblasts can secrete extracellular matrix (ECM) and various growth factors. After stimulation by inflammation or other factors, fibroblasts can transform and become activated into myofibroblasts. Activated myofibroblasts migrate to the injured site and continue to generate extracellular matrix (ECM), eventually leading to fibrosis \u003csup\u003e[24]\u003c/sup\u003e. α-Smooth muscle actin (α-SMA) is a characteristic protein of myofibroblasts. In this study, Masson's staining showed that intestinal fibrosis was significantly increased in irradiated mice, with high collagen fiber content in the submucosa, consistent with the pathological characteristics of clinical patients with radiation proctopathy. However, gavage with Liriodendron significantly reduced intestinal fibrosis in mice. The expression level of α-SMA in the rectum significantly increased after irradiation and decreased after drug administration. To explore the underlying mechanism, we performed differential gene enrichment analysis and observed that compared with irradiated mice alone, the expression of the collagen fiber formation signaling pathway and the TGF-β/Smad signaling pathway were downregulated in irradiated mice treated with Liriodendron. This suggests that Liriodendron may exert anti-fibrotic effects by downregulating the TGF-β/Smad signaling pathway and inhibiting collagen fiber formation, significantly alleviating intestinal fibrosis in mice with radiation proctopathy.\u003c/p\u003e\u003cp\u003eNevertheless, the alleviation of intestinal fibrosis was not apparent following the administration of Liriodendron via enema. The ineffectiveness of the treatment may be due to the impaired ability of the intestines to absorb the drug after radiation exposure, the drug is quickly excreted through the anus after enema administration in mice, and the further harm caused to the mice's intestines by the enema administration.\u003c/p\u003e\u003cp\u003eIn addition, we found a strange result during the study. We detected by ELISA that the serum TGF-β level of irradiated mice after treatment with Liriodendron was significantly increased. However, the expression level of TGF-β in the intestinal tissue was significantly down-regulated. After many experiments, we finally confirmed this result. TGF-β, as a key cytokine, may play anti-inflammatory and pro-inflammatory roles in different physiological and pathological states. However, it is generally considered an anti-inflammatory factor, so the serum TGF-β level of irradiated mice after treatment with Liriodendron is significantly increased to reduce inflammation. At the same time, in the process of chronic inflammation, TGF-β can promote the activation of fibroblasts and extracellular matrix (ECM) deposition, which leads to fibrosis and plays an important role in chronic inflammation and related diseases (such as liver fibrosis, lung fibrosis, and kidney fibrosis). After treatment with Liriodendron, the fibrosis in intestinal tissue was significantly reduced, so the expression level of TGF-β in intestinal tissue decreased. Nevertheless, its specific mechanism needs to be further explored.\u003c/p\u003e\u003cp\u003eDuring this study, we noticed an intriguing phenomenon: the coat color of the irradiated area of mice showed a transition to white in the sixth week after irradiation. Mice treated with Liriodendron enema after irradiation experienced a similar change in coat color, but it occurred slightly later, in the seventh week. In contrast, most of the mice that received Liriodendron through gavage after radiation did not exhibit this phenomenon during the eighth week (Figure \u003cspan refid=\"MOESM3\" class=\"InternalRef\"\u003eS3\u003c/span\u003e). These findings indicate that Liriodendron may mitigate tyrosinase damage in the hair follicles of irradiated mice. This effect may be attributed to Liriodendron suppressing NF-κB and TNF-α production \u003csup\u003e[25\u0026ndash;28]\u003c/sup\u003e.\u003c/p\u003e\u003cp\u003eThese findings suggest that Liriodendron can treat radiation proctopathy by reducing the intestinal inflammatory response, mitigating intestinal oxidative stress, and inhibiting intestinal fibrosis, thereby improving clinical symptoms and survival in irradiated mice. However, further mechanistic and clinical investigations are needed to verify its efficacy and clinical translational value.\u003c/p\u003e"},{"header":"5. Conclusion","content":"\u003cp\u003eThis study investigated the potential therapeutic effects of Liriodendron in mice with radiation proctopathy. Our findings indicate that Liriodendron can effectively alleviate the clinical symptoms caused by irradiation in mice, safeguard the integrity of the intestinal mucosal tissue, and increase survival rates. The mechanism could potentially be attributed to Liriodendron\u0026apos;s ability to mitigate intestinal oxidative stress, alleviates inflammation, and inhibit intestinal fibrosis. This demonstrates that Liriodendron possesses a distinct therapeutic impact on radiation proctopathy and warrants additional research.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eETHICS STATEMENT\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe animal experiments were approved by the Animal Care and Use Committee of the Animal Research Institute of the Sichuan Provincial People\u0026apos;s Hospital. The ethical number is Ethics (Research) No. 65 of 2017.\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eSUBJECT INFORMED CONSENT STATEMENT\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFUNDING\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by the National Natural Science Foundation of China (8200062054, 81771723) and the Department of Science and Technology of Sichuan Province (2022YFS0157,2021YFS0375) and the Grant from the Health Commission of Chengdu (No.2024586).\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCONFLICT OF INTEREST\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAUTHOR CONTRIBUTIONS\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eH.H. and G.Z. designed the study, H.H., J.L.and Y.Z. analyzed the data and wrote the manuscript; H.H., J.L., Y.Z., G.J., and B.L. completed the experimental operation to record the experimental data; Y.Z provided pre-experimental data. H.H., J.L., and G.Z were the guarantors of this work and, as such, had full access to all the data in the study and took responsibility for the integrity of the data and the accuracy of the data analysis.\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDATA AVAILABILITY STATEMENT\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe data supporting this study\u0026apos;s findings are available from the corresponding author upon reasonable request.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eShadad Abobakr K., Sullivan Frank J., Martin Joseph D., Egan Laurence J. (2013). Gastrointestinal radiation injury: prevention and treatment. World J Gastroenterol, 19(2), 199-208. doi:10.3748/wjg. v19.i2.199\u003c/li\u003e\n\u003cli\u003eFan Jinjia., Lin Binwei., Fan Mi., Niu Tintin., Gao Feng., Tan Bangxian., Du Xiaobo. (2022). Research progress on the mechanism of radiation enteritis. Front Oncol, 12, 888962. doi:10.3389/fonc.2022.888962\u003c/li\u003e\n\u003cli\u003eRen Huiwen., Wu Qi., Sun Zhiqiang., Fang Mingming., Liu Jun., Luo Judong.(2023). Research progress and treatment of radiation enteritis and gut microbiota. Radiat Oncol J, 41(2), 61-68. doi:10.3857/roj.2023.00346\u003c/li\u003e\n\u003cli\u003eAkbarali Hamid I., Muchhala Karan H., Jessup Donald K., Cheatham Stanley. (2022). Chemotherapy induced gastrointestinal toxicities. Adv Cancer Res, 155(undefined), 131-166. doi:10.1016/bs.acr.2022.02.007\u003c/li\u003e\n\u003cli\u003eMcCaughan Hannah., Boyle Stephen., McGoran John J.(2021). Update on the management of the gastrointestinal effects of radiation. World J Gastrointest Oncol, 13(5), 400-408. doi:10.4251/wjgo.v13.i5.400\u003c/li\u003e\n\u003cli\u003eZhang Li-Ying., Zhou Ting., Zhang Yi-Ming., Xu Xiao-Min., Li Yang-Yang., Wei Kong-Xi., He Jin-Peng., Ding Nan., Zhou Heng., Liu Yong-Qi.(2020). Guiqi Baizhu Decoction Alleviates Radiation Inflammation in Rats by Modulating the Composition of the Gut Microbiota. Evid Based Complement Alternat Med, 2020 9017854. doi:10.1155/2020/9017854\u003c/li\u003e\n\u003cli\u003eLi Di-Hua., Wang Yan., Lv Yuan-Shan., Liu Jun-Hong., Yang Lei., Zhang Shu-Kun., Zhuo Yu-Zhen.(2015). Preparative Purification of Liriodendron from Sargentodoxa cuneata by Macroporous Resin. Biomed Res Int, 2015(undefined), 861256. doi:10.1155/2015/861256\u003c/li\u003e\n\u003cli\u003eCheng Fang., Li Dan., Ma Xijia., Wang Yami., Lu Luyan., Hu Bin., Cui Shuke.(2024). Liriodendron exerts protective effects against chronic endometritis in rats by modulating gut microbiota composition and the arginine/nitric oxide metabolic pathway. Int Immunopharmacol, 126(undefined), 111235. doi:10.1016/j.intimp.2023.111235\u003c/li\u003e\n\u003cli\u003eZhang Zhen., Yang Lei., Wang Botao., Zhang Lanqiu., Zhang Qi., Li Dihua., Zhang Shukun., Gao Hongwei., Wang Ximo.(2017). Protective role of Liriodendron in mice with dextran sulphate sodium-induced ulcerative colitis. Int Immunopharmacol, 52(undefined), 203-210. doi:10.1016/j.intimp.2017.09.012\u003c/li\u003e\n\u003cli\u003eYang Lei., Li Dihua., Zhuo Yuzhen., Zhang Shukun., Wang Ximo., Gao Hongwei.(2016). Protective Role of Liriodendron in Sepsis-Induced Acute Lung Injury. Inflammation, 39(5), 1805-13. doi:10.1007/s10753-016-0416-1\u003c/li\u003e\n\u003cli\u003eSong Shunxin., Chen Dianke., Ma Tenghui., Luo Yanxin., Yang Zuli., Wang Daohai., Fan Xinjuan., Qin Qiyuan., Ni Beibei., Guo Xuefeng., Xian Zhenyu., Lan Ping., Cao Xinping., Li Mingtao., Wang Jianping., Wang Lei. (2014). Molecular mechanism of acute radiation enteritis revealed using proteomics and biological signaling network analysis in rats. Dig Dis Sci, 59(11), 2704-13. doi:10.1007/s10620-014-3224-1\u003c/li\u003e\n\u003cli\u003eAshcraft Kathleen A., Miles Devin., Sunday Mary E., Choudhury Kingshuk Roy., Young Kenneth H., Palmer Gregory M., Patel Pranalee., Woska Emily C., Zhang Ray., Oldham Mark., Dewhirst Mark W., Koontz Bridget F. (2018). Development and Preliminary Evaluation of a Murine Model of Chronic Radiation-Induced Proctitis. Int J Radiat Oncol Biol Phys, 101(5), 1194-1201. doi:10.1016/j.ijrobp.2018.04.061\u003c/li\u003e\n\u003cli\u003eLu Weisi., Xie Yunling., Huang Binjie., Ma Tenghui., Wang Huaiming., Deng Boxiong., Zou Shaomin., Wang Wencong., Tang Qin., Yang Ziqing., Li Xuri., Wang Lei., Fang Lekun.(2021). Platelet-derived growth factor C signaling is a potential therapeutic target for radiation proctopathy. Sci Transl Med, 13(582). doi:10.1126/scitranslmed.abc2344\u003c/li\u003e\n\u003cli\u003eBooth C, Tudor G, Tudor J, Katz BP, MacVittie TJ. Acute gastrointestinal syndrome in high-dose irradiated mice. Health Phys. 2012 Oct;103(4):383-99. doi: 10.1097/hp.0b013e318266ee13.\u003c/li\u003e\n\u003cli\u003eMacDonald KP, Rowe V, Filippich C, Thomas R, Clouston AD, Welply JK, Hart DN, Ferrara JL, Hill GR. Donor pretreatment with progenipoietin-1 is superior to granulocyte colony-stimulating factor in preventing graft-versus-host disease after allogeneic stem cell transplantation. Blood. 2003 Mar 1;101(5):2033-42. doi: 10.1182/blood-2002-05-1529.\u003c/li\u003e\n\u003cli\u003eLangberg CW, Sauer T, Reitan JB, Hauer-Jensen M. Tolerance of rat small intestine to localized single dose and fractionated irradiation. Acta Oncol. 1992;31(7):781-7. doi: 10.3109/02841869209083871\u003c/li\u003e\n\u003cli\u003eWang Weihong., Cui Bota., Nie Yongzhan., Sun Lijuan., Zhang Faming. (2024). Radiation injury and gut microbiota-based treatment. Protein Cell, 15(2), 83-97. doi:10.1093/procel/pwad044\u003c/li\u003e\n\u003cli\u003eCagin Yasir Furkan., Parlakpinar Hakan., Vardi Nigar., Aksanyar Salih. (2022). Protective effects of apocynin against ionizing radiation-induced hepatotoxicity in rats. Biotech Histochem, 97(3), 228-235. doi:10.1080/10520295.2021.1936641\u003c/li\u003e\n\u003cli\u003eCeeraz Sabrina., Thompson Charlotte R., Beatson Richard., Choy Ernest H. (2021). Harnessing CD8CD28 Regulatory T Cells as a Tool to Treat Autoimmune Disease. Cells, 10(11). doi:10.3390/cells10112973\u003c/li\u003e\n\u003cli\u003eNiwińska Anna., Olszewski Wojciech P. (2021). The role of stromal immune microenvironment in the progression of ductal carcinoma in situ (DCIS) to invasive breast cancer. Breast Cancer Res, 23(1), 118. doi:10.1186/s13058-021-01494-9\u003c/li\u003e\n\u003cli\u003eChamouard Patrick., Monneaux Fanny., Richert Zoe., Voegeli Anne-Claire., Lavaux Thomas., Gaub Marie Pierre., Baumann Ren\u0026eacute;., Oudet Pierre., Muller Sylviane. (2009). Diminution of Circulating CD4+CD25 high T cells in na\u0026iuml;ve Crohn\u0026apos;s disease. Dig Dis Sci, 54(10), 2084-93. doi:10.1007/s10620-008-0590-6\u003c/li\u003e\n\u003cli\u003eD\u0026apos;Alessio Silvia., Ungaro Federica., Noviello Daniele., Lovisa Sara., Peyrin-Biroulet Laurent., Danese Silvio. (2022). Revisiting fibrosis in inflammatory bowel disease: the gut thickens. Nat Rev Gastroenterol Hepatol, 19(3), 169-184. doi:10.1038/s41575-021-00543-0\u003c/li\u003e\n\u003cli\u003eOkoshi Kae., Kubo Hajime., Nagayama Satoshi., Tabata Chiharu., Kadokawa Yoshio., Hisamori Shigeo., Yonenaga Yoshikuni., Fujimoto Akihisa., Mori Akira., Onodera Hisashi., Watanabe Go., Sakai Yoshiharu. (2008). All-trans-retinoic acid attenuates radiation-induced intestinal fibrosis in mice. J Surg Res, 150(1), 53-9. doi:10.1016/j.jss.2007.12.762\u003c/li\u003e\n\u003cli\u003eZhao Dong, Zha Shiqian, Wang Yixuan, Pan Zhou, Yu Wenzhen, HU Ke. Macrophage-to-myofibroblast transition promotes pulmonary fibrosis occurred in LPS-induced acute lung injury of mouse models[J]. Basic \u0026amp; Clinical Medicine, 2024, 44(3): 281-287. doi:10.16352/j.issn.1001-6325.2024.03.0281\u003c/li\u003e\n\u003cli\u003eChou Wei Chin., Takeo Makoto., Rabbani Piul., Hu Hai., Lee Wendy., Chung Young Rock., Carucci John., Overbeek Paul., Ito Mayumi. (2013). Direct migration of follicular melanocyte stem cells to the epidermis after wounding or UVB irradiation is dependent on Mc1r signaling. Nat Med, 19(7), 924-9. doi:10.1038/nm.3194\u003c/li\u003e\n\u003cli\u003eTobin D J., Paus R. (2001). Graying: gerontobiology of the hair follicle pigmentary unit. Exp Gerontol, 36(1), 29-54. doi:10.1016/s0531-5565(00)00210-2\u003c/li\u003e\n\u003cli\u003eSchallreuter Karin U., Salem Mohamed M A E L., Hasse Sybille., Rokos Hartmut. (2011). The redox--biochemistry of human hair pigmentation. Pigment Cell Melanoma Res, 24(1), 51-62. doi:10.1111/j.1755-148X.2010.00794.x\u003c/li\u003e\n\u003cli\u003eSlominski Andrzej., Wortsman Jacobo., Plonka Przemyslaw M., Schallreuter Karin U., Paus Ralf., Tobin Desmond J. (2005). Hair follicle pigmentation. J Invest Dermatol, 124(1), 13-21. doi:10.1111/j.0022-202X.2004.23528.x\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"chinese-medicine","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"cmed","sideBox":"Learn more about [Chinese Medicine](http://cmjournal.biomedcentral.com)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/cmed/default.aspx","title":"Chinese Medicine","twitterHandle":"@BioMedCentral","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Radiation proctopathy, Liriodendron, Oxidative stress, Anti-apoptosis, Anti-fibrosis","lastPublishedDoi":"10.21203/rs.3.rs-7060441/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7060441/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eRadiotherapy is a routinely therapeutic approach for malignant tumors in the abdomen. Nevertheless, radiation proctopathy is the main side effects that occur during radiotherapy and there are scarce pharmaceutical interventions available. In this study we aimed to investigate the effectiveness of Liriodendron, a primary extract used in traditional Chinese medicine Fibraureae Caulis, on the prevention and treatment of radiation proctopathy. We created a mouse model of radioactive proctopathy by local irradiation and analyzed various clinicopathologic measures for the subsequent eight weeks. We found that Liriodendron gavage group and Liriodendron enema groupwith radiation proctopathy resulted in a reduction in the generation of pro-inflammatory cytokines and an increase in the secretion of anti-inflammatory cytokines by transcriptome sequencing analysis and ELISA examination. Additionally, Liriodendron administration resulted in a reductionin the level of reactive oxygen species (ROS) and apoptotic cells in intestinal tissue of mice. MASSON staining and immunohistochemistry revealed that Liriodendron could reduce the expression of α-SMA in rectal tissue and the level of intestinal fibrosis in mice with radiation proctopathy. In conclusion, this study suggests that Liriodendron has the potential to be used as a medication for treating radiation proctopathy.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e","manuscriptTitle":"Liriodendron attenuates intestinal fibrosis and inflammation in mice with radiation proctopathy","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-07-31 10:03:48","doi":"10.21203/rs.3.rs-7060441/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2025-08-05T15:38:29+00:00","index":"","fulltext":""},{"type":"reviewerAgreed","content":"126511870178048285729020725662133701779","date":"2025-08-05T13:21:32+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-08-02T13:05:34+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-08-01T01:02:08+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"260722987049399628056206341195819687870","date":"2025-07-31T16:07:36+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"208987997845896227048061089224278905902","date":"2025-07-30T00:00:43+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"47364673544982808202655070436059297859","date":"2025-07-29T16:12:22+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-07-29T15:47:57+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-07-16T03:23:42+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-07-16T03:23:25+00:00","index":"","fulltext":""},{"type":"submitted","content":"Chinese Medicine","date":"2025-07-07T01:54:22+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"chinese-medicine","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"cmed","sideBox":"Learn more about [Chinese Medicine](http://cmjournal.biomedcentral.com)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/cmed/default.aspx","title":"Chinese Medicine","twitterHandle":"@BioMedCentral","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"4d826a80-739e-4dd7-accd-4af395c4e199","owner":[],"postedDate":"July 31st, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2025-11-03T16:00:33+00:00","versionOfRecord":{"articleIdentity":"rs-7060441","link":"https://doi.org/10.1186/s13020-025-01228-5","journal":{"identity":"chinese-medicine","isVorOnly":false,"title":"Chinese Medicine"},"publishedOn":"2025-10-27 15:57:20","publishedOnDateReadable":"October 27th, 2025"},"versionCreatedAt":"2025-07-31 10:03:48","video":"","vorDoi":"10.1186/s13020-025-01228-5","vorDoiUrl":"https://doi.org/10.1186/s13020-025-01228-5","workflowStages":[]},"version":"v1","identity":"rs-7060441","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7060441","identity":"rs-7060441","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.