Phylogenomic tree of Cercozoa based on single-cell transcriptomes from 100 uncultured cells

preprint OA: closed CC-BY-4.0
Full text 158,447 characters · extracted from preprint-html · click to expand
Phylogenomic tree of Cercozoa based on single-cell transcriptomes from 100 uncultured cells | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Phylogenomic tree of Cercozoa based on single-cell transcriptomes from 100 uncultured cells Gordon Lax, Elizabeth C. Cooney, Vasily Zlatogursky, Mahara Mtawali, and 7 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7584520/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 9 You are reading this latest preprint version Abstract Background Cercozoa are single-celled eukaryotes (protists), and part of the supergroup Rhizaria. Cercozoans have vastly different morphologies and are defined by their phylogenetic affinity. While the group includes some well-known and well-researched taxa, like the chlorarachniophytes, we know very little about the remainder. Most of these are predatory protists found in soil and marine sediments, but also include marine plankton, and are underrepresented in multigene phylogenetic trees of Rhizaria, thus missing much of their diversity. We employed single-cell transcriptomics to broadly sample this uncultured diversity of Cercozoa. Results We generated a taxon-comprehensive multigene tree of Cercozoa that includes many previously unsampled groups, increasing taxon sampling by more than 300%. We report 5 novel and previously unknown lineages, and two lineages that were only known from environmental sequences. Several previously established clades are recovered, like Thecofilosea, phaeodarians, and thaumatomonads, but others like the class Imbricatea are not. We find both single and double amino-acid insertions between polyubiquitin monomers in all our assemblies, suggesting a complex pattern across Cercozoa. Conclusions By using a single-cell transcriptomics approach generated a wealth of molecular and morphological image data for phylogenomics. This phylogenetic framework is in turn the groundwork for additional analyses to further our understanding of the basic biology of Cercozoa, and their diversity. This study also highlights the number of previously unsampled taxa, and completely novel lineages in Rhizaria, and Cercozoa in particular. multigene Rhizaria RNAseq protist Phaeodaria Cercomonas Figures Figure 1 Figure 2 Figure 3 Background Cercozoa is a major lineage of microbial eukaryotes that are abundant across a wide range of ecosystems, have significant and diverse ecological impacts, and are highly diverse at both molecular and morphological levels [ 1 – 4 ]. Unlike other major lineages of eukaryotes, the phylum Cercozoa was only circumscribed through molecular phylogeny: the group lacks any shared morphology or a common body plan, so their monophyly was never recognized before molecular gene trees showed them to be related [ 5 – 7 ]. Cercozoan morphological diversity is extreme, with a wide range of unique characters and body plans ranging from small flagellates and amoeboflagellates, to naked and testate amoebae, to heliozoan-like amoebae and massive planktonic predators with mineralized endoskeletons [ 8 – 10 ]. Their ecological diversity is equally vast, with predators, grazers, phototrophs, and parasites common and abundant in freshwater, terrestrial, coastal and deep-sea environments [ 1 , 11 , 12 ]. How this diversity arose and how their many unique characteristics evolved are interesting questions, but we have few insights because Cercozoa are also one of the most poorly studied of all eukaryotic groups. As a consequence, there are sparse genomic resources (a single genome and a few transcriptomes outside the Chlorarachniophytes [ 13 ]), relatively few formally described species given the size of the group, and no well-sampled and strongly-supported phylogeny, since for most lineages only a single gene, the small subunit (SSU) rRNA, is available. Understanding the diversity and evolution of Cercozoa requires a well-supported phylogenetic tree, and while the breadth of taxa in the current SSU phylogenies has grown rapidly, many major subgroups in the tree are not well-supported (e.g. [ 14 ]). In addition, some groups encode highly divergent SSU rRNA genes, including some of the small flagellates like Helkesimastix , or the giant deep-sea phaeodarians, which drastically differ from other Cercozoans in morphology and are superficially more similar to another group, Radiolaria, to the extent that they were once classified as such, and have since been reassigned [ 15 , 16 ]. In addition, although Cercozoa are abundant in a wide range of global ecosystems, most of the current data come from terrestrial taxa [ 1 , 2 , 17 ], whereas marine environments are under-sampled [ 3 , 4 ]. New cultures of cercozoans are established at a relatively steady but low rate [ 3 , 18 – 22 ], but even in these cases often the SSU rRNA gene represents the only available molecular data, so the current genomic data are sparse and biased. Evidence of this can also be seen in the many cercozoan SSU rRNA clades that remain solely made up of environmental sequences [ 23 ]. Many of these were discovered over 20 years ago, but still remain essentially uncharacterized. Here, we have used a single-cell transcriptome approach[ 24 – 26 ] to circumvent the lack of cultured representatives and establish a strong molecular foundation for interpreting the diversity of Cercozoa. Specifically, we generated 119 single-cell transcriptomes from diverse cells broadly representing most of the clades across the cercozoan tree, emphasizing under-represented groups and habitats, like marine ecosystems. We provide the first substantial sampling from two large and complex groups that are morphologically unlike other cercozoans and more reminiscent of other major groups: the phaeodarians (which resemble radiolarians) and the desmothoracids (which resemble heliozoans). Using these 119 single-cell transcriptomes, we have generated a taxon-rich multigene analysis based on 70 genes of 115 taxa. The tree highlights cercozoan diversity and is the first multigene tree to sample most known sub-groups. Comparing this phylogenetic tree to existing trees based on SSU rRNA, we confirm some of the well-known clades, like Thecofilosea, whereas other proposed taxa, like Imbricatea, are shown to be polyphyletic. Several cells fall into clades that were previously known only from environmental sequences, and nine cells represent four novel clades that have never been sampled, even in environmental rRNA studies. Overall, this work begins to provide a well-supported backbone on which to begin to infer the evolution of a major but often overlooked group of eukaryotes. Results & Discussion Isolating Diverse Cercozoan Cells from Nature We collected 119 cells preliminarily identified as likely being cercozoans (in itself a challenging task due to their morphological variation) from 40 different locations over a span of five years ( see Supplementary Table S1 for details ). From each of these cells, cDNA and library construction was carried out, leading to 99 cells that yielded relatively high-quality transcriptome data based on recovery of phylogenomic marker genes. Some morphotypes determined to be the same species were co-assembled at the marker-gene level in PhyloFisher, yielding novel multigene data for 70 discrete taxa in our final dataset. These cells represent an incredible diversity of morphology ( see Fig. 1 for representatives, and Supplemental Figs. 1 & 2 for additional micrographs ). Most available cercozoan genomes and transcriptomes come from the photosynthetic chlorarachniophytes and the euglyphids, and all of them are from cultured species. The new transcriptomic data increase sampling across the whole of Cercozoa by 470%, or more conservatively by almost 330% when you only consider the level of distinct species. From the transcriptomes, the SSU rRNA was first extracted to get a rough idea of each cell’s identity and to seek evidence for cases where the species might already have been described formally (some transcriptomes did not have any SSU rRNA sequences recovered). The SSU rRNA tree ( Supplemental Figure S3 ) showed that the sampling does indeed cover most cercozoan subgroups, with a particularly strong representation from thecofilosans, a very large, diverse, and under-sampled subgroup. 30 cells were sufficiently closely related to known species and 32 to known genera to be given those names, while 45 lacked close, described relatives. Overall Structure of the Phylogenomic Tree Thecofilosea is one of the most diverse and widespread sub-groups of Cercozoa, but also historically under-sampled other than a few relatively well-known taxa (e.g. Cryothecomonas ), and our data confirms the deep divergence and monophyly of this group (Fig. 2 ). We also confirm that Phaeodaria, Cryomonada, and Ventricleftida are all major subgroups of Thecofilosea. In addition, many other flagellated and amoeboid gliding and surface-associated taxa like Ebria , Katarium , Rhogostoma , all fall within the Thecofilosea with strong support, but they do not fall within any of the previously recognized subgroups, suggesting that this group will require additional taxonomic revisions in the future to account for its full diversity. With the exception of the Phaeodaria and Ebria , all other thecofilosan cells appear to be surface-associated, which may be a taxonomically important characteristic to examine further. An exception to this is Cryothecomonas , which is known to be parasitic on diatoms [ 27 ], and we also found evidence for this being more widespread within the group. For example all three cells used for co-assembly Cryotheco1-co were isolated from inside different diatom frustules. The taxonomic delineation between Protaspa and Cryothecomonas is currently unclear [ 3 , 4 ], and likely requires additional sampling for molecular sequencing and ultrastructural studies since they are morphologically very similar. Interestingly, the genus Ebria falls in the same place as it does in the SSU rRNA tree, sister to a clade composed of Cryomonadida plus Rhogostoma and Mataza , all within Thecofilosea [ 3 , 28 ]. The closest relative to Ebria in SSU rRNA phylogenies is Botuliforma —a thecate benthic amoeboflagellate isolated from anoxic marine sediment that has been sequenced and reported only once [ 4 ]. This is in stark contrast to Ebria , which is a marine planktonic flagellate with an internal siliceous skeleton [ 29 ]. Very little is known about the life cycle and evolution of Ebria , and acquiring genomic or transcriptomic data from Botuliforma would be a crucial step in understanding the evolutionary history of Ebria , particularly since some members of the Thecofilosea have been shown to share ultrastructural traits [ 30 ], but such data is very limited for Ebria [ 29 ] or absent for Botuliforma . Hermesinum , which is morphologically very similar to Ebria , has also been shown to be closely related to the latter based on SSU rRNA analyses, so genomic data from this genus might also shed light on this evolution [ 28 ]. Two other previously proposed cercozoan subgroups that are recovered with high support are Marimonadida and Thaumatomonadidae (Fig. 2 ) [ 3 ]. The tree supports the monophyly of several genera originally included in Marimonadida, such as Pseudopirsonia, Auranticordis , and Abollifer , as well as several cells of unknown genera, like the co-assembly SB456C. The Thaumatomonadidae clade is similarly made up of several of the genera originally proposed to be in this group: Thaumatomastix , Allas , and Discomonas [ 3 , 31 ]. We do not recover a monophyletic group corresponding to the Sarcomonadea (Fig. 2 ; [ 3 , 32 ]), but do recover both Pediglissa and Paracercomonada, which are the two orders that were proposed to make up Sarcomonadea [ 32 ]. Pediglissa includes cercomonads and glissomonads ( Sandona SC1169), and while the support for this group is low in our phylogeny at 70/79% (UFB/PMSF), there is better support (93/88%) for a group including Pediglissa together with euglyphids. Cells Cercomonas SPO5 and Sandona SC1169 both branch with members of the Cercomonadida, but Paracercomonas branches outside this group, rendering Cercomonadida non-monophyletic, something that has been reported previously [ 3 , 32 ], and further complicating the taxonomic definition of Sarcomonadea. Cavalier-Smith et al. placed Paracercomonas in a separate subclass Paracercomonada from other cercomonads [ 32 ], but kept the taxon Sarcomonadea despite recovering it as paraphyletic. More strikingly, we do not recover any support for the Imbricatea, which was proposed based on SSU phylogenies [ 3 , 33 ]. We find various lineages that were proposed to be members of this group to be polyphyletic, in many cases with strong support. This is congruent with a study by Cavalier-Smith et al, which show Imbricatea to be non-monophyletic in a smaller multigene phylogeny [ 32 ]. Phaeodarians Phaeodarians are large, planktonic, amoeboid heterotrophs that are most common in the deep ocean and were long thought to be radiolarians due to the overall similarities occuring between them as large amoebae with complex internal mineralized skeletons [ 15 , 34 , 35 ]. However, the first SSU rRNA data from the group showed they were actually cercozoans, probably related to Thecofilosea, and the single small EST data set from one species, Aulacantha scolymantha , also showed this [ 15 , 16 , 34 ]. We have now sequenced transcriptomes from 20 phaeodarian cells, which confirms they branch within Thecofilosea (Fig. 2 ). While this is not a new placement, it is worth emphasizing this position since the previously available data was limited, and the new phaeodarian transcriptomes are among the best in our data set (some co-assemblies reaching 99% completeness). Single-cell transcriptomics seems like an ideal way to approach these difficult-to-access deep sea cells for the future. Our sampling mostly focuses on the various aulosphaerids (Aulosphaerid sp., Aulastrum ), aulacanthids ( Aulokleptes , Aulographis ), and Protocystis , and shows high support for the monophyly of Protocystis and Castanarium , but several other groups are not well represented and appear to be non-monophyletic (including aulosphaerids and aulacanthids), and the overall deep nodes in phaeodarian phylogeny are not yet resolved. A focused study on phaeodarians should allow for a larger matrix of more genes and, if mixed with wider taxon sampling, a well-resolved phylogeny of the group may be possible. Novel and Environmental Clades Bass et al (2004) identified several new clades of Cercozoa based only on environmental sequencing, and called them ‘Novel Clades (NC)’. Some of these have remained essentially uncharacterized even after 20 years, so we specifically examined any potential cases where an isolated cell represented these clades, and found two cases. The morphologies of these cells appear similar to one another and to other cercozoans at first glance, but closer inspection suggests there are differences in morphology and behaviour. In the first case, the SSU rRNA tree shows that cells CBS2 and co-assembly FilosaNC6-co (TBS14, TBS20, TBS21) correspond to Novel Clade 6 (NC6) ( Figure S3 ). These cells are inconspicuous biflagellates; in the case of FilosaNC6, the cells were all dorso-ventrally flattened, oval to oblong with notches on both anterior and posterior, and move via a ‘bouncing’ motion on their posterior flagellum (Fig. 1 J-L, Videos TBS14, TBS20, TBS21 Borealis Supplemental Data ). Cell CBS2 exhibits a similar pattern of movement, but the cell body is less flattened, more oblong, and is full of granulated reflective inclusions (Fig. 1 I). All cells ‘whip’ their anterior flagellum up and down ( Videos CBS2 Borealis Supplemental Data ). In the phylogenomic tree, this group branches with another novel clade discovered here and the genus Micrometopion (see below), with low to moderate support (90% UFB, 74% PMSF). The second case is cell LC32-83, corresponding to the environmental clade dubbed ‘eVentri’ [ 14 , 36 ], which is sister to Ventrifissura in our phylogenomic tree (Fig. 2 ), and in turn these two are sister to Verrucomonas with full support. The ‘eVentri’ environmental data, as well as Verrucomonas and Ventrifissura are all known from marine sediment [ 4 , 14 ], but exact placement of ‘eVentri’ was unclear from SSU data. Altogether, we show that these taxa make up the proposed Ventricleftida [ 3 ] with full support, despite not being recovered in most SSU phylogenies [ 3 , 14 , 20 ]. Our cell LC32-83 shares certain morphological characteristics with the ventricleftids, Ventrifissura velata and V. artocarpoidea (Fig. 1 H; [ 4 , 14 ]). All are biflagellated, and have a ‘dimpled’ texture, although it is more pronounced on V. velata and V. artocarpoidea . It should be noted that many thecofilosans, including Ventrifissura , have life cycles that are poorly understood, with diverse morphologies [ 3 , 14 ], so it remains possible that different life stages of related lineages are being observed, making them appear more morphologically distinct. Interestingly, this Ventricleftida group also contained three other cells (TBM2, TBM3, and QCH3) that formed a distinct sub-group with no close known relatives that we call ‘Novel Clade A’ (Fig. 2 ). These cells are morphologically very similar to each other—dorso-ventrally flattened flagellates that glide on their posterior flagellum, with no anterior flagellum visible, and a round to oblong cell shape with a median furrow that is very pronounced in the anterior part of the cell (Fig. 1 Q-S). Apart from the somewhat generic round-oblong cell body shape, this morphology is different from other known ventricleftids, as both Verrucomonas and Ventrifissura have two obvious emergent flagella. Some Verrucomonas have characteristic pigmented dimples on their surface as well, as opposed to all our cells [ 4 ], but it should be noted that ventricleftids overall are poorly understood, with only two studies available [ 4 , 14 ]. There are no environmental sequences that fall into this ventricleftid subgroup, despite the substantial amount of environmental sequence data from Cercozoa ( Supplemental Figure S3 ). More interestingly, three other cells (TS2, SMB3, and NO2022) also formed ‘Novel Clade B’ (Fig. 2 ), which branched with moderate support and distantly with Micrometopion and the newly characterized cells from the previously reported environmental NC6 group (see above; 90/74% [UFB/PMSF]). All three cells are biflagellates with oblong to ovoid cell shapes and two long, thin flagella (Fig. 1 A-C). While the cells seem to glide on their posterior flagellum, the anterior flagellum ‘whips’ up and down along the apical 2/3 of its length, without much side-to-side movement ( Videos TS2, SMB3, NO2022 Borealis Supplemental Data ; we did not observe this behaviour in cell NO2022). While much more pronounced here, this behaviour is similar to that of cells in Novel Clade 6. Micrometopion on the other hand is a much smaller biflagellate that glides on its posterior flagellum and has a barely emergent anterior flagellum [ 3 ], illustrating that more detailed studies are needed to understand this group. Similarly, cell QCF12 branched sister to the newly characterized cell FiloNC4co in our multigene tree, albeit with poor support (50–60%). SSU rRNA of cells used in co-assembly of FiloNC4co/’Novel Clade C’ (cells BB13, BB15, TBM7) branch with an environmental sequence (clone 9-2.2), which used to be considered a member of ‘Novel Clade 4’ previously ( Supplementary Figure S3 ; [ 23 ]), but apparently has since been viewed as a separate lineage within Cercozoa [ 3 , 20 ]. In our multigene tree, FiloNC4co and QCF12 branch sister to the Marimonadida, in a completely different part of the tree than ‘Novel Clade 4’ (Fig. 2 ), representing yet another two novel uncharacterized lineages. The morphology of QCF12 shows an oblong to ovoid cell with internal granulated structure that is dorsoventrally flattened (Fig. 1 D), gliding on its thin posterior flagellum with the thin anterior flagellum beating irregularly side-to-side ( Video QCF12 Borealis Supplemental Data ). Unfortunately, the SSU rRNA sequence could not be recovered in the transcriptome of cell QCF12 (which is rare, but not unheard of [ 25 ]), so we cannot rule out that QCF12 is related to representatives of any previously known environmental or characterized clade. The morphology of cells from FiloNC4co (Fig. 1 E-G) are somewhat different than cell QCF12, with a more irregular cell shape and more pronounced side-to-side beating of the anterior flagellum in QCF12 ( Videos QCF12 and BB13 Borealis Supplemental Data ). Deeper branches Three other cells fell in very interesting deep-branch positions: Hedriocystis , Tremula (SC1200), and co-assembly WFco (Fig. 2 ). Previously, Lapot was characterized as part of the Aquavolonidae (formerly NC10, [ 9 , 37 ]), Tremulida was formerly known as NC11 [ 38 ], and in SSU rRNA trees Tremula , Lapot , and NC12 were shown to form a clade that was sister to Endomyxa [ 9 ], but without strong support. We instead recover a strongly supported clade of Lapot , Tremula , and a previously unknown lineage represented by co-assembly WFco (Fig. 2 , ‘Novel Clade D’), all sister to a group consisting of Phytomyxea, Ascetosporea, and Apofilosa [ 39 ], albeit with low support. Cells in co-assembly WFCo are metabolic amoeboflagellates with two flagella (Fig. 1 M-O, Videos WF2, WF3, WF4 Borealis Supplemental Data ), suggesting some similarity to Lapot gusevi , which is also metabolic and possesses two unequal flagella [ 9 ]. Movement patterns of both taxa are similar as well. Furthermore, our Tremula SC1200 isolate is also metabolic with 2 emergent flagella (Fig. 1 T, Video SC1200 Borealis Supplemental Data ), suggesting this morphology might be ancestral to this group, but additional studies using light and electron microscopy are needed. Based on the strongly supported Tremulida + Aquavolonida + WFco (‘Novel Clade D’) clade in our multigene analyses, and the morphological similarities, we propose to amend the class Skiomonadae ([ 40 ], amended to include Aquavolonida [ 32 ]) and the deeper diversity associated with this clade, particularly WFco. Reminiscent of the historical association of Phaeodaria with Radiolaria, the order Desmothoracida in the class Granulofilosea bear a strong resemblance to heliozoan amoebae (Fig. 1 P), and were originally thought to be related to them, but are now known to be cercozoans (Bass et al 2009). Our Hedriocystis pellucida cell SC1203 represents the first molecular data for this species, and the first multigene data for Desmothoracida. In the SSU tree, we recover this species branching with an environmental sequence in a clade which includes Hedriocystis reticulata and Clathrulina elegans ( Figure S3 ), as expected. In the phylogenomic tree, Hedriocystis forms a deep, isolated branch within Cercozoa, as the only representative of the much larger class Granofilosea. Overall this suggests the heliozoan-like cercozoans are likely an ancient, independent lineage much like Phaeodaria, and will likely require specific attention to determine their diversity and internal evolutionary radiation. Conclusions: A Broad Scale Tree of Cercozoa Cercozoa are a major group of eukaryotes, found abundantly in diverse ecosystems across the planet, and play key roles as primary producers, heterotrophs, and parasites [ 1 , 8 , 23 ]. Yet they are dramatically understudied, with some of the most sparse genomic data in any part of the tree of life [ 13 , 41 ]. Phylogenomics has been applied to diverse members of this group relatively recently, on a small scale, based on a few available cultures [ 9 ]. Our tree roughly supports many of the conclusions of these early analyses, but also massively expands on the scope of the data available (with over 3X more taxa). This analysis already goes a long way to define which sub-groups are well-supported, which ones are not, and also provides the first supported placement for a number of groups that were previously only known from a single environmental sequence or not represented by any data at all (Fig. 3 ). While a full-scale analysis of character evolution is beyond the scope of this report, the tree topology and the data underpinning it should prove critical to such analyses. For example, we can already confirm that the polyubiquitin insertions that were first proposed to be a uniting character of Rhizaria [ 8 , 32 , 42 – 44 ] are indeed present in all of our transcriptomes, but interestingly in some clades the exact nature of the insertions varies, and have a complex distribution (Fig. 3 ). Some cercozoan clades (thaumatomonads, phaeodarians, euglyphids, cercomonads, and ventricleftids) have two amino acid insertions between polyubiquitin monomers as reported previously [ 32 , 45 ], whereas others like cryothecomonads and Ebria only have one. A single amino acid insertion was proposed to be ancestral to Rhizaria, while a double insertion may be a more derived trait [ 32 ]. Our wealth of data complicates this view somewhat, with some shallow-branching cercozoan clades likely having secondarily lost the double amino acid insertion (e.g. cryothecomonads). But for most of the basic biology of many of these groups we lack enough information to really say much. As the data for Cercozoa expand, its interpretation will certainly be aided by a strongly supported tree representing all the major subgroups of Cercozoa, which appears to be technically feasible by relying heavily on the single-cell transcriptomics methods we used here, particularly considering the time and effort needed to establish cultures of protists. Methods Cell isolation and imaging Cells were sampled from 40 different locations across North America and the Caribbean, spanning several different habitats (marine benthos, marine plankton, soil; Supplemental Table S1 ). Sampling was facilitated by the Hakai Institute (Quadra Island), the Northern Gulf of Alaska Long Term Ecological Research project (Alaska), and the Caribbean Research and Management of Biodiversity facility (CARMABI; Curaçao). For benthic samples, sediment, mud, or sand was collected from the aerated upper 2 cm. Sample extraction followed the kimwipe-method [ 46 ], with cells aggregating on coverslips after several hours. Coverslips were observed with the downside facing upwards on an inverted microscope (Leica DMIL-LED), imaged with Sony alpha7S III or Sony alpha7RIII cameras, at either 40x or 63x magnification. Planktonic samples were either collected via an array of methods. In the Gulf of Alaska, samples were collected from the R/V Sikuliaq using a 21 µm hand net, 53 and 150 µm vertically towed calvets, 150 µm multinets, and Niskin bottles on CTD-rosettes, from which water was concentrated using gravity filtration with a 0.8 µm (47 mm) filter (Pall). On Quadra Island, samples were collected using a hand net deployed from shore, or vertical 250 µm zooplankton net tows deployed from a vessel. All samples were immediately observed after collection (or after concentration in the case of Niskin samples). Cells were imaged on an inverted microscope at 10x, 20x, 40x, or 63x magnification (Leica DMIL-LED), or dissection microscope (Zeiss Stemi 508) with Sony alpha7S III or Sony alpha7RIII cameras. The single soil sample (SPO5) was isolated from forest litter, a small amount of which was submerged in dH 2 O for a day, and then observed under a Leica DMIL-LED inverted microscope and imaged with a Sony alpha7RIII camera at 63x magnification. In all cases, after imaging, cells were manually isolated from coverslips or seawater with a microcapillary, rinsed 2–6 times in drops of clean 0.2µm filtered seawater (marine samples) or 0.2µm filtered tapwater (soil), and dispensed into 2µl of SmartSeq2 lysis buffer [ 47 ]. Samples SC1169, SC1200, and SC1203 were derived from crude cultures. Raw samples ( Supplementary Table 1 ) were at room temperature for two weeks with the addition of 0.025% wheat grass extract to promote bacterial growth. Cells were manually isolated with tapered Pasteur pipettes and inoculated individually into wells of a plastic 96-well plate, containing 200 µl of Pratt’s medium with 0.025% wheat grass extract. Individual wells with growing clonal cells were transferred to a Petri dish with the same medium, and the clonal cultures were further maintained by bi-weekly reinoculation of 1 ml of old culture into fresh medium and kept at 15°C. Cells were imaged on Zeiss AxioVert A1 and Zeiss Axioplan 4 microscopes, the latter equipped with differential interference contrast (DIC) optics. Photographs and videos were captured on a Sony alpha7RIII camera. To increase cDNA yield due to small cell size, eight single cells of SC1169, five cells of SC1200, and five cells of SC1203 were respectively manually isolated into three tubes containing 2µl of SmartSeq2 lysis buffer, after having been washed several times in 0.2 µm filtered Pratt’s medium. Single-cell transcriptomics and assembly Isolated cells were disrupted by 2–5 freeze-thaw cycles in lysis buffer and cDNA was generated using SmartSeq2 with 22–24 PCR-cycles for cDNA amplification [ 47 ]. Libraries were prepared using Illumina DNA Prep kits for Illumina MiSeq, NextSeq 500, or NovaSeqX platforms, with 2x150 bp or 2x250 bp paired end reads by the UBC Sequencing and Bioinformatics Consortium (Supplementary Table S2 ). Raw reads were corrected with rcorrector version 1.0.5 [ 48 ], adapter- and quality-trimmed with trimmomatic version 0.39 [ 49 ] using parameters ILLUMINACLIP: 2:30:10 LEADING:5 SLIDINGWINDOW:5:16 MINLEN:60, trimming adapter sequences: TSO (5’AAGCAGTGGTATCAACGCAGAGTACATGGG 3’), olido-dT (5’AAGCAGTGGTATCAACGCAGAGTACTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 3’), ISPCR (5’AAGCAGTGGTATCAACGCAGAGT 3’), Transposase1 (5’CTGTCTCTTATACACATCTCCGAGCCCACGAGAC 3’), Transposase2_rc (5’CTGTCTCTTATACACATCTGACGCTGCCGACGA 3’). Trimmed reads were assembled with rnaSPAdes versions 3.15.5 or 3.14 with default parameters [ 50 ]. Protein-coding sequences were generated with transdecoder version 5.5.0 [ 51 ]. SSU rDNA phylogenetics We extracted SSU rDNA sequences from the assemblies using barrnap version 0.9 ( https://github.com/tseemann/barrnap ). Extracted sequences were blasted against NCBI GenBank’s nr/nt database to identify cercozoan SSU rDNAs and potential contaminants. Cercozoan SSU rRNAs were aligned with a custom Rhizaria dataset that was constructed using previously available datasets [ 3 , 14 , 23 ], and supplemented with manually retrieved sequences from NCBI GenBank. After adding our new SSU rRNA sequences, the 326-taxon dataset was aligned with MAFFT E-INS-I version 7.48 [ 52 ], and trimmed with trimAl version 1.2rev59 with parameters -gt 0.9 -st 0.001 [ 53 ], yielding a 1061-bp trimmed alignment. A Maximum-likelihood (ML) analysis was carried out with RAxML-NG version 1.1.0 [ 54 ] under the GTR + GAMMA model and 1,000 non-parametric bootstraps. Multigene phylogenetics For our multigene dataset, we added our 119 predicted single-cell proteomes as input into PhyloFisher version 1.2.14 [ 55 ] using the default dataset. We additionally added rhizarian transcriptomes, genomes, and EST-data collated in the EukProt version 3 database ( https://evocellbio.com/eukprot/ ) , euglyphid transcriptomes [ 56 ], ascetosporean and endomyxan genomes [ 39 ], a Polymyxa betae genome (GenBank accession GCA_003693705), three thecofilosan single-cell amplified genomes [ 57 ], and an Orciraptor agilis transcriptome (GenBank accession PRJEB49867). Data were added to the database in several batches, and each time we manually checked each of the 240 single gene trees generated as part of the PhyloFisher pipeline. Contaminant, paralogous, or otherwise aberrant sequences were deleted or omitted from the final dataset. The final dataset consisted of 70 genes from 115 rhizarian taxa (including 7 Retaria acting as an outgroup). This dataset includes taxa that were combined into a chimeric taxon in PhyloFisher using the --chimeras flag with the select_taxa.py script. Supplementary Tables S1, S2, and S3 show what taxa were subjected to this. Individual taxa used in creating these chimeras were omitted from the final tree, instead prioritizing the chimeras. Taxa and genes were chosen to maximize coverage for the single-cell transcriptomes, while retaining breadth across the tree of Rhizaria. Percentage of sites and genes recovered for each taxon are reported in Supplementary Table S3 . A Maximum-likelihood phylogeny of the final 115 taxon, 70 genes dataset (12,261 amino acid sites) was generated using IQ-TREE2 version 2.2.0 [ 58 ] under the LG + C60 + G model with 1,000 ultrafast bootstraps (UFB [ 59 ]), and under a posterior mean site frequency model (PMSF [ 60 ]) with 200 non-parametric bootstraps, using the previous LG + C60 + G tree as a guide tree. We also generated a more taxon-comprehensive, but site-poorer phylogeny, with 128 taxa and 33 genes (4,961 amino acid sites) under the LG + C60 + G model with 1,000 ultrafast bootstraps. Declarations Author Contribution GL conceived the study, isolated and imaged cells, generated transcriptomes, conducted phylogenetic analyses, wrote main manuscript text, prepared figures; ECC isolated and imaged cells, generated transcriptomes, secured funding; VZ isolated and imaged cells, generated transcriptomes; MM prepared figures; NO isolated and imaged cells, generated transcriptomes; VKLJ-R isolated and imaged cells, generated transcriptomes; SB isolated and imaged cells, generated transcriptomes; CH isolated and imaged cells, generated transcriptomes; VGH isolated and imaged cells, generated transcriptomes; DG generated transcriptomes; PJK wrote main manuscript text and secured funding. All authors reviewed the manuscript. Acknowledgement We thank Mark Vermeij of CARMABI for sampling support in Curaçao, the Hakai Institute for sampling support at Quadra Island, including Alana Closs and Tyrel Froese, and Dr. Russel Hopcroft and the crew of the R/V Sikuliaq for sampling support in the Gulf of Alaska. We also thank Dr. Sunita Sinha (UBC Sequencing + Bioinformatics Consortium) for consultation and help with library preparation and sequencing. This work was supported by grants to PJK from the Natural Sciences and Engineering Research Council of Canada (RGPIN-2025-04463) and from the Gordon and Betty Moore Foundation (https://doi.org/10. 37807/GBMF9201). Gulf of Alaska sampling was funded by the National Science Foundation (OCE-1656070). Data Availability Raw reads of all single cells are deposited under NCBI BioProject PRJNA1317988 and PRJNA1174372. SSU rRNA sequences are deposited under NCBI GenBank accessions PX213529-PX213634 and PX227518-PX227524. Image and video files, assembled transcriptomes, predicted proteomes, SSU rRNA alignment and tree, multigene alignment and trees, are deposited under Borealis accession https:/doi.org/10.5683/SP3/PW1ZZP . References Geisen S, Tveit AT, Clark IM, Richter A, Svenning MM, Bonkowski M, et al. Metatranscriptomic census of active protists in soils. ISME J. 2015;9:2178–90. https://doi.org/10.1038/ismej.2015.30 . Degrune F, Dumack K, Fiore-Donno AM, Bonkowski M, Sosa-Hernández MA, Schloter M, et al. Distinct communities of Cercozoa at different soil depths in a temperate agricultural field. FEMS Microbiol Ecol. 2019;95:fiz041. https://doi.org/10.1093/femsec/fiz041 . Howe AT, Bass D, Scoble JM, Lewis R, Vickerman K, Arndt H, et al. Novel Cultured Protists Identify Deep-branching Environmental DNA Clades of Cercozoa: New Genera Tremula, Micrometopion, Minimassisteria, Nudifila, Peregrinia. Protist. 2011;162:332–72. https://doi.org/10.1016/j.protis.2010.10.002 . Chantangsi C, Leander BS. An SSU rDNA barcoding approach to the diversity of marine interstitial cercozoans, including descriptions of four novel genera and nine novel species. Int J Syst Evol Micr. 2010;60:1962–77. https://doi.org/10.1099/ijs.0.013888-0 . Keeling PJ, Deane JA, McFadden GI. The Phylogenetic Position of Alpha- and Beta‐Tubulins from the Chlorarachnion Host and Cercomonas (Cercozoa). J Eukaryot Microbiol. 1998;45:561–70. https://doi.org/10.1111/j.1550-7408.1998.tb05117.x . Cavalier-Smith T, Chao EE. Sarcomonad ribosomal RNA sequences, rhizopod phylogeny, and the origin of euglyphid amoebae. Arch für Protistenkd. 1996;147:227–36. https://doi.org/10.1016/s0003-9365(97)80050-4 . Bhattacharya D, Helmchen T, Melkonian M. Molecular Evolutionary Analyses of Nuclear-Encoded Small Subunit Ribosomal RNA Identify an Independent Rhizopod Lineage Containing the Euglyphina and the Chlorarachniophyta. J Eukaryot Microbiol. 1995;42:65–9. https://doi.org/10.1111/j.1550-7408.1995.tb01541.x . Bass D, Moreira D, López-García P, Polet S, Chao EE, Heyden S von der, et al. Polyubiquitin Insertions and the Phylogeny of Cercozoa and Rhizaria. Protist. 2005;156:149–61. https://doi.org/10.1016/j.protis.2005.03.001 . Irwin NAT, Tikhonenkov DV, Hehenberger E, Mylnikov AP, Burki F, Keeling PJ. Phylogenomics supports the monophyly of the Cercozoa. Mol Phylogenet Evol. 2019;130:416–23. https://doi.org/10.1016/j.ympev.2018.09.004 . Nakamura Y, Tuji A, Kimoto K, Yamaguchi A, Hori RS, Suzuki N. Ecology, Morphology, Phylogeny and Taxonomic Revision of Giant Radiolarians, Orodaria ord. nov. (Radiolaria; Rhizaria; SAR). Protist. 2021;172:125808. https://doi.org/10.1016/j.protis.2021.125808 . Jamy M, Foster R, Barbera P, Czech L, Kozlov A, Stamatakis A, et al. Long-read metabarcoding of the eukaryotic rDNA operon to phylogenetically and taxonomically resolve environmental diversity. Mol Ecol Resour. 2020;20:429–43. https://doi.org/10.1111/1755-0998.13117 . Jamy M, Biwer C, Vaulot D, Obiol A, Jing H, Peura S, et al. Global patterns and rates of habitat transitions across the eukaryotic tree of life. Nat Ecol Evol. 2022;6:1458–70. https://doi.org/10.1038/s41559-022-01838-4 . Schoenle A, Francis O, Archibald JM, Burki F, Vries J de, Dumack K, et al. Protist genomics: key to understanding eukaryotic evolution. Trends Genet. 2025. https://doi.org/10.1016/j.tig.2025.05.004 . Shiratori T, Yabuki A, Ishida K-I. Morphology, Ultrastructure, and Phylogeny of Two Novel Species of Ventrifissura (V. oblonga n. sp. and V. velata n. sp., Thecofilosea, Cercozoa). Protist. 2020;171:125731. https://doi.org/10.1016/j.protis.2020.125731 . Polet S, Berney C, Fahrni José, Pawlowski J. Small-Subunit Ribosomal RNA Gene Sequences of Phaeodarea Challenge the Monophyly of Haeckel’s Radiolaria. Protist. 2004;155:53–63. https://doi.org/10.1078/1434461000164 . Sierra R, Matz MV, Aglyamova G, Pillet L, Decelle J, Not F, et al. Deep relationships of Rhizaria revealed by phylogenomics: A farewell to Haeckel’s Radiolaria. Mol Phylogenetics Evol. 2013;67:53–9. https://doi.org/10.1016/j.ympev.2012.12.011 . Roshan SK, Dumack K, Bonkowski M, Leinweber P, Karsten U, Glaser K. Taxonomic and Functional Diversity of Heterotrophic Protists (Cercozoa and Endomyxa) from Biological Soil Crusts. Microorganisms. 2021;9:205. https://doi.org/10.3390/microorganisms9020205 . Shiratori T, Kato Y, Ishida K. Molecular and morphological characterization of three novel Minorisa species (Chlorarachnea) and proposal for an emended description of the Minorisa minuta. Phycol Res. 2024;72:27–35. https://doi.org/10.1111/pre.12533 . Shiratori T, Ishida K. Rhabdamoeba marina is a heterotrophic relative of chlorarachnid algae. J Eukaryot Microbiol. 2023;:e13010. https://doi.org/10.1111/jeu.13010 . Shiratori T, Ishida K. Trachyrhizium urniformis n. g., n. sp., a Novel Marine Filose Thecate Amoeba Related to a Cercozoan Environmental Clade (Novel Clade 4). J Eukaryot Microbiol. 2016;63:722–31. https://doi.org/10.1111/jeu.12319 . Shiratori T, Yokoyama A, Ishida K-I. Phylogeny, ultrastructure, and flagellar apparatus of a new marimonad flagellate Abollifer globosa sp. nov.(Imbricatea, Cercozoa). Protist. 2014;165:808–24. https://doi.org/10.1016/j.protis.2014.10.003 . Siemensma F, Dumack K. SSU rDNA Phylogeny Indicates the Scale-lacking Trivalvulariida ord. nov. as a Sister Group to the Euglyphida (Cercozoa, Rhizaria). Protist. 2020;171:125701. https://doi.org/10.1016/j.protis.2019.125701 . Bass D, Cavalier-Smith T. Phylum-specific environmental DNA analysis reveals remarkably high global biodiversity of Cercozoa (Protozoa). Int J Syst Evol Microbiol. 2004;54:2393–404. https://doi.org/10.1099/ijs.0.63229-0 . Cooney EC, Holt CC, Jacko-Reynolds VKL, Leander BS, Keeling PJ. Photosystems in the eye-like organelles of heterotrophic warnowiid dinoflagellates. Curr Biol. 2023;33:4252–4260.e3. https://doi.org/10.1016/j.cub.2023.08.052 . Lax G, Kolisko M, Eglit Y, Lee WJ, Yubuki N, Karnkowska A, et al. Multigene phylogenetics of euglenids based on single-cell transcriptomics of diverse phagotrophs. Mol Phylogenet Evol. 2021;159:107088. https://doi.org/10.1016/j.ympev.2021.107088 . Kang S, Tice AK, Spiegel FW, Silberman JD, Pánek T, Cepicka I, et al. Between a Pod and a Hard Test: The Deep Evolution of Amoebae. Mol Biol Evol. 2017;34:2258–70. https://doi.org/10.1093/molbev/msx162 . Kühn S, Lange M, Medlin LK. Phylogenetic Position of Cryothecomonas Inferred from Nuclear-Encoded Small Subunit Ribosomal RNA. Protist. 2000;151:337–45. https://doi.org/10.1078/s1434-4610(04)70032-2 . Dumack K, Gerdzhikov D, Klisarova D. Phylogenetic analysis confirms the taxonomic placement of the marine flagellate Hermesinum adriaticum (Thecofilosea, Cercozoa, Rhizaria). J Eukaryot Microbiol. 2022;:e12905. https://doi.org/10.1111/jeu.12905 . Hargraves PE. The ebridian flagellates Ebria and Hermesinum. Plankton Biol Ecol. 2002;1:9–16. Hoppenrath M, Leander BS. Dinoflagellate, Euglenid, or Cercomonad? The Ultrastructure and Molecular Phylogenetic Position of Protaspis grandis n. sp. J Euk Micro. 2006;53:327–42. https://doi.org/10.1111/j.1550-7408.2006.00110.x . Shirkina NI. Morphology and life cycle of Thaumatomonas lauterborni de Saedeleer (Mastigophora Diesing). Fauna i Biologiya Presnovodnyh Organizmov Leningrad; Nauka. 1987;:87–107. Cavalier-Smith T, Chao EE, Lewis R. Multigene phylogeny and cell evolution of chromist infrakingdom Rhizaria: contrasting cell organisation of sister phyla Cercozoa and Retaria. Protoplasma. 2018;255:1517–74. https://doi.org/10.1007/s00709-018-1241-1 . Cavalier-Smith T, Chao EE-Y. Phylogeny and Classification of Phylum Cercozoa (Protozoa). Protist. 2003;154:341–58. https://doi.org/10.1078/143446103322454112 . Nikolaev SI, Berney C, Fahrni JF, Bolivar I, Polet S, Mylnikov AP, et al. The twilight of Heliozoa and rise of Rhizaria, an emerging supergroup of amoeboid eukaryotes. Proc Natl Acad Sci. 2004;101:8066–71. https://doi.org/10.1073/pnas.0308602101 . Nakamura Y, Imai I, Yamaguchi A, Tuji A, Not F, Suzuki N. Molecular Phylogeny of the Widely Distributed Marine Protists, Phaeodaria (Rhizaria, Cercozoa). Protist. 2015;166:363–73. https://doi.org/10.1016/j.protis.2015.05.004 . Scoble JM, Cavalier-Smith T. Scale evolution, sequence phylogeny, and taxonomy of thaumatomonad Cercozoa: 11 new species and new genera Scutellomonas, Cowlomonas, Thaumatospina and Ovaloplaca. Eur J Protistol. 2014;50:270–313. https://doi.org/10.1016/j.ejop.2013.12.005 . Bass D, Tikhonenkov DV, Foster R, Dyal P, Janouškovec J, Keeling PJ, et al. Rhizarian ‘Novel Clade 10’ Revealed as Abundant and Diverse Planktonic and Terrestrial Flagellates, including Aquavolon n. gen. J Eukaryot Microbiol. 2018;65:828–42. https://doi.org/10.1111/jeu.12524 . Bass D, Chao EE-Y, Nikolaev S, Yabuki A, Ishida K, Berney C, et al. Phylogeny of Novel Naked Filose and Reticulose Cercozoa: Granofilosea cl. n. and Proteomyxidea Revised. Protist. 2009;160:75–109. https://doi.org/10.1016/j.protis.2008.07.002 . Thorén MH, Onuț-Brännström I, Alfjorden A, Pecková H, Swords F, Hooper C, et al. Comparative genomics of Ascetosporea gives new insight into the evolutionary basis for animal parasitism in Rhizaria. BMC Biol. 2024;22:103. https://doi.org/10.1186/s12915-024-01898-x . Cavalier-Smith T, Karpov SA. Paracercomonas Kinetid Ultrastructure, Origins of the Body Plan of Cercomonadida, and Cytoskeleton Evolution in Cercozoa. Protist. 2012;163:47–75. https://doi.org/10.1016/j.protis.2011.06.004 . Keeling PJ, Campo J del. Marine Protists Are Not Just Big Bacteria. Curr Biol. 2017;27:R541–9. https://doi.org/10.1016/j.cub.2017.03.075 . Archibald JM, Teh EM, Keeling PJ. Novel Ubiquitin Fusion Proteins: Ribosomal Protein P1 and Actin. J Mol Biol. 2003;328:771–8. https://doi.org/10.1016/s0022-2836(03)00374-7 . Archibald JM, Longet D, Pawlowski J, Keeling PJ. A Novel Polyubiquitin Structure in Cercozoa and Foraminifera: Evidence for a New Eukaryotic Supergroup. Mol Biol Evol. 2003;20:62–6. https://doi.org/10.1093/molbev/msg006 . Archibald JM, Keeling PJ. Actin and Ubiquitin Protein Sequences Support a Cercozoan/Foraminiferan Ancestry for the Plasmodiophorid Plant Pathogens. J Eukaryot Microbiol. 2004;51:113–8. https://doi.org/10.1111/j.1550-7408.2004.tb00172.x . Chantangsi C, Hoppenrath M, Leander BS. Evolutionary relationships among marine cercozoans as inferred from combined SSU and LSU rDNA sequences and polyubiquitin insertions. Mol Phylogenetics Evol. 2010;57:518–27. https://doi.org/10.1016/j.ympev.2010.07.007 . Larsen J, Patterson DJ. Some flagellates (Protista) from tropical marine sediments. J Nat Hist. 1990;24:801–937. https://doi.org/10.1080/00222939000770571 . Picelli S, Faridani OR, Björklund ÅK, Winberg G, Sagasser S, Sandberg R. Full-length RNA-seq from single cells using Smart-seq2. Nat Protoc. 2014;9:171–81. https://doi.org/10.1038/nprot.2014.006 . Song L, Florea L. Rcorrector: efficient and accurate error correction for Illumina RNA-seq reads. GigaScience. 2015;4:1–8. https://doi.org/10.1186/s13742-015-0089-y . Bolger AM, Lohse M, Usadel B. Trimmomatic: a flexible trimmer for Illumina sequence data. Bioinformatics. 2014;30:2114–20. https://doi.org/10.1093/bioinformatics/btu170/ -/dc1 . Bushmanova E, Antipov D, Lapidus A, Prjibelski AD. rnaSPAdes: a de novo transcriptome assembler and its application to RNA-Seq data. GigaScience. 2019;8:giz100. https://doi.org/10.1093/gigascience/giz100 . Haas BJ, Papanicolaou A, Yassour M, Grabherr M, Blood PD, Bowden J, et al. De novo transcript sequence reconstruction from RNA-seq using the Trinity platform for reference generation and analysis. Nat Protoc. 2013;8:1494–512. https://doi.org/10.1038/nprot.2013.084 . Katoh K, Standley DM. MAFFT multiple sequence alignment software version 7: improvements in performance and usability. Mol Biol Evol. 2013;30:772–80. https://doi.org/10.1093/molbev/mst010 . Capella-Gutiérrez S, Silla-Martínez JM, Gabaldón T. trimAl: a tool for automated alignment trimming in large-scale phylogenetic analyses. Bioinformatics. 2009;25:1972–3. https://doi.org/10.1093/bioinformatics/btp348 . Kozlov AM, Darriba D, Flouri T, Morel B, Stamatakis A. RAxML-NG: A fast, scalable, and user-friendly tool for maximum likelihood phylogenetic inference. Bioinformatics. 2019;35:4453–5. https://doi.org/10.1093/bioinformatics/btz305 . Tice AK, Žihala D, Pánek T, Jones RE, Salomaki ED, Nenarokov S, et al. PhyloFisher: A phylogenomic package for resolving eukaryotic relationships. PLoS Biol. 2021;19:e3001365. https://doi.org/10.1371/journal.pbio.3001365 . Weiner AKM, Cerón-Romero MA, Yan Y, Katz LA. Phylogenomics of the Epigenetic Toolkit Reveals Punctate Retention of Genes across Eukaryotes. Genome Biol Evol. 2020;12:2196–210. https://doi.org/10.1093/gbe/evaa198 . Wideman JG, Monier A, Rodríguez-Martínez R, Leonard G, Cook E, Poirier C, et al. Unexpected mitochondrial genome diversity revealed by targeted single-cell genomics of heterotrophic flagellated protists. Nat Microbiol. 2020;5:154–65. https://doi.org/10.1038/s41564-019-0605-4 . Minh BQ, Schmidt HA, Chernomor O, Schrempf D, Woodhams MD, Haeseler A von, et al. IQ-TREE 2: New Models and Efficient Methods for Phylogenetic Inference in the Genomic Era. Mol Biol Evol. 2020;37:1530–4. https://doi.org/10.1093/molbev/msaa015 . Hoang DT, Chernomor O, Haeseler A von, Minh BQ, Vinh LS. UFBoot2: Improving the Ultrafast Bootstrap Approximation. Mol Biol Evol. 2018;35:518–22. https://doi.org/10.1093/molbev/msx281 . Wang H-C, Minh BQ, Susko E, Roger AJ. Modeling Site Heterogeneity with Posterior Mean Site Frequency Profiles Accelerates Accurate Phylogenomic Estimation. Syst Biol. 2018;67:216–35. https://doi.org/10.1093/sysbio/syx068 . Additional Declarations No competing interests reported. Supplementary Files FigS1SupplementalFigS1Platev1.pdf Supplemental Figure S1.Additional light micrographs of representatives of novel cercozoan cells from which transcriptome data were obtained. Scalebars are 10 µm, except 100 µm for P1-P5, Q1-Q2, R1. FigS2SupplementalFigS2Platev21.pdf Supplemental Figure S2. Additional light micrographs of representatives of novel cercozoan cells from which transcriptome data were obtained. Scalebars are 10 µm, except 5 µm for I. FigS3SSUsupplementalv4.pdf Supplemental Figure S3. Small Subunit rRNA (SSU rRNA) tree of Cercozoa, showing relationships of isolated cells to known diversity. Generated with Maximum-Likelihood under the GTR+Gamma model with 1,000 non-parametric bootstraps. Sequences reported in this study in bold and red, with major clades marked. Full bootstrap support (100%) is denoted by a circle, with supports below 50% omitted. FigS4phylo128T33Gsupplementalv1.pdf Supplemental Figure S4. Taxon-rich but gene-poor dataset. 128 taxon, 33 genes phylogeny of Rhizaria (4,961 amino acid sites), generated under the LG+C60+G model with 1,000 ultrafast bootstraps. TableS1v11.xlsx Supplemental Table S1. Sampling information for all cells. TableS2v1.xlsx Supplemental Table S2. Sequencing information for all cells. TableS3v1.xlsx Supplemental Table S3. Metrics for multigene analysis (taxa included, sources, coverages) Cite Share Download PDF Status: Under Review Version 1 posted Editorial decision: Revision requested 29 Oct, 2025 Reviews received at journal 21 Oct, 2025 Reviews received at journal 03 Oct, 2025 Reviewers agreed at journal 15 Sep, 2025 Reviewers agreed at journal 15 Sep, 2025 Reviewers invited by journal 13 Sep, 2025 Editor assigned by journal 11 Sep, 2025 Submission checks completed at journal 11 Sep, 2025 First submitted to journal 10 Sep, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7584520","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":515617053,"identity":"6c4e60de-f4a2-4aa8-b3fe-098e2aba23bc","order_by":0,"name":"Gordon Lax","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA2klEQVRIiWNgGAWjYJACCSCWYWBgPgBiyxCthYeBgS0BxOYhRQuPAQOEQQDIu/c+vPFxBwMP/4ycz69u1FjwMLAfProBnxbDM8eNLWeeYeCROHN2m3XOMaDDeNLSbuDVMiONTZq3Deie473bjHPYgFokeMyI0yJ/mOeZcc4/IrTIS0C1GBzvYX6c20aEFgOeY8yWM4EqDc8cM2PO7ZPgYSPkF/n2NsYbH9ts5ORuJD/+nPOtTo6f/fAx/LYcAFOgqGFgg5D4lINtaUCwmT8QUj0KRsEoGAUjEwAAUBs++pMrpZgAAAAASUVORK5CYII=","orcid":"","institution":"University of British Columbia","correspondingAuthor":true,"prefix":"","firstName":"Gordon","middleName":"","lastName":"Lax","suffix":""},{"id":515617054,"identity":"6b3bba02-26f4-4be4-823b-e82614dafa62","order_by":1,"name":"Elizabeth C. Cooney","email":"","orcid":"","institution":"University of British Columbia","correspondingAuthor":false,"prefix":"","firstName":"Elizabeth","middleName":"C.","lastName":"Cooney","suffix":""},{"id":515617055,"identity":"d119e37e-029f-497f-8ef5-b0d5412a2641","order_by":2,"name":"Vasily Zlatogursky","email":"","orcid":"","institution":"Uppsala University","correspondingAuthor":false,"prefix":"","firstName":"Vasily","middleName":"","lastName":"Zlatogursky","suffix":""},{"id":515617056,"identity":"223e5ebe-edc1-4f5e-b97c-bd2d3ffe52dc","order_by":3,"name":"Mahara Mtawali","email":"","orcid":"","institution":"University of British Columbia","correspondingAuthor":false,"prefix":"","firstName":"Mahara","middleName":"","lastName":"Mtawali","suffix":""},{"id":515617057,"identity":"99c9fa11-c08e-4250-bba9-0000c77924de","order_by":4,"name":"Noriko Okamoto","email":"","orcid":"","institution":"University of British Columbia","correspondingAuthor":false,"prefix":"","firstName":"Noriko","middleName":"","lastName":"Okamoto","suffix":""},{"id":515617058,"identity":"e725f6f1-d03a-48fd-86ea-25b556fe565a","order_by":5,"name":"Victoria K.L. Jacko-Reynolds","email":"","orcid":"","institution":"University of British Columbia","correspondingAuthor":false,"prefix":"","firstName":"Victoria","middleName":"K.L.","lastName":"Jacko-Reynolds","suffix":""},{"id":515617059,"identity":"4a5406c7-0b7c-455d-8c2a-3ae902f7c1f6","order_by":6,"name":"Saelin Bjornson","email":"","orcid":"","institution":"University of Melbourne","correspondingAuthor":false,"prefix":"","firstName":"Saelin","middleName":"","lastName":"Bjornson","suffix":""},{"id":515617060,"identity":"5612040a-e459-496f-993d-eda26d1372a0","order_by":7,"name":"Corey Holt","email":"","orcid":"","institution":"University of Bath","correspondingAuthor":false,"prefix":"","firstName":"Corey","middleName":"","lastName":"Holt","suffix":""},{"id":515617061,"identity":"3c64d1f3-c589-4038-a068-de7a47cb39c3","order_by":8,"name":"Vedprakash G. Hurdeal","email":"","orcid":"","institution":"University of British Columbia","correspondingAuthor":false,"prefix":"","firstName":"Vedprakash","middleName":"G.","lastName":"Hurdeal","suffix":""},{"id":515617062,"identity":"139862eb-07fd-451f-a736-7e15676f8a8f","order_by":9,"name":"Daniele Giannotti","email":"","orcid":"","institution":"University of British Columbia","correspondingAuthor":false,"prefix":"","firstName":"Daniele","middleName":"","lastName":"Giannotti","suffix":""},{"id":515617063,"identity":"6b0258e8-aa7c-4649-a99b-af89b0fc1661","order_by":10,"name":"Patrick J. Keeling","email":"","orcid":"","institution":"University of British Columbia","correspondingAuthor":false,"prefix":"","firstName":"Patrick","middleName":"J.","lastName":"Keeling","suffix":""}],"badges":[],"createdAt":"2025-09-10 15:38:29","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7584520/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7584520/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":91956948,"identity":"f048f049-3de5-4cac-b43f-84001fb1176a","added_by":"auto","created_at":"2025-09-23 07:21:58","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":5543891,"visible":true,"origin":"","legend":"","description":"","filename":"Cercozoadraftv2untrackedlinesfigures.docx","url":"https://assets-eu.researchsquare.com/files/rs-7584520/v1/c97c5a08cc10185be6a7429b.docx"},{"id":91954091,"identity":"22921079-54f5-4f22-b933-478ba0d9d12c","added_by":"auto","created_at":"2025-09-23 07:05:57","extension":"json","order_by":1,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":12729,"visible":true,"origin":"","legend":"","description":"","filename":"3ef384444b994609b0a82ad5ecf4705e.json","url":"https://assets-eu.researchsquare.com/files/rs-7584520/v1/1feb91e982d70ee80c53c27c.json"},{"id":91954097,"identity":"46a30125-9528-4ddf-84e0-030953713de5","added_by":"auto","created_at":"2025-09-23 07:05:57","extension":"pdf","order_by":2,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":3358707,"visible":true,"origin":"","legend":"","description":"","filename":"FigS1SupplementalFigS1Platev1.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7584520/v1/e57e7c08301db7fbeabd35a4.pdf"},{"id":91954112,"identity":"5965a68e-ac78-4cab-bd02-7cc7941b1fd7","added_by":"auto","created_at":"2025-09-23 07:05:58","extension":"pdf","order_by":3,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":2392254,"visible":true,"origin":"","legend":"","description":"","filename":"FigS2SupplementalFigS2Platev21.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7584520/v1/7ef3b6c36c37e9b57c2f0914.pdf"},{"id":91956410,"identity":"2d56095b-35ab-4055-9875-6881f7aed838","added_by":"auto","created_at":"2025-09-23 07:13:58","extension":"pdf","order_by":4,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":461112,"visible":true,"origin":"","legend":"","description":"","filename":"FigS3SSUsupplementalv4.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7584520/v1/ec49d546dd83408c7d83a8f7.pdf"},{"id":91954106,"identity":"13ab5bc9-e150-4061-8f98-30ac0709d406","added_by":"auto","created_at":"2025-09-23 07:05:57","extension":"pdf","order_by":5,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":463413,"visible":true,"origin":"","legend":"","description":"","filename":"FigS4phylo128T33Gsupplementalv1.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7584520/v1/64f743e7f97491ea76b769af.pdf"},{"id":91956946,"identity":"1f42a1c8-24b1-4feb-b258-8372379f2281","added_by":"auto","created_at":"2025-09-23 07:21:57","extension":"xlsx","order_by":6,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":28784,"visible":true,"origin":"","legend":"","description":"","filename":"TableS1v11.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-7584520/v1/ddbff1cd84d7f53929538747.xlsx"},{"id":91954096,"identity":"ac8b6cdb-2836-434d-be87-e95bee17e9a1","added_by":"auto","created_at":"2025-09-23 07:05:57","extension":"xlsx","order_by":7,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":15286,"visible":true,"origin":"","legend":"","description":"","filename":"TableS2v1.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-7584520/v1/63dc0e5929491e37ddc1d726.xlsx"},{"id":91954102,"identity":"d0fb5281-418f-4dad-b865-1237b8432c1e","added_by":"auto","created_at":"2025-09-23 07:05:57","extension":"xlsx","order_by":8,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":22565,"visible":true,"origin":"","legend":"","description":"","filename":"TableS3v1.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-7584520/v1/6e4eab57227cda5f339a1eab.xlsx"},{"id":91958575,"identity":"647c7625-616d-4e69-81fb-d27893b100a0","added_by":"auto","created_at":"2025-09-23 07:37:58","extension":"xml","order_by":9,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":150001,"visible":true,"origin":"","legend":"","description":"","filename":"3ef384444b994609b0a82ad5ecf4705e1enriched.xml","url":"https://assets-eu.researchsquare.com/files/rs-7584520/v1/36fa4b0bf739ad996fee0d74.xml"},{"id":91954116,"identity":"22a6ec18-8dc4-4142-a924-5e2f7a2591aa","added_by":"auto","created_at":"2025-09-23 07:05:58","extension":"emf","order_by":10,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":6112956,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage1.emf","url":"https://assets-eu.researchsquare.com/files/rs-7584520/v1/afc4da52cf5b577c3f0faf55.emf"},{"id":91954111,"identity":"2143e8ac-8f2b-42f6-9dd9-d596ce07bb7f","added_by":"auto","created_at":"2025-09-23 07:05:58","extension":"emf","order_by":11,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":2095728,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage2.emf","url":"https://assets-eu.researchsquare.com/files/rs-7584520/v1/4290eb7dee5651d17b0e40fa.emf"},{"id":91954108,"identity":"96d1ed8d-106e-4855-a247-f68122101a18","added_by":"auto","created_at":"2025-09-23 07:05:58","extension":"emf","order_by":12,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":719760,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage3.emf","url":"https://assets-eu.researchsquare.com/files/rs-7584520/v1/1335a2173a69b4a13e320590.emf"},{"id":91956947,"identity":"94c7493a-dd8c-4df6-8229-9a3b3c76fc7e","added_by":"auto","created_at":"2025-09-23 07:21:57","extension":"png","order_by":13,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":49044,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-7584520/v1/e4e79b8d2235291c83575b18.png"},{"id":91954110,"identity":"bed689d3-7020-46c4-90c5-b5ef4af72eb0","added_by":"auto","created_at":"2025-09-23 07:05:58","extension":"png","order_by":14,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":27577,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-7584520/v1/04c7129875156e99df2db03c.png"},{"id":91956414,"identity":"6b424144-9685-4413-bf8c-74838fb5d615","added_by":"auto","created_at":"2025-09-23 07:13:58","extension":"png","order_by":15,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":7012,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-7584520/v1/f73807bfac277fe0f3ba3154.png"},{"id":91954119,"identity":"4cd97d01-e089-4597-8b3e-9836756ac508","added_by":"auto","created_at":"2025-09-23 07:05:58","extension":"xml","order_by":16,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":148787,"visible":true,"origin":"","legend":"","description":"","filename":"3ef384444b994609b0a82ad5ecf4705e1structuring.xml","url":"https://assets-eu.researchsquare.com/files/rs-7584520/v1/cdfdf18a30d7d3304d296f27.xml"},{"id":91957980,"identity":"12172767-6a24-464e-b6be-d89d3b2fe58c","added_by":"auto","created_at":"2025-09-23 07:29:58","extension":"html","order_by":17,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":162503,"visible":true,"origin":"","legend":"","description":"","filename":"earlyproof.html","url":"https://assets-eu.researchsquare.com/files/rs-7584520/v1/99b600668bf4c6a246b640a9.html"},{"id":91956403,"identity":"600ba5c3-639f-4949-9681-f846f6851aac","added_by":"auto","created_at":"2025-09-23 07:13:57","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":565984,"visible":true,"origin":"","legend":"\u003cp\u003eLight micrographs of representatives of novel cercozoan cells from which transcriptome data were obtained. This is a small fraction of the 119 cells analyzed, chosen to show the overall morphological diversity of the cells we observed. Images of other cells are available in Supplemental Figures S1 and S2. Scalebars for A-S are 10 µm, 20 µm for T.\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-7584520/v1/8f81b8acfbc90f1e72cd7287.png"},{"id":91954094,"identity":"f8333b78-b0ae-4093-b3a0-c493f2821947","added_by":"auto","created_at":"2025-09-23 07:05:57","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":221646,"visible":true,"origin":"","legend":"\u003cp\u003eMultigene tree of Cercozoa based on 70 genes (12,261 amino acid characters) and 115 taxa, generated with Maximum Likelihood under the LG+C60+G model with 1,000 Ultrafast Bootstraps (UFB) and 200 non-parametric bootstraps (PMSF). Full bootstrap support in both analyses (100%) is denoted by a circle on the corresponding branch, while support values under 80% are not shown. Taxa characterized in this study are marked in red (or white) and bold, novel clades have a red box around them, and previously reported environmental clades have a green box around them. Co-assemblies of single cell transcriptomes are denoted with a circle-square-triangle symbol.\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-7584520/v1/3fe2d945994998939ce3a15f.png"},{"id":91954092,"identity":"953825ab-ec37-4e44-ab91-cec73bbdebeb","added_by":"auto","created_at":"2025-09-23 07:05:57","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":63538,"visible":true,"origin":"","legend":"\u003cp\u003eSchematic representation of the major groups of Cercozoa, with morphology sketches for each. Amino-acid insertions between polyubiquitin monomers are marked with coloured boxes next to each group.\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-7584520/v1/1551a6b9eb8165266619f2c8.png"},{"id":91963827,"identity":"dbc81e03-30c0-407b-9a90-59fa9ebb2e59","added_by":"auto","created_at":"2025-09-23 08:10:52","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1771508,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7584520/v1/9e8acd2a-faf4-4806-bb6a-a7f2fa8ba96e.pdf"},{"id":91956406,"identity":"632f30c0-ce0d-41be-bda7-1c77a38e1805","added_by":"auto","created_at":"2025-09-23 07:13:57","extension":"pdf","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":3358707,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSupplemental Figure S1.\u003c/strong\u003eAdditional light micrographs of representatives of novel cercozoan cells from which transcriptome data were obtained. Scalebars are 10 µm, except 100 µm for P1-P5, Q1-Q2, R1.\u003c/p\u003e","description":"","filename":"FigS1SupplementalFigS1Platev1.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7584520/v1/ff934d4aee346790a1a3b3bf.pdf"},{"id":91956409,"identity":"31b8a394-be75-4bae-8bd3-f70a2089ee1b","added_by":"auto","created_at":"2025-09-23 07:13:58","extension":"pdf","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":2392254,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSupplemental Figure S2. \u003c/strong\u003eAdditional light micrographs of representatives of novel cercozoan cells from which transcriptome data were obtained. Scalebars are 10 µm, except 5 µm for I.\u003c/p\u003e","description":"","filename":"FigS2SupplementalFigS2Platev21.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7584520/v1/a83b94ce731b137c1c57299a.pdf"},{"id":91954100,"identity":"6bd2acac-e8e4-4329-aab9-a6981810ecd2","added_by":"auto","created_at":"2025-09-23 07:05:57","extension":"pdf","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":461112,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSupplemental Figure S3. \u003c/strong\u003eSmall Subunit rRNA (SSU rRNA) tree of Cercozoa, showing relationships of isolated cells to known diversity. Generated with Maximum-Likelihood under the GTR+Gamma model with 1,000 non-parametric bootstraps. Sequences reported in this study in bold and red, with major clades marked. Full bootstrap support (100%) is denoted by a circle, with supports below 50% omitted.\u003c/p\u003e","description":"","filename":"FigS3SSUsupplementalv4.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7584520/v1/1dbc7bb131f3344dca486a4e.pdf"},{"id":91956407,"identity":"47d93eda-3989-47ad-8c27-48cd12031b48","added_by":"auto","created_at":"2025-09-23 07:13:57","extension":"pdf","order_by":4,"title":"","display":"","copyAsset":false,"role":"supplement","size":463413,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSupplemental Figure S4. \u003c/strong\u003eTaxon-rich but gene-poor dataset.\u003cstrong\u003e \u003c/strong\u003e128 taxon, 33 genes phylogeny of Rhizaria (4,961 amino acid sites), generated under the LG+C60+G model with 1,000 ultrafast bootstraps.\u003c/p\u003e","description":"","filename":"FigS4phylo128T33Gsupplementalv1.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7584520/v1/3797c11cc987c6228b1691f7.pdf"},{"id":91954095,"identity":"6a21fb61-c253-4087-8058-5c0dfb773e49","added_by":"auto","created_at":"2025-09-23 07:05:57","extension":"xlsx","order_by":5,"title":"","display":"","copyAsset":false,"role":"supplement","size":28784,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSupplemental Table S1.\u003c/strong\u003e Sampling information for all cells.\u003c/p\u003e","description":"","filename":"TableS1v11.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-7584520/v1/eee3d5a9a370c8ee3cd6b473.xlsx"},{"id":91956404,"identity":"90b697d4-1056-4ef5-8b6e-7f4ce1511ef7","added_by":"auto","created_at":"2025-09-23 07:13:57","extension":"xlsx","order_by":6,"title":"","display":"","copyAsset":false,"role":"supplement","size":15286,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSupplemental Table S2.\u003c/strong\u003e Sequencing information for all cells.\u003c/p\u003e","description":"","filename":"TableS2v1.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-7584520/v1/59ee2a8a7e5be006116c294e.xlsx"},{"id":91954105,"identity":"d8d08633-8e42-4dfa-8f74-3bbb6ff44637","added_by":"auto","created_at":"2025-09-23 07:05:57","extension":"xlsx","order_by":7,"title":"","display":"","copyAsset":false,"role":"supplement","size":22565,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSupplemental Table S3.\u003c/strong\u003e Metrics for multigene analysis (taxa included, sources, coverages)\u003c/p\u003e","description":"","filename":"TableS3v1.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-7584520/v1/3ca53c81204e39806fd0747f.xlsx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Phylogenomic tree of Cercozoa based on single-cell transcriptomes from 100 uncultured cells","fulltext":[{"header":"Background","content":"\u003cp\u003eCercozoa is a major lineage of microbial eukaryotes that are abundant across a wide range of ecosystems, have significant and diverse ecological impacts, and are highly diverse at both molecular and morphological levels [\u003cspan additionalcitationids=\"CR2 CR3\" citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. Unlike other major lineages of eukaryotes, the phylum Cercozoa was only circumscribed through molecular phylogeny: the group lacks any shared morphology or a common body plan, so their monophyly was never recognized before molecular gene trees showed them to be related [\u003cspan additionalcitationids=\"CR6\" citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. Cercozoan morphological diversity is extreme, with a wide range of unique characters and body plans ranging from small flagellates and amoeboflagellates, to naked and testate amoebae, to heliozoan-like amoebae and massive planktonic predators with mineralized endoskeletons [\u003cspan additionalcitationids=\"CR9\" citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. Their ecological diversity is equally vast, with predators, grazers, phototrophs, and parasites common and abundant in freshwater, terrestrial, coastal and deep-sea environments [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eHow this diversity arose and how their many unique characteristics evolved are interesting questions, but we have few insights because Cercozoa are also one of the most poorly studied of all eukaryotic groups. As a consequence, there are sparse genomic resources (a single genome and a few transcriptomes outside the Chlorarachniophytes [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]), relatively few formally described species given the size of the group, and no well-sampled and strongly-supported phylogeny, since for most lineages only a single gene, the small subunit (SSU) rRNA, is available.\u003cdiv class=\"BlockQuote\"\u003e\u003cp\u003eUnderstanding the diversity and evolution of Cercozoa requires a well-supported phylogenetic tree, and while the breadth of taxa in the current SSU phylogenies has grown rapidly, many major subgroups in the tree are not well-supported (e.g. [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]). In addition, some groups encode highly divergent SSU rRNA genes, including some of the small flagellates like \u003cem\u003eHelkesimastix\u003c/em\u003e, or the giant deep-sea phaeodarians, which drastically differ from other Cercozoans in morphology and are superficially more similar to another group, Radiolaria, to the extent that they were once classified as such, and have since been reassigned [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e, \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. In addition, although Cercozoa are abundant in a wide range of global ecosystems, most of the current data come from terrestrial taxa [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e], whereas marine environments are under-sampled [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eNew cultures of cercozoans are established at a relatively steady but low rate [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan additionalcitationids=\"CR19 CR20 CR21\" citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e], but even in these cases often the SSU rRNA gene represents the only available molecular data, so the current genomic data are sparse and biased. Evidence of this can also be seen in the many cercozoan SSU rRNA clades that remain solely made up of environmental sequences [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. Many of these were discovered over 20 years ago, but still remain essentially uncharacterized.\u003c/p\u003e\u003cp\u003eHere, we have used a single-cell transcriptome approach[\u003cspan additionalcitationids=\"CR25\" citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e] to circumvent the lack of cultured representatives and establish a strong molecular foundation for interpreting the diversity of Cercozoa. Specifically, we generated 119 single-cell transcriptomes from diverse cells broadly representing most of the clades across the cercozoan tree, emphasizing under-represented groups and habitats, like marine ecosystems. We provide the first substantial sampling from two large and complex groups that are morphologically unlike other cercozoans and more reminiscent of other major groups: the phaeodarians (which resemble radiolarians) and the desmothoracids (which resemble heliozoans). Using these 119 single-cell transcriptomes, we have generated a taxon-rich multigene analysis based on 70 genes of 115 taxa. The tree highlights cercozoan diversity and is the first multigene tree to sample most known sub-groups. Comparing this phylogenetic tree to existing trees based on SSU rRNA, we confirm some of the well-known clades, like Thecofilosea, whereas other proposed taxa, like Imbricatea, are shown to be polyphyletic. Several cells fall into clades that were previously known only from environmental sequences, and nine cells represent four novel clades that have never been sampled, even in environmental rRNA studies. Overall, this work begins to provide a well-supported backbone on which to begin to infer the evolution of a major but often overlooked group of eukaryotes.\u003c/p\u003e\u003c/div\u003e\u003c/p\u003e"},{"header":"Results \u0026 Discussion","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\u003ch2\u003eIsolating Diverse Cercozoan Cells from Nature\u003c/h2\u003e\u003cp\u003e\u003c/p\u003e\u003cdiv class=\"BlockQuote\"\u003e\u003cp\u003eWe collected 119 cells preliminarily identified as likely being cercozoans (in itself a challenging task due to their morphological variation) from 40 different locations over a span of five years (\u003cb\u003esee Supplementary Table \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e for details\u003c/b\u003e). From each of these cells, cDNA and library construction was carried out, leading to 99 cells that yielded relatively high-quality transcriptome data based on recovery of phylogenomic marker genes. Some morphotypes determined to be the same species were co-assembled at the marker-gene level in PhyloFisher, yielding novel multigene data for 70 discrete taxa in our final dataset. These cells represent an incredible diversity of morphology (\u003cb\u003esee\u003c/b\u003e Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e \u003cb\u003efor representatives, and Supplemental Figs.\u0026nbsp;1 \u0026amp; 2 for additional micrographs\u003c/b\u003e). Most available cercozoan genomes and transcriptomes come from the photosynthetic chlorarachniophytes and the euglyphids, and all of them are from cultured species. The new transcriptomic data increase sampling across the whole of Cercozoa by 470%, or more conservatively by almost 330% when you only consider the level of distinct species.\u003c/p\u003e\u003cp\u003eFrom the transcriptomes, the SSU rRNA was first extracted to get a rough idea of each cell’s identity and to seek evidence for cases where the species might already have been described formally (some transcriptomes did not have any SSU rRNA sequences recovered). The SSU rRNA tree (\u003cb\u003eSupplemental Figure \u003cspan refid=\"MOESM3\" class=\"InternalRef\"\u003eS3\u003c/span\u003e\u003c/b\u003e) showed that the sampling does indeed cover most cercozoan subgroups, with a particularly strong representation from thecofilosans, a very large, diverse, and under-sampled subgroup. 30 cells were sufficiently closely related to known species and 32 to known genera to be given those names, while 45 lacked close, described relatives.\u003c/p\u003e\u003c/div\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\n\u003ch3\u003eOverall Structure of the Phylogenomic Tree\u003c/h3\u003e\n\u003cp\u003e\u003c/p\u003e\u003cdiv class=\"BlockQuote\"\u003e\u003cp\u003eThecofilosea is one of the most diverse and widespread sub-groups of Cercozoa, but also historically under-sampled other than a few relatively well-known taxa (e.g. \u003cem\u003eCryothecomonas\u003c/em\u003e), and our data confirms the deep divergence and monophyly of this group (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). We also confirm that Phaeodaria, Cryomonada, and Ventricleftida are all major subgroups of Thecofilosea. In addition, many other flagellated and amoeboid gliding and surface-associated taxa like \u003cem\u003eEbria\u003c/em\u003e, \u003cem\u003eKatarium\u003c/em\u003e, \u003cem\u003eRhogostoma\u003c/em\u003e, all fall within the Thecofilosea with strong support, but they do not fall within any of the previously recognized subgroups, suggesting that this group will require additional taxonomic revisions in the future to account for its full diversity. With the exception of the Phaeodaria and \u003cem\u003eEbria\u003c/em\u003e, all other thecofilosan cells appear to be surface-associated, which may be a taxonomically important characteristic to examine further. An exception to this is \u003cem\u003eCryothecomonas\u003c/em\u003e, which is known to be parasitic on diatoms [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e], and we also found evidence for this being more widespread within the group. For example all three cells used for co-assembly Cryotheco1-co were isolated from inside different diatom frustules. The taxonomic delineation between \u003cem\u003eProtaspa\u003c/em\u003e and \u003cem\u003eCryothecomonas\u003c/em\u003e is currently unclear [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e], and likely requires additional sampling for molecular sequencing and ultrastructural studies since they are morphologically very similar.\u003c/p\u003e\u003cp\u003eInterestingly, the genus \u003cem\u003eEbria\u003c/em\u003e falls in the same place as it does in the SSU rRNA tree, sister to a clade composed of Cryomonadida plus \u003cem\u003eRhogostoma\u003c/em\u003e and \u003cem\u003eMataza\u003c/em\u003e, all within Thecofilosea [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. The closest relative to \u003cem\u003eEbria\u003c/em\u003e in SSU rRNA phylogenies is \u003cem\u003eBotuliforma\u003c/em\u003e—a thecate benthic amoeboflagellate isolated from anoxic marine sediment that has been sequenced and reported only once [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. This is in stark contrast to \u003cem\u003eEbria\u003c/em\u003e, which is a marine planktonic flagellate with an internal siliceous skeleton [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. Very little is known about the life cycle and evolution of \u003cem\u003eEbria\u003c/em\u003e, and acquiring genomic or transcriptomic data from \u003cem\u003eBotuliforma\u003c/em\u003e would be a crucial step in understanding the evolutionary history of \u003cem\u003eEbria\u003c/em\u003e, particularly since some members of the Thecofilosea have been shown to share ultrastructural traits [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e], but such data is very limited for \u003cem\u003eEbria\u003c/em\u003e [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e] or absent for \u003cem\u003eBotuliforma\u003c/em\u003e. \u003cem\u003eHermesinum\u003c/em\u003e, which is morphologically very similar to \u003cem\u003eEbria\u003c/em\u003e, has also been shown to be closely related to the latter based on SSU rRNA analyses, so genomic data from this genus might also shed light on this evolution [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e].\u003c/p\u003e\u003c/div\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cdiv class=\"BlockQuote\"\u003e\u003cp\u003eTwo other previously proposed cercozoan subgroups that are recovered with high support are Marimonadida and Thaumatomonadidae (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e) [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. The tree supports the monophyly of several genera originally included in Marimonadida, such as \u003cem\u003ePseudopirsonia, Auranticordis\u003c/em\u003e, and \u003cem\u003eAbollifer\u003c/em\u003e, as well as several cells of unknown genera, like the co-assembly SB456C. The Thaumatomonadidae clade is similarly made up of several of the genera originally proposed to be in this group: \u003cem\u003eThaumatomastix\u003c/em\u003e, \u003cem\u003eAllas\u003c/em\u003e, and \u003cem\u003eDiscomonas\u003c/em\u003e [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eWe do not recover a monophyletic group corresponding to the Sarcomonadea (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e; [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]), but do recover both Pediglissa and Paracercomonada, which are the two orders that were proposed to make up Sarcomonadea [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. Pediglissa includes cercomonads and glissomonads (\u003cem\u003eSandona\u003c/em\u003e SC1169), and while the support for this group is low in our phylogeny at 70/79% (UFB/PMSF), there is better support (93/88%) for a group including Pediglissa together with euglyphids. Cells \u003cem\u003eCercomonas\u003c/em\u003e SPO5 and \u003cem\u003eSandona\u003c/em\u003e SC1169 both branch with members of the Cercomonadida, but \u003cem\u003eParacercomonas\u003c/em\u003e branches outside this group, rendering Cercomonadida non-monophyletic, something that has been reported previously [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e], and further complicating the taxonomic definition of Sarcomonadea. Cavalier-Smith et al. placed \u003cem\u003eParacercomonas\u003c/em\u003e in a separate subclass Paracercomonada from other cercomonads [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e], but kept the taxon Sarcomonadea despite recovering it as paraphyletic.\u003c/p\u003e\u003cp\u003eMore strikingly, we do not recover any support for the Imbricatea, which was proposed based on SSU phylogenies [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]. We find various lineages that were proposed to be members of this group to be polyphyletic, in many cases with strong support. This is congruent with a study by Cavalier-Smith et al, which show Imbricatea to be non-monophyletic in a smaller multigene phylogeny [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e].\u003c/p\u003e\u003c/div\u003e\u003cp\u003e\u003c/p\u003e\n\u003ch3\u003ePhaeodarians\u003c/h3\u003e\n\u003cp\u003e\u003c/p\u003e\u003cdiv class=\"BlockQuote\"\u003e\u003cp\u003ePhaeodarians are large, planktonic, amoeboid heterotrophs that are most common in the deep ocean and were long thought to be radiolarians due to the overall similarities occuring between them as large amoebae with complex internal mineralized skeletons [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e, \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e, \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]. However, the first SSU rRNA data from the group showed they were actually cercozoans, probably related to Thecofilosea, and the single small EST data set from one species, \u003cem\u003eAulacantha scolymantha\u003c/em\u003e, also showed this [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e, \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e, \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. We have now sequenced transcriptomes from 20 phaeodarian cells, which confirms they branch within Thecofilosea (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). While this is not a new placement, it is worth emphasizing this position since the previously available data was limited, and the new phaeodarian transcriptomes are among the best in our data set (some co-assemblies reaching 99% completeness). Single-cell transcriptomics seems like an ideal way to approach these difficult-to-access deep sea cells for the future. Our sampling mostly focuses on the various aulosphaerids (Aulosphaerid sp., \u003cem\u003eAulastrum\u003c/em\u003e), aulacanthids (\u003cem\u003eAulokleptes\u003c/em\u003e, \u003cem\u003eAulographis\u003c/em\u003e), and \u003cem\u003eProtocystis\u003c/em\u003e, and shows high support for the monophyly of \u003cem\u003eProtocystis\u003c/em\u003e and \u003cem\u003eCastanarium\u003c/em\u003e, but several other groups are not well represented and appear to be non-monophyletic (including aulosphaerids and aulacanthids), and the overall deep nodes in phaeodarian phylogeny are not yet resolved. A focused study on phaeodarians should allow for a larger matrix of more genes and, if mixed with wider taxon sampling, a well-resolved phylogeny of the group may be possible.\u003c/p\u003e\u003c/div\u003e\u003cp\u003e\u003c/p\u003e\n\u003ch3\u003eNovel and Environmental Clades\u003c/h3\u003e\n\u003cp\u003e\u003c/p\u003e\u003cdiv class=\"BlockQuote\"\u003e\u003cp\u003eBass et al (2004) identified several new clades of Cercozoa based only on environmental sequencing, and called them ‘Novel Clades (NC)’. Some of these have remained essentially uncharacterized even after 20 years, so we specifically examined any potential cases where an isolated cell represented these clades, and found two cases. The morphologies of these cells appear similar to one another and to other cercozoans at first glance, but closer inspection suggests there are differences in morphology and behaviour.\u003c/p\u003e\u003cp\u003eIn the first case, the SSU rRNA tree shows that cells CBS2 and co-assembly FilosaNC6-co (TBS14, TBS20, TBS21) correspond to Novel Clade 6 (NC6) (\u003cb\u003eFigure \u003cspan refid=\"MOESM3\" class=\"InternalRef\"\u003eS3\u003c/span\u003e\u003c/b\u003e). These cells are inconspicuous biflagellates; in the case of FilosaNC6, the cells were all dorso-ventrally flattened, oval to oblong with notches on both anterior and posterior, and move via a ‘bouncing’ motion on their posterior flagellum (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eJ-L, \u003cb\u003eVideos TBS14, TBS20, TBS21 Borealis Supplemental Data\u003c/b\u003e). Cell CBS2 exhibits a similar pattern of movement, but the cell body is less flattened, more oblong, and is full of granulated reflective inclusions (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eI). All cells ‘whip’ their anterior flagellum up and down (\u003cb\u003eVideos CBS2 Borealis Supplemental Data\u003c/b\u003e). In the phylogenomic tree, this group branches with another novel clade discovered here and the genus \u003cem\u003eMicrometopion\u003c/em\u003e (see below), with low to moderate support (90% UFB, 74% PMSF).\u003c/p\u003e\u003cp\u003eThe second case is cell LC32-83, corresponding to the environmental clade dubbed ‘eVentri’ [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e], which is sister to Ventrifissura in our phylogenomic tree (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e), and in turn these two are sister to \u003cem\u003eVerrucomonas\u003c/em\u003e with full support. The ‘eVentri’ environmental data, as well as \u003cem\u003eVerrucomonas\u003c/em\u003e and Ventrifissura are all known from marine sediment [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e], but exact placement of ‘eVentri’ was unclear from SSU data. Altogether, we show that these taxa make up the proposed Ventricleftida [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e] with full support, despite not being recovered in most SSU phylogenies [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. Our cell LC32-83 shares certain morphological characteristics with the ventricleftids, \u003cem\u003eVentrifissura velata\u003c/em\u003e and \u003cem\u003eV. artocarpoidea\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eH; [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]). All are biflagellated, and have a ‘dimpled’ texture, although it is more pronounced on \u003cem\u003eV. velata\u003c/em\u003e and \u003cem\u003eV. artocarpoidea\u003c/em\u003e. It should be noted that many thecofilosans, including \u003cem\u003eVentrifissura\u003c/em\u003e, have life cycles that are poorly understood, with diverse morphologies [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e], so it remains possible that different life stages of related lineages are being observed, making them appear more morphologically distinct.\u003c/p\u003e\u003cp\u003eInterestingly, this Ventricleftida group also contained three other cells (TBM2, TBM3, and QCH3) that formed a distinct sub-group with no close known relatives that we call ‘Novel Clade A’ (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). These cells are morphologically very similar to each other—dorso-ventrally flattened flagellates that glide on their posterior flagellum, with no anterior flagellum visible, and a round to oblong cell shape with a median furrow that is very pronounced in the anterior part of the cell (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eQ-S). Apart from the somewhat generic round-oblong cell body shape, this morphology is different from other known ventricleftids, as both \u003cem\u003eVerrucomonas\u003c/em\u003e and \u003cem\u003eVentrifissura\u003c/em\u003e have two obvious emergent flagella. Some \u003cem\u003eVerrucomonas\u003c/em\u003e have characteristic pigmented dimples on their surface as well, as opposed to all our cells [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e], but it should be noted that ventricleftids overall are poorly understood, with only two studies available [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. There are no environmental sequences that fall into this ventricleftid subgroup, despite the substantial amount of environmental sequence data from Cercozoa (\u003cb\u003eSupplemental Figure \u003cspan refid=\"MOESM3\" class=\"InternalRef\"\u003eS3\u003c/span\u003e\u003c/b\u003e).\u003c/p\u003e\u003cp\u003eMore interestingly, three other cells (TS2, SMB3, and NO2022) also formed ‘Novel Clade B’ (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e), which branched with moderate support and distantly with \u003cem\u003eMicrometopion\u003c/em\u003e and the newly characterized cells from the previously reported environmental NC6 group (see above; 90/74% [UFB/PMSF]). All three cells are biflagellates with oblong to ovoid cell shapes and two long, thin flagella (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA-C). While the cells seem to glide on their posterior flagellum, the anterior flagellum ‘whips’ up and down along the apical 2/3 of its length, without much side-to-side movement (\u003cb\u003eVideos TS2, SMB3, NO2022 Borealis Supplemental Data\u003c/b\u003e; we did not observe this behaviour in cell NO2022). While much more pronounced here, this behaviour is similar to that of cells in Novel Clade 6. \u003cem\u003eMicrometopion\u003c/em\u003e on the other hand is a much smaller biflagellate that glides on its posterior flagellum and has a barely emergent anterior flagellum [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e], illustrating that more detailed studies are needed to understand this group.\u003c/p\u003e\u003cp\u003eSimilarly, cell QCF12 branched sister to the newly characterized cell FiloNC4co in our multigene tree, albeit with poor support (50–60%). SSU rRNA of cells used in co-assembly of FiloNC4co/’Novel Clade C’ (cells BB13, BB15, TBM7) branch with an environmental sequence (clone 9-2.2), which used to be considered a member of ‘Novel Clade 4’ previously (\u003cb\u003eSupplementary Figure \u003cspan refid=\"MOESM3\" class=\"InternalRef\"\u003eS3\u003c/span\u003e\u003c/b\u003e; [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]), but apparently has since been viewed as a separate lineage within Cercozoa [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. In our multigene tree, FiloNC4co and QCF12 branch sister to the Marimonadida, in a completely different part of the tree than ‘Novel Clade 4’ (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e), representing yet another two novel uncharacterized lineages. The morphology of QCF12 shows an oblong to ovoid cell with internal granulated structure that is dorsoventrally flattened (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD), gliding on its thin posterior flagellum with the thin anterior flagellum beating irregularly side-to-side (\u003cb\u003eVideo QCF12 Borealis Supplemental Data\u003c/b\u003e). Unfortunately, the SSU rRNA sequence could not be recovered in the transcriptome of cell QCF12 (which is rare, but not unheard of [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]), so we cannot rule out that QCF12 is related to representatives of any previously known environmental or characterized clade. The morphology of cells from FiloNC4co (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eE-G) are somewhat different than cell QCF12, with a more irregular cell shape and more pronounced side-to-side beating of the anterior flagellum in QCF12 (\u003cb\u003eVideos QCF12 and BB13 Borealis Supplemental Data\u003c/b\u003e).\u003c/p\u003e\u003c/div\u003e\u003cp\u003e\u003c/p\u003e\n\u003ch3\u003eDeeper branches\u003c/h3\u003e\n\u003cp\u003e\u003c/p\u003e\u003cdiv class=\"BlockQuote\"\u003e\u003cp\u003eThree other cells fell in very interesting deep-branch positions: \u003cem\u003eHedriocystis\u003c/em\u003e, \u003cem\u003eTremula\u003c/em\u003e (SC1200), and co-assembly WFco (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e\u003cp\u003ePreviously, \u003cem\u003eLapot\u003c/em\u003e was characterized as part of the Aquavolonidae (formerly NC10, [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e, \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]), Tremulida was formerly known as NC11 [\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e], and in SSU rRNA trees \u003cem\u003eTremula\u003c/em\u003e, \u003cem\u003eLapot\u003c/em\u003e, and NC12 were shown to form a clade that was sister to Endomyxa [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e], but without strong support. We instead recover a strongly supported clade of \u003cem\u003eLapot\u003c/em\u003e, \u003cem\u003eTremula\u003c/em\u003e, and a previously unknown lineage represented by co-assembly WFco (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e, ‘Novel Clade D’), all sister to a group consisting of Phytomyxea, Ascetosporea, and Apofilosa [\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e], albeit with low support. Cells in co-assembly WFCo are metabolic amoeboflagellates with two flagella (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eM-O, \u003cb\u003eVideos WF2, WF3, WF4 Borealis Supplemental Data\u003c/b\u003e), suggesting some similarity to \u003cem\u003eLapot gusevi\u003c/em\u003e, which is also metabolic and possesses two unequal flagella [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. Movement patterns of both taxa are similar as well. Furthermore, our \u003cem\u003eTremula\u003c/em\u003e SC1200 isolate is also metabolic with 2 emergent flagella (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eT, \u003cb\u003eVideo SC1200 Borealis Supplemental Data\u003c/b\u003e), suggesting this morphology might be ancestral to this group, but additional studies using light and electron microscopy are needed. Based on the strongly supported Tremulida + Aquavolonida + WFco (‘Novel Clade D’) clade in our multigene analyses, and the morphological similarities, we propose to amend the class Skiomonadae ([\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e], amended to include Aquavolonida [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]) and the deeper diversity associated with this clade, particularly WFco.\u003c/p\u003e\u003cp\u003eReminiscent of the historical association of Phaeodaria with Radiolaria, the order Desmothoracida in the class Granulofilosea bear a strong resemblance to heliozoan amoebae (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eP), and were originally thought to be related to them, but are now known to be cercozoans (Bass et al 2009). Our \u003cem\u003eHedriocystis pellucida\u003c/em\u003e cell SC1203 represents the first molecular data for this species, and the first multigene data for Desmothoracida. In the SSU tree, we recover this species branching with an environmental sequence in a clade which includes \u003cem\u003eHedriocystis reticulata\u003c/em\u003e and \u003cem\u003eClathrulina elegans\u003c/em\u003e (\u003cb\u003eFigure \u003cspan refid=\"MOESM3\" class=\"InternalRef\"\u003eS3\u003c/span\u003e\u003c/b\u003e), as expected. In the phylogenomic tree, \u003cem\u003eHedriocystis\u003c/em\u003e forms a deep, isolated branch within Cercozoa, as the only representative of the much larger class Granofilosea. Overall this suggests the heliozoan-like cercozoans are likely an ancient, independent lineage much like Phaeodaria, and will likely require specific attention to determine their diversity and internal evolutionary radiation.\u003c/p\u003e\u003c/div\u003e\u003cp\u003e\u003c/p\u003e\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\u003cdiv class=\"BlockQuote\"\u003e\u003c/div\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e"},{"header":"Conclusions: A Broad Scale Tree of Cercozoa","content":"\u003cp\u003e\u003c/p\u003e\u003cp\u003eCercozoa are a major group of eukaryotes, found abundantly in diverse ecosystems across the planet, and play key roles as primary producers, heterotrophs, and parasites [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. Yet they are dramatically understudied, with some of the most sparse genomic data in any part of the tree of life [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e, \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e].\u003c/p\u003e\u003cp\u003ePhylogenomics has been applied to diverse members of this group relatively recently, on a small scale, based on a few available cultures [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. Our tree roughly supports many of the conclusions of these early analyses, but also massively expands on the scope of the data available (with over 3X more taxa). This analysis already goes a long way to define which sub-groups are well-supported, which ones are not, and also provides the first supported placement for a number of groups that were previously only known from a single environmental sequence or not represented by any data at all (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eWhile a full-scale analysis of character evolution is beyond the scope of this report, the tree topology and the data underpinning it should prove critical to such analyses. For example, we can already confirm that the polyubiquitin insertions that were first proposed to be a uniting character of Rhizaria [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e, \u003cspan additionalcitationids=\"CR43\" citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e–\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e] are indeed present in all of our transcriptomes, but interestingly in some clades the exact nature of the insertions varies, and have a complex distribution (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). Some cercozoan clades (thaumatomonads, phaeodarians, euglyphids, cercomonads, and ventricleftids) have two amino acid insertions between polyubiquitin monomers as reported previously [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e, \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e], whereas others like cryothecomonads and \u003cem\u003eEbria\u003c/em\u003e only have one. A single amino acid insertion was proposed to be ancestral to Rhizaria, while a double insertion may be a more derived trait [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. Our wealth of data complicates this view somewhat, with some shallow-branching cercozoan clades likely having secondarily lost the double amino acid insertion (e.g. cryothecomonads).\u003c/p\u003e\u003cp\u003eBut for most of the basic biology of many of these groups we lack enough information to really say much. As the data for Cercozoa expand, its interpretation will certainly be aided by a strongly supported tree representing all the major subgroups of Cercozoa, which appears to be technically feasible by relying heavily on the single-cell transcriptomics methods we used here, particularly considering the time and effort needed to establish cultures of protists.\u003c/p\u003e"},{"header":"Methods","content":"\u003cdiv id=\"Sec10\" class=\"Section2\"\u003e\u003ch2\u003eCell isolation and imaging\u003c/h2\u003e\u003cp\u003eCells were sampled from 40 different locations across North America and the Caribbean, spanning several different habitats (marine benthos, marine plankton, soil; \u003cb\u003eSupplemental Table \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e\u003c/b\u003e). Sampling was facilitated by the Hakai Institute (Quadra Island), the Northern Gulf of Alaska Long Term Ecological Research project (Alaska), and the Caribbean Research and Management of Biodiversity facility (CARMABI; Cura\u0026ccedil;ao). For benthic samples, sediment, mud, or sand was collected from the aerated upper 2 cm. Sample extraction followed the kimwipe-method [\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e], with cells aggregating on coverslips after several hours. Coverslips were observed with the downside facing upwards on an inverted microscope (Leica DMIL-LED), imaged with Sony alpha7S III or Sony alpha7RIII cameras, at either 40x or 63x magnification.\u003c/p\u003e\u003cp\u003ePlanktonic samples were either collected via an array of methods. In the Gulf of Alaska, samples were collected from the R/V Sikuliaq using a 21 \u0026micro;m hand net, 53 and 150 \u0026micro;m vertically towed calvets, 150 \u0026micro;m multinets, and Niskin bottles on CTD-rosettes, from which water was concentrated using gravity filtration with a 0.8 \u0026micro;m (47 mm) filter (Pall). On Quadra Island, samples were collected using a hand net deployed from shore, or vertical 250 \u0026micro;m zooplankton net tows deployed from a vessel. All samples were immediately observed after collection (or after concentration in the case of Niskin samples). Cells were imaged on an inverted microscope at 10x, 20x, 40x, or 63x magnification (Leica DMIL-LED), or dissection microscope (Zeiss Stemi 508) with Sony alpha7S III or Sony alpha7RIII cameras.\u003c/p\u003e\u003cp\u003eThe single soil sample (SPO5) was isolated from forest litter, a small amount of which was submerged in dH\u003csub\u003e2\u003c/sub\u003eO for a day, and then observed under a Leica DMIL-LED inverted microscope and imaged with a Sony alpha7RIII camera at 63x magnification.\u003c/p\u003e\u003cp\u003eIn all cases, after imaging, cells were manually isolated from coverslips or seawater with a microcapillary, rinsed 2\u0026ndash;6 times in drops of clean 0.2\u0026micro;m filtered seawater (marine samples) or 0.2\u0026micro;m filtered tapwater (soil), and dispensed into 2\u0026micro;l of SmartSeq2 lysis buffer [\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eSamples SC1169, SC1200, and SC1203 were derived from crude cultures. Raw samples (\u003cb\u003eSupplementary Table\u0026nbsp;1\u003c/b\u003e) were at room temperature for two weeks with the addition of 0.025% wheat grass extract to promote bacterial growth. Cells were manually isolated with tapered Pasteur pipettes and inoculated individually into wells of a plastic 96-well plate, containing 200 \u0026micro;l of Pratt\u0026rsquo;s medium with 0.025% wheat grass extract. Individual wells with growing clonal cells were transferred to a Petri dish with the same medium, and the clonal cultures were further maintained by bi-weekly reinoculation of 1 ml of old culture into fresh medium and kept at 15\u0026deg;C. Cells were imaged on Zeiss AxioVert A1 and Zeiss Axioplan 4 microscopes, the latter equipped with differential interference contrast (DIC) optics. Photographs and videos were captured on a Sony alpha7RIII camera. To increase cDNA yield due to small cell size, eight single cells of SC1169, five cells of SC1200, and five cells of SC1203 were respectively manually isolated into three tubes containing 2\u0026micro;l of SmartSeq2 lysis buffer, after having been washed several times in 0.2 \u0026micro;m filtered Pratt\u0026rsquo;s medium.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\u003ch2\u003eSingle-cell transcriptomics and assembly\u003c/h2\u003e\u003cp\u003eIsolated cells were disrupted by 2\u0026ndash;5 freeze-thaw cycles in lysis buffer and cDNA was generated using SmartSeq2 with 22\u0026ndash;24 PCR-cycles for cDNA amplification [\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e]. Libraries were prepared using Illumina DNA Prep kits for Illumina MiSeq, NextSeq 500, or NovaSeqX platforms, with 2x150 bp or 2x250 bp paired end reads by the UBC Sequencing and Bioinformatics Consortium (Supplementary Table \u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003eS2\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eRaw reads were corrected with rcorrector version 1.0.5 [\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e], adapter- and quality-trimmed with trimmomatic version 0.39 [\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e] using parameters ILLUMINACLIP: 2:30:10 LEADING:5 SLIDINGWINDOW:5:16 MINLEN:60, trimming adapter sequences: TSO (5\u0026rsquo;AAGCAGTGGTATCAACGCAGAGTACATGGG 3\u0026rsquo;), olido-dT (5\u0026rsquo;AAGCAGTGGTATCAACGCAGAGTACTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 3\u0026rsquo;), ISPCR (5\u0026rsquo;AAGCAGTGGTATCAACGCAGAGT 3\u0026rsquo;), Transposase1 (5\u0026rsquo;CTGTCTCTTATACACATCTCCGAGCCCACGAGAC 3\u0026rsquo;), Transposase2_rc (5\u0026rsquo;CTGTCTCTTATACACATCTGACGCTGCCGACGA 3\u0026rsquo;). Trimmed reads were assembled with rnaSPAdes versions 3.15.5 or 3.14 with default parameters [\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e]. Protein-coding sequences were generated with transdecoder version 5.5.0 [\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e].\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\u003ch2\u003eSSU rDNA phylogenetics\u003c/h2\u003e\u003cp\u003eWe extracted SSU rDNA sequences from the assemblies using barrnap version 0.9 (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://github.com/tseemann/barrnap\u003c/span\u003e\u003cspan address=\"https://github.com/tseemann/barrnap\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003e).\u003c/span\u003e Extracted sequences were blasted against NCBI GenBank\u0026rsquo;s nr/nt database to identify cercozoan SSU rDNAs and potential contaminants. Cercozoan SSU rRNAs were aligned with a custom Rhizaria dataset that was constructed using previously available datasets [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e], and supplemented with manually retrieved sequences from NCBI GenBank. After adding our new SSU rRNA sequences, the 326-taxon dataset was aligned with MAFFT E-INS-I version 7.48 [\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e], and trimmed with trimAl version 1.2rev59 with parameters -gt 0.9 -st 0.001 [\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e], yielding a 1061-bp trimmed alignment. A Maximum-likelihood (ML) analysis was carried out with RAxML-NG version 1.1.0 [\u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e] under the GTR\u0026thinsp;+\u0026thinsp;GAMMA model and 1,000 non-parametric bootstraps.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e\u003ch2\u003eMultigene phylogenetics\u003c/h2\u003e\u003cp\u003eFor our multigene dataset, we added our 119 predicted single-cell proteomes as input into PhyloFisher version 1.2.14 [\u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e55\u003c/span\u003e] using the default dataset. We additionally added rhizarian transcriptomes, genomes, and EST-data collated in the EukProt version 3 database (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://evocellbio.com/eukprot/\u003c/span\u003e\u003cspan address=\"https://evocellbio.com/eukprot/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003e)\u003c/span\u003e, euglyphid transcriptomes [\u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e], ascetosporean and endomyxan genomes [\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e], a \u003cem\u003ePolymyxa betae\u003c/em\u003e genome (GenBank accession GCA_003693705), three thecofilosan single-cell amplified genomes [\u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e57\u003c/span\u003e], and an \u003cem\u003eOrciraptor agilis\u003c/em\u003e transcriptome (GenBank accession PRJEB49867).\u003c/p\u003e\u003cp\u003eData were added to the database in several batches, and each time we manually checked each of the 240 single gene trees generated as part of the PhyloFisher pipeline. Contaminant, paralogous, or otherwise aberrant sequences were deleted or omitted from the final dataset.\u003c/p\u003e\u003cp\u003eThe final dataset consisted of 70 genes from 115 rhizarian taxa (including 7 Retaria acting as an outgroup). This dataset includes taxa that were combined into a chimeric taxon in PhyloFisher using the --chimeras flag with the select_taxa.py script. Supplementary Tables S1, S2, and S3 show what taxa were subjected to this. Individual taxa used in creating these chimeras were omitted from the final tree, instead prioritizing the chimeras. Taxa and genes were chosen to maximize coverage for the single-cell transcriptomes, while retaining breadth across the tree of Rhizaria. Percentage of sites and genes recovered for each taxon are reported in \u003cb\u003eSupplementary Table \u003cspan refid=\"MOESM3\" class=\"InternalRef\"\u003eS3\u003c/span\u003e\u003c/b\u003e.\u003c/p\u003e\u003cp\u003eA Maximum-likelihood phylogeny of the final 115 taxon, 70 genes dataset (12,261 amino acid sites) was generated using IQ-TREE2 version 2.2.0 [\u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e58\u003c/span\u003e] under the LG\u0026thinsp;+\u0026thinsp;C60\u0026thinsp;+\u0026thinsp;G model with 1,000 ultrafast bootstraps (UFB [\u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e59\u003c/span\u003e]), and under a posterior mean site frequency model (PMSF [\u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e60\u003c/span\u003e]) with 200 non-parametric bootstraps, using the previous LG\u0026thinsp;+\u0026thinsp;C60\u0026thinsp;+\u0026thinsp;G tree as a guide tree.\u003c/p\u003e\u003cp\u003eWe also generated a more taxon-comprehensive, but site-poorer phylogeny, with 128 taxa and 33 genes (4,961 amino acid sites) under the LG\u0026thinsp;+\u0026thinsp;C60\u0026thinsp;+\u0026thinsp;G model with 1,000 ultrafast bootstraps.\u003c/p\u003e\u003c/div\u003e"},{"header":"Declarations","content":"\u003ch2\u003e\u0026nbsp;\u003c/h2\u003e\n\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\n\u003cp\u003eGL conceived the study, isolated and imaged cells, generated transcriptomes, conducted phylogenetic analyses, wrote main manuscript text, prepared figures; ECC isolated and imaged cells, generated transcriptomes, secured funding; VZ isolated and imaged cells, generated transcriptomes; MM prepared figures; NO isolated and imaged cells, generated transcriptomes; VKLJ-R isolated and imaged cells, generated transcriptomes; SB isolated and imaged cells, generated transcriptomes; CH isolated and imaged cells, generated transcriptomes; VGH isolated and imaged cells, generated transcriptomes; DG generated transcriptomes; PJK wrote main manuscript text and secured funding. All authors reviewed the manuscript.\u003c/p\u003e\n\u003ch2\u003eAcknowledgement\u003c/h2\u003e\n\u003cp\u003eWe thank Mark Vermeij of CARMABI for sampling support in Cura\u0026ccedil;ao, the Hakai Institute for sampling support at Quadra Island, including Alana Closs and Tyrel Froese, and Dr. Russel Hopcroft and the crew of the R/V Sikuliaq for sampling support in the Gulf of Alaska. We also thank Dr. Sunita Sinha (UBC Sequencing + Bioinformatics Consortium) for consultation and help with library preparation and sequencing. This work was supported by grants to PJK from the Natural Sciences and Engineering Research Council of Canada (RGPIN-2025-04463) and from the Gordon and Betty Moore Foundation (https://doi.org/10. 37807/GBMF9201). Gulf of Alaska sampling was funded by the National Science Foundation (OCE-1656070).\u003c/p\u003e\n\u003ch2\u003eData Availability\u003c/h2\u003e\n\u003cp\u003eRaw reads of all single cells are deposited under NCBI BioProject PRJNA1317988 and PRJNA1174372. SSU rRNA sequences are deposited under NCBI GenBank accessions PX213529-PX213634 and PX227518-PX227524. Image and video files, assembled transcriptomes, predicted proteomes, SSU rRNA alignment and tree, multigene alignment and trees, are deposited under Borealis accession https:/doi.org/10.5683/SP3/PW1ZZP .\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eGeisen S, Tveit AT, Clark IM, Richter A, Svenning MM, Bonkowski M, et al. Metatranscriptomic census of active protists in soils. ISME J. 2015;9:2178\u0026ndash;90. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/ismej.2015.30\u003c/span\u003e\u003cspan address=\"10.1038/ismej.2015.30\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eDegrune F, Dumack K, Fiore-Donno AM, Bonkowski M, Sosa-Hern\u0026aacute;ndez MA, Schloter M, et al. Distinct communities of Cercozoa at different soil depths in a temperate agricultural field. FEMS Microbiol Ecol. 2019;95:fiz041. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/femsec/fiz041\u003c/span\u003e\u003cspan address=\"10.1093/femsec/fiz041\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHowe AT, Bass D, Scoble JM, Lewis R, Vickerman K, Arndt H, et al. Novel Cultured Protists Identify Deep-branching Environmental DNA Clades of Cercozoa: New Genera Tremula, Micrometopion, Minimassisteria, Nudifila, Peregrinia. Protist. 2011;162:332\u0026ndash;72. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.protis.2010.10.002\u003c/span\u003e\u003cspan address=\"10.1016/j.protis.2010.10.002\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eChantangsi C, Leander BS. An SSU rDNA barcoding approach to the diversity of marine interstitial cercozoans, including descriptions of four novel genera and nine novel species. Int J Syst Evol Micr. 2010;60:1962\u0026ndash;77. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1099/ijs.0.013888-0\u003c/span\u003e\u003cspan address=\"10.1099/ijs.0.013888-0\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKeeling PJ, Deane JA, McFadden GI. The Phylogenetic Position of Alpha- and Beta‐Tubulins from the Chlorarachnion Host and Cercomonas (Cercozoa). J Eukaryot Microbiol. 1998;45:561\u0026ndash;70. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/j.1550-7408.1998.tb05117.x\u003c/span\u003e\u003cspan address=\"10.1111/j.1550-7408.1998.tb05117.x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCavalier-Smith T, Chao EE. Sarcomonad ribosomal RNA sequences, rhizopod phylogeny, and the origin of euglyphid amoebae. Arch f\u0026uuml;r Protistenkd. 1996;147:227\u0026ndash;36. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/s0003-9365(97)80050-4\u003c/span\u003e\u003cspan address=\"10.1016/s0003-9365(97)80050-4\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBhattacharya D, Helmchen T, Melkonian M. Molecular Evolutionary Analyses of Nuclear-Encoded Small Subunit Ribosomal RNA Identify an Independent Rhizopod Lineage Containing the Euglyphina and the Chlorarachniophyta. J Eukaryot Microbiol. 1995;42:65\u0026ndash;9. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/j.1550-7408.1995.tb01541.x\u003c/span\u003e\u003cspan address=\"10.1111/j.1550-7408.1995.tb01541.x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBass D, Moreira D, L\u0026oacute;pez-Garc\u0026iacute;a P, Polet S, Chao EE, Heyden S von der, et al. Polyubiquitin Insertions and the Phylogeny of Cercozoa and Rhizaria. Protist. 2005;156:149\u0026ndash;61. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.protis.2005.03.001\u003c/span\u003e\u003cspan address=\"10.1016/j.protis.2005.03.001\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eIrwin NAT, Tikhonenkov DV, Hehenberger E, Mylnikov AP, Burki F, Keeling PJ. Phylogenomics supports the monophyly of the Cercozoa. Mol Phylogenet Evol. 2019;130:416\u0026ndash;23. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.ympev.2018.09.004\u003c/span\u003e\u003cspan address=\"10.1016/j.ympev.2018.09.004\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eNakamura Y, Tuji A, Kimoto K, Yamaguchi A, Hori RS, Suzuki N. Ecology, Morphology, Phylogeny and Taxonomic Revision of Giant Radiolarians, Orodaria ord. nov. (Radiolaria; Rhizaria; SAR). Protist. 2021;172:125808. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.protis.2021.125808\u003c/span\u003e\u003cspan address=\"10.1016/j.protis.2021.125808\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eJamy M, Foster R, Barbera P, Czech L, Kozlov A, Stamatakis A, et al. Long-read metabarcoding of the eukaryotic rDNA operon to phylogenetically and taxonomically resolve environmental diversity. Mol Ecol Resour. 2020;20:429\u0026ndash;43. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/1755-0998.13117\u003c/span\u003e\u003cspan address=\"10.1111/1755-0998.13117\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eJamy M, Biwer C, Vaulot D, Obiol A, Jing H, Peura S, et al. Global patterns and rates of habitat transitions across the eukaryotic tree of life. Nat Ecol Evol. 2022;6:1458\u0026ndash;70. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41559-022-01838-4\u003c/span\u003e\u003cspan address=\"10.1038/s41559-022-01838-4\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSchoenle A, Francis O, Archibald JM, Burki F, Vries J de, Dumack K, et al. Protist genomics: key to understanding eukaryotic evolution. Trends Genet. 2025. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.tig.2025.05.004\u003c/span\u003e\u003cspan address=\"10.1016/j.tig.2025.05.004\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eShiratori T, Yabuki A, Ishida K-I. Morphology, Ultrastructure, and Phylogeny of Two Novel Species of Ventrifissura (V. oblonga n. sp. and V. velata n. sp., Thecofilosea, Cercozoa). Protist. 2020;171:125731. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.protis.2020.125731\u003c/span\u003e\u003cspan address=\"10.1016/j.protis.2020.125731\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePolet S, Berney C, Fahrni Jos\u0026eacute;, Pawlowski J. Small-Subunit Ribosomal RNA Gene Sequences of Phaeodarea Challenge the Monophyly of Haeckel\u0026rsquo;s Radiolaria. Protist. 2004;155:53\u0026ndash;63. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1078/1434461000164\u003c/span\u003e\u003cspan address=\"10.1078/1434461000164\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSierra R, Matz MV, Aglyamova G, Pillet L, Decelle J, Not F, et al. Deep relationships of Rhizaria revealed by phylogenomics: A farewell to Haeckel\u0026rsquo;s Radiolaria. Mol Phylogenetics Evol. 2013;67:53\u0026ndash;9. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.ympev.2012.12.011\u003c/span\u003e\u003cspan address=\"10.1016/j.ympev.2012.12.011\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eRoshan SK, Dumack K, Bonkowski M, Leinweber P, Karsten U, Glaser K. Taxonomic and Functional Diversity of Heterotrophic Protists (Cercozoa and Endomyxa) from Biological Soil Crusts. Microorganisms. 2021;9:205. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/microorganisms9020205\u003c/span\u003e\u003cspan address=\"10.3390/microorganisms9020205\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eShiratori T, Kato Y, Ishida K. Molecular and morphological characterization of three novel Minorisa species (Chlorarachnea) and proposal for an emended description of the Minorisa minuta. Phycol Res. 2024;72:27\u0026ndash;35. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/pre.12533\u003c/span\u003e\u003cspan address=\"10.1111/pre.12533\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eShiratori T, Ishida K. Rhabdamoeba marina is a heterotrophic relative of chlorarachnid algae. J Eukaryot Microbiol. 2023;:e13010. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/jeu.13010\u003c/span\u003e\u003cspan address=\"10.1111/jeu.13010\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eShiratori T, Ishida K. Trachyrhizium urniformis n. g., n. sp., a Novel Marine Filose Thecate Amoeba Related to a Cercozoan Environmental Clade (Novel Clade 4). J Eukaryot Microbiol. 2016;63:722\u0026ndash;31. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/jeu.12319\u003c/span\u003e\u003cspan address=\"10.1111/jeu.12319\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eShiratori T, Yokoyama A, Ishida K-I. Phylogeny, ultrastructure, and flagellar apparatus of a new marimonad flagellate Abollifer globosa sp. nov.(Imbricatea, Cercozoa). Protist. 2014;165:808\u0026ndash;24. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.protis.2014.10.003\u003c/span\u003e\u003cspan address=\"10.1016/j.protis.2014.10.003\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSiemensma F, Dumack K. SSU rDNA Phylogeny Indicates the Scale-lacking Trivalvulariida ord. nov. as a Sister Group to the Euglyphida (Cercozoa, Rhizaria). Protist. 2020;171:125701. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.protis.2019.125701\u003c/span\u003e\u003cspan address=\"10.1016/j.protis.2019.125701\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBass D, Cavalier-Smith T. Phylum-specific environmental DNA analysis reveals remarkably high global biodiversity of Cercozoa (Protozoa). Int J Syst Evol Microbiol. 2004;54:2393\u0026ndash;404. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1099/ijs.0.63229-0\u003c/span\u003e\u003cspan address=\"10.1099/ijs.0.63229-0\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCooney EC, Holt CC, Jacko-Reynolds VKL, Leander BS, Keeling PJ. Photosystems in the eye-like organelles of heterotrophic warnowiid dinoflagellates. Curr Biol. 2023;33:4252\u0026ndash;4260.e3. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.cub.2023.08.052\u003c/span\u003e\u003cspan address=\"10.1016/j.cub.2023.08.052\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLax G, Kolisko M, Eglit Y, Lee WJ, Yubuki N, Karnkowska A, et al. Multigene phylogenetics of euglenids based on single-cell transcriptomics of diverse phagotrophs. Mol Phylogenet Evol. 2021;159:107088. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.ympev.2021.107088\u003c/span\u003e\u003cspan address=\"10.1016/j.ympev.2021.107088\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKang S, Tice AK, Spiegel FW, Silberman JD, P\u0026aacute;nek T, Cepicka I, et al. Between a Pod and a Hard Test: The Deep Evolution of Amoebae. Mol Biol Evol. 2017;34:2258\u0026ndash;70. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/molbev/msx162\u003c/span\u003e\u003cspan address=\"10.1093/molbev/msx162\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eK\u0026uuml;hn S, Lange M, Medlin LK. Phylogenetic Position of Cryothecomonas Inferred from Nuclear-Encoded Small Subunit Ribosomal RNA. Protist. 2000;151:337\u0026ndash;45. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1078/s1434-4610(04)70032-2\u003c/span\u003e\u003cspan address=\"10.1078/s1434-4610(04)70032-2\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eDumack K, Gerdzhikov D, Klisarova D. Phylogenetic analysis confirms the taxonomic placement of the marine flagellate Hermesinum adriaticum (Thecofilosea, Cercozoa, Rhizaria). J Eukaryot Microbiol. 2022;:e12905. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/jeu.12905\u003c/span\u003e\u003cspan address=\"10.1111/jeu.12905\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHargraves PE. The ebridian flagellates Ebria and Hermesinum. Plankton Biol Ecol. 2002;1:9\u0026ndash;16.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHoppenrath M, Leander BS. Dinoflagellate, Euglenid, or Cercomonad? The Ultrastructure and Molecular Phylogenetic Position of Protaspis grandis n. sp. J Euk Micro. 2006;53:327\u0026ndash;42. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/j.1550-7408.2006.00110.x\u003c/span\u003e\u003cspan address=\"10.1111/j.1550-7408.2006.00110.x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eShirkina NI. Morphology and life cycle of Thaumatomonas lauterborni de Saedeleer (Mastigophora Diesing). Fauna i Biologiya Presnovodnyh Organizmov Leningrad; Nauka. 1987;:87\u0026ndash;107.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCavalier-Smith T, Chao EE, Lewis R. Multigene phylogeny and cell evolution of chromist infrakingdom Rhizaria: contrasting cell organisation of sister phyla Cercozoa and Retaria. Protoplasma. 2018;255:1517\u0026ndash;74. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s00709-018-1241-1\u003c/span\u003e\u003cspan address=\"10.1007/s00709-018-1241-1\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCavalier-Smith T, Chao EE-Y. Phylogeny and Classification of Phylum Cercozoa (Protozoa). Protist. 2003;154:341\u0026ndash;58. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1078/143446103322454112\u003c/span\u003e\u003cspan address=\"10.1078/143446103322454112\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eNikolaev SI, Berney C, Fahrni JF, Bolivar I, Polet S, Mylnikov AP, et al. The twilight of Heliozoa and rise of Rhizaria, an emerging supergroup of amoeboid eukaryotes. Proc Natl Acad Sci. 2004;101:8066\u0026ndash;71. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1073/pnas.0308602101\u003c/span\u003e\u003cspan address=\"10.1073/pnas.0308602101\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eNakamura Y, Imai I, Yamaguchi A, Tuji A, Not F, Suzuki N. Molecular Phylogeny of the Widely Distributed Marine Protists, Phaeodaria (Rhizaria, Cercozoa). Protist. 2015;166:363\u0026ndash;73. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.protis.2015.05.004\u003c/span\u003e\u003cspan address=\"10.1016/j.protis.2015.05.004\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eScoble JM, Cavalier-Smith T. Scale evolution, sequence phylogeny, and taxonomy of thaumatomonad Cercozoa: 11 new species and new genera Scutellomonas, Cowlomonas, Thaumatospina and Ovaloplaca. Eur J Protistol. 2014;50:270\u0026ndash;313. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.ejop.2013.12.005\u003c/span\u003e\u003cspan address=\"10.1016/j.ejop.2013.12.005\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBass D, Tikhonenkov DV, Foster R, Dyal P, Janouškovec J, Keeling PJ, et al. Rhizarian \u0026lsquo;Novel Clade 10\u0026rsquo; Revealed as Abundant and Diverse Planktonic and Terrestrial Flagellates, including Aquavolon n. gen. J Eukaryot Microbiol. 2018;65:828\u0026ndash;42. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/jeu.12524\u003c/span\u003e\u003cspan address=\"10.1111/jeu.12524\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBass D, Chao EE-Y, Nikolaev S, Yabuki A, Ishida K, Berney C, et al. Phylogeny of Novel Naked Filose and Reticulose Cercozoa: Granofilosea cl. n. and Proteomyxidea Revised. Protist. 2009;160:75\u0026ndash;109. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.protis.2008.07.002\u003c/span\u003e\u003cspan address=\"10.1016/j.protis.2008.07.002\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eThor\u0026eacute;n MH, Onuț-Br\u0026auml;nnstr\u0026ouml;m I, Alfjorden A, Peckov\u0026aacute; H, Swords F, Hooper C, et al. Comparative genomics of Ascetosporea gives new insight into the evolutionary basis for animal parasitism in Rhizaria. BMC Biol. 2024;22:103. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s12915-024-01898-x\u003c/span\u003e\u003cspan address=\"10.1186/s12915-024-01898-x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCavalier-Smith T, Karpov SA. Paracercomonas Kinetid Ultrastructure, Origins of the Body Plan of Cercomonadida, and Cytoskeleton Evolution in Cercozoa. Protist. 2012;163:47\u0026ndash;75. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.protis.2011.06.004\u003c/span\u003e\u003cspan address=\"10.1016/j.protis.2011.06.004\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKeeling PJ, Campo J del. Marine Protists Are Not Just Big Bacteria. Curr Biol. 2017;27:R541\u0026ndash;9. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.cub.2017.03.075\u003c/span\u003e\u003cspan address=\"10.1016/j.cub.2017.03.075\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eArchibald JM, Teh EM, Keeling PJ. Novel Ubiquitin Fusion Proteins: Ribosomal Protein P1 and Actin. J Mol Biol. 2003;328:771\u0026ndash;8. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/s0022-2836(03)00374-7\u003c/span\u003e\u003cspan address=\"10.1016/s0022-2836(03)00374-7\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eArchibald JM, Longet D, Pawlowski J, Keeling PJ. A Novel Polyubiquitin Structure in Cercozoa and Foraminifera: Evidence for a New Eukaryotic Supergroup. Mol Biol Evol. 2003;20:62\u0026ndash;6. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/molbev/msg006\u003c/span\u003e\u003cspan address=\"10.1093/molbev/msg006\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eArchibald JM, Keeling PJ. Actin and Ubiquitin Protein Sequences Support a Cercozoan/Foraminiferan Ancestry for the Plasmodiophorid Plant Pathogens. J Eukaryot Microbiol. 2004;51:113\u0026ndash;8. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/j.1550-7408.2004.tb00172.x\u003c/span\u003e\u003cspan address=\"10.1111/j.1550-7408.2004.tb00172.x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eChantangsi C, Hoppenrath M, Leander BS. Evolutionary relationships among marine cercozoans as inferred from combined SSU and LSU rDNA sequences and polyubiquitin insertions. Mol Phylogenetics Evol. 2010;57:518\u0026ndash;27. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.ympev.2010.07.007\u003c/span\u003e\u003cspan address=\"10.1016/j.ympev.2010.07.007\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLarsen J, Patterson DJ. Some flagellates (Protista) from tropical marine sediments. J Nat Hist. 1990;24:801\u0026ndash;937. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1080/00222939000770571\u003c/span\u003e\u003cspan address=\"10.1080/00222939000770571\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePicelli S, Faridani OR, Bj\u0026ouml;rklund \u0026Aring;K, Winberg G, Sagasser S, Sandberg R. Full-length RNA-seq from single cells using Smart-seq2. Nat Protoc. 2014;9:171\u0026ndash;81. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/nprot.2014.006\u003c/span\u003e\u003cspan address=\"10.1038/nprot.2014.006\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSong L, Florea L. Rcorrector: efficient and accurate error correction for Illumina RNA-seq reads. GigaScience. 2015;4:1\u0026ndash;8. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s13742-015-0089-y\u003c/span\u003e\u003cspan address=\"10.1186/s13742-015-0089-y\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBolger AM, Lohse M, Usadel B. Trimmomatic: a flexible trimmer for Illumina sequence data. Bioinformatics. 2014;30:2114\u0026ndash;20. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/bioinformatics/btu170/\u003c/span\u003e\u003cspan address=\"10.1093/bioinformatics/btu170/\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e-/dc1\u003c/span\u003e\u003cspan address=\"http://-/dc1\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBushmanova E, Antipov D, Lapidus A, Prjibelski AD. rnaSPAdes: a de novo transcriptome assembler and its application to RNA-Seq data. GigaScience. 2019;8:giz100. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/gigascience/giz100\u003c/span\u003e\u003cspan address=\"10.1093/gigascience/giz100\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHaas BJ, Papanicolaou A, Yassour M, Grabherr M, Blood PD, Bowden J, et al. De novo transcript sequence reconstruction from RNA-seq using the Trinity platform for reference generation and analysis. Nat Protoc. 2013;8:1494\u0026ndash;512. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/nprot.2013.084\u003c/span\u003e\u003cspan address=\"10.1038/nprot.2013.084\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKatoh K, Standley DM. MAFFT multiple sequence alignment software version 7: improvements in performance and usability. Mol Biol Evol. 2013;30:772\u0026ndash;80. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/molbev/mst010\u003c/span\u003e\u003cspan address=\"10.1093/molbev/mst010\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCapella-Guti\u0026eacute;rrez S, Silla-Mart\u0026iacute;nez JM, Gabald\u0026oacute;n T. trimAl: a tool for automated alignment trimming in large-scale phylogenetic analyses. Bioinformatics. 2009;25:1972\u0026ndash;3. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/bioinformatics/btp348\u003c/span\u003e\u003cspan address=\"10.1093/bioinformatics/btp348\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKozlov AM, Darriba D, Flouri T, Morel B, Stamatakis A. RAxML-NG: A fast, scalable, and user-friendly tool for maximum likelihood phylogenetic inference. Bioinformatics. 2019;35:4453\u0026ndash;5. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/bioinformatics/btz305\u003c/span\u003e\u003cspan address=\"10.1093/bioinformatics/btz305\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eTice AK, Žihala D, P\u0026aacute;nek T, Jones RE, Salomaki ED, Nenarokov S, et al. PhyloFisher: A phylogenomic package for resolving eukaryotic relationships. PLoS Biol. 2021;19:e3001365. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1371/journal.pbio.3001365\u003c/span\u003e\u003cspan address=\"10.1371/journal.pbio.3001365\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWeiner AKM, Cer\u0026oacute;n-Romero MA, Yan Y, Katz LA. Phylogenomics of the Epigenetic Toolkit Reveals Punctate Retention of Genes across Eukaryotes. Genome Biol Evol. 2020;12:2196\u0026ndash;210. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/gbe/evaa198\u003c/span\u003e\u003cspan address=\"10.1093/gbe/evaa198\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWideman JG, Monier A, Rodr\u0026iacute;guez-Mart\u0026iacute;nez R, Leonard G, Cook E, Poirier C, et al. Unexpected mitochondrial genome diversity revealed by targeted single-cell genomics of heterotrophic flagellated protists. Nat Microbiol. 2020;5:154\u0026ndash;65. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41564-019-0605-4\u003c/span\u003e\u003cspan address=\"10.1038/s41564-019-0605-4\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMinh BQ, Schmidt HA, Chernomor O, Schrempf D, Woodhams MD, Haeseler A von, et al. IQ-TREE 2: New Models and Efficient Methods for Phylogenetic Inference in the Genomic Era. Mol Biol Evol. 2020;37:1530\u0026ndash;4. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/molbev/msaa015\u003c/span\u003e\u003cspan address=\"10.1093/molbev/msaa015\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHoang DT, Chernomor O, Haeseler A von, Minh BQ, Vinh LS. UFBoot2: Improving the Ultrafast Bootstrap Approximation. Mol Biol Evol. 2018;35:518\u0026ndash;22. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/molbev/msx281\u003c/span\u003e\u003cspan address=\"10.1093/molbev/msx281\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWang H-C, Minh BQ, Susko E, Roger AJ. Modeling Site Heterogeneity with Posterior Mean Site Frequency Profiles Accelerates Accurate Phylogenomic Estimation. Syst Biol. 2018;67:216\u0026ndash;35. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/sysbio/syx068\u003c/span\u003e\u003cspan address=\"10.1093/sysbio/syx068\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"bmc-biology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"","sideBox":"Learn more about [BMC Biology](https://bmcbiol.biomedcentral.com/)","snPcode":"12915","submissionUrl":"https://submission.springernature.com/new-submission/12915/3","title":"BMC Biology","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"multigene, Rhizaria, RNAseq, protist, Phaeodaria, Cercomonas","lastPublishedDoi":"10.21203/rs.3.rs-7584520/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7584520/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003eBackground \u003c/strong\u003eCercozoa are single-celled eukaryotes (protists), and part of the supergroup Rhizaria. Cercozoans have vastly different morphologies and are defined by their phylogenetic affinity. While the group includes some well-known and well-researched taxa, like the chlorarachniophytes, we know very little about the remainder. Most of these are predatory protists found in soil and marine sediments, but also include marine plankton, and are underrepresented in multigene phylogenetic trees of Rhizaria, thus missing much of their diversity. We employed single-cell transcriptomics to broadly sample this uncultured diversity of Cercozoa.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eResults\u003c/strong\u003e We generated a taxon-comprehensive multigene tree of Cercozoa that includes many previously unsampled groups, increasing taxon sampling by more than 300%. We report 5 novel and previously unknown lineages, and two lineages that were only known from environmental sequences. Several previously established clades are recovered, like Thecofilosea, phaeodarians, and thaumatomonads, but others like the class Imbricatea are not. We find both single and double amino-acid insertions between polyubiquitin monomers in all our assemblies, suggesting a complex pattern across Cercozoa.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConclusions\u003c/strong\u003e By using a single-cell transcriptomics approach generated a wealth of molecular and morphological image data for phylogenomics. This phylogenetic framework is in turn the groundwork for additional analyses to further our understanding of the basic biology of Cercozoa, and their diversity. This study also highlights the number of previously unsampled taxa, and completely novel lineages in Rhizaria, and Cercozoa in particular.\u003c/p\u003e","manuscriptTitle":"Phylogenomic tree of Cercozoa based on single-cell transcriptomes from 100 uncultured cells","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-09-23 07:05:52","doi":"10.21203/rs.3.rs-7584520/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2025-10-29T08:31:58+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-10-21T09:57:22+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-10-03T13:07:25+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"244579897148719964593979339888488721739","date":"2025-09-16T02:07:09+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"333135977237303165873291469525566405943","date":"2025-09-15T10:56:01+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-09-14T01:48:04+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-09-11T13:13:56+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-09-11T08:51:51+00:00","index":"","fulltext":""},{"type":"submitted","content":"BMC Biology","date":"2025-09-10T15:33:42+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"bmc-biology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"","sideBox":"Learn more about [BMC Biology](https://bmcbiol.biomedcentral.com/)","snPcode":"12915","submissionUrl":"https://submission.springernature.com/new-submission/12915/3","title":"BMC Biology","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"6a14534d-e3fc-4ed2-9505-4e316943f48e","owner":[],"postedDate":"September 23rd, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[],"tags":[],"updatedAt":"2026-01-27T10:15:21+00:00","versionOfRecord":[],"versionCreatedAt":"2025-09-23 07:05:52","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-7584520","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7584520","identity":"rs-7584520","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2025) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00
unpaywall
last seen: 2026-05-23T02:00:01.238055+00:00
License: CC-BY-4.0