Mechanism of lncRNA WARS2-IT1 promoting angiogenesis of glioma through miR-299-3P/VEGFA axis and activating PI3K/AKT signaling pathway

Mechanism of lncRNA WARS2-IT1 promoting angiogenesis of glioma through miR-299-3P/VEGFA axis and activating PI3K/AKT signaling pathway | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Mechanism of lncRNA WARS2-IT1 promoting angiogenesis of glioma through miR-299-3P/VEGFA axis and activating PI3K/AKT signaling pathway Mingbin Hu, Weiguo Gu, Yajun Huai, Chunliang Wang, Jinhong Mei This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7026304/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 01 Aug, 2025 Read the published version in Cytotechnology → Version 1 posted 7 You are reading this latest preprint version Abstract Glioma is a common primary intracranial tumor with easy recurrence and poor prognosis. Emerging evidence has highlighted the involvement of LncRNA in glioma proliferation, invasion, migration and angiogenesis, but at present, there is no relevant research on LncRNA WARS2-IT1. We performed qRT-PCR and Western blotting to evaluate the expression of related RNA in glioma. Cell Counting Kit-8, Scratch-healing test, Transwell, EDU test to assess the cell proliferation, migration and invasion ability in glioma and Tube formation assay contributed to endothelial cell angiogenesis. Apoptosis was measured via flow cytometry. Bioinformatics prediction and dual-luciferase reporter assays were conducted to validate the regulatory interactions in T98G and U251 cell lines. Results showed that lncRNA WARS2-IT1 and VEGFA were highly expressed in glioma cells, while miR-299-3p was enriched in normal glial HEB cells. WARS2-IT1 Knockdown significantly suppressed glioma cell proliferation, migration, invasion, and endothelial angiogenesis, while promoting apoptosis. Mechanistically, WARS2-IT1 harbored a complementary binding site for miR-299-3p, which directly targeted the 3-UTR of VEGFA. Further analysis revealed that WARS2-IT1 promotes glioma progression and angiogenesis through the PI3K/AKT signaling pathway. These findings suggest that the oncogenic lncRNA WARS2-IT1 contributes to glioma pathogenesis by upregulating VEGFA via sponging miR-299-3p, highlighting its therapeutic target potentiality. Glioma lncRNA WARS2-IT1 Angiogenesis miR-299-3p PI3K/AKT signal pathway Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 INTRODUCTION Glioma is a common primary intracranial tumor with easy recurrence and poor prognosis[ 1 ], The five-year survival rate of patients is still less than 5% even with comprehensive treatment such as surgery, radiotherapy and chemotherapy[ 2 ]. Previous studies have shown that angiogenesis plays a key role in the occurrence, development and metastasis of glioma[ 3 ]. The expression of vascular factor is an effective target in the treatment of glioma. Bevacizumab can specifically prevent the binding of vascular endothelial growth factor and its receptor and inhibit the formation of tumor blood vessels, Relevant studies and data show that although bevacizumab can not prolong the overall survival time, it can significantly improve the quality of life of patients with advanced glioma. Bevacizumab is also the only targeted drug that can be used for glioma at present[ 4 ]. It has achieved relatively good curative effect, but more than 30% of patients still have no response to anti angiogenesis treatment at first, and eventually the relevant patients will relapse and die of the disease soon. There is evidence that the regulation of noncoding RNA plays an important role in angiogenesis, especially long-chain noncoding RNA and microRNA[ 5 ]. Long noncoding RNAs (lncRNAs), a class of noncoding transcripts exceeding 200 nucleotides in length that lack protein-coding potential and have been shown to exert essential regulatory functions in various cellular processes, including proliferation, differentiation, genomic imprinting, and immune responses [ 6 ]. lncRNAs are usually located in the nucleus. It is mainly involved in transcriptional regulation and epigenetics in the nucleus [ 7 ]. When lncRNAs is located in cytoplasm, such lncRNAs acts as a "molecular sponge" to adsorb miRNA, regulate the protein expression level of downstream coding genes through the mechanism of CeRNA, and then participate in regulating various tumor-associated biological processes [ 8 ]. In glioma samples, the expression of several oncogenic lncRNA was upregulated. For example, MIR22HG is a carcinogenic lncRNAs. Knockdown of lncRNA by regulating miR-22-3p and miR-22-5p expression leads to Wnt/β-catenin pathway Inactivation, reduces cell proliferation, invasion and tumor growth in xenotransplantation model[ 9 ]. SNHG9 has also been shown to be overexpressed in glioblastoma samples, which is associated with low patient survival, SNHG9 plays a role in regulating cell growth and aerobic glycolysis through miR-199a-5p/Wnt2 axis in glioblastoma[ 10 ]. Studies have also found that lncRNA participates in the regulation of glioma angiogenesis by affecting the expression of VEGFA, lncRNA H19 in glioma cells, which could promote proliferation, migration, invasion and angiogenesis via miR-138/HIF-1α axis as a ceRNA[ 11 ]. The oncogenic LncRNA TMPO-AS1 has been closely linked to gastric cancer progression, exerting its effects by upregulating BRCC3 via miR-126-5p. This interaction activates the PI3K/AKT signaling cascade, thereby enhancing gastric cancer cell proliferation and promoting endothelial angiogenesis [ 12 ]. Mitochondrial tryptophanyl-tRNA synthetase 2(Wars2) is a crucial and widely expressed enzyme that facilitates covalent attachment of tryptophan to its cognate tRNA during mitochondrial protein translation [ 13 ]. WARS2 , encoding the L53F variant within its ATP-binding motif, exhibits reduced enzymatic activity; its inhibition in endothelial cells suppresses angiogenesis [ 14 ]. WARS2-IT1 is WARS2 intronic transcript 1, at present, there is no relevant research on the lncRNA WARS2-IT1. miRNAs are ~ 22-nucleotide endogenous noncoding RNAs that suppress gene expression by binding target mRNAs [ 15 ]. miR-299, located at 14q32, is reportedly upregulated in acute myeloid leukemia [ 16 ]. Recent evidence indicates that miR-299 acts as a tumor suppressor via inhibiting cellular proliferation, migration, and invasion. Notably, miR-299-3p is regulated by lncRNAs and binds the 3′UTR of VEGFA mRNA, thereby modulating melanoma cell growth and invasiveness [ 17 ]. miR-299-3p is downregulated in colon carcinoma tissues and cell lines and exerts its tumor-suppressive functions via targeting the 3′UTR of VEGFA mRNA [ 18 ]. Additionally, miR-299 is reportedly downregulated in glioma tissues and is inhibited by lncRNA TUG1, which promotes angiogenesis and upregulates VEGF expression by inhibiting miR-299 [ 19 ]. However, the miR-299 effect on GBM angiogenesis is still obscure. Angiogenesis is a defining hallmark of cancer, including brain tumors. Angiogenesis in the central nervous system (CNS) is predominantly controlled by classical signaling pathways, notably the vascular endothelial growth factor VEGF–VEGFR and angiopoietin–Tie receptor systems [ 20 ]. The expression level of VEGFA can be regulated by upstream molecules, such as lncRNA and miRNA, so as to affect the angiogenesis of glioma. Exosomal signaling influences glioma angiogenesis by modulating VEGFA expression within glioma cells and through transfer to endothelial cells via glioma-derived extracellular vesicles [ 21 ]. Moreover, LRIG3—a potential tumor suppressor—has been shown to be selectively expressed in malignant tumors; in glioma cells, it downregulates VEGFA and suppresses PI3K/AKT pathway activation, thereby attenuating angiogenesis [ 22 ]. It can be seen that VEGFA is an important mechanism of glioma angiogenesis by influencing the downstream PI3K/AKT signaling pathway. However, how lncRNA WARS2-IT1 regulates glioma angiogenesis through activating the downstream PI3K/AKT signaling pathway has not relate researchs. This study aimed to assess the expression profiles of lncRNA WARS2-IT1, miR-299-3p, and VEGFA in GECs and to elucidate their roles in GBM-associated angiogenesis. The interplay among these molecules was systematically investigated, confirming their collective role in regulating GBM angiogenesis. Ultimately, this study aimed to provide a foundation for the development of targeted molecular and anti-angiogenic therapies for glioma. MATERIALS AND METHODS Ethics statement Informed written consent was obtained from each partici pant prior to the study. The study protocols were approved by the Ethics Committee of First Affiliated Hospital of Nanchang University and performed in line with the Declaration of Helsinki. Animal experiments were strictly in accordance with the Guide for Care and Use of Laboratory Animals issued by the US National Institutes of Health. The protocol for animal experiments was approved by the Institutional Animal Care and Use Committee of First Affiliated Hospital of Nanchang University（Medical Ethics Number：（2024） CDYFYYLK（06-021）.Animal Ethics Number：CDYFY-IACUC-202407QR205）. Cell Culture Human brain microvascular endothelial cells (HBMVECs) were obtained from American Type Culture Collection (ATCC, Manassas, VA, USA) and cultured in endothelial cell medium (ECM; ScienCell, CA, USA) supplemented with 5% ScienCell® fetal bovine serum, endothelial cell growth supplement (ECGS, Cat. No. 1052), and penicillin/streptomycin solution (P/S, Cat. No. 0503). Cultures were maintained at 37 °C in a humid 5% CO₂ atmosphere. Human glioma cell lines (U87, U118, U251, and T98G), the normal glial cell line HEB, and HEK293T cells were obtained from Beijing BeNa Culture Collection Cell Center. All were maintained in high-glucose DMEM supplemented with 10% (FBS; Solarbio, Beijing, China) at 37 °C in 5% CO₂. Glioma cells were seeded in 10-cm Petri dishes. Cell Transfection The lentivirus-based short hairpin RNA (shRNA) targeting WARS2-IT1 system was constructed utilizing GeneChem (Shanghai, China). The sequence or shRNA targeting WARS2-IT1 was as follow shRNA WARS2-IT1#1, 5′- GGAA GATAAGGGAGAGTTTGA -3′; shRNA WARS2-IT1#2, 5′- GGACAATAATGTACAGACTGA -3′; shRNA WARS2-IT1#3, 5′- GGAGCAAAGGTGACTTGT TAT -3′. The lentivirus was used to infect 293T cells (MOI = 6E+8 TU/mL), and puromycin (1 μg/mL) was used to select the stable lentivirus-based T98G, U251 infected cells. miR-299-3p mimics and inhibitors, along with corresponding negative controls (NC), were acquired from GenePharma (Shanghai, China) and transfected into T98G and U251 cells utilizing Lipofectamine 3000 (Life Technologies, USA) in Opti-MEM at 70–80% confluence. Cells were collected 48 h post-transfection. Quantitative Real-time PCR Total RNA was extracted individually from Glioma cell or tissues and Normal glial cell or tissues with a commercial RNA preparation kit (Axygen ® Scientific, Union City, CA). RNA concentration and purity were assessed utilizing a NanoDrop 2000/2000C spectrophotometer based on the A260/A280 ratio. For WARS2-IT1, cDNA was generated utilizing PrimeScript RT reagent kit (Vazyme ® , #R323), For miR-299-3p analysis, miRNA-specific cDNA was synthesized utilizing stem-loop primers and SYBR ® Green MicroRNA reverse Transcription Kit (Vazyme ® , #MR101-01/02). Table 1 presents the primer sequences used in reverse transcriptionquantitative PCR (RT-qPCR), The primers for WARS2-IT1 and GAPDH, miR-299-3p and U6 were synthesized by GeneChem (Shanghai, China). Expression levels of WARS2-IT1 and GAPDH were quantified utilizing the One-Step SYBR PrimeScript RT-PCR (Vazyme®, Kit Cat. No. Q341-02). The miR-299-3p and U6 expression levels were examined with miRNA Universal SYBR qPCR Master Mix Kits (Vazyme ® , #MQ101-01). Relative gene expressions were estimated utilizing 2 −△△CT method and normalized to the corresponding internal control levels. Cell Proliferation Assay Cell Counting Kit-8 (CCK-8, Bioss, Beijing, China) assay was conducted for the cell proliferation assay. Cells were plated in 96-well plates at the density of 2000 cells per well, then added with 10 µL of the CCK-8 solution. Cells were incubated in a humidified incubator at 37◦C for 2 h. The absorbance at 450 nm was measured with the Fisher Scientific Labserv K3 microplate reader (ThermoFisher, US). EdU test kit was purchased from BBI LIFE SCIENCES (Sangon Biotech, Shanghai, China). Exponentially growing cells were sorted into 96-well plates, and to each group, 3 duplicated cells were set up. First, the cells were labeled with EdU reagent. 2× EdU working solution was prepared in serum-free medium. Preheat 2× EdU solution, and then add 2× EdU solution to the equal volume of medium containing experimental cells to obtain 1× EdU solution. The treated cells were incubated for 12 hours. Next, Cell immobilization and permeabilization. Add an appropriate amount of PBS containing paraformaldehyde into each well, incubate at room temperature for 15 minutes. Remove the stationary solution and wash it with PBS for three times. Then add cell permeabilization solution and incubate at room temperature for 20 minutes. PBS is washed twice to remove the washing solution. Remove the permeation buffer and wash with PBS twice. Finally, EdU detected cell proliferation. Prepare and add the reaction mixture according to the instructions, Incubate in dark for 30 minutes at room temperature. Cell Migration or Invasion Assay Scratch test, forty-eight hours after transfection, each group of cells were sorted into 6-well plates at 5 × 10 5 cells/well, The fusion rate reached 100% after overnight vaccination. Use 200 μL pipette tip scratch the cell layer, Pipette tip should be perpendicular to the line drawn on the back of the plate before the experiment. After the scratch, PBS was washed 3 times, and then the fresh serum-free medium was replaced. The cells were cultured in an incubator. Then take out the cells at an appropriate time point, such as 0 and 24h, observe and measure the width of the scratch with a microscope line, and take photos. Calculate using Image J software (NIH, USA). Transwell assay, the Transwell migration assay was performed using the 24-well transwell chamber coated with or without Matrigel, Invasion assays were performed similarly using matrigel-coated inserts (BD Bioscience, USA), without Matrigel was migration assay. Firstly, the cell suspension was prepared, before preparing the cell suspension, the cells can be starved for 12-24h and the optimal cell density was calculated and diluted. Secondly, add 600 µl medium containing 15% FBS into the lower chamber of the 24 well plate, and pay attention to avoid bubbles. Next, Incubate in 37℃ incubator for 12-48h, take out Transwell chamber and wash it twice with PBS. Gently wipe off the non migrating cells in the upper layer with a cotton swab, fix them with methanol or formaldehyde for 30 minutes, and air dry the chamber properly. Dye with 0.1% crystal violet for 30-60 min and wash with PBS for 3 times. Finally, the cells were observed in five visual fields under a 400× microscope and counted. Flow cytometry analysis of cell apoptosis After apoptosis treatment, cells were digested with trypsin without EDTA, and 1~5 × 10 5 cells were collected. The fluorescein isothiocyanate Annexin V-FITC/PI Cell Apoptosis Detection Kit (TransGen Biotech, Beijing, China) based on double staining with FITC-Annexin V and PI was applied to detect the apoptosis level. Next, add 100ul precooled 1 × Annexin V Banding Buffer and resuspend the cells, Secondly, 5ul annexin V-FITC and 5ul PI were added to each tube respectively. Finally, apoptotic cells T98G and U251 were kept on ice in the dark and assessed using a flow cytometer (FACSAria III; BD Biosciences, San Jose, CA, USA). Tube Formation Assay Mix the Matrigel(BD Biosciences, Bedford, MA, United States) with serum-free medium according to 1:1 and add it into 96 well plate, then put it into the incubator for 30min to solidify. Next, the concentration of 2 × 10 5 /mL human brain microvascular endothelial cells(HBMEC) were added to Matrigel-coated wells which were resuspended in 100 µL complete ECM medium, repeated three wells. After incubation in CO2 incubator at 37 ℃, angiogenesis can be seen after 4 hours and the Image J software (NIH, United States) was used to measure the total tubule length and numbers of tubule branches. Western Blot Analysis Total proteins from the cells on ice were extracted by RIPA buffer with protease inhibitors (Solarbio Science & Technology, Beijing, China). Electrophoresis was conducted to equal amount of protein samples (40 µg) with sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS–PAGE) and then transferred to PVDF membranes. Membranes were incubated in 5% non-fat milk dissolved in Tris-buffffered saline (TBS) containing 0.1% Tween-20 for 2 h at room temperature and then incubated with primary antibodies against VEGFA (1:500, abcam, ab185238), CD34 (1:1000, Proteintech, Chicago, United States), p-PI3K (1:500, Proteintech, Chicago, United States), p-PI3K (1:1,000, CST, EUGENE), PI3K (1:1,000, CST, EUGENE), p-AKT (1:1,000, CST, EUGENE), AKT (1:1,000, CST, EUGENE), MMP2 (1:1,000, CST, EUGENE), MMP9 (1:1,000, CST, EUGENE), Cacaspse3 (1:500, Proteintech, Chicago, United States), Cacaspse7 (1:500, Proteintech, Chicago, United States), BAX (1:500, Proteintech, Chicago, United States), Bcl2 (1:500, Proteintech, Chicago, United States) and GAPDH (1:1000, Proteintech, Chicago, United States) at 4◦C overnight. On next day, membranes were incubated with secondary antibodies (goat anti-rabbit or goat anti-mouse, 1:5000, respectively; Santa Cruz Biotechnology, Santa Cruz, CA, United States) at room temperature for 2 h. Immunoblots were visualized by enhanced chemiluminescence (ECL kit, Solarbio Science & Technology, Beijing, China) and scanned, calculate the integrated density values(IDV) using Image Lab software. Reporter Vectors Construction and Luciferase Reporter Assays The potential binding sites of miRNA-299-3p in WARS2-IT1 and VEGFA 3’-UTR sequences were amplified by PCR and cloned into a pmirGlo Dual-luciferase miRNA Target Expression Vector (Promega, Madison, WI, United States) to construct luciferase reporter vector (WARS2-IT1-Wt and VEGFA-Wt, GenePharma). The sequence of putative binding site was replaced as indicated (WARS2-IT1-Mut and VEGFA-Mut) to mutate the putative binding site of WARS2-IT1 or VEGFA. HEK-293T cells were seeded in 96-well plates and were co-transfected with WARS2-IT1-Wt (or WARS2-IT1-Mut) or VEGFA-Wt (or VEGFA-Mut) and miRNA-299-3p or miRNA-299-3p-NC plasmids when the conflfluence reached at 70∼80%. Dual-Luciferase reporter assay kit (Promega) was then applied to measure the luciferase activities at 48 h after the transfection. In Vivo Matrigel Plug Assay BALB/c male athymic nude mice were sourced from Vital River Laboratory Animal Technology Co., Ltd. (Hunan, China) and maintained on autoclaved food and water throughout the study. In vivo, experiments were performed in compliance with institutional ethical standards and protocol for animal experiments was approved by the Institutional Animal Care and Use Committee of First Affiliated Hospital of Nanchang University（Animal Ethics Number：CDYFY-IACUC-202407QR205）. Briefly, A cell suspension of GECs (3 × 10⁵ cells/mL in 400 µL of 80% Matrigel) was prepared and injected subcutaneously. Plugs were excised, weighed, photographed, and incubated overnight at 4 °C in 400 µL PBS to extract hemoglobin. Hemoglobin was quantified utilizing Drabkin’s reagent (Sigma) per the manufacturer’s instructions. Statistical Analysis Quantitative data are expressed as mean ± standard deviation (SD). Statistical analyses were performed using SPSS V.22.0, applying Student’s t-test or one-way ANOVA as appropriate. A P-value < 0.05 was considered statistically significant. RESULTS 1. WARS2-IT1 is significantly overexpressed in glioma tissues, cells and associated with poor prognosis A total of 7235 differentially expressed lncRNA were analyzed after removing ineffective glioma (2 cases of low-grade and 2 cases of high-grade glioma) and 2 cases of normal brain tissue sequencing data, and the heat map of the first 50 differentially expressed lncRNA in the sequencing data was drawn based on Padj value, P value, FPKM value and |log 2 FC| value ( Fig. 1 A ). We chose WARS2-IT1 as the research object of this study. Further through searching the relevant GEPIA bioinformatics database, we found that its carcinogenic effect has been documented in other various cancer types except glioma ( Fig. 1 B ). Analysis utilizing GEPIA online platform (http://gepia.cancer-pku.cn/) revealed elevated WARS2-IT1 expression in the TCGA-GBM dataset ( Fig. 1 C ). Consistent with this prediction, RT-qPCR confirmed significantly increased WARS2-IT1 levels in glioma tissues (p < 0.05) ( Fig. 1 D ). In addition, WARS2-IT1 expression was significantly upregulated in glioma cell lines (U87, U118, U251, and T98G) relative to normal glial cell line HEB, with the highest levels observed in T98G and U251, and the lowest in U118 (all p < 0.05) ( Fig. 1 E ). Then, U251 and T98G cells were selected for subsequent experiments. Retrospective analysis of TCGA-LGG and TCGA-GBM cohorts indicated that patients with high WARS2-IT1 expression (n = 254) exhibited significantly shorter disease-free survival relative to those with low expression (n = 256). Similarly, elevated WARS2-IT1 levels were associated with reduced overall survival ( Fig. 1 F ). Additionally, the association between WARS2-IT1 expression and clinicopathological features in glioma patients was evaluated. As summarized in Table 2 , WARS2-IT1 expression showed no significant correlation with age, sex, tumor location, or lobe involvement (p > 0.05). However, significantly higher WARS2-IT1 levels were observed in patients with tumors ≥ 5 cm, KPS scores < 70, or high-grade glioma (p < 0.05). These findings indicate that WARS2-IT1 is markedly upregulated in glioma tissues and cell lines and may contribute to its progression. 2. Knockdown of WARS2-IT1 suppressed Glioma Cell Proliferation, Migration, Invasion and endothelial cells angiogenesis To further elucidate the functional role of WARS2-IT1 in glioma, T98G and U251 cells were transfected with shRNAs targeting WARS2-IT1. Knockdown efficiency was validated by qRT-PCR ( Fig. 2A ). As a result, Wound-Healing Assay assaysrevealed a significant decrease in migration capacity in the sh-WARS2-IT1 group relative to sh-NC group( Fig. 2 B ). Additionally, CCK-8，Transwell assays demonstrated that WARS2-IT1 silencing substantially impaired the migration and invasion abilities of T98G and U251 cells ( Fig. 2C ). EDU array results exposed that down regulation of WARS2-IT1, the proliferation ability of glioma cells T98G and U251 decreased significantly( Fig. 2 D ). Moreover, colony formation assays were conducted to explore the lncRNA WARS2-IT1 role in endothelial angiogenesis. The results showed that knockdown of WARS2-IT1 via shRNA significantly inhibited angiogenic activity in endothelial cells ( Fig. 2E ). These findings indicate that WARS2-IT1 may act as an oncogenic regulator by enhancing endothelial cell proliferation, migration, and angiogenesis. 3. WARS2-IT1 is mainly located in the cytoplasm WARS2-IT1 was selected from the pool of differentially expressed lncRNAs for further investigation. According to sequencing data and the UCSC Genome dataset (http://genome.ucsc.edu/), WARS2-IT1 is located on human chromosome 1 (chr1:119,047,404–119,063,287) and spans 2,060 bp. The full-length sequence and predicted secondary structure of WARS2-IT1 are shown in Fig. S2A. Bioinformatic analysis using the Coding Potential Assessment Tool (CPAT; http://lilab.research.bcm.edu/cpat/) identified WARS2-IT1 as a noncoding RNA (Fig. S2B). Subcellular localization is closely linked to lncRNA function. Bioinformatic prediction utilizing lncLocator webserver (www.csbio.sjtu.edu.cn/bioinf/lncLocator) indicated that WARS2-IT1 is predominantly localized in cytoplasm ( Fig. 3 A ). Additionally, nucleocytoplasmic separation confirmed that WARS2-IT1 is predominantly localized in cytoplasm ( Fig. 3 B ). According to its localization, WARS2-IT1 may function as a ceRNA. 4. WARS2-IT1 induces VEGFA expression by sponging miR‑299-3P To gain deeper insight into functional WARS2-IT1 mechanisms in glioma, based on previous studies, we speculate that WARS2-IT1 exerts its regulatory function via a ceRNA mechanism. We conducted the following method identify potential miRNA targets of WARS2-IT1 . Firstly, Moreover, the target miRNA related to lncRNA WARS2-IT1 and VEGFA predicted by each bioinformatics database (miRcode,http://www.mircode.org/、LncBase Predicted v.2, http://carolina.imis. athena-innovation.gr/diana_tools and StarBase,http://rna.sysu.edu.cn/encori/), and then a Venn diagram was constructed with 3 intersections (miR-299-3p, miR-3194-3p and miR-2355-5p) found ( Fig. 4A ). Based on TCGA database, Pearson correlation analysis demonstrated a significant corelation between WARS2-IT1 expression and the levels of miR-299-3p, miR-3194-3p, and miR-2355-5p. In these three miRNAs, miR-3194-3p was a strong positive correlation with lncRNA WARS2-IT1 in TCGA-LGG data of glioma (r = 0.122, p<0.01). miR-2355-5p was negative correlation with lncRNA WARS2-IT1 in TCGA-LGG data of glioma (r =−0.060, p＞0.05) ，just miR-299-3p was strong negative correlation with lncRNA WARS2-IT1 expression was depicted in Fig. 4D (Pearson r = −0.166, p<0.001). Integrated analysis of predictions from three bioinformatics databases identified miR-299-3p as the sole miRNA intersecting both WARS2-IT1 and VEGFA target predictions ( Fig. 4E ). Subsequently, RT-qPCR analysis of 52 glioma and 10 normal glial tissue samples revealed a significant downregulation of miR-299-3p in glioma tissues (p < 0.05; Fig. 4B ), whereas WARS2-IT1 expression exhibited an opposite pattern ( Fig. 4 E ). Similarly, RT-qPCR demonstrated reduced miR-299-3p levels in T98G and U251 glioma cells relative to HEB glial cells, with the SiHa cells showing the lowest miR-299-3p expression ( Fig. 4C ). Given the preceding results, we hypothesized that WARS2-IT1 may directly interact to miR-299-3p in glioma. LncBase analysis predicted complementary binding sites ( Fig. 4 C ). A dual-luciferase reporter assay was conducted to confirm the interaction between WARS2-IT1 and miR-299-3p. The luciferase activity of the WARS2-IT1-WT construct was significantly suppressed by miR-299-3p mimics (p < 0.05), whereas the WARS2-IT1-MU construct showed no change, confirming the direct binding of WARS2-IT1 to miR-299-3p ( Fig. 4E ). These findings suggest that WARS2-IT1 may regulate miR-299-3p in glioma cells. 5.WARS2-IT1 Knockdown Suppresses Glioma Cell Proliferation, Migration via Upregulation of miR-299-3p We performed the CCK 8 cell proliferation assay ( Fig. 5 A ) EDU assay( Fig. 5 B ). It was clear that the T98G, U251 cells with lncRNA knockdown WARS2-IT1 (WARS2-IT1 shRNA), overexpressed miR-299-3p (miR-299-3p mimics) revealed markedly decreased proliferation relative to its NC group. Additionally, it was evident that knockdown miR-299-3p (miR-299-3p inhibitors) resulted in the highest observed proliferation rate (p < 0.01), further supporting the WARS2-IT1/miR-299-3p axis role in promoting glioma cell proliferation. Next, we will explore the effects of knocking down or overexpressing miR-299-3p on the biological behavior of glioma cells. In T98G and U251 cells, cell scratch assay results showed that silencing miR-299-3p accelerated the healing rate of cell scratches, while overexpression of miR-299-3p significantly inhibited the healing rate of cell scratches ( Figure 5C , P<0.05); Similarly, the results of Transwell migration chamber experiments suggest that transfection with miR-299-3p inhibitors enhances the migration ability of cells, while transfection with miR-299-3p mimetics significantly inhibits the migration ability of both glioma cells ( Figure 5D , P<0.05), suggesting that miR-299-3p may inhibit the migration ability of glioma cells. 6. Knockdown of WARS2-IT1 inhibits invasion and increased apoptosis of glioma cells by upregulating miR‑299-3P Transwell assays were conducted to evaluate the invasive potential of T98G and U251 cells following miR-299-3p overexpression. Both interventions significantly reduce invasion (p = 0.0085). Quantification further confirmed that invaded cells ‘number was significantly lower in miR-299-3p-overexpressing cells relative to NC group (p = 0.0008; Fig. 6A ). The Transwell array findings indicated that compared with the miR-299-3p overexpression alone, the invasion ability of glioma cells T98G and U251 decreased significantly; However, silencing miR-299-3p at the same time partially reversed the inhibitory effect of miR-299-3p overexpression alone on the glioma proliferation cells (T98G and U251).Further, Flow cytometry (FCM) in both U251 and T98G cells revealed that WARS2-IT1 knockdown (sh-WARS2-IT1) significantly reduced apoptosis relative to sh-NC group. In contrast, miR-299-3p overexpression increased apoptosis, whereas its inhibition suppressed apoptosis relative to their respective negative controls (p < 0.05; Fig. 6B ). To further investigate the effect of WARS2-IT1/miR-299-3p/VEGFA axis on angiogenesis of HBMVECs, we knocked down WARS2-IT1 , over-expression or inhibited miR-299-3p in HBMVECs, respectively, then the conditioned culture medium was collected to culture HBMVECs to assess tube formation of HBMVECs, respectively. The results showed that WARS2-IT1 silencing or over-expression miR-299-3p down-regulated the tube formation of HBMVECs, whereas miR-299-3p inhibition evidently increased tube formation of HBMVECs by almost two folds, however, the combination of HBMVECs knocking down and miR-299-3p inhibition lead to a minor increase of these indexes of HBMVECs ( Fig. 6C ). In all, these results indicated that WARS2-IT1 expressed in glioma might promote the tube formation of HBMVECs via sponging miR-299-3p, thus facilitating the tumorigenicity of glioma. 7. Rescue Experiment further verificate knockdown of lncRNA WARS2-IT1 inhibits invasion ， Proliferation, Migration and endothelial angiogenesis and by upregulating miR‑299-3P. Additionally, We carried out the functional recovery experiment of scratch migration, CCK-8 proliferation, Transwell invasion, and tubular formation recovery experiments. The results showed that relative to downregulation of lncRNA WARS2-IT1 alone, the migration, proliferation, invasion, angiogenesis, and angiogenesis abilities of T98G and U251 glioma cells were significantly weakened; But at the same time, silencing miR-299-3p partially reversed the inhibitory effect of downregulating lncRNA WARS2-IT1 alone on the migration ( Fig. 7 A ), proliferation ( Fig. 7 D ), invasion ( Fig. 7 B ), and angiogenesis ( Fig. 7 C ) ability of T98G and U251 glioma cells. At the same time, we conducted a recovery experiment to detect the angiogenesis related protein VEGFA. Compared with downregulating lncRNA WARS2-IT1 alone, the expression of VEGFA protein in T98G and U251 glioma cells was significantly decreased; But at the same time, silencing miR-299-3p partially reversed the effect of downregulating lncRNA WARS2-IT1 alone on the decreased expression of VEGFA protein during the migration of T98G and U251 glioma cells ( Fig. 7 E ) The CCK-8, EDU array results exposed compared with the down regulation of WARS2-IT1 alone, the proliferation ability of glioma cells T98G and U251 decreased significantly; However, silencing miR-299-3p at the same time partially reversed the inhibitory effect of down regulating WARS2-IT1 alone on glioma cells T98G and U251 proliferation, silencing miR-299-3p at the same time partially reversed the Promote apoptotic effect of down-regulating WARS2-IT1 alone on the apoptosis of glioma cells T98G and U251. 8. WARS2-IT1 promotes tumor progression via the PI3K/AKT pathway Then, VEGFA expression was assessed by Western blot following WARS2-IT1 knockdown combined with either miR-299-3p overexpression or inhibition. As depicted in Fig. 8 , VEGFA levels were reduced in the sh-WARS2-IT1 group, with miR-299-3p overexpression further enhancing this suppression. Conversely, miR-299-3p inhibition partially rescued VEGFA expression. Furthermore, Western blotting was performed to evaluate key proteins involved in multiple regulatory pathways, including p-PI3K and p-AKT (PI3K/AKT signaling), MMP2 and MMP9 (invasion), Bcl-2, caspase-3, and caspase-7 (apoptosis), as well as CD34 (angiogenesis). As illustrated in Fig. 8, WARS2-IT1 knockdown resulted in significant reductions in p-PI3K and p-AKT protein levels in both cell lines, indicating that WARS2-IT1 exerts its regulatory effects in glioma cells via PI3K/AKT signaling pathway. After transfection of sh lncRNA WARS2-IT1 or miR-299-3p mimics, the expression of proliferation related proteins MMP-2 and MMP-9, apoptosis related proteins Bcl-2, angiogenesis related proteins VEGFA and CD34 decreased significantly, while the apoptosis-related protein expressions, Bax, caspase-3 and caspase-7 increased, while trend of related protein expression was opposite after transfection of miR-299-3p inhibitors. 9. WARS2-IT1 Knockdown Produced the Optimum Tumor Suppressive Effect in Vivo. The aforementioned in vitro findings indicated that lncRNA WARS2-IT1 facilitates glioma cell proliferation, angiogenesis, and invasion. To evaluate its tumor-promoting role in vivo, an orthotopic xenograft mouse model was established. T98G cells stably expressing luciferase were transfected with either sh-WARS2-IT1 or sh-NC and subsequently injected into the axillary region of nude mice. At four weeks post-inoculation, in vivo imaging system (IVIS) monitoring demonstrated reduced luciferase activity in tumors derived from shIncRNA-WARS2-IT1 cells, relative to sh-NC group ( Fig. 9 A ), suggesting impaired tumor size and metastasis. As shown in Fig. 9B - C , decreased expression of lncRNA WARS2-IT1 weakened tumor growth in vivo,as compared with the controls. These results uncovered lncRNA WARS2-IT1 knockdown represses glioma development. In addition, IHC analysis revealed that WARS2-IT1 inhibition reduced VEGFA and CD34 staining, along with a microvessel density value ( Fig. 9 D ), indicating that WARS2-IT1 modulates angiogenesis in vivo. DISCUSSION Glioma, which originates from glial cells or precursor cells, represents the most prevalent malignant primary tumor of CNS [23,24]. It is distinguished by aggressive infiltration, easy recurrence and high mortality. Despite the continuous improvement of various treatment methods, including surgery, chemotherapy and radiotherapy, the overall survival time after comprehensive treatment is only 14 months [25]. Emerging research suggests that abnormal expression of lncRNAs and microRNAs in glioma and their interaction may represent novel molecular targets for glioma therapy. [26–28]. VEGFA is a known important factor promoting angiogenesis, which is widely involved in the angiogenesis of a variety of tumors. As a "molecular sponge", lncRNA adsorbs miRNA through the mechanism of ceRNA, participates in regulating VEGFA expression, and affects glioma angiogenesis. In glioma, the proliferation, invasion and angiogenesis of miR-299 / VEGF axis were significantly affected under the regulation of lncRNA TUG1[19]. In the context of emerging ceRNA frameworks implicated in tumorigenesis, we delineated a new WARS2-IT1/miR-299-3p/VEGFA axis in glioma, highlighting the potential of WARS2-IT1 as a potential biomarker of glioma. Increasing evidence has linked aberrant lncRNA expression to the development and progression of various cancers [29, 30]. Through full transcriptome sequencing of 2 normal brain tissues and 4 glioma tissues (2 low-grade and 2 high-grade gliomas), 7235 lncRNAs were detected. It was found that the expression of 3828 lncRNAs increased and 3407 lncRNAs decreased. The lncRNA WARS2-IT1 of this study was comprehensively screened. Comprehensive bioinformatics data analysis shows that WARS2-IT1 may be a new carcinogenic lncRNA, and there is no relevant research on this RNA at present. The expression of WARS2-IT1 in 52 gliomas and 10 normal brain tissues was analyzed by RT-PCR. The findings revealed that WARS2-IT1 expression levels in gliomas were significantly elevated than those in normal brain tissues (P < 0.05). The correlation between WARS2-IT1 and clinicopathological parameters of glioma patients was further analyzed. The study showed that wars2-it1 expression levels in glioma tissues were significantly correlated to KPS score, who grade and tumor size (P < 0.05). Further cell verification showed that WARS2-IT1 expression across glioma cell lines T98G, U87, U118 and U251 was significantly elevated relative to normal glioma cell line HEB (P < 0.05). Comprehensive relevant studies show that WARS2-IT1 plays a pivotal role in glioma initiation and progression. At present, many studies have shown that the subcellular localization and function of lncRNA have obvious specificity.Many studies have found that lncRNA is located in the nucleus. When lncRNA is located in the cytoplasm, it participates in mRNA stability, translation control and ceRNA transcriptional regulation of various solid tumors [31]. Recent studies have demonstrated that lncRNAs can function as a molecular miRNA’s sponges, thereby modulating mRNA expression levels [32,33]. Through metal response elements (MREs), lncRNAs sequester miRNAs and prevent the suppression of downstream target mRNAs [34]. We verified that lncRNA WARS2-IT1 is mainly located in the cytoplasm through nucleocytoplasmic isolation experiment. Therefore, we hypothesized that lncRNA WARS2-IT1 may contribute in the regulation of specific miRNAs in glioma cells through the mechanism of ceRNA, so as to affect the biological behavior of glioma. We screened out miR-299-3p that has common intersection with lncRNA WARS2-IT1 and downstream target gene VEGFA through bioinformatics analysis. It was found that miR-299-3p is expressed in a variety of tumors and has common MREs with multiple lncRNAs. It participates in tumorigenesis and progression by the mechanism of ceRNA. Guo et al. [17] found that lncRNA MIR205HG regulates the occurrence and development of melanoma through miR-299-3p / VEGFA axis. In the gastric cancer study [35], it was also found that lncRNA HCP5 can serve as a miR-299-3p "molecular sponge" and affect the occurrence and development of gastric cancer by affecting the expression of downstream SMAD5 protein. miR-299-3p also played the same effect in liver cancer [36] and lung adenocarcinoma [37]. Therefore, miR-299-3p may interfere with tumor angiogenesis by affecting the expression of downstream VEGFA. VEGFA is a well-established key mediator of glioma angiogenesis; however, its regulation by lncRNA WARS2-IT1 and miR-299-3p remains mainly unclear. In this study, qRT-PCR and Western blot analyses revealed elevated expression of lncRNA WARS2-IT1 and VEGFA, alongside reduced levels of miR-299-3p, in glioma cell lines T98G and U251. Knockdown of WARS2-IT1 upregulated miR-299-3p and downregulated VEGFA, thereby inhibiting cell proliferation and promoting apoptosis. These findings support the oncogenic function of WARS2-IT1 and reveal its additional role in modulating endothelial angiogenesis. Silencing lncRNA WARS2-IT1 via shRNA significantly reduced endothelial cell proliferation, migration, and angiogenic capacity. Therefore, these findings suggest that WARS2-IT1 has a critical pathological role in glioma by suppressing miR-299-3p expression and enhancing VEGFA expression. Increasing evidence indicates that lncRNA WARS2-IT1 commonly functions as a miRNA sponge, attenuating miRNA activity during tumorigenesis. In this study, bioinformatic analysis revealed that WARS2-IT1 harbors a complementary binding sequence for miR-299-3p, a finding validated by dual-luciferase reporter assays. miR-299-3p was also shown to directly bind the 3′-UTR of VEGFA, and its mimics significantly suppressed luciferase activity of the WARS2-IT1-WT construct. Importantly, WARS2-IT1 knockdown inhibited glioma cell proliferation and angiogenesis through upregulation of miR-299-3p. Collectively, these results support a regulatory axis in which WARS2-IT1 modulates glioma progression by sponging miR-299-3p and thereby promoting VEGFA-mediated proliferative and angiogenic signaling. Current studies have confirmed that the PI3K/AKT signaling pathway is critically involved in cancer initiation and progression. This pathway is frequently activated in tumor cells and is also triggered in endothelial cells upon VEGF binding to its receptors, promoting endothelial migration. In glioma, PI3K/AKT activation enhances VEGF secretion and further modulates the expression of additional angiogenic factors, including nitric oxide and angiopoietin mutations, which can synergistically increase the activity of VEGF promoter in glioma cells, so as to promote glioma angiogenesis [38]. Further studies have found that lncRNA can regulate tumor angiogenesis by affecting PI3K / AKT signaling pathway, for example, HNF1A-AS1 functions as a ceRNA that promotes metastasis and angiogenesis in gastric cancer by activating the PI3K/AKT signaling pathway through sponging of miR-30b-3p, providing novel insights into the gastric cancer molecular mechanisms [39]. In gliomas, many studies have found that lncRNA can regulate the angiogenesis of gliomas by affecting the downstream PI3K / AKT signaling pathway. Yarmishyn et al. [40] reported that the lncRNA SPRY4-IT1 promotes angiogenesis in glioma by activating the PI3K/AKT signaling pathway. Domestic scholars Wang et al. [41] indicated that lncRNA MCM3AP-AS1 promotes angiogenesis in glioblastoma by functioning as a ceRNA that activates the downstream PI3K/AKT signaling pathway. Sun et al. [12] also found that lncRNA CCAT2 can affect the downstream PI3K / AKT signaling pathway and regulate glioma angiogenesis through the mechanism of ceRNA. Despite accumulating evidence implicating lncRNAs in glioma progression, the specific signaling pathway through which WARS2-IT1 exerts its effects remained unclear. In this study, we employed shRNA-mediated knockdown of WARS2-IT1 along with miR-299-3p mimics and inhibitors to elucidate the underlying mechanism. Western blot analysis revealed that knockdown of lncRNA WARS2-IT1 significantly altered p-PI3K and p-AKT expressions, indicating that WARS2-IT1 regulates glioma cells via the PI3K/AKT signaling pathway. After transfection of sh lncRNA WARS2-IT1 or miR-299-3p mimics, the expression of proliferation related proteins MMP-2 and MMP-9, apoptosis related proteins Bcl-2, angiogenesis related proteins VEGFA and CD34 decreased significantly, while the expression of apoptosis related proteins Bax, caspase-3 and caspase-7 increased, while related protein expression trend was opposite after transfection of mirna-299-3p inhibitors. As outlined above, our study revealed that lncRNA WARS2-IT1 and VEGFA are overexpressed, while miR-299-3p is downregulated in glioma, and established the functional interplay among WARS2-IT1, miR-299-3p, and VEGFA in regulating glioma cell proliferation, migration, and angiogenesis. Collectively, these findings demonstrate that the PI3K/AKT signaling pathway mediates the functional role of lncRNA WARS2-IT1 in glioma. This study further elucidates the molecular mechanism and regulatory network of WARS2-IT1, offering potential avenues for improved diagnosis and therapeutic targeting in glioma. Nonetheless, certain limitations remain regarding the detailed molecular mechanisms involved. Future studies will aim to expand upon these findings through clinical investigation of the molecular outcomes implicated in this pathway. CONCLUSION In conclusion, our study demonstrated the present study indicated that WARS2-IT1 was a potential oncogene, which could increase the level of VEGF and induce glioma cell proliferation, angiogenesis and migration through miR-299-3p. Both in vitro and in vivo experiments demonstrated that the WARS2-IT1/miR-299-3p/VEGFA axis has a critical role in regulating angiogenesis in glioblastoma (GBM). Moreover, the PI3K/AKT signaling pathway was confirmed as a key mediator of WARS2-IT1’s function in glioma. Collectively, these findings provide a novel conceptual and experimental framework for understanding GBM angiogenesis. Importantly, the WARS2-IT1/miR-299-3p/VEGFA axis may represent a promising therapeutic target for anti-angiogenic strategies in glioma. Declarations Funding support: Key Project of Jiangxi Natural Science Foundation, NO.20212ACB206015. National Natural Science Foundation of China, Regional Project, NO.82260525. Author Contribution Mingbin Hu：Lead all experimental projects, article writing, and main contributors of this study.Weiguo Gu：All data analysis, table drawing, and chart creation for the article.Yajun Huai：Participate in the formatting writing, article review, and formatting correction of this article.Chunliang Wang：The research idea design of this article, the design purpose of each experiment, and the project application.Jinhong Mei：The project leader of the article, the important designer of the project, the final reviewer of the article, and the result reviewer of all experiments. References Goldman S, Onar-Thomas A, Dunkel I, et al. Abstract CT051: Tumor treating fields in pediatric recurrent high-grade glioma and ependymoma[J]. Cancer Research, 2017, 77(13 Supplement):CT051 -CT051. Tran K, Brice R, Yao L. Bioscaffold-based study of glioblastoma cell behavior and drug delivery for tumor therapy. Neurochem Int. 2021 Jul;147:105049. Bush NA, Chang SM, Berger MS. Current and future strategies for treatment of glioma. Neurosurg Rev. 2017 Jan;40(1):1-14. Wick W, Gorlia T, Bendszus M, et al. Lomustine and Bevacizumab in Progressive Glioblastoma. N Engl J Med. 2017 Nov 16;377(20):1954-1963. Ma H, Weng F, Tong X, Li H, Yao Y, Yuan J. LncRNA TRPM2-AS promotes endometrial carcinoma progression and angiogenesis via targeting miR-497-5p/SPP1 axis. Cell Mol Biol Lett. 2024 Jul 2;29(1):93 Chang L, Ding J, Pu J, Zhu J, Zhou X, Luo Q, Li J, Qian M, Lin S, Li J, Wang K. A novel lncRNA LOC101928222 promotes colorectal cancer angiogenesis by stabilizing HMGCS2 mRNA and increasing cholesterol synthesis. J Exp Clin Cancer Res. 2024 Jul 4;43(1):185. Zhang X, Sun S, Pu JK, Tsang AC, Lee D, Man VO, et al. Long non-coding RNA expression profiles predict clinical phenotypes in glioma. Neurobiol Dis. 2012 Oct;48(1): 1-8. Wu Y, Qian Z. Long non-coding RNAs (lncRNAs) and microRNAs regulatory pathways in the tumorigenesis and pathogenesis of glioma. Discov Med. 2019 Sep;28(153):129-138. Han M, Wang S, Fritah S, Wang X, Zhou W, Yang N, et al. Interfering with long non-coding RNA MIR22HG processing inhibits glioblastoma progression through suppression of Wnt/b-catenin signalling. Brain.2020.143(2):512-530. Zhang H, Qin D, Jiang Z, Zhang J. SNHG9/miR-199a-5p/Wnt2 axis regulates cell growth and aerobic glycolysis in glioblastoma. J Neuropathol Exp Neurol.2019.78(10): 939-948. Liu ZZ, Tian YF, Wu H, Ouyang SY, Kuang WL. LncRNA H19 promotes glioma angiogenesis through miR-138/HIF-1α/VEGF axis. Neoplasma. 2020 Jan;67(1):111-118. Hu Y, Zhang Y, Ding M, Xu R. Long noncoding RNA TMPO-AS1/miR-126-5p/BRCC3 axis accelerates gastric cancer progression and angiogenesis via activating PI3K/Akt/mTOR pathway. J Gastroenterol Hepatol. 2021 Jul;36(7):1877-1888. Theisen BE, Rumyantseva A, Cohen JS, et al. Deficiency of WARS2, encoding mitochondrial tryptophanyl tRNA synthetase, causes severe infantile onset leukoencephalopathy. Am J Med Genet A. 2017 Sep;173(9):2505-2510. Wang M, Sips P, Khin E, Rotival M, Sun X, et al. Wars2 is a determinant of angiogenesis. Nat Commun. 2016 Jul 8;7:12061. Tsikrika FD, Avgeris M, Levis PK, Tokas T, Stravodimos K, Scorilas A. miR-221/222 cluster expression improves clinical stratification of non-muscle invasive bladder cancer (TaT1) patients' risk for short-term relapse and progression. Genes Chromosomes Cancer. 2018 Mar;57(3):150-161. Dixon-McIver A, East P, Mein CA, Cazier JB, Molloy G, Chaplin T, et al. Distinctive patterns of microRNA expression associated with karyotype in acute myeloid leukaemia. PLoS One. 2008 May 14;3(5):e2141. Guo J, Gan Q, Gan C, Zhang X, Ma X, Dong M. LncRNA MIR205HG regulates melanomagenesis via the miR-299-3p/VEGFA axis. Aging (Albany NY). 2021 Feb 1;13(4):5297-5311. Wang JY, Jiang JB, Li Y, Wang YL, Dai Y. MicroRNA-299-3p suppresses proliferation and invasion by targeting VEGFA in human colon carcinoma. Biomed Pharmacother. 2017 Sep;93:1047-1054. Cai H, Liu X, Zheng J, Xue Y, Ma J, Li Z, Xi Z, Li Z, Bao M, Liu Y. Long non-coding RNA taurine upregulated 1 enhances tumor-induced angiogenesis through inhibiting microRNA-299 in human glioblastoma. Oncogene. 2017 Jan 19;36(3):318-331. Trevisan E, Bertero L, Bosa C, Magistrello M, Pellerino A, Rudà R, Soffietti R. Antiangiogenic therapy of brain tumors: the role of bevacizumab. Neurol Sci. 2014 Apr;35(4):507-14. Ma X, Li Z, Li T, Zhu L, Li Z, Tian N. Long non-coding RNA HOTAIR enhances angiogenesis by induction of VEGFA expression in glioma cells and transmission to endothelial cells via glioma cell derived-extracellular vesicles. Am J Transl Res. 2017 Nov 15;9(11):5012-5021. Peng C, Chen H, Li Y, Yang H, Qin P, Ma B, Duan Q, Wang B, Mao F, Guo D. LRIG3 Suppresses Angiogenesis by Regulating the PI3K/AKT/VEGFA Signaling Pathway in Glioma. Front Oncol. 2021 Feb 25;11:621154. Chen Q, Han B, Meng X, Duan C, Yang C, Wu Z, et al. Immunogenomic Analysis Reveals LGALS1 Contributes to the Immune Heterogeneity and Immunosuppression in Glioma. Int J Cancer, 2019, 145(2): 517 - 530. Lapointe S, Perry A, Butowski NA. Primary Brain Tumours in Adults. Lancet, 2018, 392(10145): 432 - 446. Shi J, Dong B, Cao J, Mao Y, Guan W, Peng Y, Wang S. Long non-coding RNA in glioma: signaling pathways. Oncotarget. 2017 Apr 18;8(16):27582-27592. Chen S, Tu S, Huang Y, Lin H, Wang Y, Dai X. LncRNA MKLN1-AS promotes glioma tumorigenesis and growth via activating the Hippo pathway through miR-126-5p/TEAD1 axis. Naunyn Schmiedebergs Arch Pharmacol. 2025 Jun;398(6):6787-6799. Cheng Z, Li Z, Ma K, Li X, Tian N, Duan J, Xiao X, et al. Long Non-coding RNA XIST Promotes Glioma Tumorigenicity and Angiogenesis by Acting as a Molecular Sponge of miR-429. J Cancer. 2017 Nov 6;8(19):4106-4116. Guo J, Cai H, Zheng J, Liu X, Liu Y, Ma J, et al. Long non-coding RNA NEAT1 regulates permeability of the blood-tumor barrier via miR-181d-5p-mediated expression changes in ZO-1, occludin, and claudin-5. Biochim Biophys Acta Mol Basis Dis. 2017 Sep;1863(9): 2240-2254. Li CH, Chen Y. Insight into the role of long noncoding RNA in Cancer development and progression. Int Rev Cell Mol Biol. 2016;326:33–65. Lorenzi L, Avila Cobos F, Decock A, Everaert C, Helsmoortel H, Lefever S, et al. Long noncoding RNA expression profiling in cancer: Challenges and opportunities. Genes Chromosomes Cancer. 2019 Apr;58(4):191-199. Liu L, Xu Q, Xiong Y, Deng H, Zhou J. LncRNA LINC01094 contributes to glioma progression by modulating miR-224-5p/CHSY1 axis. Hum Cell. 2022 Jan;35(1):214-225. Wu W, Yu T, Wu Y, Tian W, Zhang J, Wang Y. The miR155HG/miR-185/ANXA2 loop contributes to glioblastoma growth and progression. J Exp Clin Cancer Res. 2019 Mar 21;38(1):133. Zhao H, Wang Y, Liang C, Xie M. LncRNA FOXD3-AS1/miR-128-3p axis-mediated IGF2BP3 in glioma stimulates cancer angiogenesis and progression. Folia Neuropathol. 2023;61(2):168-184. Salmena L, Poliseno L, Tay Y, Kats L, Pandolfi PP. A ceRNA hypothesis: the Rosetta Stone of a hidden RNA language? Cell. 2011 Aug 5;146(3):353-358. Yin D, Lu X. Silencing of long non-coding RNA HCP5 inhibits proliferation, invasion, migration, and promotes apoptosis via regulation of miR-299-3p/SMAD5 axis in gastric cancer cells. Bioengineered. 2021 Dec;12(1):225-239. Mu B, Lv C, Liu Q, Yang H. Long non-coding RNA ZEB1-AS1 promotes proliferation and metastasis of hepatocellular carcinoma cells by targeting miR-299-3p/E2F1 axis. J Biochem. 2021 Sep 22;170(1):41-50. Liu L, Li Y, Zhang R, Li C, Xiong J, Wei Y. MIR205HG acts as a ceRNA to expedite cell proliferation and progression in lung squamous cell carcinoma via targeting miR-299-3p/MAP3K2 axis. BMC Pulm Med. 2020 Jun 8;20(1):163. Pore N, Liu S, Haas-Kogan D A, O’Rourke D M, and Maity A. PTEN mutation and epidermal growth factor receptor activation regulate vascular endothelial growth factor (VEGF) mRNA expression in human glioblastoma cells by transactivating the proximal VEGF promoter. Cancer Res, 2003,63, 236–241. Liu HT, Ma RR, Lv BB, Zhang H, Shi DB, Guo XY, Zhang GH, Gao P. LncRNA-HNF1A-AS1 functions as a competing endogenous RNA to activate PI3K/AKT signalling pathway by sponging miR-30b-3p in gastric cancer. Br J Cancer. 2020 Jun;122(12):1825-1836. Yarmishyn AA, Batagov AO, Tan JZ, Sundaram GM, Sampath P, Kuznetsov VA, et al. HOXD-AS1 is a novel lncRNA encoded in HOXD cluster and a marker of neuroblastoma progression revealed via integrative analysis of noncoding transcriptome. BMC Genomics. 2014;15 Suppl 9(Suppl 9):S7. Wang J, Chen Y, Wang Q, Xu H, Jiang Q, Wang M, Li S, Chen Y, Wu C, Yu P, Xiao Z, Chen W, Lan Q. LncRNA SPRY4-IT1 facilitates cell proliferation and angiogenesis of glioma via the miR-101-3p/EZH2/VEGFA signaling axis. Cancer Med. 2023 Mar;12(6):7309-7326. Tables Table 1 Primers used for qRT-PCR analysis lncRNA WARS2-IT1 Forward 5’-AAC TTG TTG GGA CCT GGA GCA AAG-3’ Reverse 5’-AAT CTC TAG GGC AGG GGC AAA ATG-3’ GADPH Forward 5’-GUA UGA CAA CAG CCU CAA GTT-3’ Reverse 5’-CUU GAG GCU GUU GUC AUA CTT-3’ miRNA-299-3p Forward 5'‐CGCGTATGTGGGATGGTAAA‐3' Reverse 5'‐AGTGCAGGGTCCGAGGTATT‐3' Stem-loop Primer 5'‐GTCGTATCCAGTGCAGGGTCCGAGGTATTC GCACTGGATACGACAAGCGG‐3' U6 Forward 5'‐AGGGGCAGGGACGGG‐3' Reverse 5'‐TGGTGTCGTGGAGTCG‐3' Stem-loop Primer 5'‐CTCAACTGGTGTCGTGGAGTCGGCAATTCA GTTGAGGGGCCA‐3' Table 2. Relationship between AFAP1-AS1 expression and the clinical pathological characteristics Clinical pathological features WARS2-IT1 expression Number of Cases P value Low expression (< median) High expression ( 60 19 16 35 Gender 52 0.508 Male 13 10 23 Female 16 13 29 Grade 52 0.037* WHO I-II 4 10 14 WHO III-IV 25 13 38 Tumor size 52 0.003* ≥ 5cm 23 9 32 < 5cm 6 14 20 KPS 52 0.017* ≥ 70 15 20 35 < 70 14 3 17 Tumor location 52 0.554 Left brain 15 10 25 Right brain 14 13 27 Cumulative lobe 52 0.140 Single lobe 23 12 35 Multiple lobes 6 11 17 Note : KPS: Karnofsky functional status score, * p<0.05； Additional Declarations No competing interests reported. Supplementary Files graphicalabstract.docx Cite Share Download PDF Status: Published Journal Publication published 01 Aug, 2025 Read the published version in Cytotechnology → Version 1 posted Editorial decision: Accepted 23 Jul, 2025 Reviews received at journal 22 Jul, 2025 Reviewers agreed at journal 22 Jul, 2025 Reviewers invited by journal 22 Jul, 2025 Editor assigned by journal 02 Jul, 2025 Submission checks completed at journal 02 Jul, 2025 First submitted to journal 02 Jul, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7026304","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":489716100,"identity":"75c9a0eb-1abb-4d59-a681-c3d7a5474cb7","order_by":0,"name":"Mingbin Hu","email":"","orcid":"","institution":"Th e First Affiliated Hospital of Nanchang University","correspondingAuthor":false,"prefix":"","firstName":"Mingbin","middleName":"","lastName":"Hu","suffix":""},{"id":489716101,"identity":"f403a23a-76aa-439e-8ba3-fe0f93c6c189","order_by":1,"name":"Weiguo Gu","email":"","orcid":"","institution":"Th e First Affiliated Hospital of Nanchang University","correspondingAuthor":false,"prefix":"","firstName":"Weiguo","middleName":"","lastName":"Gu","suffix":""},{"id":489716102,"identity":"20377529-b039-46a7-bd05-7fd8ca46f37c","order_by":2,"name":"Yajun Huai","email":"","orcid":"","institution":"Th e First Affiliated Hospital of Nanchang University","correspondingAuthor":false,"prefix":"","firstName":"Yajun","middleName":"","lastName":"Huai","suffix":""},{"id":489716103,"identity":"ca336dd3-5288-4ea2-9153-b2faad35de4e","order_by":3,"name":"Chunliang Wang","email":"","orcid":"","institution":"Th e First Affiliated Hospital of Nanchang University","correspondingAuthor":false,"prefix":"","firstName":"Chunliang","middleName":"","lastName":"Wang","suffix":""},{"id":489716104,"identity":"3fb4afd7-eb87-46ec-bced-72dba379e9d7","order_by":4,"name":"Jinhong Mei","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAuUlEQVRIiWNgGAWjYFCCMwwSYJq9sfHBBxK0GDAw8BxuNpxBnBYeqBaJ9DZpDmI06DaePXjjQ80fOfOZDxukGRjs5HQbCGgxO3Au2XLGMQNjmduJDcYFDMnGZgcIajljJs3bYJA4QzqxIXkGw4HEbcRrkTzYcJiHNC0SjI3NxGoxBvrF2FiCJ7GZcYYBMX65ccYQGGJychLsx5//+FBhJ0dQC4MEigoDQspBgL+BGFWjYBSMglEwogEAkcxE2Wi/6aUAAAAASUVORK5CYII=","orcid":"","institution":"Th e First Affiliated Hospital of Nanchang University","correspondingAuthor":true,"prefix":"","firstName":"Jinhong","middleName":"","lastName":"Mei","suffix":""}],"badges":[],"createdAt":"2025-07-02 07:23:15","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7026304/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7026304/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1007/s10616-025-00824-5","type":"published","date":"2025-08-01T16:13:37+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":87508715,"identity":"1387ec5a-08e9-44b1-98b3-e41d6394660a","added_by":"auto","created_at":"2025-07-24 15:10:53","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":239920,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eWARS2-IT1 is upregulated in glioma tissues and cells.\u003c/strong\u003e A The volcano plot of organizational sequencing results shows that WARS2-IT1 expression is upregulated in tissues. B The heatmap results of the top 50 differentially expressed RNAs in tissue sequencing showed a significant upregulation of WARS2-IT1. C Based on TCGA database from GEPIA（https://www.gepia.cancer-pku.cn/ ）Querying high expression of WARS2-IT1 in human malignant tumors on bioinformatics websites. D Retrieve high expression of WARS2-IT1 in glioma tissue from bioinformatics websites. E Compared to normal brain tissue (10 cases), WARS2-IT1 was significantly elevated in glioma tissue (52 cases) . F Compared to normal brain glial cells HEB, the expression of WARS2-IT1 is significantly increased in glioma cells(verified by log-rank test). All the measurement data were expressed as mean ± standard deviation. The comparison between two groups was analyzed by paired t-test. Data among multiple groups were compared by one-way ANOVA, followed by Tukey’s post hoc test. The experiment was repeated three times (*p \u0026lt; 0.05，**p \u0026lt; 0.001，***p \u0026lt; 0.001).\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-7026304/v1/0fa3c612be1334fc035d9791.png"},{"id":87508717,"identity":"080e7826-b1e1-4873-b79f-1cecee7c2698","added_by":"auto","created_at":"2025-07-24 15:10:53","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":276141,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eWARS2-IT1 accelerates the development of glioma in vitro.\u003c/strong\u003e A Sh-WARS2-IT1#1 showed the highest silencing interference efficiency in the constructed stable cell line T98G and cell line U251 . B The scratch test and cell migration assay results showed that silencing lncRNA WARS2-IT1 significantly inhibited the Migration ability of T98G and U251 cells . C The CCK8，Transwell invasion experiment results shows that silencing lncRNA WARS2-IT1 significantly inhibited the proliferation rate of T98G and U251 cells . D The EDU experiment results showed that silencing lncRNA WARS2-IT1 significantly inhibited the proliferation of T98G and U251 cells. E The results of Tube Formation Assay showed that silencing lncRNA WARS2-IT1 significantly inhibited tubular formation in HBMVEC cells . All the measurement data were expressed as mean ± standard deviation. The comparison between two groups was analyzed by paired t-test. Data among multiple groups were compared by one-way ANOVA, followed by Tukey’s post hoc test. The experiment was repeated three times，(*p \u0026lt; 0.05，**p \u0026lt; 0.01，***p \u0026lt; 0.001).\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-7026304/v1/52caed06c6cf9d0493e12638.png"},{"id":87509285,"identity":"010e31af-3842-4528-83e6-d80def4c4ff8","added_by":"auto","created_at":"2025-07-24 15:18:53","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":67665,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eLncRNA WARS2-IT1 is mainly localized in the cytoplasm of glioma cells. \u003c/strong\u003eA Based on lncRNA subcellular localization database lncLocator（http://www.csbio.sjtu.edu.cn/bioinf/）Prediction of subcellular localization of WARS2-IT1 in glioma using lncLocator/bioinformatics website. B The results of RNA nuclear cytoplasmic separation experiments confirm that WARS2-IT1 is mainly expressed in the cytoplasm of T98G and U251 cells （*p \u0026lt; 0.05）. All the measurement data were expressed as mean ± standard deviation. The comparison between two groups was analyzed by paired t-test. Data among multiple groups were compared by one-way ANOVA, followed by Tukey’s post hoc test. The experiment was repeated three times.\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-7026304/v1/5d59bfe03502a5ef48562407.png"},{"id":87508722,"identity":"914352f6-ff5a-4e49-a88f-1422b966a6c8","added_by":"auto","created_at":"2025-07-24 15:10:53","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":293218,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eWARS2-IT1 regulates VEGFA expression via sponging miR‑299-3p.\u003c/strong\u003e A Three circles represent the retrieval results from ENCORI and LncBase databases as well as the pre diction results, and the middle part represents the intersection (miR-299-3p, miR-3194-3p and miR-2355-5p). B Compared to normal brain tissue (10 cases), miR-299-3p was significantly reduced in glioma tissue (P\u0026lt;0.05). C Compared to normal brain glial cells HEB, the expression of miR-299-3p in cells was significantly reduced (P\u0026lt;0.05). D Screening of differentially expressed miRNAs using Venn intersection plots in various bioinformatics prediction databases, miR-299-3P showed a negative regulatory relationship with lncRNA WARS2-IT1(P\u0026lt;0.05). E The dual luciferase gene reporter experiment of T98G and U251 cell lines showed that the group co transfected with miR-299-3p and wild-type VEGFA reporter gene plasmid had the lowest fluorescence intensity(P\u0026lt;0.05). All the measurement data were expressed as mean ± standard deviation. The comparison between two groups was analyzed by paired t-test. Data among multiple groups were compared by one-way ANOVA, followed by Tukey’s post hoc test. The experiment was repeated three times，(*p \u0026lt; 0.05，**p \u0026lt; 0.01，***p \u0026lt; 0.001).\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-7026304/v1/7cfdfa23d23c4391f659f925.png"},{"id":87508726,"identity":"7ddddeb0-914c-4a0c-b47b-02e8f7351a9b","added_by":"auto","created_at":"2025-07-24 15:10:54","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":360282,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eUpregulating miR‑299-3p inhibits the migration and proliferation of glioma cells.\u003c/strong\u003e A The results of CCK8 proliferation experiment suggest that silencing miR-299-3p accelerates cell proliferation rate, while overexpression of miR-299-3p significantly inhibits cell proliferation ability. B The EDU proliferation experiment results showed that overexpression of miR-299-3p significantly inhibited the proliferation of T98G and U251 cells, while silencing miR-299-3p showed the opposite trend (P\u0026lt;0.05). C The scratch test results showed that overexpression of miR-299-3p significantly inhibited the scratch healing rate of T98G and U251 cells (P\u0026lt;0.05), while inhibition of miR-299-3p showed the opposite trend(P\u0026lt;0.05). D The Transwell migration experiment results showed that overexpression of miR-299-3p significantly inhibited the migration of T98G and U251 cells, while silencing miR-299-3p showed the opposite trend(P\u0026lt;0.05). All the measurement data were expressed as mean ± standard deviation. The comparison between two groups was analyzed by paired t-test. Data among multiple groups were compared by one-way ANOVA, followed by Tukey’s post hoc test. The experiment was repeated three times.\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-7026304/v1/1fd0b1aaf48b83e4983bcc32.png"},{"id":87509289,"identity":"1ba18bc1-eec2-4cd9-90f6-264e172d21f6","added_by":"auto","created_at":"2025-07-24 15:18:54","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":529139,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eKnockdown of WARS2-IT1 inhibits invasion and increased apoptosis of glioma cells by upregulating miR‑299-3P.\u003c/strong\u003e A Overexpression of miR-299-3p significantly promoted the proportion of T98G and U251 cell apoptosis (P\u0026lt;0.05). B The Transwell invasion experiment results showed that overexpression of miR-299-3p significantly inhibited the invasion of T98G and U251 cells, while silencing miR-299-3p showed the opposite trend (P\u0026lt;0.05).C The results of the tubular experiment showed that overexpression of miR-299-3p significantly inhibited tubular formation in HBMVEC cells (P\u0026lt;0.05), while silencing miR-299-3p showed the opposite trend (P\u0026lt;0.05). All the measurement data were expressed as mean ± standard deviation. The comparison between two groups was analyzed by paired t-test. Data among multiple groups were compared by one-way ANOVA, followed by Tukey’s post hoc test. The experiment was repeated three times.\u003c/p\u003e","description":"","filename":"6.png","url":"https://assets-eu.researchsquare.com/files/rs-7026304/v1/6aea71dc08fbf9acd1c31570.png"},{"id":87508728,"identity":"be3cdb5c-2bd1-4e4e-91bb-7a10a076c5d9","added_by":"auto","created_at":"2025-07-24 15:10:54","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":573343,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eRescue experimental verification of the effects of silencing or overexpression of miR-299-3p on glioma proliferation, invasion, migration, and angiogenesis. \u003c/strong\u003eCompared to downregulating lncRNA WARS2-IT1 alone, scratch assay (A) showed a significant decrease in the migration ability of T98G and U251 glioma cells. However, silencing miR-299-3p partially reversed the effect of downregulating lncRNA WARS2-IT1 alone on the migration ability of T98G and U251 glioma cells; (B) Transwell invasion experiments showed that the invasion ability of T98G and U251 glioma cells was significantly weakened, but silencing miR-299-3p partially reversed the effect of downregulating lncRNA WARS2-IT1 alone on the invasion ability of T98G and U251 glioma cells; (C) The tubular formation experiment showed that the tubular formation of HBMVEC in glioma cells was significantly weakened, but at the same time, silencing miR-299-3p partially reversed the effect of downregulating lncRNA WARS2-IT1 alone on the tubular formation ability of glioma endothelial cells. (D) The CCK8 proliferation experiment showed a significant decrease in the proliferation ability of T98G and U251 glioma cells, but silencing miR-299-3p partially reversed the effect of downregulating lncRNA WARS2-IT1 alone on the proliferation ability of T98G and U251 glioma cells; (E) The expression level of VEGFA protein was significantly decreased in T98G and U251 glioma cells, but silencing miR-299-3p partially reversed the effect of downregulating lncRNA WARS2-IT1 alone on the decrease in VEGFA protein expression in glioma cells. All the measurement data were expressed as mean ± standard deviation. The comparison between two groups was analyzed by paired t-test. Data among multiple groups were compared by one-way ANOVA, followed by Tukey’s post hoc test. The experiment was repeated three times.\u003c/p\u003e","description":"","filename":"7.png","url":"https://assets-eu.researchsquare.com/files/rs-7026304/v1/5ae9cf75fa04e16ba3ce1168.png"},{"id":87510278,"identity":"581b7594-792c-4d1d-a16b-54501aa235fb","added_by":"auto","created_at":"2025-07-24 15:26:54","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":362548,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eWARS2-IT1 exerts glioma promoter function through the PI3K/AKT pathway.\u003c/strong\u003e Western Blot was used to detect the effects of silencing lncRNA WARS2-IT1, miR-299-3p, and overexpression of miR-299-3p on the expression of PI3K, p-PI3K, AKT, p-AKT, Caspase3, Caspase7, Bax, Bcl-2, MMP2, MMP9, VEGFA, and CD34 proteins in T98G and U251 cells (* * P\u0026lt;0.01). NC-sh，NC-sh lncRNA WARS2-IT1； sh lncRNA，sh lncRNA WARS2-IT1.\u003c/p\u003e","description":"","filename":"8.png","url":"https://assets-eu.researchsquare.com/files/rs-7026304/v1/4cc5b04f59a3e20a56b96c38.png"},{"id":87510277,"identity":"93f5a4c8-fb94-42cd-99c7-17b5f2780262","added_by":"auto","created_at":"2025-07-24 15:26:54","extension":"png","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":373332,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSilencing WARS2-IT1 inhibits the tumorigenic ability of glioma cells in vivo.\u003c/strong\u003e A: After 27 days of vaccination, in vivo fluorescence imaging analysis was performed to detect tumor growth in each group of nude mice; B: Tumor formation status of nude mice in each group; C: Anatomical tumor images of sh lncRNA group and sh NC group animals; D: After 27 days of inoculation, the tumor time tumor volume growth curve of tumor bearing nude mice. sh lncRNA，sh lncRNA WARS2-IT1.\u003c/p\u003e","description":"","filename":"9.png","url":"https://assets-eu.researchsquare.com/files/rs-7026304/v1/cfd728a27b0db44b847854cd.png"},{"id":88268358,"identity":"6269e3a6-2d0f-4869-821e-14521994e3e3","added_by":"auto","created_at":"2025-08-04 16:51:12","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":4477990,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7026304/v1/cc7c634c-ae9a-4e03-8a3b-3c205ec8e073.pdf"},{"id":87508720,"identity":"5c7d38c2-abb4-4b31-b6de-d2798b6b0692","added_by":"auto","created_at":"2025-07-24 15:10:53","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":16441,"visible":true,"origin":"","legend":"","description":"","filename":"graphicalabstract.docx","url":"https://assets-eu.researchsquare.com/files/rs-7026304/v1/265b55b2428001b11d43dd12.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Mechanism of lncRNA WARS2-IT1 promoting angiogenesis of glioma through miR-299-3P/VEGFA axis and activating PI3K/AKT signaling pathway","fulltext":[{"header":"INTRODUCTION","content":"\u003cp\u003eGlioma is a common primary intracranial tumor with easy recurrence and poor prognosis[\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e], The five-year survival rate of patients is still less than 5% even with comprehensive treatment such as surgery, radiotherapy and chemotherapy[\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. Previous studies have shown that angiogenesis plays a key role in the occurrence, development and metastasis of glioma[\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. The expression of vascular factor is an effective target in the treatment of glioma. Bevacizumab can specifically prevent the binding of vascular endothelial growth factor and its receptor and inhibit the formation of tumor blood vessels, Relevant studies and data show that although bevacizumab can not prolong the overall survival time, it can significantly improve the quality of life of patients with advanced glioma. Bevacizumab is also the only targeted drug that can be used for glioma at present[\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. It has achieved relatively good curative effect, but more than 30% of patients still have no response to anti angiogenesis treatment at first, and eventually the relevant patients will relapse and die of the disease soon. There is evidence that the regulation of noncoding RNA plays an important role in angiogenesis, especially long-chain noncoding RNA and microRNA[\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eLong noncoding RNAs (lncRNAs), a class of noncoding transcripts exceeding 200 nucleotides in length that lack protein-coding potential and have been shown to exert essential regulatory functions in various cellular processes, including proliferation, differentiation, genomic imprinting, and immune responses [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. lncRNAs are usually located in the nucleus. It is mainly involved in transcriptional regulation and epigenetics in the nucleus [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. When lncRNAs is located in cytoplasm, such lncRNAs acts as a \"molecular sponge\" to adsorb miRNA, regulate the protein expression level of downstream coding genes through the mechanism of CeRNA, and then participate in regulating various tumor-associated biological processes [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. In glioma samples, the expression of several oncogenic lncRNA was upregulated. For example, MIR22HG is a carcinogenic lncRNAs. Knockdown of lncRNA by regulating miR-22-3p and miR-22-5p expression leads to Wnt/β-catenin pathway Inactivation, reduces cell proliferation, invasion and tumor growth in xenotransplantation model[\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. SNHG9 has also been shown to be overexpressed in glioblastoma samples, which is associated with low patient survival, SNHG9 plays a role in regulating cell growth and aerobic glycolysis through miR-199a-5p/Wnt2 axis in glioblastoma[\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. Studies have also found that lncRNA participates in the regulation of glioma angiogenesis by affecting the expression of VEGFA, lncRNA H19 in glioma cells, which could promote proliferation, migration, invasion and angiogenesis via miR-138/HIF-1α axis as a ceRNA[\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. The oncogenic LncRNA TMPO-AS1 has been closely linked to gastric cancer progression, exerting its effects by upregulating BRCC3 via miR-126-5p. This interaction activates the PI3K/AKT signaling cascade, thereby enhancing gastric cancer cell proliferation and promoting endothelial angiogenesis [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. Mitochondrial tryptophanyl-tRNA synthetase 2(Wars2) is a crucial and widely expressed enzyme that facilitates covalent attachment of tryptophan to its cognate tRNA during mitochondrial protein translation [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. \u003cem\u003eWARS2\u003c/em\u003e, encoding the L53F variant within its ATP-binding motif, exhibits reduced enzymatic activity; its inhibition in endothelial cells suppresses angiogenesis [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. WARS2-IT1 is WARS2 intronic transcript 1, at present, there is no relevant research on the lncRNA WARS2-IT1.\u003c/p\u003e\u003cp\u003emiRNAs are ~\u0026thinsp;22-nucleotide endogenous noncoding RNAs that suppress gene expression by binding target mRNAs [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. miR-299, located at 14q32, is reportedly upregulated in acute myeloid leukemia [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. Recent evidence indicates that miR-299 acts as a tumor suppressor via inhibiting cellular proliferation, migration, and invasion. Notably, miR-299-3p is regulated by lncRNAs and binds the 3\u0026prime;UTR of VEGFA mRNA, thereby modulating melanoma cell growth and invasiveness [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. miR-299-3p is downregulated in colon carcinoma tissues and cell lines and exerts its tumor-suppressive functions via targeting the 3\u0026prime;UTR of VEGFA mRNA [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. Additionally, miR-299 is reportedly downregulated in glioma tissues and is inhibited by lncRNA TUG1, which promotes angiogenesis and upregulates VEGF expression by inhibiting miR-299 [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. However, the miR-299 effect on GBM angiogenesis is still obscure.\u003c/p\u003e\u003cp\u003eAngiogenesis is a defining hallmark of cancer, including brain tumors. Angiogenesis in the central nervous system (CNS) is predominantly controlled by classical signaling pathways, notably the vascular endothelial growth factor VEGF\u0026ndash;VEGFR and angiopoietin\u0026ndash;Tie receptor systems [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. The expression level of VEGFA can be regulated by upstream molecules, such as lncRNA and miRNA, so as to affect the angiogenesis of glioma. Exosomal signaling influences glioma angiogenesis by modulating VEGFA expression within glioma cells and through transfer to endothelial cells via glioma-derived extracellular vesicles [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. Moreover, LRIG3\u0026mdash;a potential tumor suppressor\u0026mdash;has been shown to be selectively expressed in malignant tumors; in glioma cells, it downregulates VEGFA and suppresses PI3K/AKT pathway activation, thereby attenuating angiogenesis [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. It can be seen that VEGFA is an important mechanism of glioma angiogenesis by influencing the downstream PI3K/AKT signaling pathway. However, how lncRNA WARS2-IT1 regulates glioma angiogenesis through activating the downstream PI3K/AKT signaling pathway has not relate researchs.\u003c/p\u003e\u003cp\u003eThis study aimed to assess the expression profiles of lncRNA WARS2-IT1, miR-299-3p, and VEGFA in GECs and to elucidate their roles in GBM-associated angiogenesis. The interplay among these molecules was systematically investigated, confirming their collective role in regulating GBM angiogenesis. Ultimately, this study aimed to provide a foundation for the development of targeted molecular and anti-angiogenic therapies for glioma.\u003c/p\u003e"},{"header":"MATERIALS AND METHODS","content":"\u003cp\u003e\u003cstrong\u003eEthics statement \u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eInformed written consent was obtained from each partici pant prior to the study. The study protocols were approved by the Ethics Committee of First Affiliated Hospital of Nanchang University and performed in line with the Declaration of Helsinki. Animal experiments were strictly in accordance\u003c/p\u003e\n\u003cp\u003ewith the Guide for Care and Use of Laboratory Animals issued by the US National Institutes of Health. The protocol for animal experiments was approved by the Institutional Animal Care and Use Committee of First Affiliated Hospital of Nanchang University（Medical Ethics Number：（2024） \u003c/p\u003e\n\u003cp\u003eCDYFYYLK（06-021）.Animal Ethics Number：CDYFY-IACUC-202407QR205）.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCell Culture \u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eHuman brain microvascular endothelial cells (HBMVECs) were obtained from American Type Culture Collection (ATCC, Manassas, VA, USA) and cultured in endothelial cell medium (ECM; ScienCell, CA, USA) supplemented with 5% ScienCell® fetal bovine serum, endothelial cell growth supplement (ECGS, Cat. No. 1052), and penicillin/streptomycin solution (P/S, Cat. No. 0503). Cultures were maintained at 37 °C in a humid 5% CO₂ atmosphere. Human glioma cell lines (U87, U118, U251, and T98G), the normal glial cell line HEB, and HEK293T cells were obtained from Beijing BeNa Culture Collection Cell Center. All were maintained in high-glucose DMEM supplemented with 10% (FBS; Solarbio, Beijing, China) at 37 °C in 5% CO₂. Glioma cells were seeded in 10-cm Petri dishes.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCell Transfection \u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe lentivirus-based short hairpin RNA (shRNA) targeting WARS2-IT1 system was constructed utilizing GeneChem (Shanghai, China). The sequence or shRNA targeting WARS2-IT1 was as follow shRNA WARS2-IT1#1, 5′- GGAA GATAAGGGAGAGTTTGA -3′; shRNA WARS2-IT1#2, 5′- GGACAATAATGTACAGACTGA -3′; shRNA WARS2-IT1#3, 5′- GGAGCAAAGGTGACTTGT TAT -3′. The lentivirus was used to infect 293T cells (MOI = 6E+8 TU/mL), and puromycin (1 μg/mL) was used to select the stable lentivirus-based T98G, U251 infected cells. miR-299-3p mimics and inhibitors, along with corresponding negative controls (NC), were acquired from GenePharma (Shanghai, China) and transfected into T98G and U251 cells utilizing Lipofectamine 3000 (Life Technologies, USA) in Opti-MEM at 70–80% confluence. Cells were collected 48 h post-transfection. \u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eQuantitative Real-time PCR\u003c/strong\u003e \u003c/p\u003e\n\u003cp\u003eTotal RNA was extracted individually from Glioma cell or tissues and Normal glial cell or tissues with a commercial RNA preparation kit (Axygen\u003csup\u003e®\u003c/sup\u003e Scientific, Union City, CA). RNA concentration and purity were assessed utilizing a NanoDrop 2000/2000C spectrophotometer based on the A260/A280 ratio. For WARS2-IT1, cDNA was generated utilizing PrimeScript RT reagent kit (Vazyme\u003csup\u003e®\u003c/sup\u003e, #R323), For miR-299-3p analysis, miRNA-specific cDNA was synthesized utilizing stem-loop primers and SYBR\u003csup\u003e®\u003c/sup\u003e Green MicroRNA reverse Transcription Kit (Vazyme\u003csup\u003e®\u003c/sup\u003e, #MR101-01/02). \u003cstrong\u003eTable 1\u003c/strong\u003e presents the primer sequences used in reverse transcriptionquantitative PCR (RT-qPCR), The primers for WARS2-IT1 and GAPDH, miR-299-3p and U6 were synthesized by GeneChem (Shanghai, China). Expression levels of WARS2-IT1 and GAPDH were quantified utilizing the One-Step SYBR PrimeScript RT-PCR (Vazyme®, Kit Cat. No. Q341-02). The miR-299-3p and U6 expression levels were examined with miRNA Universal SYBR qPCR Master Mix Kits (Vazyme\u003csup\u003e®\u003c/sup\u003e, #MQ101-01). Relative gene expressions were estimated utilizing 2\u003csup\u003e−△△CT\u003c/sup\u003e method and normalized to the corresponding internal control levels. \u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCell Proliferation Assay \u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCell Counting Kit-8 (CCK-8, Bioss, Beijing, China) assay was conducted for the cell proliferation assay. Cells were plated in 96-well plates at the density of 2000 cells per well, then added with 10 µL of the CCK-8 solution. Cells were incubated in a humidified incubator at 37◦C for 2 h. The absorbance at 450 nm was measured with the Fisher Scientific Labserv K3 microplate reader (ThermoFisher, US).\u003c/p\u003e\n\u003cp\u003eEdU test kit was purchased from BBI LIFE SCIENCES (Sangon Biotech, Shanghai, China). Exponentially growing cells were sorted into 96-well plates, and to each group, 3 duplicated cells were set up. First, the cells were labeled with EdU reagent. 2× EdU working solution was prepared in serum-free medium. Preheat 2× EdU solution, and then add 2× EdU solution to the equal volume of medium containing experimental cells to obtain 1× EdU solution. The treated cells were incubated for 12 hours. Next, Cell immobilization and permeabilization. Add an appropriate amount of PBS containing paraformaldehyde into each well, incubate at room temperature for 15 minutes. Remove the stationary solution and wash it with PBS for three times. Then add cell permeabilization solution and incubate at room temperature for 20 minutes. PBS is washed twice to remove the washing solution. Remove the permeation buffer and wash with PBS twice. Finally, EdU detected cell proliferation. Prepare and add the reaction mixture according to the instructions, Incubate in dark for 30 minutes at room temperature. \u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCell Migration or Invasion Assay \u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eScratch test, forty-eight hours after transfection, each group of cells were sorted into 6-well plates at 5 × 10\u003csup\u003e5\u003c/sup\u003e cells/well, The fusion rate reached 100% after overnight vaccination. Use 200 μL pipette tip scratch the cell layer, Pipette tip should be perpendicular to the line drawn on the back of the plate before the experiment. After the scratch, PBS was washed 3 times, and then the fresh serum-free medium was replaced. The cells were cultured in an incubator. Then take out the cells at an appropriate time point, such as 0 and 24h, observe and measure the width of the scratch with a microscope line, and take photos. Calculate using Image J software (NIH, USA).\u003c/p\u003e\n\u003cp\u003eTranswell assay, the Transwell migration assay was performed using the 24-well transwell chamber coated with or without Matrigel, Invasion assays were performed similarly using matrigel-coated inserts (BD Bioscience, USA), without Matrigel was migration assay. Firstly, the cell suspension was prepared, before preparing the cell suspension, the cells can be starved for 12-24h and the optimal cell density was calculated and diluted. Secondly, add 600 µl medium containing 15% FBS into the lower chamber of the 24 well plate, and pay attention to avoid bubbles. Next, Incubate in 37℃ incubator for 12-48h, take out Transwell chamber and wash it twice with PBS. Gently wipe off the non migrating cells in the upper layer with a cotton swab, fix them with methanol or formaldehyde for 30 minutes, and air dry the chamber properly. Dye with 0.1% crystal violet for 30-60 min and wash with PBS for 3 times. Finally, the cells were observed in five visual fields under a 400× microscope and counted. \u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFlow cytometry analysis of cell apoptosis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAfter apoptosis treatment, cells were digested with trypsin without EDTA, and 1~5 × 10\u003csup\u003e5\u003c/sup\u003e cells were collected. The fluorescein isothiocyanate Annexin V-FITC/PI Cell Apoptosis Detection Kit (TransGen Biotech, Beijing, China) based on double staining with FITC-Annexin V and PI was applied to detect the apoptosis level. Next, add 100ul precooled 1 × Annexin V Banding Buffer and resuspend the cells, Secondly, 5ul annexin V-FITC and 5ul PI were added to each tube respectively. Finally, apoptotic cells T98G and U251 were kept on ice in the dark and assessed using a flow cytometer (FACSAria III; BD Biosciences, San Jose, CA, USA).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTube Formation Assay \u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eMix the Matrigel(BD Biosciences, Bedford, MA, United States) with serum-free medium according to 1:1 and add it into 96 well plate, then put it into the incubator for 30min to solidify. Next, the concentration of 2 × 10\u003csup\u003e5\u003c/sup\u003e/mL human brain microvascular endothelial cells(HBMEC) were added to Matrigel-coated wells which were resuspended in 100 µL complete ECM medium, repeated three wells. After incubation in CO2 incubator at 37 ℃, angiogenesis can be seen after 4 hours and the Image J software (NIH, United States) was used to measure the total tubule length and numbers of tubule branches. \u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eWestern Blot Analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTotal proteins from the cells on ice were extracted by RIPA buffer with protease inhibitors (Solarbio Science \u0026amp; Technology, Beijing, China). Electrophoresis was conducted to equal amount of protein samples (40 µg) with sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS–PAGE) and then transferred to PVDF membranes. Membranes were incubated in 5% non-fat milk dissolved in Tris-buffffered saline (TBS) containing 0.1% Tween-20 for 2 h at room temperature and then incubated with primary antibodies against VEGFA (1:500, abcam, ab185238), CD34 (1:1000, Proteintech, Chicago, United States), p-PI3K (1:500, Proteintech, Chicago, United States), p-PI3K (1:1,000, CST, EUGENE), PI3K (1:1,000, CST, EUGENE), p-AKT (1:1,000, CST, EUGENE), AKT (1:1,000, CST, EUGENE), MMP2 (1:1,000, CST, EUGENE), MMP9 (1:1,000, CST, EUGENE), Cacaspse3 (1:500, Proteintech, Chicago, United States), Cacaspse7 (1:500, Proteintech, Chicago, United States), BAX (1:500, Proteintech, Chicago, United States), Bcl2 (1:500, Proteintech, Chicago, United States) and GAPDH (1:1000, Proteintech, Chicago, United States) at 4◦C overnight. On next day, membranes were incubated with secondary antibodies (goat anti-rabbit or goat anti-mouse, 1:5000, respectively; Santa Cruz Biotechnology, Santa Cruz, CA, United States) at room temperature for 2 h. Immunoblots were visualized by enhanced chemiluminescence (ECL kit, Solarbio Science \u0026amp; Technology, Beijing, China) and scanned, calculate the integrated density values(IDV) using Image Lab software.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eReporter Vectors Construction and Luciferase Reporter Assays \u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe potential binding sites of miRNA-299-3p in WARS2-IT1 and VEGFA 3’-UTR sequences were amplified by PCR and cloned into a pmirGlo Dual-luciferase miRNA Target Expression Vector (Promega, Madison, WI, United States) to construct luciferase reporter vector (WARS2-IT1-Wt and VEGFA-Wt, GenePharma). The sequence of putative binding site was replaced as indicated (WARS2-IT1-Mut and VEGFA-Mut) to mutate the putative binding site of WARS2-IT1 or VEGFA. HEK-293T cells were seeded in 96-well plates and were co-transfected with WARS2-IT1-Wt (or WARS2-IT1-Mut) or VEGFA-Wt (or VEGFA-Mut) and miRNA-299-3p or miRNA-299-3p-NC plasmids when the conflfluence reached at 70∼80%. Dual-Luciferase reporter assay kit (Promega) was then applied to measure the luciferase activities at 48 h after the transfection.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eIn Vivo Matrigel Plug Assay \u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eBALB/c male athymic nude mice were sourced from Vital River Laboratory Animal Technology Co., Ltd. (Hunan, China) and maintained on autoclaved food and water throughout the study. In vivo, experiments were performed in compliance with institutional ethical standards and protocol for animal experiments was approved by the Institutional Animal Care and Use Committee of First Affiliated Hospital of Nanchang University（Animal Ethics Number：CDYFY-IACUC-202407QR205）.\u003c/p\u003e\n\u003cp\u003eBriefly, A cell suspension of GECs (3 × 10⁵ cells/mL in 400 µL of 80% Matrigel) was prepared and injected subcutaneously. Plugs were excised, weighed, photographed, and incubated overnight at 4 °C in 400 µL PBS to extract hemoglobin. Hemoglobin was quantified utilizing Drabkin’s reagent (Sigma) per the manufacturer’s instructions.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eStatistical Analysis \u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eQuantitative data are expressed as mean ± standard deviation (SD). Statistical analyses were performed using SPSS V.22.0, applying Student’s t-test or one-way ANOVA as appropriate. A P-value \u0026lt; 0.05 was considered statistically significant. \u003c/p\u003e"},{"header":"RESULTS","content":"\u003cp\u003e\u003cstrong\u003e1.\u003c/strong\u003e\u003cstrong\u003eWARS2-IT1 is significantly overexpressed in glioma tissues, cells and associated with poor prognosis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003eA total of 7235 differentially expressed lncRNA were analyzed after removing ineffective glioma (2 cases of low-grade and 2 cases of high-grade glioma) and 2 cases of normal brain tissue sequencing data, and the heat map of the first 50 differentially expressed lncRNA in the sequencing data was drawn based on Padj value, P value, FPKM value and |log\u003csub\u003e2\u003c/sub\u003eFC| value (\u003cstrong\u003eFig. 1\u003c/strong\u003e\u003cstrong\u003eA\u003c/strong\u003e). We chose WARS2-IT1 as the research object of this study. Further through searching the relevant GEPIA bioinformatics database, we found that its carcinogenic effect has been documented in other various cancer types except glioma (\u003cstrong\u003eFig. 1\u003c/strong\u003e\u003cstrong\u003eB\u003c/strong\u003e). Analysis utilizing GEPIA online platform (http://gepia.cancer-pku.cn/) revealed elevated WARS2-IT1 expression in the TCGA-GBM dataset (\u003cstrong\u003eFig. 1\u003c/strong\u003e\u003cstrong\u003eC\u003c/strong\u003e). Consistent with this prediction, RT-qPCR confirmed significantly increased WARS2-IT1 levels in glioma tissues (p \u0026lt; 0.05) (\u003cstrong\u003eFig. 1\u003c/strong\u003e\u003cstrong\u003eD\u003c/strong\u003e). In addition, WARS2-IT1 expression was significantly upregulated in glioma cell lines (U87, U118, U251, and T98G) relative to normal glial cell line HEB, with the highest levels observed in T98G and U251, and the lowest in U118 (all p \u0026lt; 0.05) (\u003cstrong\u003eFig. 1\u003c/strong\u003e\u003cstrong\u003eE\u003c/strong\u003e). Then, U251 and T98G cells were selected for subsequent experiments. Retrospective analysis of TCGA-LGG and TCGA-GBM cohorts indicated that patients with high WARS2-IT1 expression (n\u0026nbsp;= 254) exhibited significantly shorter disease-free survival relative to those with low expression (n\u0026nbsp;= 256). Similarly, elevated WARS2-IT1 levels were associated with reduced overall survival (\u003cstrong\u003eFig. 1\u003c/strong\u003e\u003cstrong\u003eF\u003c/strong\u003e).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eAdditionally, the association between WARS2-IT1 expression and clinicopathological features in glioma patients was evaluated. As summarized in \u003cstrong\u003eTable 2\u003c/strong\u003e, WARS2-IT1 expression showed no significant correlation with age, sex, tumor location, or lobe involvement (p \u0026gt; 0.05). However, significantly higher WARS2-IT1 levels were observed in patients with tumors \u0026ge; 5 cm, KPS scores \u0026lt; 70, or high-grade glioma (p \u0026lt; 0.05). These findings indicate that WARS2-IT1 is markedly upregulated in glioma tissues and cell lines and may contribute to its progression.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.\u003c/strong\u003e\u003cstrong\u003eKnockdown of WARS2-IT1 suppressed Glioma Cell Proliferation, Migration, Invasion and endothelial cells angiogenesis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo further elucidate the functional role of WARS2-IT1 in glioma, T98G and U251 cells were transfected with shRNAs targeting WARS2-IT1. Knockdown efficiency was validated by qRT-PCR (\u003cstrong\u003eFig. 2A\u003c/strong\u003e). As a result, Wound-Healing\u0026nbsp;Assay assaysrevealed a significant decrease in migration capacity in the sh-WARS2-IT1 group relative to sh-NC group(\u003cstrong\u003eFig. 2\u003c/strong\u003e\u003cstrong\u003eB\u003c/strong\u003e). Additionally,\u0026nbsp;CCK-8，Transwell assays demonstrated that WARS2-IT1 silencing substantially impaired the migration and invasion abilities of T98G and U251 cells (\u003cstrong\u003eFig. 2C\u003c/strong\u003e). EDU array results exposed\u0026nbsp;that\u0026nbsp;down regulation of WARS2-IT1, the proliferation ability of glioma cells T98G and U251 decreased significantly(\u003cstrong\u003eFig. 2\u003c/strong\u003e\u003cstrong\u003eD\u003c/strong\u003e).\u003c/p\u003e\n\u003cp\u003eMoreover, colony formation assays were conducted to explore the lncRNA WARS2-IT1 role in endothelial angiogenesis. The results showed that knockdown of WARS2-IT1 via shRNA significantly inhibited angiogenic activity in endothelial cells (\u003cstrong\u003eFig. 2E\u003c/strong\u003e). These findings indicate that WARS2-IT1 may act as an oncogenic regulator by enhancing endothelial cell proliferation, migration, and angiogenesis.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3.\u003c/strong\u003e\u003cstrong\u003eWARS2-IT1\u003c/strong\u003e \u003cstrong\u003eis mainly located in the cytoplasm\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWARS2-IT1 was selected from the pool of differentially expressed lncRNAs for further investigation. According to sequencing data and the UCSC Genome dataset (http://genome.ucsc.edu/), WARS2-IT1 is located on human chromosome 1 (chr1:119,047,404\u0026ndash;119,063,287) and spans 2,060 bp. The full-length sequence and predicted secondary structure of WARS2-IT1 are shown in Fig. S2A. Bioinformatic analysis using the Coding Potential Assessment Tool (CPAT; http://lilab.research.bcm.edu/cpat/) identified WARS2-IT1 as a noncoding RNA (Fig. S2B). Subcellular localization is closely linked to lncRNA function. Bioinformatic prediction utilizing lncLocator webserver (www.csbio.sjtu.edu.cn/bioinf/lncLocator) indicated that WARS2-IT1 is predominantly localized in cytoplasm (\u003cstrong\u003eFig.\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003e3\u003c/strong\u003e\u003cstrong\u003eA\u003c/strong\u003e). Additionally, nucleocytoplasmic separation\u0026nbsp;confirmed that WARS2-IT1 is\u0026nbsp;predominantly localized in cytoplasm (\u003cstrong\u003eFig.\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003e3\u003c/strong\u003e\u003cstrong\u003eB\u003c/strong\u003e). According to its localization, WARS2-IT1 may function as a ceRNA.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e4.\u003c/strong\u003e\u003cstrong\u003eWARS2-IT1 induces VEGFA expression by sponging miR‑299-3P\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo gain deeper insight into functional WARS2-IT1 mechanisms in glioma, based on previous studies, we speculate that WARS2-IT1 exerts its regulatory function via a ceRNA mechanism. We conducted the following method identify potential miRNA targets of WARS2-IT1 . Firstly, Moreover, the target miRNA related to lncRNA WARS2-IT1 and VEGFA predicted by each bioinformatics database (miRcode,http://www.mircode.org/、LncBase Predicted v.2, http://carolina.imis. athena-innovation.gr/diana_tools and StarBase,http://rna.sysu.edu.cn/encori/), and then a Venn diagram was constructed with 3 intersections (miR-299-3p, miR-3194-3p and miR-2355-5p) found (\u003cstrong\u003eFig.\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003e4A\u003c/strong\u003e). \u0026nbsp;\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eBased on TCGA database, Pearson correlation analysis demonstrated a significant corelation between WARS2-IT1 expression and the levels of miR-299-3p, miR-3194-3p, and miR-2355-5p. In these three miRNAs, miR-3194-3p was a strong positive correlation with lncRNA WARS2-IT1 in TCGA-LGG data of glioma (r = 0.122, p\u0026lt;0.01). miR-2355-5p was negative correlation with lncRNA WARS2-IT1 in TCGA-LGG data of glioma (r =\u0026minus;0.060, p＞0.05) ，just miR-299-3p was strong negative correlation with lncRNA WARS2-IT1 expression was depicted in\u003cstrong\u003e\u0026nbsp;Fig.\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003e4D\u003c/strong\u003e (Pearson r = \u0026minus;0.166, p\u0026lt;0.001).\u003c/p\u003e\n\u003cp\u003eIntegrated analysis of predictions from three bioinformatics databases identified miR-299-3p as the sole miRNA intersecting both WARS2-IT1 and VEGFA target predictions (\u003cstrong\u003eFig.\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003e4E\u003c/strong\u003e). Subsequently, RT-qPCR analysis of 52 glioma and 10 normal glial tissue samples revealed a significant downregulation of miR-299-3p in glioma tissues (p \u0026lt; 0.05; \u003cstrong\u003eFig.\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003e4B\u003c/strong\u003e), whereas WARS2-IT1 expression exhibited an opposite pattern (\u003cstrong\u003eFig.\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003e4\u003c/strong\u003e\u003cstrong\u003eE\u003c/strong\u003e). Similarly, RT-qPCR demonstrated reduced miR-299-3p levels in T98G and U251 glioma cells relative to HEB glial cells, with the SiHa cells showing the lowest miR-299-3p expression (\u003cstrong\u003eFig.\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003e4C\u003c/strong\u003e).\u0026nbsp;Given the preceding results, we hypothesized that WARS2-IT1 may directly\u0026nbsp;interact to miR-299-3p in glioma. LncBase analysis predicted complementary binding sites (\u003cstrong\u003eFig.\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003e4\u003c/strong\u003e\u003cstrong\u003eC\u003c/strong\u003e). A dual-luciferase reporter assay was conducted to confirm the interaction between WARS2-IT1 and miR-299-3p. The luciferase activity of the WARS2-IT1-WT construct was significantly suppressed by miR-299-3p mimics (p \u0026lt; 0.05), whereas the WARS2-IT1-MU construct showed no change, confirming the direct binding of WARS2-IT1 to miR-299-3p (\u003cstrong\u003eFig.\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003e4E\u003c/strong\u003e). These findings suggest that WARS2-IT1 may regulate miR-299-3p in glioma cells.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e5.WARS2-IT1 Knockdown Suppresses Glioma Cell Proliferation, Migration via Upregulation of miR-299-3p\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003eWe performed the CCK 8 cell proliferation assay (\u003cstrong\u003eFig.\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003e5\u003c/strong\u003e\u003cstrong\u003eA\u003c/strong\u003e) EDU assay(\u003cstrong\u003eFig.\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003e5\u003c/strong\u003e\u003cstrong\u003eB\u003c/strong\u003e). It was clear that the T98G, U251 cells with lncRNA knockdown WARS2-IT1 (WARS2-IT1 shRNA), overexpressed miR-299-3p (miR-299-3p mimics) revealed markedly decreased proliferation relative to its NC group. Additionally, it was evident that knockdown miR-299-3p (miR-299-3p inhibitors) resulted in the highest observed proliferation rate (p \u0026lt; 0.01), further supporting the WARS2-IT1/miR-299-3p axis role in promoting glioma cell proliferation. Next, we will explore the effects of knocking down or overexpressing miR-299-3p on the biological behavior of glioma cells. In T98G and U251 cells, cell scratch assay results showed that silencing miR-299-3p accelerated the healing rate of cell scratches, while overexpression of miR-299-3p significantly inhibited the healing rate of cell scratches (\u003cstrong\u003eFigure 5C\u003c/strong\u003e, P\u0026lt;0.05); Similarly, the results of Transwell migration chamber experiments suggest that transfection with miR-299-3p inhibitors enhances the migration ability of cells, while transfection with miR-299-3p mimetics significantly inhibits the migration ability of both glioma cells (\u003cstrong\u003eFigure 5D\u003c/strong\u003e, P\u0026lt;0.05), suggesting that miR-299-3p may inhibit the migration ability of glioma cells.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e6.\u003c/strong\u003e\u003cstrong\u003eKnockdown of WARS2-IT1 inhibits invasion\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;and increased apoptosis\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;of glioma cells by upregulating miR‑299-3P\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTranswell assays were conducted to evaluate the invasive potential of T98G and U251 cells following miR-299-3p overexpression. Both interventions significantly reduce invasion (p = 0.0085). Quantification further confirmed that invaded cells \u0026lsquo;number was significantly lower in miR-299-3p-overexpressing cells relative to NC group (p = 0.0008; \u003cstrong\u003eFig.\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003e6A\u003c/strong\u003e). The Transwell array findings indicated that compared with the miR-299-3p overexpression alone, the invasion ability of glioma cells T98G and U251 decreased significantly; However, silencing miR-299-3p at the same time partially reversed the inhibitory effect of miR-299-3p overexpression alone on the glioma proliferation cells (T98G and U251).Further, Flow cytometry (FCM) in both U251 and T98G cells revealed that WARS2-IT1 knockdown (sh-WARS2-IT1) significantly reduced apoptosis relative to sh-NC group. In contrast, miR-299-3p overexpression increased apoptosis, whereas its inhibition suppressed apoptosis relative to their respective negative controls (p \u0026lt; 0.05; \u003cstrong\u003eFig.\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003e6B\u003c/strong\u003e).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eTo further investigate the effect of WARS2-IT1/miR-299-3p/VEGFA axis on angiogenesis of HBMVECs, we knocked down WARS2-IT1 , over-expression or inhibited miR-299-3p in HBMVECs, respectively, then the conditioned culture medium was collected to culture HBMVECs to assess tube formation of HBMVECs, respectively. The results showed that WARS2-IT1 silencing \u0026nbsp;or \u0026nbsp;over-expression miR-299-3p down-regulated the tube formation of HBMVECs, whereas miR-299-3p inhibition evidently increased tube formation of HBMVECs by almost two folds, however, the combination of HBMVECs knocking down and miR-299-3p inhibition lead to a minor increase of these indexes of HBMVECs (\u003cstrong\u003eFig. 6C\u003c/strong\u003e). In all, these results indicated that WARS2-IT1 expressed in glioma might promote the tube formation of HBMVECs via sponging miR-299-3p, thus facilitating the tumorigenicity of glioma.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e7. Rescue Experiment further verificate knockdown of lncRNA WARS2-IT1 inhibits invasion\u003c/strong\u003e\u003cstrong\u003e，\u003c/strong\u003e\u003cstrong\u003eProliferation, Migration\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;and\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eendothelial angiogenesis and by upregulating miR‑299-3P.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAdditionally, We carried out the functional recovery experiment of scratch migration, CCK-8 proliferation, Transwell invasion, and tubular formation recovery experiments. The results showed that relative to downregulation of lncRNA WARS2-IT1 alone, the migration, proliferation, invasion, angiogenesis, and angiogenesis abilities of T98G and U251 glioma cells were significantly weakened; But at the same time, silencing miR-299-3p partially reversed the inhibitory effect of downregulating lncRNA WARS2-IT1 alone on the migration (\u003cstrong\u003eFig.\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003e7\u003c/strong\u003e\u003cstrong\u003eA\u003c/strong\u003e), proliferation (\u003cstrong\u003eFig.\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003e7\u003c/strong\u003e\u003cstrong\u003eD\u003c/strong\u003e), invasion (\u003cstrong\u003eFig.\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003e7\u003c/strong\u003e\u003cstrong\u003eB\u003c/strong\u003e), and angiogenesis (\u003cstrong\u003eFig.\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003e7\u003c/strong\u003e\u003cstrong\u003eC\u003c/strong\u003e) ability of T98G and U251 glioma cells. At the same time, we conducted a recovery experiment to detect the angiogenesis related protein VEGFA. Compared with downregulating lncRNA WARS2-IT1 alone, the expression of VEGFA protein in T98G and U251 glioma cells was significantly decreased; But at the same time, silencing miR-299-3p partially reversed the effect of downregulating lncRNA WARS2-IT1 alone on the decreased expression of VEGFA protein during the migration of T98G and U251 glioma cells (\u003cstrong\u003eFig.\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003e7\u003c/strong\u003e\u003cstrong\u003eE\u003c/strong\u003e)\u003c/p\u003e\n\u003cp\u003eThe CCK-8, EDU array results exposed compared with the down regulation of WARS2-IT1 alone, the proliferation ability of glioma cells T98G and U251 decreased significantly; However, silencing miR-299-3p at the same time partially reversed the inhibitory effect of down regulating WARS2-IT1 alone on glioma cells T98G and U251 proliferation, silencing miR-299-3p at the same time partially reversed the Promote apoptotic effect of down-regulating WARS2-IT1 alone on the apoptosis of glioma cells T98G and U251.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e8.\u003c/strong\u003e\u003cstrong\u003eWARS2-IT1 promotes tumor progression via the PI3K/AKT pathway\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u0026nbsp; \u0026nbsp;Then, VEGFA expression was assessed by Western blot following WARS2-IT1 knockdown combined with either miR-299-3p overexpression or inhibition. As depicted in \u003cstrong\u003eFig.\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003e8\u003c/strong\u003e, VEGFA levels were reduced in the sh-WARS2-IT1 group, with miR-299-3p overexpression further enhancing this suppression. Conversely, miR-299-3p inhibition partially rescued VEGFA expression. Furthermore, Western blotting was performed to evaluate key proteins involved in multiple regulatory pathways, including p-PI3K and p-AKT (PI3K/AKT signaling), MMP2 and MMP9 (invasion), Bcl-2, caspase-3, and caspase-7 (apoptosis), as well as CD34 (angiogenesis). As illustrated in Fig. 8, WARS2-IT1 knockdown resulted in significant reductions in p-PI3K and p-AKT protein levels in both cell lines, indicating that WARS2-IT1 exerts its regulatory effects in glioma cells via PI3K/AKT signaling pathway. After transfection of sh lncRNA WARS2-IT1 or miR-299-3p mimics, the expression of proliferation related proteins MMP-2 and MMP-9, apoptosis related proteins Bcl-2, angiogenesis related proteins VEGFA and CD34 decreased significantly, while the apoptosis-related protein expressions, Bax, caspase-3 and caspase-7 increased, while trend of related protein expression was opposite after transfection of miR-299-3p inhibitors.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e9.\u003c/strong\u003e\u003cstrong\u003eWARS2-IT1\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;Knockdown Produced the Optimum Tumor Suppressive Effect in Vivo.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe aforementioned in vitro findings indicated that lncRNA WARS2-IT1 facilitates glioma cell proliferation, angiogenesis, and invasion. To evaluate its tumor-promoting role in vivo, an orthotopic xenograft mouse model was established. T98G cells stably expressing luciferase were transfected with either sh-WARS2-IT1 or sh-NC and subsequently injected into the axillary region of nude mice. At four weeks post-inoculation, in vivo imaging system (IVIS) monitoring demonstrated reduced luciferase activity in tumors derived from shIncRNA-WARS2-IT1 cells, relative to sh-NC group (\u003cstrong\u003eFig.\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003e9\u003c/strong\u003e\u003cstrong\u003eA\u003c/strong\u003e), suggesting impaired tumor size and metastasis. As shown in \u003cstrong\u003eFig.\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003e9B\u003c/strong\u003e\u003cstrong\u003e-\u003c/strong\u003e\u003cstrong\u003eC\u003c/strong\u003e, decreased expression of lncRNA WARS2-IT1 weakened tumor growth in vivo,as compared with the controls. These results uncovered lncRNA WARS2-IT1 knockdown represses glioma development.\u003c/p\u003e\n\u003cp\u003eIn addition, IHC analysis revealed that WARS2-IT1 inhibition reduced VEGFA and CD34 staining, along with a microvessel density value (\u003cstrong\u003eFig.\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003e9\u003c/strong\u003e\u003cstrong\u003eD\u003c/strong\u003e), indicating that WARS2-IT1 modulates angiogenesis in vivo.\u003c/p\u003e"},{"header":"DISCUSSION","content":"\u003cp\u003eGlioma, which originates from glial cells or precursor cells, represents the most prevalent malignant primary tumor of CNS\u0026nbsp;[23,24]. It is distinguished by aggressive infiltration, easy recurrence and high mortality. Despite the continuous improvement of various treatment methods, including surgery, chemotherapy and radiotherapy, the overall survival time after comprehensive treatment is only 14 months\u0026nbsp;[25]. Emerging research\u0026nbsp;suggests that abnormal expression of lncRNAs and microRNAs in glioma and their interaction\u0026nbsp;may represent novel molecular targets for glioma therapy.\u0026nbsp;[26\u0026ndash;28]. VEGFA is a known important factor promoting angiogenesis, which is widely involved in the angiogenesis of a variety of tumors. As a \u0026quot;molecular sponge\u0026quot;, lncRNA adsorbs miRNA through the mechanism of ceRNA, participates in regulating VEGFA expression, and affects glioma angiogenesis. In glioma, the proliferation, invasion and angiogenesis of miR-299 / VEGF axis were significantly affected under the regulation of lncRNA TUG1[19]. In the context of emerging ceRNA frameworks implicated in tumorigenesis, we delineated a new WARS2-IT1/miR-299-3p/VEGFA axis in glioma, highlighting the potential of WARS2-IT1 as a potential biomarker of glioma.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003eIncreasing evidence has linked aberrant lncRNA expression to the development and progression of various cancers [29,\u0026nbsp;30]. Through full transcriptome sequencing of 2 normal brain tissues and 4 glioma tissues (2 low-grade and 2 high-grade gliomas), 7235 lncRNAs were detected. It was found that the expression of 3828 lncRNAs increased and 3407 lncRNAs decreased. The lncRNA WARS2-IT1 of this study was comprehensively screened. Comprehensive bioinformatics data analysis shows that WARS2-IT1 may be a new carcinogenic lncRNA, and there is no relevant research on this RNA at present. The expression of WARS2-IT1 in 52 gliomas and 10 normal brain tissues was analyzed by RT-PCR. The findings revealed that WARS2-IT1 expression levels in gliomas were significantly elevated than those in normal brain tissues (P \u0026lt; 0.05). The correlation between WARS2-IT1 and clinicopathological parameters of glioma patients was further analyzed. The study showed that wars2-it1 expression levels in glioma tissues were significantly correlated to KPS score, who grade and tumor size (P \u0026lt; 0.05). Further cell verification showed that WARS2-IT1 expression across glioma cell lines T98G, U87, U118 and U251 was significantly elevated relative to normal glioma cell line HEB (P \u0026lt; 0.05). Comprehensive relevant studies show that WARS2-IT1 plays a pivotal role in glioma initiation and progression.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp; \u0026nbsp; At present, many studies have shown that the subcellular localization and function of lncRNA have obvious specificity.Many studies have found that lncRNA is located in the nucleus. When lncRNA is located in the cytoplasm, it participates in mRNA stability, translation control and ceRNA transcriptional regulation of various solid tumors [31].\u0026nbsp;Recent studies have demonstrated that lncRNAs can function as a molecular miRNA\u0026rsquo;s sponges, thereby modulating mRNA expression levels [32,33]. Through metal response elements (MREs), lncRNAs sequester miRNAs and prevent the suppression of downstream target mRNAs [34]. We verified that lncRNA WARS2-IT1 is mainly located in the cytoplasm through nucleocytoplasmic isolation experiment. Therefore, we hypothesized that lncRNA WARS2-IT1 may contribute in the regulation of specific miRNAs in glioma cells through the mechanism of ceRNA, so as to affect the biological behavior of glioma. We screened out miR-299-3p that has common intersection with lncRNA WARS2-IT1 and downstream target gene VEGFA through bioinformatics analysis. It was found that miR-299-3p is expressed in a variety of tumors and has common MREs with multiple lncRNAs. It participates in tumorigenesis and progression by the mechanism of ceRNA. Guo et al. [17] found that\u0026nbsp;lncRNA\u0026nbsp;MIR205HG\u0026nbsp;regulates the occurrence and development of melanoma through miR-299-3p / VEGFA axis. In the gastric cancer study [35], it was also found that\u0026nbsp;lncRNA HCP5\u0026nbsp;can serve as a miR-299-3p \u0026quot;molecular sponge\u0026quot; and affect the occurrence and development of gastric cancer by affecting the expression of downstream\u0026nbsp;SMAD5\u0026nbsp;protein. miR-299-3p also played the same effect in liver cancer [36] and lung adenocarcinoma [37]. Therefore, miR-299-3p may interfere with tumor angiogenesis by affecting the expression of downstream VEGFA.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eVEGFA is a well-established key mediator of glioma angiogenesis; however, its regulation by lncRNA WARS2-IT1 and miR-299-3p remains mainly unclear.\u0026nbsp;In this study, qRT-PCR and Western blot analyses revealed elevated expression of lncRNA WARS2-IT1 and VEGFA, alongside reduced levels of miR-299-3p, in glioma cell lines T98G and U251. Knockdown of WARS2-IT1 upregulated miR-299-3p and downregulated VEGFA, thereby inhibiting cell proliferation and promoting apoptosis. These findings support the oncogenic function of WARS2-IT1 and reveal its additional role in modulating endothelial angiogenesis. Silencing lncRNA WARS2-IT1 via shRNA significantly reduced endothelial cell proliferation, migration, and angiogenic capacity. Therefore, these findings suggest that WARS2-IT1 has a critical pathological role in glioma by suppressing miR-299-3p expression and enhancing VEGFA expression.\u003c/p\u003e\n\u003cp\u003eIncreasing evidence indicates that lncRNA WARS2-IT1 commonly functions as a miRNA sponge, attenuating miRNA activity during tumorigenesis. In this study, bioinformatic analysis revealed that WARS2-IT1 harbors a complementary binding sequence for miR-299-3p, a finding validated by dual-luciferase reporter assays. miR-299-3p was also shown to directly bind the 3\u0026prime;-UTR of VEGFA, and its mimics significantly suppressed luciferase activity of the WARS2-IT1-WT construct. Importantly, WARS2-IT1 knockdown inhibited glioma cell proliferation and angiogenesis through upregulation of miR-299-3p. Collectively, these results support a regulatory axis in which WARS2-IT1 modulates glioma progression by sponging miR-299-3p and thereby promoting VEGFA-mediated proliferative and angiogenic signaling.\u003c/p\u003e\n\u003cp\u003eCurrent studies have confirmed that the PI3K/AKT signaling pathway is critically involved in cancer initiation and progression. This pathway is frequently activated in tumor cells and is also triggered in endothelial cells upon VEGF binding to its receptors, promoting endothelial migration. In glioma, PI3K/AKT activation enhances VEGF secretion and further modulates the expression of additional angiogenic factors, including nitric oxide and angiopoietin mutations, which can synergistically increase the activity of VEGF promoter in glioma cells, so as to promote glioma angiogenesis [38].\u0026nbsp;Further studies have found that\u0026nbsp;lncRNA\u0026nbsp;can regulate tumor angiogenesis by affecting PI3K / AKT signaling pathway, for example, HNF1A-AS1 functions as a ceRNA that promotes metastasis and angiogenesis in gastric cancer by activating the PI3K/AKT signaling pathway through sponging of miR-30b-3p, providing novel insights into the gastric cancer molecular mechanisms\u0026nbsp;[39].\u0026nbsp;In gliomas, many studies have found that lncRNA can regulate the angiogenesis of gliomas by affecting the downstream PI3K / AKT signaling pathway. Yarmishyn et al. [40] reported that the lncRNA SPRY4-IT1 promotes angiogenesis in glioma by activating the PI3K/AKT signaling pathway. Domestic scholars Wang et al. [41]\u0026nbsp;indicated that lncRNA MCM3AP-AS1 promotes angiogenesis in glioblastoma by functioning as a ceRNA that activates the downstream PI3K/AKT signaling pathway. Sun et al. [12] also found that\u0026nbsp;lncRNA CCAT2 can affect the downstream PI3K / AKT signaling pathway and regulate glioma angiogenesis through the mechanism of ceRNA.\u0026nbsp;Despite accumulating evidence implicating lncRNAs in glioma progression, the specific signaling pathway through which WARS2-IT1 exerts its effects remained unclear. In this study, we employed shRNA-mediated knockdown of WARS2-IT1 along with miR-299-3p mimics and inhibitors to elucidate the underlying mechanism. Western blot analysis revealed that knockdown of lncRNA WARS2-IT1 significantly altered p-PI3K and p-AKT expressions, indicating that WARS2-IT1 regulates glioma cells via the PI3K/AKT signaling pathway. After transfection of sh lncRNA WARS2-IT1 or miR-299-3p mimics, the expression of proliferation related proteins MMP-2 and MMP-9, apoptosis related proteins Bcl-2, angiogenesis related proteins VEGFA and CD34 decreased significantly, while the expression of apoptosis related proteins Bax, caspase-3 and caspase-7 increased, while related protein expression trend was opposite after transfection of mirna-299-3p inhibitors.\u003c/p\u003e\n\u003cp\u003eAs outlined above, our study revealed that lncRNA WARS2-IT1 and VEGFA are overexpressed, while miR-299-3p is downregulated in glioma, and established the functional interplay among WARS2-IT1, miR-299-3p, and VEGFA in regulating glioma cell proliferation, migration, and angiogenesis. Collectively, these findings demonstrate that the PI3K/AKT signaling pathway mediates the functional role of lncRNA WARS2-IT1 in glioma. This study further elucidates the molecular mechanism and regulatory network of WARS2-IT1, offering potential avenues for improved diagnosis and therapeutic targeting in glioma. Nonetheless, certain limitations remain regarding the detailed molecular mechanisms involved. Future studies will aim to expand upon these findings through clinical investigation of the molecular outcomes implicated in this pathway.\u003c/p\u003e"},{"header":"CONCLUSION","content":"\u003cp\u003eIn conclusion, our study demonstrated the present study indicated that WARS2-IT1 was a potential oncogene, which could increase the level of VEGF and induce glioma cell proliferation, angiogenesis and migration through miR-299-3p. Both in vitro and in vivo experiments demonstrated that the WARS2-IT1/miR-299-3p/VEGFA axis has a critical role in regulating angiogenesis in glioblastoma (GBM). Moreover, the PI3K/AKT signaling pathway was confirmed as a key mediator of WARS2-IT1\u0026rsquo;s function in glioma. Collectively, these findings provide a novel conceptual and experimental framework for understanding GBM angiogenesis. Importantly, the WARS2-IT1/miR-299-3p/VEGFA axis may represent a promising therapeutic target for anti-angiogenic strategies in glioma.\u003c/p\u003e"},{"header":"Declarations","content":"\u003ch2\u003eFunding\u003c/h2\u003e\n\u003cp\u003esupport: Key Project of Jiangxi Natural Science Foundation, NO.20212ACB206015.\u003c/p\u003e\n\u003cp\u003eNational Natural Science Foundation of China, Regional Project, NO.82260525.\u003c/p\u003e\n\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\n\u003cp\u003eMingbin Hu：Lead all experimental projects, article writing, and main contributors of this study.Weiguo Gu：All data analysis, table drawing, and chart creation for the article.Yajun Huai：Participate in the formatting writing, article review, and formatting correction of this article.Chunliang Wang：The research idea design of this article, the design purpose of each experiment, and the project application.Jinhong Mei：The project leader of the article, the important designer of the project, the final reviewer of the article, and the result reviewer of all experiments.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n \u003cli\u003eGoldman S, Onar-Thomas A, Dunkel I, et al. Abstract CT051: Tumor treating fields in pediatric recurrent high-grade glioma and ependymoma[J]. Cancer Research, 2017, 77(13 Supplement):CT051 -CT051.\u003c/li\u003e\n \u003cli\u003eTran K, Brice R, Yao L. Bioscaffold-based study of glioblastoma cell behavior and drug delivery for tumor therapy. Neurochem Int. 2021 Jul;147:105049.\u003c/li\u003e\n \u003cli\u003eBush NA, Chang SM, Berger MS. Current and future strategies for treatment of glioma. Neurosurg Rev. 2017 Jan;40(1):1-14.\u003c/li\u003e\n \u003cli\u003eWick W, Gorlia T, Bendszus M, et al. Lomustine and Bevacizumab in Progressive Glioblastoma. N Engl J Med. 2017 Nov 16;377(20):1954-1963.\u003c/li\u003e\n \u003cli\u003eMa H, Weng F, Tong X, Li H, Yao Y, Yuan J. LncRNA TRPM2-AS promotes endometrial carcinoma progression and angiogenesis via targeting miR-497-5p/SPP1 axis. Cell Mol Biol Lett. 2024 Jul 2;29(1):93\u003c/li\u003e\n \u003cli\u003eChang L, Ding J, Pu J, Zhu J, Zhou X, Luo Q, Li J, Qian M, Lin S, Li J, Wang K. A novel lncRNA LOC101928222 promotes colorectal cancer angiogenesis by stabilizing HMGCS2 mRNA and increasing cholesterol synthesis. J Exp Clin Cancer Res. 2024 Jul 4;43(1):185.\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eZhang X, Sun S, Pu JK, Tsang AC, Lee D, Man VO, et al. Long non-coding RNA expression profiles predict clinical phenotypes in glioma. Neurobiol Dis. 2012 Oct;48(1): 1-8.\u003c/li\u003e\n \u003cli\u003eWu Y, Qian Z. Long non-coding RNAs (lncRNAs) and microRNAs regulatory pathways in the tumorigenesis and pathogenesis of glioma. Discov Med. 2019 Sep;28(153):129-138.\u003c/li\u003e\n \u003cli\u003eHan M, Wang S, Fritah S, Wang X, Zhou W, Yang N, et al. Interfering with \u0026nbsp;long non-coding RNA MIR22HG processing inhibits glioblastoma progression through suppression of Wnt/b-catenin signalling. Brain.2020.143(2):512-530.\u003c/li\u003e\n \u003cli\u003eZhang H, Qin D, Jiang Z, Zhang J. SNHG9/miR-199a-5p/Wnt2 axis regulates cell growth and aerobic glycolysis in glioblastoma. J Neuropathol Exp Neurol.2019.78(10): 939-948.\u003c/li\u003e\n \u003cli\u003eLiu ZZ, Tian YF, Wu H, Ouyang SY, Kuang WL. LncRNA H19 promotes glioma angiogenesis through miR-138/HIF-1\u0026alpha;/VEGF axis. Neoplasma. 2020 Jan;67(1):111-118.\u003c/li\u003e\n \u003cli\u003eHu Y, Zhang Y, Ding M, Xu R. Long noncoding RNA TMPO-AS1/miR-126-5p/BRCC3 axis accelerates gastric cancer progression and angiogenesis via activating PI3K/Akt/mTOR pathway. J Gastroenterol Hepatol. 2021 Jul;36(7):1877-1888.\u003c/li\u003e\n \u003cli\u003eTheisen BE, Rumyantseva A, Cohen JS, et al. Deficiency of WARS2, encoding mitochondrial tryptophanyl tRNA synthetase, causes severe infantile onset leukoencephalopathy. Am J Med Genet A. 2017 Sep;173(9):2505-2510.\u003c/li\u003e\n \u003cli\u003eWang M, Sips P, Khin E, Rotival M, Sun X, et al. Wars2 is a determinant of angiogenesis. Nat Commun. 2016 Jul 8;7:12061.\u003c/li\u003e\n \u003cli\u003eTsikrika FD, Avgeris M, Levis PK, Tokas T, Stravodimos K, Scorilas A. miR-221/222 cluster expression improves clinical stratification of non-muscle invasive bladder cancer (TaT1) patients\u0026apos; risk for short-term relapse and progression. Genes Chromosomes Cancer. 2018 Mar;57(3):150-161.\u003c/li\u003e\n \u003cli\u003eDixon-McIver A, East P, Mein CA, Cazier JB, Molloy G, Chaplin T, et al. Distinctive patterns of microRNA expression associated with karyotype in acute myeloid leukaemia. PLoS One. 2008 May 14;3(5):e2141.\u003c/li\u003e\n \u003cli\u003eGuo J, Gan Q, Gan C, Zhang X, Ma X, Dong M. LncRNA MIR205HG regulates melanomagenesis via the miR-299-3p/VEGFA axis. Aging (Albany NY). 2021 Feb 1;13(4):5297-5311.\u003c/li\u003e\n \u003cli\u003eWang JY, Jiang JB, Li Y, Wang YL, Dai Y. MicroRNA-299-3p suppresses proliferation and invasion by targeting VEGFA in human colon carcinoma. Biomed Pharmacother. 2017 Sep;93:1047-1054.\u003c/li\u003e\n \u003cli\u003eCai H, Liu X, Zheng J, Xue Y, Ma J, Li Z, Xi Z, Li Z, Bao M, Liu Y. Long non-coding RNA taurine upregulated 1 enhances tumor-induced angiogenesis through inhibiting microRNA-299 in human glioblastoma. Oncogene. 2017 Jan 19;36(3):318-331.\u003c/li\u003e\n \u003cli\u003eTrevisan E, Bertero L, Bosa C, Magistrello M, Pellerino A, Rud\u0026agrave; R, Soffietti R. Antiangiogenic therapy of brain tumors: the role of bevacizumab. Neurol Sci. 2014 Apr;35(4):507-14.\u003c/li\u003e\n \u003cli\u003eMa X, Li Z, Li T, Zhu L, Li Z, Tian N. Long non-coding RNA HOTAIR enhances angiogenesis by induction of VEGFA expression in glioma cells and transmission to endothelial cells via glioma cell derived-extracellular vesicles. Am J Transl Res. 2017 Nov 15;9(11):5012-5021.\u003c/li\u003e\n \u003cli\u003ePeng C, Chen H, Li Y, Yang H, Qin P, Ma B, Duan Q, Wang B, Mao F, Guo D. LRIG3 Suppresses Angiogenesis by Regulating the PI3K/AKT/VEGFA Signaling Pathway in Glioma. Front Oncol. 2021 Feb 25;11:621154.\u003c/li\u003e\n \u003cli\u003eChen Q, Han B, Meng X, Duan C, Yang C, Wu Z, et al. Immunogenomic Analysis Reveals LGALS1 Contributes to the Immune Heterogeneity and \u0026nbsp;Immunosuppression in Glioma. Int J Cancer, 2019, 145(2): 517 - 530.\u003c/li\u003e\n \u003cli\u003eLapointe S, Perry A, Butowski NA. Primary Brain Tumours in Adults. Lancet, 2018, 392(10145): 432 - 446.\u003c/li\u003e\n \u003cli\u003eShi J, Dong B, Cao J, Mao Y, Guan W, Peng Y, Wang S. Long non-coding RNA in glioma: signaling pathways. Oncotarget. 2017 Apr 18;8(16):27582-27592.\u003c/li\u003e\n \u003cli\u003eChen S, Tu S, Huang Y, Lin H, Wang Y, Dai X. LncRNA MKLN1-AS promotes glioma tumorigenesis and growth via activating the Hippo pathway through miR-126-5p/TEAD1 axis. Naunyn Schmiedebergs Arch Pharmacol. 2025 Jun;398(6):6787-6799.\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eCheng Z, Li Z, Ma K, Li X, Tian N, Duan J, Xiao X, et al. Long Non-coding RNA XIST Promotes Glioma Tumorigenicity and Angiogenesis by Acting as a Molecular Sponge of miR-429. J Cancer. 2017 Nov 6;8(19):4106-4116.\u003c/li\u003e\n \u003cli\u003eGuo J, Cai H, Zheng J, Liu X, Liu Y, Ma J, et al. Long non-coding RNA NEAT1 regulates permeability of the blood-tumor barrier via miR-181d-5p-mediated expression changes in ZO-1, occludin, and claudin-5. Biochim Biophys Acta Mol Basis Dis. 2017 Sep;1863(9): 2240-2254.\u003c/li\u003e\n \u003cli\u003eLi CH, Chen Y. Insight into the role of long noncoding RNA in Cancer development and progression. Int Rev Cell Mol Biol. 2016;326:33\u0026ndash;65.\u003c/li\u003e\n \u003cli\u003eLorenzi L, Avila Cobos F, Decock A, Everaert C, Helsmoortel H, Lefever S, et al. Long noncoding RNA expression profiling in cancer: Challenges and opportunities. Genes Chromosomes Cancer. 2019 Apr;58(4):191-199.\u003c/li\u003e\n \u003cli\u003eLiu L, Xu Q, Xiong Y, Deng H, Zhou J. LncRNA LINC01094 contributes to glioma progression by modulating miR-224-5p/CHSY1 axis. Hum Cell. 2022 Jan;35(1):214-225.\u003c/li\u003e\n \u003cli\u003eWu W, Yu T, Wu Y, Tian W, Zhang J, Wang Y. The miR155HG/miR-185/ANXA2 loop contributes to glioblastoma growth and progression. J Exp Clin Cancer Res. 2019 Mar 21;38(1):133.\u003c/li\u003e\n \u003cli\u003eZhao H, Wang Y, Liang C, Xie M. LncRNA FOXD3-AS1/miR-128-3p axis-mediated IGF2BP3 in glioma stimulates cancer angiogenesis and progression. Folia Neuropathol. 2023;61(2):168-184.\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eSalmena L, Poliseno L, Tay Y, Kats L, Pandolfi PP. A ceRNA hypothesis: the Rosetta Stone of a hidden RNA language? Cell. 2011 Aug 5;146(3):353-358.\u003c/li\u003e\n \u003cli\u003eYin D, Lu X. Silencing of long non-coding RNA HCP5 inhibits proliferation, invasion, migration, and promotes apoptosis via regulation of miR-299-3p/SMAD5 axis in gastric cancer cells. Bioengineered. 2021 Dec;12(1):225-239.\u003c/li\u003e\n \u003cli\u003eMu B, Lv C, Liu Q, Yang H. Long non-coding RNA ZEB1-AS1 promotes proliferation and metastasis of hepatocellular carcinoma cells by targeting miR-299-3p/E2F1 axis. J Biochem. 2021 Sep 22;170(1):41-50.\u003c/li\u003e\n \u003cli\u003eLiu L, Li Y, Zhang R, Li C, Xiong J, Wei Y. MIR205HG acts as a ceRNA to expedite cell proliferation and progression in lung squamous cell carcinoma via targeting miR-299-3p/MAP3K2 axis. BMC Pulm Med. 2020 Jun 8;20(1):163.\u003c/li\u003e\n \u003cli\u003ePore N, Liu S, Haas-Kogan D A, O\u0026rsquo;Rourke D M, and Maity A. PTEN mutation and epidermal growth factor receptor activation regulate vascular endothelial growth factor (VEGF) mRNA expression in human glioblastoma cells by transactivating the proximal VEGF promoter. Cancer Res, 2003,63, 236\u0026ndash;241.\u003c/li\u003e\n \u003cli\u003eLiu HT, Ma RR, Lv BB, Zhang H, Shi DB, Guo XY, Zhang GH, Gao P. LncRNA-HNF1A-AS1 functions as a competing endogenous RNA to activate PI3K/AKT signalling pathway by sponging miR-30b-3p in gastric cancer. Br J Cancer. 2020 Jun;122(12):1825-1836.\u003c/li\u003e\n \u003cli\u003eYarmishyn AA, Batagov AO, Tan JZ, Sundaram GM, Sampath P, Kuznetsov VA, et al. HOXD-AS1 is a novel lncRNA encoded in HOXD cluster and a marker of neuroblastoma progression revealed via integrative analysis of noncoding transcriptome. BMC Genomics. 2014;15 Suppl 9(Suppl 9):S7.\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eWang J, Chen Y, Wang Q, Xu H, Jiang Q, Wang M, Li S, Chen Y, Wu C, Yu P, Xiao Z, Chen W, Lan Q. LncRNA SPRY4-IT1 facilitates cell proliferation and angiogenesis of glioma via the miR-101-3p/EZH2/VEGFA signaling axis. Cancer Med. 2023 Mar;12(6):7309-7326. \u003c/li\u003e\n\u003c/ol\u003e"},{"header":"Tables","content":"\u003cp\u003e\u003cstrong\u003eTable 1\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003ePrimers used for qRT-PCR analysis\u003c/strong\u003e\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" style=\"width: 135px;\"\u003e\n \u003cp\u003elncRNA WARS2-IT1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 82px;\"\u003e\n \u003cp\u003eForward\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 333px;\"\u003e\n \u003cp\u003e5\u0026rsquo;-AAC TTG TTG GGA CCT GGA GCA AAG-3\u0026rsquo;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 82px;\"\u003e\n \u003cp\u003eReverse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 333px;\"\u003e\n \u003cp\u003e5\u0026rsquo;-AAT CTC TAG GGC AGG GGC AAA ATG-3\u0026rsquo;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" style=\"width: 135px;\"\u003e\n \u003cp\u003eGADPH\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 82px;\"\u003e\n \u003cp\u003eForward\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 333px;\"\u003e\n \u003cp\u003e5\u0026rsquo;-GUA UGA CAA CAG CCU CAA GTT-3\u0026rsquo;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 82px;\"\u003e\n \u003cp\u003eReverse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 333px;\"\u003e\n \u003cp\u003e5\u0026rsquo;-CUU GAG GCU GUU GUC AUA CTT-3\u0026rsquo;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"3\" style=\"width: 135px;\"\u003e\n \u003cp\u003emiRNA-299-3p\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 82px;\"\u003e\n \u003cp\u003eForward\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 333px;\"\u003e\n \u003cp\u003e5\u0026apos;‐CGCGTATGTGGGATGGTAAA‐3\u0026apos;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 82px;\"\u003e\n \u003cp\u003eReverse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 333px;\"\u003e\n \u003cp\u003e5\u0026apos;‐AGTGCAGGGTCCGAGGTATT‐3\u0026apos;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 82px;\"\u003e\n \u003cp\u003eStem-loop Primer\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 333px;\"\u003e\n \u003cp\u003e5\u0026apos;‐GTCGTATCCAGTGCAGGGTCCGAGGTATTC GCACTGGATACGACAAGCGG‐3\u0026apos;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"3\" style=\"width: 135px;\"\u003e\n \u003cp\u003eU6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 82px;\"\u003e\n \u003cp\u003eForward\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 333px;\"\u003e\n \u003cp\u003e5\u0026apos;‐AGGGGCAGGGACGGG‐3\u0026apos;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 82px;\"\u003e\n \u003cp\u003eReverse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 333px;\"\u003e\n \u003cp\u003e5\u0026apos;‐TGGTGTCGTGGAGTCG‐3\u0026apos;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 82px;\"\u003e\n \u003cp\u003eStem-loop Primer\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 333px;\"\u003e\n \u003cp\u003e5\u0026apos;‐CTCAACTGGTGTCGTGGAGTCGGCAATTCA GTTGAGGGGCCA‐3\u0026apos;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003cstrong\u003eTable 2.\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eRelationship between AFAP1-AS1 expression and the clinical pathological characteristics\u003c/strong\u003e\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" class=\"fr-table-selection-hover\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" style=\"width: 118px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eClinical pathological features\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" style=\"width: 223px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eWARS2-IT1 \u0026nbsp;expression\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" style=\"width: 119px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eNumber of Cases\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" valign=\"top\" style=\"width: 84px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003eP\u0026nbsp;\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003evalue\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 112px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eLow expression\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003e(\u0026lt; median)\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 112px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eHigh expression\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003e(\u0026lt; median)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 118px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eAge (years)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 112px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 112px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 119px;\"\u003e\n \u003cp\u003e52\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 84px;\"\u003e\n \u003cp\u003e0.757\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 118px;\"\u003e\n \u003cp\u003e\u0026le;\u0026nbsp;60\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 112px;\"\u003e\n \u003cp\u003e10\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 112px;\"\u003e\n \u003cp\u003e7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 119px;\"\u003e\n \u003cp\u003e17\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 84px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 118px;\"\u003e\n \u003cp\u003e\u0026gt;\u0026nbsp;60\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 112px;\"\u003e\n \u003cp\u003e19\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 112px;\"\u003e\n \u003cp\u003e16\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 119px;\"\u003e\n \u003cp\u003e35\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 84px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 118px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eGender\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 112px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 112px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 119px;\"\u003e\n \u003cp\u003e52\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 84px;\"\u003e\n \u003cp\u003e0.508\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 118px;\"\u003e\n \u003cp\u003eMale\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 112px;\"\u003e\n \u003cp\u003e13\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 112px;\"\u003e\n \u003cp\u003e10\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 119px;\"\u003e\n \u003cp\u003e23\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 84px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 118px;\"\u003e\n \u003cp\u003eFemale\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 112px;\"\u003e\n \u003cp\u003e16\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 112px;\"\u003e\n \u003cp\u003e13\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 119px;\"\u003e\n \u003cp\u003e29\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 84px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 118px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eGrade\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 112px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 112px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 119px;\"\u003e\n \u003cp\u003e52\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 84px;\"\u003e\n \u003cp\u003e0.037*\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 118px;\"\u003e\n \u003cp\u003eWHO I-II\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 112px;\"\u003e\n \u003cp\u003e4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 112px;\"\u003e\n \u003cp\u003e10\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 119px;\"\u003e\n \u003cp\u003e14\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 84px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 118px;\"\u003e\n \u003cp\u003eWHO III-IV\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 112px;\"\u003e\n \u003cp\u003e25\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 112px;\"\u003e\n \u003cp\u003e13\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 119px;\"\u003e\n \u003cp\u003e38\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 84px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 118px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eTumor size\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 112px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 112px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 119px;\"\u003e\n \u003cp\u003e52\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 84px;\"\u003e\n \u003cp\u003e0.003*\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 118px;\"\u003e\n \u003cp\u003e\u0026ge; 5cm\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 112px;\"\u003e\n \u003cp\u003e23\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 112px;\"\u003e\n \u003cp\u003e9\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 119px;\"\u003e\n \u003cp\u003e32\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 84px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 118px;\"\u003e\n \u003cp\u003e\u0026lt; 5cm\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 112px;\"\u003e\n \u003cp\u003e6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 112px;\"\u003e\n \u003cp\u003e14\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 119px;\"\u003e\n \u003cp\u003e20\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 84px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 118px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eKPS\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 112px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 112px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 119px;\"\u003e\n \u003cp\u003e52\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 84px;\"\u003e\n \u003cp\u003e0.017*\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 118px;\"\u003e\n \u003cp\u003e\u0026ge; 70\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 112px;\"\u003e\n \u003cp\u003e15\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 112px;\"\u003e\n \u003cp\u003e20\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 119px;\"\u003e\n \u003cp\u003e35\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 84px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 118px;\"\u003e\n \u003cp\u003e\u0026lt; 70\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 112px;\"\u003e\n \u003cp\u003e14\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 112px;\"\u003e\n \u003cp\u003e3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 119px;\"\u003e\n \u003cp\u003e17\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 84px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 118px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eTumor location\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 112px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 112px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 119px;\"\u003e\n \u003cp\u003e52\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 84px;\"\u003e\n \u003cp\u003e0.554\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 118px;\"\u003e\n \u003cp\u003eLeft brain\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 112px;\"\u003e\n \u003cp\u003e15\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 112px;\"\u003e\n \u003cp\u003e10\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 119px;\"\u003e\n \u003cp\u003e25\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 84px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 118px;\"\u003e\n \u003cp\u003eRight brain\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 112px;\"\u003e\n \u003cp\u003e14\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 112px;\"\u003e\n \u003cp\u003e13\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 119px;\"\u003e\n \u003cp\u003e27\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 84px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 118px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eCumulative lobe\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 112px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 112px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 119px;\"\u003e\n \u003cp\u003e52\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 84px;\"\u003e\n \u003cp\u003e0.140\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 118px;\"\u003e\n \u003cp\u003eSingle lobe\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 112px;\"\u003e\n \u003cp\u003e23\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 112px;\"\u003e\n \u003cp\u003e12\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 119px;\"\u003e\n \u003cp\u003e35\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 84px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 118px;\"\u003e\n \u003cp\u003eMultiple lobes\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 112px;\"\u003e\n \u003cp\u003e6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 112px;\"\u003e\n \u003cp\u003e11\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 119px;\"\u003e\n \u003cp\u003e17\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 84px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003eNote : KPS: Karnofsky functional status score, * p\u0026lt;0.05；\u003c/p\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"cytotechnology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"cyto","sideBox":"Learn more about [Cytotechnology](http://link.springer.com/journal/10616)","snPcode":"10616","submissionUrl":"https://submission.nature.com/new-submission/10616/3","title":"Cytotechnology","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"Glioma, lncRNA WARS2-IT1, Angiogenesis, miR-299-3p, PI3K/AKT signal pathway","lastPublishedDoi":"10.21203/rs.3.rs-7026304/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7026304/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eGlioma is a common primary intracranial tumor with easy recurrence and poor prognosis. Emerging evidence has highlighted the involvement of LncRNA in glioma proliferation, invasion, migration and angiogenesis, but at present, there is no relevant research on LncRNA WARS2-IT1. We performed qRT-PCR and Western blotting to evaluate the expression of related RNA in glioma. Cell Counting Kit-8, Scratch-healing test, Transwell, EDU test to assess the cell proliferation, migration and invasion ability in glioma and Tube formation assay contributed to endothelial cell angiogenesis. Apoptosis was measured via flow cytometry. Bioinformatics prediction and dual-luciferase reporter assays were conducted to validate the regulatory interactions in T98G and U251 cell lines. Results showed that lncRNA WARS2-IT1 and VEGFA were highly expressed in glioma cells, while miR-299-3p was enriched in normal glial HEB cells. WARS2-IT1 Knockdown significantly suppressed glioma cell proliferation, migration, invasion, and endothelial angiogenesis, while promoting apoptosis. Mechanistically, WARS2-IT1 harbored a complementary binding site for miR-299-3p, which directly targeted the 3-UTR of VEGFA. Further analysis revealed that WARS2-IT1 promotes glioma progression and angiogenesis through the PI3K/AKT signaling pathway. These findings suggest that the oncogenic lncRNA WARS2-IT1 contributes to glioma pathogenesis by upregulating VEGFA via sponging miR-299-3p, highlighting its therapeutic target potentiality.\u003c/p\u003e","manuscriptTitle":"Mechanism of lncRNA WARS2-IT1 promoting angiogenesis of glioma through miR-299-3P/VEGFA axis and activating PI3K/AKT signaling pathway","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-07-24 15:10:49","doi":"10.21203/rs.3.rs-7026304/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Accepted","date":"2025-07-23T11:19:23+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-07-22T13:31:59+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"80439870902678544131917538153638026254","date":"2025-07-22T13:19:21+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-07-22T10:40:55+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-07-02T17:50:27+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-07-02T17:48:18+00:00","index":"","fulltext":""},{"type":"submitted","content":"Cytotechnology","date":"2025-07-02T07:10:17+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"cytotechnology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"cyto","sideBox":"Learn more about [Cytotechnology](http://link.springer.com/journal/10616)","snPcode":"10616","submissionUrl":"https://submission.nature.com/new-submission/10616/3","title":"Cytotechnology","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"4a938b70-3169-4e11-bf44-a0266f1e54eb","owner":[],"postedDate":"July 24th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2025-08-04T16:45:11+00:00","versionOfRecord":{"articleIdentity":"rs-7026304","link":"https://doi.org/10.1007/s10616-025-00824-5","journal":{"identity":"cytotechnology","isVorOnly":false,"title":"Cytotechnology"},"publishedOn":"2025-08-01 16:13:37","publishedOnDateReadable":"August 1st, 2025"},"versionCreatedAt":"2025-07-24 15:10:49","video":"","vorDoi":"10.1007/s10616-025-00824-5","vorDoiUrl":"https://doi.org/10.1007/s10616-025-00824-5","workflowStages":[]},"version":"v1","identity":"rs-7026304","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7026304","identity":"rs-7026304","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}