Tumor Necrosis Factor Receptor 1-mediated Caspase-2 driven apoptosis reduces HBV DNA levels during free-fatty acid exposure in vitro | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Tumor Necrosis Factor Receptor 1-mediated Caspase-2 driven apoptosis reduces HBV DNA levels during free-fatty acid exposure in vitro Maoping Li, Kaizhong Luo, Na Qin, Yuxin Zheng, Xinqiang Xiao, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-9179452/v1 This work is licensed under a CC BY 4.0 License Status: Under Revision Version 1 posted 7 You are reading this latest preprint version Abstract Background The coexistence of chronic hepatitis B (CHB) and metabolic dysfunction–associated steatotic liver disease (MASLD) is increasingly prevalent. Clinical and experimental evidence suggests an inverse association between hepatic steatosis and hepatitis B virus (HBV) replication; however, the underlying molecular mechanisms remain poorly defined. This study aimed to investigate the effect of free fatty acid–induced steatosis on HBV replication and the associated apoptotic signaling pathways in vitro. Methods HepG2.2.15 cells, a stable HBV-producing hepatocyte cell line, were treated with a free fatty acid (FFA) mixture of sodium oleate and sodium palmitate at a 2:1 ratio to induce steatosis. Intracellular triglyceride content and Oil Red O staining were used to confirm lipid accumulation. Apoptosis was assessed by flow cytometry. The expression levels of tumor necrosis factor-alpha (TNF-α), tumor necrosis factor receptor 1 (TNFR1), Caspase-2, Caspase-8, and HBV DNA were analyzed before and after FFA treatment. Results FFA treatment induced significant lipid accumulation in HepG2.2.15 cells, accompanied by increased apoptotic cell death. Steatotic cells exhibited significantly elevated levels of TNF-α, TNFR1, Caspase-2, and Caspase-8 compared with untreated controls. In parallel, intracellular HBV DNA levels were markedly reduced following steatosis induction. Conclusions Free fatty acid–induced steatosis in HepG2.2.15 cells is associated with activation of the TNF-α/TNFR1/Caspase-8/Caspase-2 apoptotic pathway and a concomitant reduction in HBV DNA levels. These findings suggest that lipid-induced apoptosis may contribute to the suppression of HBV replication in the context of metabolic stress. Chronic Hepatitis B Metabolic Dysfunction-Associated Steatotic Liver Disease Apoptosis TNFR1 Caspase-2 Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 1. Introduction Chronic hepatitis B (CHB) remains a major global health burden, with a substantial proportion of patients progressing to liver cirrhosis or hepatocellular carcinoma (HCC) in the absence of effective viral control[ 1 ]. In parallel, the global prevalence of metabolic dysfunction–associated steatotic liver disease (MASLD) continues to rise, driven by increasing rates of obesity and metabolic syndrome[ 2 , 3 ]. As a result, the coexistence of CHB and MASLD has become increasingly common in clinical practice, particularly in Asian populations[ 4 ]. Interestingly, accumulating clinical evidence suggests that hepatic steatosis is frequently associated with lower serum HBV DNA levels and a higher probability of hepatitis B surface antigen (HBsAg) clearance[ 5 – 7 ]. These observations imply that metabolic stress within hepatocytes may exert a suppressive effect on HBV replication[ 8 , 9 ]. However, this apparent antiviral phenomenon contrasts with the well-established role of MASLD in accelerating liver fibrosis progression and increasing long-term HCC risk, highlighting a complex and incompletely understood interaction between metabolic injury and viral persistence[ 6 , 10 , 11 ]. Previous studies exploring the relationship between MASLD and HBV infection have largely focused on epidemiological associations or innate immune activation, such as toll-like receptor–mediated signaling[ 12 , 13 ]. While these immune mechanisms may contribute to viral suppression, they do not fully explain how intracellular metabolic stress directly influences HBV replication within infected hepatocytes. In particular, the role of lipotoxicity-induced cell death pathways in modulating HBV viral markers has received limited experimental attention. Lipotoxic apoptosis is a characteristic feature of MASLD and is triggered by excessive accumulation of long-chain free fatty acids (FFAs) in non-adipose tissues[ 14 , 15 ]. Among the caspase family members, Caspase-2 has emerged as a key regulator of lipid-induced apoptosis and metabolic stress responses[ 14 , 16 , 17 ]. Concurrently, tumor necrosis factor-α (TNF-α) signaling through tumor necrosis factor receptor 1 (TNFR1) is known to activate non-canonical apoptotic pathways involving Caspase-8 and Caspase-2, independent of the classical Caspase-3 cascade[ 14 , 18 , 19 ]. Elevated circulating levels of TNF-α and soluble TNFR1 have been reported in patients with MASLD and correlate with disease severity[ 20 , 21 ]. Based on these observations, we hypothesized that FFA-induced metabolic stress may activate a TNFR1–Caspase-8–Caspase-2 apoptotic axis in HBV-producing hepatocytes, thereby contributing to the reduction of HBV replication markers. To test this hypothesis, we established an in vitro steatosis model using HepG2.2.15 cells and systematically investigated the relationship between lipid accumulation, apoptotic signaling, and HBV DNA levels. 2. Materials and methods 2.1. Cell culture and FFA treatment HepG2.2.15 cells were obtained from the Cell Bank of the Chinese Academy of Sciences (Shanghai, China). The HepG2.2.15 cells were cultured in Dulbecco's Modified Eagle's Medium (DMEM, Hyclone, Shanghai, China) supplemented with 10% fetal bovine serum (Gibco, NY, USA) and 100 U/ml penicillin and streptomycin in a 37°C, 5% CO 2 humidified incubator. To prepare the free fatty acid (FFA) mixture, oleic acid and palmitic acid (Kunchuang, Xi'an, China) were combined in a 2:1 ratio. HepG2.2.15 cells were exposed to varying concentrations of FFA (0, 0.25, 0.5, and 1 mM) for 24, 48, or 72 h to induce lipid accumulation. 2.2 Cell viability assay Cell viability was measured using the MTT assay. Briefly, HepG2.2.15 cells were plated at a density of 4 × 10 3 cells per well in a 96-well plate and incubated overnight. Cells were then treated with the FFA mixture (0, 0.25, 0.5, and 1 mM) for varying times (0, 24, 48, and 72 h). After treatment, 20 µl of MTT solution (5 mg/ml) (Fdbio, Hangzhou, China) was added to each well, and the cells were incubated at 37°C for 2 h. The medium was carefully removed, and the formed crystals were dissolved in 150 µl of dimethyl sulfoxide (DMSO). Absorbance was measured at 570 nm. 2.3. Oil Red-O staining and triglyceride assay Cells were washed with PBS, fixed with 4% paraformaldehyde for 15 min, and washed. Oil Red O staining was performed for 0.5 h using a kit (Beyotime, Shanghai, China), followed by washing with PBS and microscopic observation of lipid accumulation in the cells. For quantitative assessment of lipid accumulation, Oil Red O-stained images were analyzed using ImageJ software. The RGB channels were split to isolate the red channel (Oil Red O signal), followed by thresholding to differentiate positively stained regions (lipid droplets) from the background. The lipid droplet area percentage was calculated as: (Number of positive pixels / Total cellular pixels) × 100%, with identical threshold parameters applied to all images within the same experiment. Total triglyceride levels were measured with the GPO-PAP double-reagent colorimetric method using a triglyceride assay kit (Fdbio, Hangzhou, China) following the manufacturer’s instructions. The triglyceride concentrations were normalized to the protein content. 2.4. Assessment of TNF-α and HBV-DNA HepG2.2.15 cells were seeded in a 6-well plate at a density of 1.0 × 10 5 cells per well. After 24 h, the medium was removed, and the cells were treated with different concentrations of FFA (0, 0.25, 0.5, and 1 mM) for 24, 48, or 72 h. TNF-α levels were measured in the supernatant using an enzyme-linked immunosorbent assay(Xinyu, Shanghai, China) at 450 nm, and the concentration was determined from a standard curve. Total DNA was extracted using the QIAamp DNA Mini Kit (Qiagen, Shanghai, China). HBV DNA content was quantified by real-time qPCR with SYBR Green I. The primers used for HBV DNA amplification were: 5′-GTTGCCCGTTTGTCCTCTAATTC-3′ (forward) and 5′-GGAGGGATACATAGAGGTTCCTT-3′ (reverse). 2.5. Measurement of HBsAg, HBeAg, and HBV pgRNA The levels of hepatitis B surface antigen (HBsAg) and hepatitis B e antigen (HBeAg) viral secretory proteins in the supernatant were measured using enzyme-linked immunosorbent assay (ELISA) kits from Shanghai GeHua Bio-engineering, China. HBV DNA was quantified by fluorescent quantitative PCR employing commercial kits (Sansure Biotech Inc., China). For HBV pgRNA analysis, total RNA was isolated from 200 µL samples using a magnetic bead-based kit (Sansure Biotech Inc., China) and subsequently reverse-transcribed into cDNA at 50°C for 30 minutes. The cDNA was then amplified via a PCR protocol consisting of an initial denaturation at 95°C for 2 minutes, followed by 50 cycles of denaturation at 95°C for 15 seconds and annealing/extension at 60°C for 30 seconds, with a final cooling step at 25°C for 10 seconds. Fluorescence detection was performed using the 7500 real-time PCR System (Applied Biosystems®). GAPDH served as the endogenous control for data normalization. Relative gene expression, calculated via the 2^(-ΔΔCt) method, is presented as fold-change relative to the control group. 2.6. Apoptosis assay Cells were collected using EDTA-free trypsin digestion, washed twice with PBS, and centrifuged at 2000 g for 5 min each time. The cells were then resuspended in 500 µl of Binding buffer and mixed with 5 µl of Annexin V-APC (KeyGEN, Jiangsu, China). Next, 5 µl of propidium iodide was added. After incubating samples in the dark at room temperature for 10 min, the samples were analyzed using a flow cytometer (Beckman, A00-1-1102). 2.7. Caspase-2 activity assay Caspase-2 activity was determined using a commercial assay kit (Solarbio, Beijing, China). In brief, collected cells were lysed, and the supernatant was collected after centrifugation. An equal amount of protein from the lysates was then incubated with the Caspase-2 specific substrate Ac-VDVAD-pNA at 37°C for 2–4 hours. The enzymatic activity was quantified by measuring the absorbance of the released p-nitroaniline (pNA) at 405 nm. 2.8. Western blot analysis Cells were washed with PBS buffer and total protein was extracted using RIPA lysis buffer(Thermo Fisher, Shanghai, China) following the manufacturer's instructions. Protein concentration was determined using the BCA assay (Pierce Chemicals). Protein samples (20 µg) were separated on a 10% SDS-polyacrylamide gel and transferred to a PVDF membrane (Bio-Rad). The membrane was blocked with PBS containing 0.1% Tween 20 and 5% skim milk and then incubated with antibodies against TNFR1 (Proteintech, Wuhan, China), Caspase-2 (Proteintech), or Caspase-8 (Proteintech). Detection was performed using horseradish peroxidase–conjugated secondary antibodies and enhanced chemiluminescence (Amersham Pharmacia Biotech) following the manufacturer’s protocol. Band densities were quantified using ImageJ software. 2.9. Quantitative real-time PCR Total RNA was extracted using TRIzol (Invitrogen, Carlsbad, CA, USA). The concentration and purity of the samples were assessed using a NanoDrop 2000 Micro UV-Vis Spectrophotometer (1011U, NanoDrop, USA). Primers for cDNA synthesis were designed following the instructions provided for TaqMan MicroRNA Analysis Reverse Transcription Primers (4427975, Applied Biosystems, USA) and PrimeScript RT Kit (RR047A, Takara, Japan) (Table 1 ). Real-time PCR was conducted using TaqMan Multiplex Real-Time Solution (4,461,882, Thermo Fisher Scientific, USA) on an ABI7500 Quantitative PCR System (7500, ABI, USA), with β-actin mRNA as the normalization control. Relative transcription levels of target genes were calculated using the 2-△△CT method. All experiments were performed in triplicate. Table 1 Primers for RT-PCR. Gene Species Primer (Forward:5′-3′) Primer (Reverse:5′-3′) TNFR1 human TGCCTACCCCAGATTGAGAA ATTTCCCACAAACAATGGAGTAG Caspase-2 human TGATGCCTTCTGTGAAGCAC AGGGGACAGGACTCACACAC Caspase-8 human GGATGGCCACTGTGAATAACTG TCGAGGACATCGCTCTCTCA β-actin human TAAAACGCAGCTCAGTAACAGTCGG TGCAATCCTGTGGCATCCATGAAAC TNFR1: tumor necrosis factor receptor 1 2.10. TNF-α treatment In some experiments, HepG2.2.15 cells were treated with TNF-α (20 ng/mL) (ACROBiosystems, Beijing, China) for 48 h. 2.11. TNFR1 overexpression and knockdown TNFR1 cDNA was amplified using specific primers (Forward: 5'-CCCAAGCTTATGATGGACTTGGAGTTGCCACCGC-3'; Reverse: 5'-CGGAATTCCTAGTTTTTCTTTGTATCTGGCTTC-3'). The PCR product was digested with EcoRI and HindIII and ligated into pCDNA3.1 to generate pCDNA3.1-TNFR1. The plasmid was then transiently transfected into cells using UltraFection 3.0 (4A BIOTECH, Suzhou, China) to obtain HepG2.2.15 cells with stable TNFR1 expression. SiRNA targeting TNFR1 (si-TNFR1) (Forward: 5’-GGAACCUACUUGUACAAUGACTT-3'; Reverse: 5’-GUCAUUGUACAAGGUUCCTT-3'), Caspase-2 (si-Caspase-2) (Forward: 5’-AAACAGCTGTTGTTGAGCGAA-3’; Reverse: 5’-TTTGTCGACAACAACTCGCTT-3’) and a negative control siRNA (si-NC) (5’-UUCUCCGAACGUGUCACGUTT-3’) were designed and obtained from GenePharma (Shanghai, China). si-TNFR1 and si-NC were transfected into HepG2.2.15 cells using UltraFection 3.0. After 48 h of incubation, cells were harvested for analyses. 2.12 Statistical analysis Data are expressed as mean ± Standard Error (SE). All data were statistically analyzed using GraphPad Prism V9.5. The significance of differences between two groups was assessed using a two-tailed independent samples t-test. For comparisons involving more than two groups, one-way analysis of variance (ANOVA) was used. 3. Results 3.1. FFA induces lipid accumulation HepG2.2.15 cells were incubated with different concentrations of FFA (0.25, 0.5, 1 mM) for various times (24, 48, and 72 h) to induce lipid accumulation. Oil Red O staining confirmed lipid deposition in the cells (Fig. 1 A, B). Compared with the control group, triglyceride (TG) content—expressed as millimoles per gram of cellular protein (mmol/g prot)—was markedly increased in all treatment groups. Except for the 0.25 mM FFA group, all other concentrations showed statistically significant differences versus controls (Fig. 1 C, D). MTT assays confirmed that both increasing FFA concentrations and prolonged incubation time affected cell viability (Fig. 1 E, F). Collectively, these results demonstrate that FFA treatment induces lipid accumulation in HepG2.2.15 cells, with significant TG elevation at higher FFA concentrations. 3.2. FFA upregulates TNF-α and inhibits HBV-DNA HepG2.2.15 cells were treated with different concentrations (0.25, 0.5, 1 mM) of free fatty acids (FFA) for various durations (0, 24, 48, 72 hours). The levels of HBV-DNA titers, HBsAg, and HBeAg in the cell supernatant, along with intracellular pgRNA levels and TNF-α concentration, were measured. With increasing treatment time and concentration, HBV-DNA titers in lipid-accumulated HepG2.2.15 cells demonstrated a decreasing trend (Fig. 2 A, B). Meanwhile, intracellular pgRNA levels, as well as HBsAg and HBeAg levels in the supernatant, showed a corresponding decreasing trend consistent with that of HBV-DNA (Fig. 2 C-H). Compared with the control group, TNF-α levels in the supernatant of FFA-treated cells increased in a time- and concentration-dependent manner (Fig. 2 I, J). In summary, these findings indicate that in lipid-accumulated HepG2.2.15 cells, FFA treatment reduced HBV-DNA titers, HBsAg and HBeAg levels in the supernatant, and intracellular pgRNA levels, while simultaneously increasing TNF-α levels, all in a time- and concentration-dependent manner. 3.3. Hepatic steatosis leads to apoptosis of HepG2.2.15 cells. We assessed the influence of FFA on apoptosis in HepG2.2.15 cells. Cells were exposed to different concentrations of FFA (0, 0.25, 0.5, 1 mM) for various durations (0, 24, 48, 72 h). Annexin V and PI staining was used to evaluate cell apoptosis. Cells were classified as follows: 1) live cells, negative for both Annexin V-FITC and PI; 2) early apoptotic cells, positive for Annexin V-FITC and negative for PI; 3) late apoptotic cells, positive for both Annexin V-FITC and PI; and 4) necrotic cells, positive for PI only. As shown in Fig. 3 , FFA induced apoptosis in HepG2.2.15 cells in a dose- and time-dependent manner. Compared with the control group, the cells treated with 1 mM FFA for 72 h showed a 3.9% increase in early apoptotic cells and 2.24% increase in late apoptotic cells. These findings indicate that FFA induces apoptosis in HepG2.2.15 cells. In summary, these results demonstrate that FFA induces apoptosis in HepG2.2.15 cells in a dose- and time-dependent manner, with increased early and late apoptotic cell populations observed at higher FFA concentrations and longer exposure times. 3.4. Lipid droplet accumulation in HepG2.2.15 cells regulates apoptosis through the TNFR1-mediated Caspase-2 pathway FFA at various concentrations increased the mRNA and protein levels of TNFR1, Caspase-2, and Caspase-8 in lipid-accumulated HepG2.2.15 cells compared with controls; the results showed concentration-dependent and time-dependent effects (Fig. 4 A, B, C, D). We used 1 mM FFA to incubate HepG2.2.15 cells for 48 h in subsequent experiments. To further investigate the role of TNFR1 in lipid-accumulated HepG2.2.15 cells, exogenous TNF-α (20 ng/mL) was added. We observed significant increases in TNFR1, Caspase-2, and Caspase-8 at both the mRNA and protein levels after 48 h of treatment (Fig. 4 E, F). A TNFR1 overexpression plasmid was transfected into HepG2.2.15 cells and TNFR1 was knocked down using siRNA. The efficiency of overexpression and knockdown was confirmed (Fig. 5 A, B). Transfected HepG2.2.15 cells were incubated with FFA for 48 h. In lipid-accumulated HepG2.2.15 cells overexpressing TNFR1, the levels of Caspase-2 and Caspase-8 were elevated at both mRNA and protein levels compared with controls, in contrast, incubating TNFR1 knockdown HepG2.2.15 cells with mixed fatty acids led to reduced levels of Caspase-2 and Caspase-8 (Fig. 5 C, D, E). Furthermore, we found that Caspase-2 enzymatic activity was enhanced in TNFR1-overexpressing lipid-accumulated cells, whereas the opposite effect was observed in TNFR1-knockdown cells (Fig. 5 F). In summary, these results suggest that FFA upregulates TNFR1, Caspase-2, and Caspase-8 expression in a dose- and time-dependent manner, and that TNFR1 plays a key role in regulating apoptosis in lipid-accumulated HepG2.2.15 cells, as evidenced by the modulation of Caspase-2 and Caspase-8 levels following TNFR1 overexpression or knockdown. 3.5. Knockdown of Caspase-2 reduces the apoptosis rate in HepG2.2.15 cells To further investigate the role of Caspase-2 in lipid accumulation in HepG2.2.15 cells, we knocked down Caspase-2 in HepG2.2.15 cells using siRNA, and the knockdown efficiency was confirmed (Fig. 6 A). After incubating the treated HepG2.2.15 cells with FFA for 48 hours, we assessed the apoptosis rate. Compared to the control, the apoptosis rate was reduced in Caspase-2 knockdown HepG2.2.15 cells (Fig. 6 B). In conclusion, these results suggest that Caspase-2 plays a crucial role in regulating apoptosis in HepG2.2.15 cells with lipid accumulation. 3.6. Overexpression of TNFR1 and Caspase-2 reduces HBV DNA levels in HepG2.2.15 cells, while knockdown of TNFR1 and Caspase-2 increases HBV DNA levels in HepG2.2.15 cells To investigate the relationship between HBV DNA levels and the TNFR1/Caspase-8/Caspase-2 signaling pathway, we incubated HepG2.2.15 cells with FFA for 48 hours, while overexpressing or knocking down TNFR1 or Caspase-2. We then measured the HBV DNA levels in the cell supernatants. As shown in Fig. 6 , compared to the control group, overexpression of TNFR1 resulted in a decrease in HBV DNA levels in the supernatants, while knockdown of TNFR1 or Caspase-2 led to an increase in HBV DNA levels. In summary, these results suggest that the TNFR1/Caspase-8/Caspase-2 signaling pathway regulates HBV DNA levels in HepG2.2.15 cells. 4. Discussion In the present study, we demonstrate that free fatty acid–induced steatosis suppresses HBV replication markers in HepG2.2.15 cells and is accompanied by activation of a TNFR1-mediated apoptotic signaling pathway. Specifically, lipid accumulation resulted in increased TNF-α production, upregulation of TNFR1, and activation of the Caspase-8/Caspase-2 axis, ultimately leading to enhanced apoptotic cell death and reduced HBV DNA levels. Our findings are consistent with previous clinical observations reporting an inverse association between hepatic steatosis and HBV viremia[ 6 , 8 ]. While earlier studies have proposed innate immune activation as a potential explanation for this phenomenon, our data provide experimental evidence supporting an alternative, non-immune mechanism whereby metabolic stress directly limits viral persistence through apoptosis of HBV-producing hepatocytes[ 12 , 13 ]. This mechanism may partially account for the lower viral loads observed in CHB patients with concurrent MASLD. Caspase-2 has increasingly been recognized as a critical mediator of lipotoxic apoptosis across multiple metabolic disease models[ 14 , 17 ]. In hepatocytes, excessive intracellular lipid accumulation disrupts mitochondrial function and redox homeostasis, creating a cellular environment permissive for Caspase-2 activation. Our results extend these observations by demonstrating that Caspase-2 activation in steatotic hepatocytes is functionally linked to reductions in HBV DNA levels. Importantly, genetic manipulation of Caspase-2 expression directly altered HBV DNA output, supporting a causal relationship between apoptotic signaling and viral suppression. TNF-α/TNFR1 signaling plays a central role in liver inflammation and cell fate determination[ 22 ]. Engagement of TNFR1 can initiate divergent downstream pathways, including survival signaling via NF-κB or apoptosis via formation of death-inducing signaling complexes[ 18 , 19 ]. In this study, FFA exposure shifted TNFR1 signaling toward a pro-apoptotic program involving Caspase-8 and Caspase-2. Overexpression of TNFR1 further enhanced Caspase-2 activation and reduced HBV DNA levels, whereas TNFR1 knockdown attenuated these effects, highlighting the regulatory role of this receptor in linking metabolic stress to viral control. Notably, the magnitude of HBV DNA reduction and apoptosis observed in our model was modest. This likely reflects the multifactorial nature of HBV persistence in vivo, where viral replication is influenced by host immunity, hepatocyte turnover, and metabolic status. Our in vitro system isolates a single pathway and therefore cannot fully recapitulate the complexity of chronic HBV infection. Nevertheless, the consistent directional changes observed across multiple experimental conditions underscore the biological relevance of the TNFR1–Caspase-2 axis in this context. The clinical implications of these findings warrant careful consideration. Although MASLD-associated apoptosis may contribute to reduced HBV replication, sustained lipotoxic injury is also a recognized driver of fibrosis progression and hepatocarcinogenesis[ 6 , 11 , 23 ]. Thus, metabolic stress may exert both antiviral and pro-fibrotic effects, underscoring the need for balanced therapeutic strategies in patients with CHB and MASLD. Several limitations of this study should be acknowledged. First, HepG2.2.15 cells harbor an integrated HBV genome and do not fully model the complete viral life cycle, limiting extrapolation to in vivo infection dynamics. Second, the absence of animal or clinical validation restricts our ability to assess long-term disease outcomes. Future studies incorporating physiologically relevant HBV infection models and longitudinal analyses are required to further define the role of lipotoxic apoptosis in HBV pathogenesis. In conclusion, our study identifies TNFR1-mediated Caspase-2 activation as a potential mechanistic link between metabolic stress and suppression of HBV replication. These findings provide new insight into the complex interaction between MASLD and chronic hepatitis B and highlight apoptotic signaling as a previously underappreciated regulator of viral persistence. Abbreviations ANOVA: Analysis of variance CHB: Chronic hepatitis B DMEM: Dulbecco's Modified Eagle's Medium DMSO: Dimethyl sulfoxide ELISA: Enzyme-linked immunosorbent assay FFA: Free fatty acid HBeAg: Hepatitis B e antigen HBsAg: Hepatitis B surface antigen HBV: Hepatitis B virus HCC: Hepatocellular carcinoma MASLD: Metabolic dysfunction-associated steatotic liver disease pNA: p-nitroaniline SE: Standard Error TG: Triglyceride TNF-α: Tumor necrosis factor-alpha TNFR1: Tumor necrosis factor receptor 1 Declarations Ethics approval and consent to participate Not applicable. This study was conducted in vitro using the HepG2.2.15 cell line and does not involve human participants, human data, human tissue, or animals. Consent for publication Not applicable. Availability of data and materials All data generated or analysed during this study are included in this published article and its supplementary information files. The datasets used and/or analysed during the current study are also available from the corresponding author on reasonable request. Competing interests The authors declare that they have no competing interests. Funding This study was supported by grants from the Natural Science Foundation of Hunan Province of China (2024JJ9150), Clinical Medical Research Center for Viral Hepatitis of Hunan Province (2023SK4009), and The Scientific Research Program of FuRong Laboratory (No. 2023SK2108). Authors' contributions ML collected data and drafted the manuscript. KL and XX contributed to the interpretation of the data, and the critical revision of the manuscript. YW supervised the study. YZ and NQ designed the study and revised the manuscript. All authors read and approved the final manuscript. Acknowledgements The authors would like to express their gratitude to Liwenbianji (https://www.liwenbianji.cn/) for the expert linguistic services provided. Authors' information Not applicable. References Tang LSY, Covert E, Wilson E, Kottilil S. Chronic Hepatitis B Infection: A Review. JAMA. 2018;319:1802–13. https://doi.org/10.1001/jama.2018.3795. Samuel VT, Shulman GI. Nonalcoholic Fatty Liver Disease, Insulin Resistance, and Ceramides. N Engl J Med. 2019;381:1866–9. https://doi.org/10.1056/NEJMcibr1910023. Riazi K, Azhari H, Charette JH, Underwood FE, King JA, Afshar EE, et al. The prevalence and incidence of NAFLD worldwide: a systematic review and meta-analysis. Lancet Gastroenterol Hepatol. 2022;7:851–61. https://doi.org/10.1016/S2468-1253(22)00165-0. Yang M, Wei L. Impact of NAFLD on the outcome of patients with chronic hepatitis B in Asia. Liver International. 2022;42:1981–90. https://doi.org/10.1111/liv.15252. Wang L, Wang Y, Liu S, Zhai X, Zhou G, Lu F, et al. Nonalcoholic fatty liver disease is associated with lower hepatitis B viral load and antiviral response in pediatric population. J Gastroenterol. 2019;54:1096–105. https://doi.org/10.1007/s00535-019-01594-6. Mak L-Y, Hui RW-H, Fung J, Liu F, Wong DK-H, Cheung K-S, et al. Diverse effects of hepatic steatosis on fibrosis progression and functional cure in virologically quiescent chronic hepatitis B. J Hepatol. 2020;73:800–6. https://doi.org/10.1016/j.jhep.2020.05.040. Li J, Yang H-I, Yeh M-L, Le MH, Le AK, Yeo YH, et al. Association Between Fatty Liver and Cirrhosis, Hepatocellular Carcinoma, and Hepatitis B Surface Antigen Seroclearance in Chronic Hepatitis B. J Infect Dis. 2021;224:294–302. https://doi.org/10.1093/infdis/jiaa739. Hui RWH, Seto W-K, Cheung K-S, Mak L-Y, Liu KSH, Fung J, et al. Inverse relationship between hepatic steatosis and hepatitis B viremia: Results of a large case-control study. J Viral Hepat. 2018;25:97–104. https://doi.org/10.1111/jvh.12766. Zhu L, Jiang J, Zhai X, Baecker A, Peng H, Qian J, et al. Hepatitis B virus infection and risk of non-alcoholic fatty liver disease: A population-based cohort study. Liver Int. 2019;39:70–80. https://doi.org/10.1111/liv.13933. Lee YB, Ha Y, Chon YE, Kim MN, Lee JH, Park H, et al. Association between hepatic steatosis and the development of hepatocellular carcinoma in patients with chronic hepatitis B. Clin Mol Hepatol. 2019;25:52–64. https://doi.org/10.3350/cmh.2018.0040. Kim MN, Han K, Yoo J, Hwang SG, Ahn SH. Increased risk of hepatocellular carcinoma and mortality in chronic viral hepatitis with concurrent fatty liver. Aliment Pharmacol Ther. 2022;55:97–107. https://doi.org/10.1111/apt.16706. Nakamoto N, Kanai T. Role of toll-like receptors in immune activation and tolerance in the liver. Front Immunol. 2014;5:221. https://doi.org/10.3389/fimmu.2014.00221. Zhang R-N, Pan Q, Zhang Z, Cao H-X, Shen F, Fan J-G. Saturated Fatty Acid inhibits viral replication in chronic hepatitis B virus infection with nonalcoholic Fatty liver disease by toll-like receptor 4-mediated innate immune response. Hepat Mon. 2015;15:e27909. https://doi.org/10.5812/hepatmon.15(5)2015.27909. Johnson ES, Lindblom KR, Robeson A, Stevens RD, Ilkayeva OR, Newgard CB, et al. Metabolomic profiling reveals a role for caspase-2 in lipoapoptosis. J Biol Chem. 2013;288:14463–75. https://doi.org/10.1074/jbc.M112.437210. Malhi H, Bronk SF, Werneburg NW, Gores GJ. Free fatty acids induce JNK-dependent hepatocyte lipoapoptosis. J Biol Chem. 2006;281:12093–101. https://doi.org/10.1074/jbc.M510660200. Xu H-Y, Chen Z-W, Li H, Zhou L, Liu F, Lv Y-Y, et al. 12-Deoxyphorbol 13-palmitate mediated cell growth inhibition, G2-M cell cycle arrest and apoptosis in BGC823 cells. Eur J Pharmacol. 2013;700:13–22. https://doi.org/10.1016/j.ejphar.2012.11.015. Machado M, Michelotti G, Pereira de Almeida T, Boursier J, Kruger L, Swiderska-Syn M, et al. Reduced Lipoapoptosis, Hedgehog Pathway Activation, and Fibrosis in Caspase-2 deficient Mice with Nonalcoholic Steatohepatitis. Gut. 2015;64:1148–57. https://doi.org/10.1136/gutjnl-2014-307362. Brenner D, Blaser H, Mak TW. Regulation of tumour necrosis factor signalling: live or let die. Nat Rev Immunol. 2015;15:362–74. https://doi.org/10.1038/nri3834. Dostert C, Grusdat M, Letellier E, Brenner D. The TNF Family of Ligands and Receptors: Communication Modules in the Immune System and Beyond. Physiol Rev. 2019;99:115–60. https://doi.org/10.1152/physrev.00045.2017. Abiru S, Migita K, Maeda Y, Daikoku M, Ito M, Ohata K, et al. Serum cytokine and soluble cytokine receptor levels in patients with non-alcoholic steatohepatitis. Liver Int. 2006;26:39–45. https://doi.org/10.1111/j.1478-3231.2005.01191.x. Potoupni V, Georgiadou M, Chatzigriva E, Polychronidou G, Markou E, Zapantis Gakis C, et al. Circulating tumor necrosis factor-α levels in non-alcoholic fatty liver disease: A systematic review and a meta-analysis. J Gastroenterol Hepatol. 2021;36:3002–14. https://doi.org/10.1111/jgh.15631. Tiegs G, Horst AK. TNF in the liver: targeting a central player in inflammation. Semin Immunopathol. 2022;44:445–59. https://doi.org/10.1007/s00281-022-00910-2. Vieira Barbosa J, Milligan S, Frick A, Broestl J, Younossi Z, Afdhal NH, et al. Fibrosis-4 Index as an Independent Predictor of Mortality and Liver-Related Outcomes in NAFLD. Hepatol Commun. 2022;6:765–79. https://doi.org/10.1002/hep4.1841. Additional Declarations No competing interests reported. Supplementary Files S1rawimages.pdf S1 File. The raw data of some figures in the paper. Cite Share Download PDF Status: Under Revision Version 1 posted Editorial decision: Revision requested 02 May, 2026 Reviews received at journal 19 Apr, 2026 Reviewers agreed at journal 05 Apr, 2026 Reviewers invited by journal 24 Mar, 2026 Editor assigned by journal 23 Mar, 2026 Submission checks completed at journal 23 Mar, 2026 First submitted to journal 20 Mar, 2026 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-9179452","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":611139703,"identity":"19e9e120-3d0b-4234-9968-3236f4ec622a","order_by":0,"name":"Maoping Li","email":"","orcid":"","institution":"The Second Xiangya Hospital, Central South University","correspondingAuthor":false,"prefix":"","firstName":"Maoping","middleName":"","lastName":"Li","suffix":""},{"id":611139704,"identity":"941fad67-ddda-4c6d-9523-cf564ff2c7ef","order_by":1,"name":"Kaizhong Luo","email":"","orcid":"","institution":"The Second Xiangya Hospital, Central South University","correspondingAuthor":false,"prefix":"","firstName":"Kaizhong","middleName":"","lastName":"Luo","suffix":""},{"id":611139706,"identity":"5036abfc-6773-4ab4-bd82-6b3a43a13046","order_by":2,"name":"Na Qin","email":"","orcid":"","institution":"The Second Xiangya Hospital, Central South University","correspondingAuthor":false,"prefix":"","firstName":"Na","middleName":"","lastName":"Qin","suffix":""},{"id":611139707,"identity":"ab90fe49-d1f2-4322-a0de-8fa283179ab6","order_by":3,"name":"Yuxin Zheng","email":"","orcid":"","institution":"The Second Xiangya Hospital, Central South University","correspondingAuthor":false,"prefix":"","firstName":"Yuxin","middleName":"","lastName":"Zheng","suffix":""},{"id":611139708,"identity":"da4ac205-8862-420c-bb60-24c20e98fcd8","order_by":4,"name":"Xinqiang Xiao","email":"","orcid":"","institution":"The Second Xiangya Hospital, Central South University","correspondingAuthor":false,"prefix":"","firstName":"Xinqiang","middleName":"","lastName":"Xiao","suffix":""},{"id":611139709,"identity":"cf3d5c6e-6e82-4e4e-9ba5-ca66278b115a","order_by":5,"name":"Yanjiao Wang","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAy0lEQVRIiWNgGAWjYBAC+2b2AwYJPDYQHg8xWgzYexIKPsikkaKF54DBxxk2h0nQYi6RkLiZJ+e8vPyMBMYHb9sY5M0JabGckXjYmOfMbcMNNxKYDee2MRjubCCk50ZCmjFvz+0EA4kENmneNoYEgwOEtZj/5v13LgHoMPbfRGkxOHPAwHAGz4EEoF42ZqK0SLb3JBh84Ek23HDmYbPknHMShhsIaeFnBkelnbx8e/LBD2/KbOQJ+wUBGBuAhATx6kfBKBgFo2AU4AYA1T9ADYRlN60AAAAASUVORK5CYII=","orcid":"","institution":"The Second Xiangya Hospital, Central South University","correspondingAuthor":true,"prefix":"","firstName":"Yanjiao","middleName":"","lastName":"Wang","suffix":""}],"badges":[],"createdAt":"2026-03-20 13:38:40","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-9179452/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-9179452/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":105472978,"identity":"9f486fa9-cdd4-4cdc-ba59-ab8264fcd481","added_by":"auto","created_at":"2026-03-26 12:17:50","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":868081,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eBiological effects of FFA on HepG2.2.15 cells.\u003c/strong\u003e (A, C, E) Representative images of lipid accumulation in HepG2.2.15 cells treated with 0, 0.25, 0.5, and 1 mM FFA for 48 h are shown (400× magnification). Lipid accumulation was visualized by Oil Red O staining (A), triglyceride content was measured (mmol/g protein) (C), and cell viability was assessed by MTT assay (E). (B, D, F) Representative images of lipid accumulation in HepG2.2.15 cells treated with 1 mM FFA for 0, 24, 48, and 72 h are shown. Lipid accumulation was indicated by Oil Red O staining (B), triglyceride content was measured (D), and cell viability was assessed by MTT assay (F). Values represent the mean ± SE (N = 3), *\u003cem\u003ep\u003c/em\u003e\u0026lt;0.05\u003c/p\u003e","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-9179452/v1/4d9353443a0d8923d949d05f.png"},{"id":105472977,"identity":"3266d689-860f-4fe0-848d-efad3116968b","added_by":"auto","created_at":"2026-03-26 12:17:50","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":471713,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eFFA treatment suppresses HBV replication markers and induces TNF-α secretion in HepG2.2.15 cells in a time- and concentration-dependent manner. \u003c/strong\u003e(A, B) HBV-DNA titers in the supernatant decreased with increasing FFA concentration (A) and prolonged treatment duration (B).\u003cstrong\u003e \u003c/strong\u003e(C-H) Consistent reduction in intracellular pgRNA levels (C, D) and supernatant HBsAg (E, F) and HBeAg (G, H) was observed under corresponding FFA treatments.\u003cstrong\u003e \u003c/strong\u003e(I, J) TNF-α levels in the supernatant increased in response to escalating FFA concentrations (I) and extended incubation time (J).\u003cstrong\u003e \u003c/strong\u003eData are presented as mean ± SE (N = 3). *p \u0026lt; 0.05 vs. control group\u003c/p\u003e","description":"","filename":"floatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-9179452/v1/7fb1d1fee860e40fcee80dfc.png"},{"id":105472981,"identity":"05e88e9b-7480-47b8-89bb-b92900469957","added_by":"auto","created_at":"2026-03-26 12:17:50","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":562216,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eApoptosis was induced by FFA in HepG2.2.15 cells.\u003c/strong\u003e (A) Apoptosis in HepG2.2.15 cells was assessed after 48 h of incubation with different concentrations of FFA (0.25, 0.5, and 1 mM). (B) Apoptosis in HepG2.2.15 cells was evaluated after treatment with 1 mM FFA for various times (0, 24, 48, and 72 h). All data conform to a normal distribution, values represent the mean ± SE (N = 3), *\u003cem\u003ep\u003c/em\u003e\u0026lt;0.05\u003c/p\u003e","description":"","filename":"floatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-9179452/v1/b4096301b1f17bb9fdb0f02a.png"},{"id":105565968,"identity":"464b3b07-3c17-4a14-8bca-a0fde2bfdcc6","added_by":"auto","created_at":"2026-03-27 12:54:54","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":585672,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eChanges in the expression of TNFR1, Caspase-2, and Caspase-8 in HepG2.2.15 cells before and after steatosis.\u003c/strong\u003e(A, C) Protein and mRNA expression levels of TNFR1, Caspase-2, and Caspase-8 in HepG2.2.15 cells incubated with different concentrations of fatty acids for 48 hours. (B, D) Protein and mRNA expression levels of TNFR1, Caspase-2, and Caspase-8 in HepG2.2.15 cells incubated with 1 mM fatty acids at different time points. (E) After 48 h of incubation with exogenous TNF-α in steatotic HepG2.2.15 cells, the protein levels of TNFR1, Caspase-2, and Caspase-8 were significantly elevated. (F) After 48 h of TNF-α treatment in steatotic HepG2.2.15 cells, TNFR1 mRNA levels were significantly elevated. GAPDH was the loading control. All data conform to a normal distribution, values represent the mean ± SE (N = 3), *p\u0026lt;0.05\u003c/p\u003e","description":"","filename":"floatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-9179452/v1/5805f8f339cc64b07a4b8c1c.png"},{"id":105472982,"identity":"a3d8ca78-ba6f-45dc-8540-4582f961607e","added_by":"auto","created_at":"2026-03-26 12:17:50","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":365267,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eTNFR1 regulates caspase-2 and caspase-8 expression and caspase-2 enzymatic activity in lipid-accumulated HepG2.2.15 cells.\u003c/strong\u003e (A) TNFR1 protein and mRNA expression levels were measured in HepG2.2.15 cells transfected with a TNFR1 overexpression plasmid. (B) HepG2.2.15 cells were transfected with either TNFR1-targeted siRNA or non-specific siRNA, and TNFR1 protein and mRNA expression levels were assessed. (C, D, E) After transfection of HepG2.2.15 cells with TNFR1 overexpression plasmid, TNFR1-targeted siRNA, or control siRNA, the protein and mRNA expression levels of Caspase-2 and Caspase-8 were measured. (F) Caspase-2 enzymatic activity was measured in HepG2.2.15 cells transfected with TNFR1 overexpression plasmid, TNFR1-specific siRNA, or control siRNA.GAPDH was the loading control. All data conform to a normal distribution, values represent the mean ± SE (N = 3), *p\u0026lt;0.05\u003c/p\u003e","description":"","filename":"floatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-9179452/v1/53c90458e298444a65aa663b.png"},{"id":105472979,"identity":"cf360be3-6bc6-4617-bfff-f7af0ecb6ff8","added_by":"auto","created_at":"2026-03-26 12:17:50","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":567881,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eTNFR1–Caspase-2–mediated apoptosis restricts HBV DNA accumulation in lipid-diseased HepG2.2.15 cells.\u003c/strong\u003e (A) HepG2.2.15 cells were transfected with Caspase-2-targeting siRNA or nonspecific siRNA, and the expression levels of Caspase-2 protein and mRNA were assessed. (B) After 48 hours of co-incubation with FFA, the apoptosis rate was measured in Caspase-2 knockdown HepG2.2.15 cells. (C) Overexpression of TNFR1 significantly reduced the HBV DNA levels in the supernatant of HepG2.2.15 cells. (D) Knockdown of TNFR1 significantly increased the HBV DNA levels in the supernatant of HepG2.2.15 cells. (E) Knockdown of Caspase-2 significantly increased the HBV DNA levels in the supernatant of HepG2.2.15 cells. All data conform to a normal distribution, values represent the mean ± SE (N = 3), *p\u0026lt;0.05\u003c/p\u003e","description":"","filename":"floatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-9179452/v1/ae7f0b711fe57479af669181.png"},{"id":105570091,"identity":"991e4595-ee61-46d3-810b-b5f437335a7f","added_by":"auto","created_at":"2026-03-27 13:14:35","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2655012,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-9179452/v1/f4a18622-dc41-44db-9d30-8a1c2f7cc7f0.pdf"},{"id":105472984,"identity":"369b7294-2bdc-49b2-b53a-782409166e82","added_by":"auto","created_at":"2026-03-26 12:17:50","extension":"pdf","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":3497288,"visible":true,"origin":"","legend":"\u003cp\u003eS1 File. The raw data of some figures in the paper.\u003c/p\u003e","description":"","filename":"S1rawimages.pdf","url":"https://assets-eu.researchsquare.com/files/rs-9179452/v1/cce2862181c857f5fce0a07b.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Tumor Necrosis Factor Receptor 1-mediated Caspase-2 driven apoptosis reduces HBV DNA levels during free-fatty acid exposure in vitro","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eChronic hepatitis B (CHB) remains a major global health burden, with a substantial proportion of patients progressing to liver cirrhosis or hepatocellular carcinoma (HCC) in the absence of effective viral control[\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. In parallel, the global prevalence of metabolic dysfunction\u0026ndash;associated steatotic liver disease (MASLD) continues to rise, driven by increasing rates of obesity and metabolic syndrome[\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e, \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. As a result, the coexistence of CHB and MASLD has become increasingly common in clinical practice, particularly in Asian populations[\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eInterestingly, accumulating clinical evidence suggests that hepatic steatosis is frequently associated with lower serum HBV DNA levels and a higher probability of hepatitis B surface antigen (HBsAg) clearance[\u003cspan additionalcitationids=\"CR6\" citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. These observations imply that metabolic stress within hepatocytes may exert a suppressive effect on HBV replication[\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. However, this apparent antiviral phenomenon contrasts with the well-established role of MASLD in accelerating liver fibrosis progression and increasing long-term HCC risk, highlighting a complex and incompletely understood interaction between metabolic injury and viral persistence[\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e, \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e].\u003c/p\u003e \u003cp\u003ePrevious studies exploring the relationship between MASLD and HBV infection have largely focused on epidemiological associations or innate immune activation, such as toll-like receptor\u0026ndash;mediated signaling[\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. While these immune mechanisms may contribute to viral suppression, they do not fully explain how intracellular metabolic stress directly influences HBV replication within infected hepatocytes. In particular, the role of lipotoxicity-induced cell death pathways in modulating HBV viral markers has received limited experimental attention.\u003c/p\u003e \u003cp\u003eLipotoxic apoptosis is a characteristic feature of MASLD and is triggered by excessive accumulation of long-chain free fatty acids (FFAs) in non-adipose tissues[\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. Among the caspase family members, Caspase-2 has emerged as a key regulator of lipid-induced apoptosis and metabolic stress responses[\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. Concurrently, tumor necrosis factor-α (TNF-α) signaling through tumor necrosis factor receptor 1 (TNFR1) is known to activate non-canonical apoptotic pathways involving Caspase-8 and Caspase-2, independent of the classical Caspase-3 cascade[\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e, \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. Elevated circulating levels of TNF-α and soluble TNFR1 have been reported in patients with MASLD and correlate with disease severity[\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e, \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eBased on these observations, we hypothesized that FFA-induced metabolic stress may activate a TNFR1\u0026ndash;Caspase-8\u0026ndash;Caspase-2 apoptotic axis in HBV-producing hepatocytes, thereby contributing to the reduction of HBV replication markers. To test this hypothesis, we established an in vitro steatosis model using HepG2.2.15 cells and systematically investigated the relationship between lipid accumulation, apoptotic signaling, and HBV DNA levels.\u003c/p\u003e"},{"header":"2. Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e2.1. Cell culture and FFA treatment\u003c/h2\u003e \u003cp\u003eHepG2.2.15 cells were obtained from the Cell Bank of the Chinese Academy of Sciences (Shanghai, China). The HepG2.2.15 cells were cultured in Dulbecco's Modified Eagle's Medium (DMEM, Hyclone, Shanghai, China) supplemented with 10% fetal bovine serum (Gibco, NY, USA) and 100 U/ml penicillin and streptomycin in a 37\u0026deg;C, 5% CO\u003csub\u003e2\u003c/sub\u003e humidified incubator.\u003c/p\u003e \u003cp\u003eTo prepare the free fatty acid (FFA) mixture, oleic acid and palmitic acid (Kunchuang, Xi'an, China) were combined in a 2:1 ratio. HepG2.2.15 cells were exposed to varying concentrations of FFA (0, 0.25, 0.5, and 1 mM) for 24, 48, or 72 h to induce lipid accumulation.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003e2.2 Cell viability assay\u003c/h2\u003e \u003cp\u003eCell viability was measured using the MTT assay. Briefly, HepG2.2.15 cells were plated at a density of 4 \u0026times; 10\u003csup\u003e3\u003c/sup\u003e cells per well in a 96-well plate and incubated overnight. Cells were then treated with the FFA mixture (0, 0.25, 0.5, and 1 mM) for varying times (0, 24, 48, and 72 h). After treatment, 20 \u0026micro;l of MTT solution (5 mg/ml) (Fdbio, Hangzhou, China) was added to each well, and the cells were incubated at 37\u0026deg;C for 2 h. The medium was carefully removed, and the formed crystals were dissolved in 150 \u0026micro;l of dimethyl sulfoxide (DMSO). Absorbance was measured at 570 nm.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003e2.3. Oil Red-O staining and triglyceride assay\u003c/h2\u003e \u003cp\u003eCells were washed with PBS, fixed with 4% paraformaldehyde for 15 min, and washed. Oil Red O staining was performed for 0.5 h using a kit (Beyotime, Shanghai, China), followed by washing with PBS and microscopic observation of lipid accumulation in the cells. For quantitative assessment of lipid accumulation, Oil Red O-stained images were analyzed using ImageJ software. The RGB channels were split to isolate the red channel (Oil Red O signal), followed by thresholding to differentiate positively stained regions (lipid droplets) from the background. The lipid droplet area percentage was calculated as: (Number of positive pixels / Total cellular pixels) \u0026times; 100%, with identical threshold parameters applied to all images within the same experiment.\u003c/p\u003e \u003cp\u003eTotal triglyceride levels were measured with the GPO-PAP double-reagent colorimetric method using a triglyceride assay kit (Fdbio, Hangzhou, China) following the manufacturer\u0026rsquo;s instructions. The triglyceride concentrations were normalized to the protein content.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003e2.4. Assessment of TNF-α and HBV-DNA\u003c/h2\u003e \u003cp\u003eHepG2.2.15 cells were seeded in a 6-well plate at a density of 1.0 \u0026times; 10\u003csup\u003e5\u003c/sup\u003e cells per well. After 24 h, the medium was removed, and the cells were treated with different concentrations of FFA (0, 0.25, 0.5, and 1 mM) for 24, 48, or 72 h. TNF-α levels were measured in the supernatant using an enzyme-linked immunosorbent assay(Xinyu, Shanghai, China) at 450 nm, and the concentration was determined from a standard curve.\u003c/p\u003e \u003cp\u003eTotal DNA was extracted using the QIAamp DNA Mini Kit (Qiagen, Shanghai, China). HBV DNA content was quantified by real-time qPCR with SYBR Green I. The primers used for HBV DNA amplification were: 5\u0026prime;-GTTGCCCGTTTGTCCTCTAATTC-3\u0026prime; (forward) and 5\u0026prime;-GGAGGGATACATAGAGGTTCCTT-3\u0026prime; (reverse).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003e2.5. Measurement of HBsAg, HBeAg, and HBV pgRNA\u003c/h2\u003e \u003cp\u003eThe levels of hepatitis B surface antigen (HBsAg) and hepatitis B e antigen (HBeAg) viral secretory proteins in the supernatant were measured using enzyme-linked immunosorbent assay (ELISA) kits from Shanghai GeHua Bio-engineering, China.\u003c/p\u003e \u003cp\u003eHBV DNA was quantified by fluorescent quantitative PCR employing commercial kits (Sansure Biotech Inc., China). For HBV pgRNA analysis, total RNA was isolated from 200 \u0026micro;L samples using a magnetic bead-based kit (Sansure Biotech Inc., China) and subsequently reverse-transcribed into cDNA at 50\u0026deg;C for 30 minutes. The cDNA was then amplified via a PCR protocol consisting of an initial denaturation at 95\u0026deg;C for 2 minutes, followed by 50 cycles of denaturation at 95\u0026deg;C for 15 seconds and annealing/extension at 60\u0026deg;C for 30 seconds, with a final cooling step at 25\u0026deg;C for 10 seconds. Fluorescence detection was performed using the 7500 real-time PCR System (Applied Biosystems\u0026reg;). GAPDH served as the endogenous control for data normalization. Relative gene expression, calculated via the 2^(-ΔΔCt) method, is presented as fold-change relative to the control group.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003e2.6. Apoptosis assay\u003c/h2\u003e \u003cp\u003eCells were collected using EDTA-free trypsin digestion, washed twice with PBS, and centrifuged at 2000 g for 5 min each time. The cells were then resuspended in 500 \u0026micro;l of Binding buffer and mixed with 5 \u0026micro;l of Annexin V-APC (KeyGEN, Jiangsu, China). Next, 5 \u0026micro;l of propidium iodide was added. After incubating samples in the dark at room temperature for 10 min, the samples were analyzed using a flow cytometer (Beckman, A00-1-1102).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003e2.7. Caspase-2 activity assay\u003c/h2\u003e \u003cp\u003eCaspase-2 activity was determined using a commercial assay kit (Solarbio, Beijing, China). In brief, collected cells were lysed, and the supernatant was collected after centrifugation. An equal amount of protein from the lysates was then incubated with the Caspase-2 specific substrate Ac-VDVAD-pNA at 37\u0026deg;C for 2\u0026ndash;4 hours. The enzymatic activity was quantified by measuring the absorbance of the released p-nitroaniline (pNA) at 405 nm.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003e2.8. Western blot analysis\u003c/h2\u003e \u003cp\u003eCells were washed with PBS buffer and total protein was extracted using RIPA lysis buffer(Thermo Fisher, Shanghai, China) following the manufacturer's instructions. Protein concentration was determined using the BCA assay (Pierce Chemicals). Protein samples (20 \u0026micro;g) were separated on a 10% SDS-polyacrylamide gel and transferred to a PVDF membrane (Bio-Rad). The membrane was blocked with PBS containing 0.1% Tween 20 and 5% skim milk and then incubated with antibodies against TNFR1 (Proteintech, Wuhan, China), Caspase-2 (Proteintech), or Caspase-8 (Proteintech). Detection was performed using horseradish peroxidase\u0026ndash;conjugated secondary antibodies and enhanced chemiluminescence (Amersham Pharmacia Biotech) following the manufacturer\u0026rsquo;s protocol. Band densities were quantified using ImageJ software.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003e2.9. Quantitative real-time PCR\u003c/h2\u003e \u003cp\u003eTotal RNA was extracted using TRIzol (Invitrogen, Carlsbad, CA, USA). The concentration and purity of the samples were assessed using a NanoDrop 2000 Micro UV-Vis Spectrophotometer (1011U, NanoDrop, USA). Primers for cDNA synthesis were designed following the instructions provided for TaqMan MicroRNA Analysis Reverse Transcription Primers (4427975, Applied Biosystems, USA) and PrimeScript RT Kit (RR047A, Takara, Japan) (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). Real-time PCR was conducted using TaqMan Multiplex Real-Time Solution (4,461,882, Thermo Fisher Scientific, USA) on an ABI7500 Quantitative PCR System (7500, ABI, USA), with β-actin mRNA as the normalization control. Relative transcription levels of target genes were calculated using the 2-△△CT method. All experiments were performed in triplicate.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimers for RT-PCR.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSpecies\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003ePrimer (Forward:5\u0026prime;-3\u0026prime;)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003ePrimer (Reverse:5\u0026prime;-3\u0026prime;)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTNFR1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ehuman\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTGCCTACCCCAGATTGAGAA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eATTTCCCACAAACAATGGAGTAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCaspase-2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ehuman\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTGATGCCTTCTGTGAAGCAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eAGGGGACAGGACTCACACAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCaspase-8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ehuman\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGGATGGCCACTGTGAATAACTG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eTCGAGGACATCGCTCTCTCA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eβ-actin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ehuman\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTAAAACGCAGCTCAGTAACAGTCGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eTGCAATCCTGTGGCATCCATGAAAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"4\"\u003eTNFR1: tumor necrosis factor receptor 1\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003e2.10. TNF-α treatment\u003c/h2\u003e \u003cp\u003eIn some experiments, HepG2.2.15 cells were treated with TNF-α (20 ng/mL) (ACROBiosystems, Beijing, China) for 48 h.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003e2.11. TNFR1 overexpression and knockdown\u003c/h2\u003e \u003cp\u003eTNFR1 cDNA was amplified using specific primers (Forward: 5'-CCCAAGCTTATGATGGACTTGGAGTTGCCACCGC-3'; Reverse: 5'-CGGAATTCCTAGTTTTTCTTTGTATCTGGCTTC-3'). The PCR product was digested with EcoRI and HindIII and ligated into pCDNA3.1 to generate pCDNA3.1-TNFR1. The plasmid was then transiently transfected into cells using UltraFection 3.0 (4A BIOTECH, Suzhou, China) to obtain HepG2.2.15 cells with stable TNFR1 expression.\u003c/p\u003e \u003cp\u003eSiRNA targeting TNFR1 (si-TNFR1) (Forward: 5\u0026rsquo;-GGAACCUACUUGUACAAUGACTT-3'; Reverse: 5\u0026rsquo;-GUCAUUGUACAAGGUUCCTT-3'), Caspase-2 (si-Caspase-2) (Forward: 5\u0026rsquo;-AAACAGCTGTTGTTGAGCGAA-3\u0026rsquo;; Reverse: 5\u0026rsquo;-TTTGTCGACAACAACTCGCTT-3\u0026rsquo;) and a negative control siRNA (si-NC) (5\u0026rsquo;-UUCUCCGAACGUGUCACGUTT-3\u0026rsquo;) were designed and obtained from GenePharma (Shanghai, China). si-TNFR1 and si-NC were transfected into HepG2.2.15 cells using UltraFection 3.0. After 48 h of incubation, cells were harvested for analyses.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003e2.12 Statistical analysis\u003c/h2\u003e \u003cp\u003eData are expressed as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;Standard Error (SE). All data were statistically analyzed using GraphPad Prism V9.5. The significance of differences between two groups was assessed using a two-tailed independent samples t-test. For comparisons involving more than two groups, one-way analysis of variance (ANOVA) was used.\u003c/p\u003e \u003c/div\u003e"},{"header":"3. Results","content":"\u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003e3.1. FFA induces lipid accumulation\u003c/h2\u003e \u003cp\u003eHepG2.2.15 cells were incubated with different concentrations of FFA (0.25, 0.5, 1 mM) for various times (24, 48, and 72 h) to induce lipid accumulation. Oil Red O staining confirmed lipid deposition in the cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA, B). Compared with the control group, triglyceride (TG) content\u0026mdash;expressed as millimoles per gram of cellular protein (mmol/g prot)\u0026mdash;was markedly increased in all treatment groups. Except for the 0.25 mM FFA group, all other concentrations showed statistically significant differences versus controls (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC, D). MTT assays confirmed that both increasing FFA concentrations and prolonged incubation time affected cell viability (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eE, F). Collectively, these results demonstrate that FFA treatment induces lipid accumulation in HepG2.2.15 cells, with significant TG elevation at higher FFA concentrations.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003e3.2. FFA upregulates TNF-α and inhibits HBV-DNA\u003c/h2\u003e \u003cp\u003eHepG2.2.15 cells were treated with different concentrations (0.25, 0.5, 1 mM) of free fatty acids (FFA) for various durations (0, 24, 48, 72 hours). The levels of HBV-DNA titers, HBsAg, and HBeAg in the cell supernatant, along with intracellular pgRNA levels and TNF-α concentration, were measured. With increasing treatment time and concentration, HBV-DNA titers in lipid-accumulated HepG2.2.15 cells demonstrated a decreasing trend (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA, B). Meanwhile, intracellular pgRNA levels, as well as HBsAg and HBeAg levels in the supernatant, showed a corresponding decreasing trend consistent with that of HBV-DNA (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC-H). Compared with the control group, TNF-α levels in the supernatant of FFA-treated cells increased in a time- and concentration-dependent manner (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eI, J). In summary, these findings indicate that in lipid-accumulated HepG2.2.15 cells, FFA treatment reduced HBV-DNA titers, HBsAg and HBeAg levels in the supernatant, and intracellular pgRNA levels, while simultaneously increasing TNF-α levels, all in a time- and concentration-dependent manner.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003e3.3. Hepatic steatosis leads to apoptosis of HepG2.2.15 cells.\u003c/h2\u003e \u003cp\u003eWe assessed the influence of FFA on apoptosis in HepG2.2.15 cells. Cells were exposed to different concentrations of FFA (0, 0.25, 0.5, 1 mM) for various durations (0, 24, 48, 72 h). Annexin V and PI staining was used to evaluate cell apoptosis. Cells were classified as follows: 1) live cells, negative for both Annexin V-FITC and PI; 2) early apoptotic cells, positive for Annexin V-FITC and negative for PI; 3) late apoptotic cells, positive for both Annexin V-FITC and PI; and 4) necrotic cells, positive for PI only. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e, FFA induced apoptosis in HepG2.2.15 cells in a dose- and time-dependent manner. Compared with the control group, the cells treated with 1 mM FFA for 72 h showed a 3.9% increase in early apoptotic cells and 2.24% increase in late apoptotic cells. These findings indicate that FFA induces apoptosis in HepG2.2.15 cells. In summary, these results demonstrate that FFA induces apoptosis in HepG2.2.15 cells in a dose- and time-dependent manner, with increased early and late apoptotic cell populations observed at higher FFA concentrations and longer exposure times.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003e3.4. Lipid droplet accumulation in HepG2.2.15 cells regulates apoptosis through the TNFR1-mediated Caspase-2 pathway\u003c/h2\u003e \u003cp\u003eFFA at various concentrations increased the mRNA and protein levels of TNFR1, Caspase-2, and Caspase-8 in lipid-accumulated HepG2.2.15 cells compared with controls; the results showed concentration-dependent and time-dependent effects (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA, B, C, D). We used 1 mM FFA to incubate HepG2.2.15 cells for 48 h in subsequent experiments.\u003c/p\u003e \u003cp\u003eTo further investigate the role of TNFR1 in lipid-accumulated HepG2.2.15 cells, exogenous TNF-α (20 ng/mL) was added. We observed significant increases in TNFR1, Caspase-2, and Caspase-8 at both the mRNA and protein levels after 48 h of treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eE, F).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eA TNFR1 overexpression plasmid was transfected into HepG2.2.15 cells and TNFR1 was knocked down using siRNA. The efficiency of overexpression and knockdown was confirmed (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA, B). Transfected HepG2.2.15 cells were incubated with FFA for 48 h. In lipid-accumulated HepG2.2.15 cells overexpressing TNFR1, the levels of Caspase-2 and Caspase-8 were elevated at both mRNA and protein levels compared with controls, in contrast, incubating TNFR1 knockdown HepG2.2.15 cells with mixed fatty acids led to reduced levels of Caspase-2 and Caspase-8 (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC, D, E). Furthermore, we found that Caspase-2 enzymatic activity was enhanced in TNFR1-overexpressing lipid-accumulated cells, whereas the opposite effect was observed in TNFR1-knockdown cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eF).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eIn summary, these results suggest that FFA upregulates TNFR1, Caspase-2, and Caspase-8 expression in a dose- and time-dependent manner, and that TNFR1 plays a key role in regulating apoptosis in lipid-accumulated HepG2.2.15 cells, as evidenced by the modulation of Caspase-2 and Caspase-8 levels following TNFR1 overexpression or knockdown.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003e3.5. Knockdown of Caspase-2 reduces the apoptosis rate in HepG2.2.15 cells\u003c/h2\u003e \u003cp\u003eTo further investigate the role of Caspase-2 in lipid accumulation in HepG2.2.15 cells, we knocked down Caspase-2 in HepG2.2.15 cells using siRNA, and the knockdown efficiency was confirmed (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA). After incubating the treated HepG2.2.15 cells with FFA for 48 hours, we assessed the apoptosis rate. Compared to the control, the apoptosis rate was reduced in Caspase-2 knockdown HepG2.2.15 cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eB). In conclusion, these results suggest that Caspase-2 plays a crucial role in regulating apoptosis in HepG2.2.15 cells with lipid accumulation.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003e3.6. Overexpression of TNFR1 and Caspase-2 reduces HBV DNA levels in HepG2.2.15 cells, while knockdown of TNFR1 and Caspase-2 increases HBV DNA levels in HepG2.2.15 cells\u003c/b\u003e \u003c/p\u003e \u003cp\u003eTo investigate the relationship between HBV DNA levels and the TNFR1/Caspase-8/Caspase-2 signaling pathway, we incubated HepG2.2.15 cells with FFA for 48 hours, while overexpressing or knocking down TNFR1 or Caspase-2. We then measured the HBV DNA levels in the cell supernatants. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e, compared to the control group, overexpression of TNFR1 resulted in a decrease in HBV DNA levels in the supernatants, while knockdown of TNFR1 or Caspase-2 led to an increase in HBV DNA levels. In summary, these results suggest that the TNFR1/Caspase-8/Caspase-2 signaling pathway regulates HBV DNA levels in HepG2.2.15 cells.\u003c/p\u003e \u003c/div\u003e"},{"header":"4. Discussion","content":"\u003cp\u003eIn the present study, we demonstrate that free fatty acid\u0026ndash;induced steatosis suppresses HBV replication markers in HepG2.2.15 cells and is accompanied by activation of a TNFR1-mediated apoptotic signaling pathway. Specifically, lipid accumulation resulted in increased TNF-α production, upregulation of TNFR1, and activation of the Caspase-8/Caspase-2 axis, ultimately leading to enhanced apoptotic cell death and reduced HBV DNA levels.\u003c/p\u003e \u003cp\u003eOur findings are consistent with previous clinical observations reporting an inverse association between hepatic steatosis and HBV viremia[\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e, \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. While earlier studies have proposed innate immune activation as a potential explanation for this phenomenon, our data provide experimental evidence supporting an alternative, non-immune mechanism whereby metabolic stress directly limits viral persistence through apoptosis of HBV-producing hepatocytes[\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. This mechanism may partially account for the lower viral loads observed in CHB patients with concurrent MASLD.\u003c/p\u003e \u003cp\u003eCaspase-2 has increasingly been recognized as a critical mediator of lipotoxic apoptosis across multiple metabolic disease models[\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. In hepatocytes, excessive intracellular lipid accumulation disrupts mitochondrial function and redox homeostasis, creating a cellular environment permissive for Caspase-2 activation. Our results extend these observations by demonstrating that Caspase-2 activation in steatotic hepatocytes is functionally linked to reductions in HBV DNA levels. Importantly, genetic manipulation of Caspase-2 expression directly altered HBV DNA output, supporting a causal relationship between apoptotic signaling and viral suppression.\u003c/p\u003e \u003cp\u003eTNF-α/TNFR1 signaling plays a central role in liver inflammation and cell fate determination[\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. Engagement of TNFR1 can initiate divergent downstream pathways, including survival signaling via NF-κB or apoptosis via formation of death-inducing signaling complexes[\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e, \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. In this study, FFA exposure shifted TNFR1 signaling toward a pro-apoptotic program involving Caspase-8 and Caspase-2. Overexpression of TNFR1 further enhanced Caspase-2 activation and reduced HBV DNA levels, whereas TNFR1 knockdown attenuated these effects, highlighting the regulatory role of this receptor in linking metabolic stress to viral control.\u003c/p\u003e \u003cp\u003eNotably, the magnitude of HBV DNA reduction and apoptosis observed in our model was modest. This likely reflects the multifactorial nature of HBV persistence in vivo, where viral replication is influenced by host immunity, hepatocyte turnover, and metabolic status. Our in vitro system isolates a single pathway and therefore cannot fully recapitulate the complexity of chronic HBV infection. Nevertheless, the consistent directional changes observed across multiple experimental conditions underscore the biological relevance of the TNFR1\u0026ndash;Caspase-2 axis in this context.\u003c/p\u003e \u003cp\u003eThe clinical implications of these findings warrant careful consideration. Although MASLD-associated apoptosis may contribute to reduced HBV replication, sustained lipotoxic injury is also a recognized driver of fibrosis progression and hepatocarcinogenesis[\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e, \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. Thus, metabolic stress may exert both antiviral and pro-fibrotic effects, underscoring the need for balanced therapeutic strategies in patients with CHB and MASLD.\u003c/p\u003e \u003cp\u003eSeveral limitations of this study should be acknowledged. First, HepG2.2.15 cells harbor an integrated HBV genome and do not fully model the complete viral life cycle, limiting extrapolation to in vivo infection dynamics. Second, the absence of animal or clinical validation restricts our ability to assess long-term disease outcomes. Future studies incorporating physiologically relevant HBV infection models and longitudinal analyses are required to further define the role of lipotoxic apoptosis in HBV pathogenesis.\u003c/p\u003e \u003cp\u003eIn conclusion, our study identifies TNFR1-mediated Caspase-2 activation as a potential mechanistic link between metabolic stress and suppression of HBV replication. These findings provide new insight into the complex interaction between MASLD and chronic hepatitis B and highlight apoptotic signaling as a previously underappreciated regulator of viral persistence.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cp\u003eANOVA: Analysis of variance\u0026nbsp;\u003c/p\u003e\n\n\u003cp\u003eCHB: Chronic hepatitis B\u0026nbsp;\u003c/p\u003e\n\n\u003cp\u003eDMEM: Dulbecco\u0026apos;s Modified Eagle\u0026apos;s Medium\u0026nbsp;\u003c/p\u003e\n\n\u003cp\u003eDMSO: Dimethyl sulfoxide\u0026nbsp;\u003c/p\u003e\n\n\u003cp\u003eELISA: Enzyme-linked immunosorbent assay\u0026nbsp;\u003c/p\u003e\n\n\u003cp\u003eFFA: Free fatty acid\u0026nbsp;\u003c/p\u003e\n\n\u003cp\u003eHBeAg: Hepatitis B e antigen\u0026nbsp;\u003c/p\u003e\n\n\u003cp\u003eHBsAg: Hepatitis B surface antigen\u0026nbsp;\u003c/p\u003e\n\n\u003cp\u003eHBV: Hepatitis B virus\u0026nbsp;\u003c/p\u003e\n\n\u003cp\u003eHCC: Hepatocellular carcinoma\u0026nbsp;\u003c/p\u003e\n\n\u003cp\u003eMASLD: Metabolic dysfunction-associated steatotic liver disease\u0026nbsp;\u003c/p\u003e\n\n\u003cp\u003epNA: p-nitroaniline\u0026nbsp;\u003c/p\u003e\n\n\u003cp\u003eSE: Standard Error\u0026nbsp;\u003c/p\u003e\n\n\u003cp\u003eTG: Triglyceride\u0026nbsp;\u003c/p\u003e\n\n\u003cp\u003eTNF-\u0026alpha;: Tumor necrosis factor-alpha\u0026nbsp;\u003c/p\u003e\n\n\u003cp\u003eTNFR1: Tumor necrosis factor receptor 1\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eNot applicable. This study was conducted \u003cem\u003ein vitro\u003c/em\u003e using the HepG2.2.15 cell line and does not involve human participants, human data, human tissue, or animals.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eAll data generated or analysed during this study are included in this published article and its supplementary information files. The datasets used and/or analysed during the current study are also available from the corresponding author on reasonable request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThis study was supported by grants from the Natural Science Foundation of Hunan Province of China (2024JJ9150), Clinical Medical Research Center for Viral Hepatitis of Hunan Province (2023SK4009), and The Scientific Research Program of FuRong Laboratory (No. 2023SK2108).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors\u0026apos; contributions\u003c/strong\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eML collected data and drafted the manuscript. KL and XX contributed to the interpretation of the data, and the critical revision of the manuscript. YW supervised the study. YZ and NQ designed the study and revised the manuscript. All authors read and approved the final manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe authors would like to express their gratitude to Liwenbianji (https://www.liwenbianji.cn/) for the expert linguistic services provided.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors\u0026apos; information\u003c/strong\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eTang LSY, Covert E, Wilson E, Kottilil S. Chronic Hepatitis B Infection: A Review. JAMA. 2018;319:1802\u0026ndash;13. https://doi.org/10.1001/jama.2018.3795.\u003c/li\u003e\n\u003cli\u003eSamuel VT, Shulman GI. Nonalcoholic Fatty Liver Disease, Insulin Resistance, and Ceramides. N Engl J Med. 2019;381:1866\u0026ndash;9. https://doi.org/10.1056/NEJMcibr1910023.\u003c/li\u003e\n\u003cli\u003eRiazi K, Azhari H, Charette JH, Underwood FE, King JA, Afshar EE, et al. The prevalence and incidence of NAFLD worldwide: a systematic review and meta-analysis. Lancet Gastroenterol Hepatol. 2022;7:851\u0026ndash;61. https://doi.org/10.1016/S2468-1253(22)00165-0.\u003c/li\u003e\n\u003cli\u003eYang M, Wei L. Impact of NAFLD on the outcome of patients with chronic hepatitis B in Asia. Liver International. 2022;42:1981\u0026ndash;90. https://doi.org/10.1111/liv.15252.\u003c/li\u003e\n\u003cli\u003eWang L, Wang Y, Liu S, Zhai X, Zhou G, Lu F, et al. Nonalcoholic fatty liver disease is associated with lower hepatitis B viral load and antiviral response in pediatric population. J Gastroenterol. 2019;54:1096\u0026ndash;105. https://doi.org/10.1007/s00535-019-01594-6.\u003c/li\u003e\n\u003cli\u003eMak L-Y, Hui RW-H, Fung J, Liu F, Wong DK-H, Cheung K-S, et al. Diverse effects of hepatic steatosis on fibrosis progression and functional cure in virologically quiescent chronic hepatitis B. J Hepatol. 2020;73:800\u0026ndash;6. https://doi.org/10.1016/j.jhep.2020.05.040.\u003c/li\u003e\n\u003cli\u003eLi J, Yang H-I, Yeh M-L, Le MH, Le AK, Yeo YH, et al. Association Between Fatty Liver and Cirrhosis, Hepatocellular Carcinoma, and Hepatitis B Surface Antigen Seroclearance in Chronic Hepatitis B. J Infect Dis. 2021;224:294\u0026ndash;302. https://doi.org/10.1093/infdis/jiaa739.\u003c/li\u003e\n\u003cli\u003eHui RWH, Seto W-K, Cheung K-S, Mak L-Y, Liu KSH, Fung J, et al. Inverse relationship between hepatic steatosis and hepatitis B viremia: Results of a large case-control study. J Viral Hepat. 2018;25:97\u0026ndash;104. https://doi.org/10.1111/jvh.12766.\u003c/li\u003e\n\u003cli\u003eZhu L, Jiang J, Zhai X, Baecker A, Peng H, Qian J, et al. Hepatitis B virus infection and risk of non-alcoholic fatty liver disease: A population-based cohort study. Liver Int. 2019;39:70\u0026ndash;80. https://doi.org/10.1111/liv.13933.\u003c/li\u003e\n\u003cli\u003eLee YB, Ha Y, Chon YE, Kim MN, Lee JH, Park H, et al. Association between hepatic steatosis and the development of hepatocellular carcinoma in patients with chronic hepatitis B. Clin Mol Hepatol. 2019;25:52\u0026ndash;64. https://doi.org/10.3350/cmh.2018.0040.\u003c/li\u003e\n\u003cli\u003eKim MN, Han K, Yoo J, Hwang SG, Ahn SH. Increased risk of hepatocellular carcinoma and mortality in chronic viral hepatitis with concurrent fatty liver. Aliment Pharmacol Ther. 2022;55:97\u0026ndash;107. https://doi.org/10.1111/apt.16706.\u003c/li\u003e\n\u003cli\u003eNakamoto N, Kanai T. Role of toll-like receptors in immune activation and tolerance in the liver. Front Immunol. 2014;5:221. https://doi.org/10.3389/fimmu.2014.00221.\u003c/li\u003e\n\u003cli\u003eZhang R-N, Pan Q, Zhang Z, Cao H-X, Shen F, Fan J-G. Saturated Fatty Acid inhibits viral replication in chronic hepatitis B virus infection with nonalcoholic Fatty liver disease by toll-like receptor 4-mediated innate immune response. Hepat Mon. 2015;15:e27909. https://doi.org/10.5812/hepatmon.15(5)2015.27909.\u003c/li\u003e\n\u003cli\u003eJohnson ES, Lindblom KR, Robeson A, Stevens RD, Ilkayeva OR, Newgard CB, et al. Metabolomic profiling reveals a role for caspase-2 in lipoapoptosis. J Biol Chem. 2013;288:14463\u0026ndash;75. https://doi.org/10.1074/jbc.M112.437210.\u003c/li\u003e\n\u003cli\u003eMalhi H, Bronk SF, Werneburg NW, Gores GJ. Free fatty acids induce JNK-dependent hepatocyte lipoapoptosis. J Biol Chem. 2006;281:12093\u0026ndash;101. https://doi.org/10.1074/jbc.M510660200.\u003c/li\u003e\n\u003cli\u003eXu H-Y, Chen Z-W, Li H, Zhou L, Liu F, Lv Y-Y, et al. 12-Deoxyphorbol 13-palmitate mediated cell growth inhibition, G2-M cell cycle arrest and apoptosis in BGC823 cells. Eur J Pharmacol. 2013;700:13\u0026ndash;22. https://doi.org/10.1016/j.ejphar.2012.11.015.\u003c/li\u003e\n\u003cli\u003eMachado M, Michelotti G, Pereira de Almeida T, Boursier J, Kruger L, Swiderska-Syn M, et al. Reduced Lipoapoptosis, Hedgehog Pathway Activation, and Fibrosis in Caspase-2 deficient Mice with Nonalcoholic Steatohepatitis. Gut. 2015;64:1148\u0026ndash;57. https://doi.org/10.1136/gutjnl-2014-307362.\u003c/li\u003e\n\u003cli\u003eBrenner D, Blaser H, Mak TW. Regulation of tumour necrosis factor signalling: live or let die. Nat Rev Immunol. 2015;15:362\u0026ndash;74. https://doi.org/10.1038/nri3834.\u003c/li\u003e\n\u003cli\u003eDostert C, Grusdat M, Letellier E, Brenner D. The TNF Family of Ligands and Receptors: Communication Modules in the Immune System and Beyond. Physiol Rev. 2019;99:115\u0026ndash;60. https://doi.org/10.1152/physrev.00045.2017.\u003c/li\u003e\n\u003cli\u003eAbiru S, Migita K, Maeda Y, Daikoku M, Ito M, Ohata K, et al. Serum cytokine and soluble cytokine receptor levels in patients with non-alcoholic steatohepatitis. Liver Int. 2006;26:39\u0026ndash;45. https://doi.org/10.1111/j.1478-3231.2005.01191.x.\u003c/li\u003e\n\u003cli\u003ePotoupni V, Georgiadou M, Chatzigriva E, Polychronidou G, Markou E, Zapantis Gakis C, et al. Circulating tumor necrosis factor-\u0026alpha; levels in non-alcoholic fatty liver disease: A systematic review and a meta-analysis. J Gastroenterol Hepatol. 2021;36:3002\u0026ndash;14. https://doi.org/10.1111/jgh.15631.\u003c/li\u003e\n\u003cli\u003eTiegs G, Horst AK. TNF in the liver: targeting a central player in inflammation. Semin Immunopathol. 2022;44:445\u0026ndash;59. https://doi.org/10.1007/s00281-022-00910-2.\u003c/li\u003e\n\u003cli\u003eVieira Barbosa J, Milligan S, Frick A, Broestl J, Younossi Z, Afdhal NH, et al. Fibrosis-4 Index as an Independent Predictor of Mortality and Liver-Related Outcomes in NAFLD. Hepatol Commun. 2022;6:765\u0026ndash;79. https://doi.org/10.1002/hep4.1841.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"virology-journal","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"virj","sideBox":"Learn more about [Virology Journal](http://virologyj.biomedcentral.com/)","snPcode":"12985","submissionUrl":"https://submission.nature.com/new-submission/12985/3","title":"Virology Journal","twitterHandle":"@VirologyJ","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Chronic Hepatitis B, Metabolic Dysfunction-Associated Steatotic Liver Disease, Apoptosis, TNFR1, Caspase-2","lastPublishedDoi":"10.21203/rs.3.rs-9179452/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-9179452/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBackground\u003c/h2\u003e \u003cp\u003eThe coexistence of chronic hepatitis B (CHB) and metabolic dysfunction\u0026ndash;associated steatotic liver disease (MASLD) is increasingly prevalent. Clinical and experimental evidence suggests an inverse association between hepatic steatosis and hepatitis B virus (HBV) replication; however, the underlying molecular mechanisms remain poorly defined. This study aimed to investigate the effect of free fatty acid\u0026ndash;induced steatosis on HBV replication and the associated apoptotic signaling pathways in vitro.\u003c/p\u003e\u003ch2\u003eMethods\u003c/h2\u003e \u003cp\u003eHepG2.2.15 cells, a stable HBV-producing hepatocyte cell line, were treated with a free fatty acid (FFA) mixture of sodium oleate and sodium palmitate at a 2:1 ratio to induce steatosis. Intracellular triglyceride content and Oil Red O staining were used to confirm lipid accumulation. Apoptosis was assessed by flow cytometry. The expression levels of tumor necrosis factor-alpha (TNF-α), tumor necrosis factor receptor 1 (TNFR1), Caspase-2, Caspase-8, and HBV DNA were analyzed before and after FFA treatment.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e \u003cp\u003eFFA treatment induced significant lipid accumulation in HepG2.2.15 cells, accompanied by increased apoptotic cell death. Steatotic cells exhibited significantly elevated levels of TNF-α, TNFR1, Caspase-2, and Caspase-8 compared with untreated controls. In parallel, intracellular HBV DNA levels were markedly reduced following steatosis induction.\u003c/p\u003e\u003ch2\u003eConclusions\u003c/h2\u003e \u003cp\u003eFree fatty acid\u0026ndash;induced steatosis in HepG2.2.15 cells is associated with activation of the TNF-α/TNFR1/Caspase-8/Caspase-2 apoptotic pathway and a concomitant reduction in HBV DNA levels. These findings suggest that lipid-induced apoptosis may contribute to the suppression of HBV replication in the context of metabolic stress.\u003c/p\u003e","manuscriptTitle":"Tumor Necrosis Factor Receptor 1-mediated Caspase-2 driven apoptosis reduces HBV DNA levels during free-fatty acid exposure in vitro","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2026-03-26 12:17:45","doi":"10.21203/rs.3.rs-9179452/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2026-05-02T13:05:43+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2026-04-19T14:01:59+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"203220289767288667878485789486041757139","date":"2026-04-05T06:08:46+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2026-03-24T05:27:22+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2026-03-23T22:43:16+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2026-03-23T22:42:23+00:00","index":"","fulltext":""},{"type":"submitted","content":"Virology Journal","date":"2026-03-20T13:32:35+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"virology-journal","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"virj","sideBox":"Learn more about [Virology Journal](http://virologyj.biomedcentral.com/)","snPcode":"12985","submissionUrl":"https://submission.nature.com/new-submission/12985/3","title":"Virology Journal","twitterHandle":"@VirologyJ","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"61332527-72b5-4560-9e2d-c722e580ac57","owner":[],"postedDate":"March 26th, 2026","published":true,"recentEditorialEvents":[{"type":"decision","content":"Revision requested","date":"2026-05-02T13:05:43+00:00","index":"","fulltext":""}],"rejectedJournal":[],"revision":"","amendment":"","status":"in-revision","subjectAreas":[],"tags":[],"updatedAt":"2026-05-02T13:10:46+00:00","versionOfRecord":[],"versionCreatedAt":"2026-03-26 12:17:45","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-9179452","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-9179452","identity":"rs-9179452","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.