An optimized protocol for in vitro regeneration and genetic transformation of broomcorn millet

preprint OA: closed CC-BY-4.0
📄 Open PDF Full text JSON View at publisher
Full text 116,852 characters · extracted from preprint-html · click to expand
An optimized protocol for in vitro regeneration and genetic transformation of broomcorn millet | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article An optimized protocol for in vitro regeneration and genetic transformation of broomcorn millet Zhaolan Cui, Wenmin Wei, Xinqi Han, Yuechen Wang, Juqing Jia, and 6 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4697063/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background Broomcorn millet has many advantages, such as abiotic stress resistance, a short growth cycle and high nutritional value. However, due to the lack of efficient genetic transformation methods for broomcorn millet, the characterization of genes related to important traits lags behind that of other crop species. Therefore, establishing efficient in vitro regeneration and genetic transformation methods for broomcorn millet is essential. Results In this study, we used mature seeds from the sequenced cultivar 'Longmi 4' as explants and optimized their in vitro regeneration and genetic transformation methods. The optimal hormone concentrations for embryogenic callus induction medium were 2.5 mg/L 2,4-D and 0.5 mg/L BAP. The optimal hormone concentrations for shoot regeneration media were 2 mg/L kinetin and 0.5 mg/L a-naphthaleneacetic acid. Additionally, the cocultivation time was 3 days, and the optimal hygromcin concentration for putative transgenic callus selection was 45 mg/L. The transgenic efficiency was 21.25% after our modification approach. Conclusions Here, we present a simple and highly efficient Agrobacterium -mediated genetic transformation protocol for broomcorn millet. Our work provides a tool for the characterization of genes related to important traits, as well as a new strategy for broomcorn millet breeding. Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Introduction Broomcorn millet ( Panicum miliaceum L.), or proso millet, which belongs to the Poaceae family, originated from northern China approximately 10 000 years ago [ 1 ]. It is cultivated in arid and semiarid areas with a high degree of drought and salt tolerance [ 2 – 4 ]. It also has a short growth cycle, with early-maturing varieties reaching maturity in 60 days [ 5 ]. In addition, its grains have high nutritional and medicinal value [ 6 – 8 ]. However, due to the lack of efficient genetic transformation methods for broomcorn millet, the characterization of genes related to these important traits lags behind that of other crop species. Agrobacterium -mediated genetic transformation is a natural plant genetic transformation system characterized by low copy numbers and genetic stability of exogenous genes in plants [ 9 ]. Initially, used for transgenic dicot plants, significant progress has been made over the past two decades in major graminaceous crops such as rice, maize, wheat, and other grasses [ 10 ]. Rice, as a model monocot plant, has undergone relatively systematic genetic transformation since the first Agrobacterium-mediated transformation in 1993 [ 11 ]. Researchers have optimized this system, achieving transformation efficiencies of up to 90% [ 12 , 13 ]. Unlike rice, genetic transformation in maize is greatly influenced by the type of callus and genotype, with immature embryos and the maize cultivar A188 being more easily transformed. Adjusting the spatial and temporal expression patterns of the Baby boom ( Bbm ) and Wuschel2 ( Wus2 ) genes has increased transformation efficiency in several commercial maize varieties, independent of genotype [ 14 ]. Other graminaceous crop species, including wheat and sorghum, still exhibit relatively low genetic transformation efficiencies. Kumar et al. [ 15 ] generated callus tissue from immature and mature bread wheat embryos, infected them with Agrobacterium , and successfully cultivated stable transgenic plants, with transformation efficiencies of 14.9% in immature embryos and 9.8% in mature embryos. Similarly, the genetic transformation efficiency of sorghum is strongly influenced by its genotype, with transformation rates ranging from 0.3–8.3% [ 16 ]. In vitro regeneration and genetic transformation of broomcorn millet are still in the early stages. Only a few research teams have attempted to construct in vitro regeneration systems using different explants. In 1973, Rangan et al. [ 17 ] first used the mesocotyl as an explant to culture broomcorn millet in vitro, successfully inducing embryogenic callus but failing to obtain regenerated plants. Later, Rangan and Vasil [ 18 ] induced embryogenic calli using floral primordia from young panicles and successfully obtained complete plants. Recently, Liu used mature embryos from broomcorn millet seeds as explants, transformed them with Agrobacterium , and successfully established a genetic transformation system [ 19 , 20 ]. Liu reported significant differences in regeneration ability among different plant genotypes. The average transformation efficiency for 'Longmi 4', which is a widely cultivated genotype and a sequencing cultivar, was 4%. The low efficiency greatly limits the application of advanced technologies such as gene editing in this crop. Therefore, establishing efficient in vitro regeneration and genetic transformation methods for broomcorn millet is essential. In this study, we used 'Longmi 4' mature seeds as explants, compared the components of the tissue culture media, optimized the in vitro regeneration system of broomcorn millet, and explored two important factors affecting Agrobacterium -mediated transformation. The goal was to establish a highly efficient in vitro regeneration and genetic transformation system for broomcorn millet. Materials and Methods Plant Materials Mature seeds of the broomcorn millet cultivar 'Longmi 4' used in this study were obtained from the College of Agriculture, Inner Mongolia Agricultural University. Embryogenic callus induction The dry seeds were carefully dehusked with abrasive paper. Dehusked and healthy seeds were sterilized in 75% (v/v) ethanol for 1 min, followed by 10% sodium hypochlorite for 5 min, after which they were washed with sterilized water five times and subsequently air-dried on sterile filter paper. The sterilized seeds were then inoculated on callus induction medium (MCI) adapted from rice [ 21 ]. The MCI medium consisted of MS salt containing all vitamins, 300 mg/L casein enzymatic hydrolysate, 600 mg/L L-proline, 30 g/L maltose, and 3 g/L Phytagel. The pH was adjusted to 5.8 with 0.1 M NaOH before autoclaving. To identify the optimal callus induction medium for 'Longmi 4', four different concentrations of 2,4-dichlorophenoxyacetic acid (2,4-D) and 6-benzyla minopurine (BAP) were tested using an orthogonal array L16(4 2 ) (Table 1 ). Twenty seeds were placed on each Petri dish, and 5 plates were used for each treatment. The plates were incubated at 26°C ± 2°C in the dark. Primary calli appeared after 2 weeks, and embryogenic calli were obtained after subculturing for another 2 weeks. The embryogenic callus induction rate was calculated as (number of embryogenic calli/number of seeds) × 100%. Table 1 Orthogonal experiment results of embryogenic callus induction Treatments Factors Induction rate(%) 2,4-D (mg/L) BAP (mg/L) 1 1(2.0) 1(0.0) 30.00% 2 1 2(0.25) 33.35% 3 1 3(0.5) 46.65% 4 1 4(1.0) 40.30% 5 2(2.5) 1 46.65% 6 2 2 61.25% 7 2 3 66.66% 8 2 4 63.35% 9 3(3.0) 1 50.00% 10 3 2 46.70% 11 3 3 56.65% 12 3 4 46.70% 13 4(3.5) 1 36.65% 14 4 2 40.00% 15 4 3 56.65% 16 4 4 23.35% Plant regeneration The embryogenic callus was then transferred to shoot regeneration medium (SRM) to induce shoot formation. The SRM consisted of MS salt with vitamins, 2 mg/L kinetin, 0.5 mg/L a-naphthaleneacetic acid (NAA), 30 g/L maltose, and 3 g/L Phytagel, pH 5.8. To optimize the cytokinin concentration in SRM media, kinetin and NAA were tested at four different concentrations using an L16(4 2 ) orthogonal array (Table 2 ). Ten embryogenic calluses were placed on each Petri dish, and 3 plates were used for each treatment. The plates were incubated at 26°C ± 2°C under a 16/8 h light/dark cycle. After 2 weeks, the shoot grew to 1–2 cm, and the shoot was transferred to rooting media consisting of half-strength MS salt supplemented with 30 g/L sucrose and 3 g/L Phytagel. The regeneration rate was calculated as (number of regenerated plants/number of embryogenic calli) × 100%. Table 2 Variance (ANOVA) analysis of the results of the orthogonal experiment results Hormones SS DF MS F P 2,4-D 0.126 3 0.042 8.498 0.005** 6BA 0.058 3 0.019 3.951 0.047* Residual 0.044 9 0.005 Binary vector The binary vector pRHVcGFP was kindly provided by Dr. Wang Guoliang [ 22 ]. Green fluorescent protein (GFP) was used as the reporter gene under the control of the maize ubiquitin ( Zmubi ) promoter, and the hygromycin phosphotransferase ( hpt ) gene was used as the selection marker gene under the control of the cauliflower mosaic virus 35S promoter. Determination of hygromycin concentration To determine the appropriate hygromycin concentration for selecting putative transformants, the calli were cultured in MCI media supplemented with different hygromycin concentrations (0, 10, 15, 20, 25, 30, 35, 40, 45, and 50 mg/L). Ten calli were cultured on a Petri dish plate (90 mm), and each treatment was repeated three times. After 4 weeks of cultivation at 26°C ± 2°C in the dark, the survival rate of the calli was recorded. Genetic transformation The transformation method used in this study was modified from a rice transformation protocol [ 21 ]. pRHVcGFP was transformed into Agrobacterium tumefaciens EHA105. Single colonies were scraped from the plate and inoculated into 100 mL of LB liquid media supplemented with 50 mg/L kanamycin and 35 mg/L rifampicin at 28°C and 200 rpm until an OD of 1.0 was reached. The cells were then centrifuged at 5000 × g for 10 min and resuspended in 100 ml of inflation medium (MS salt, 68 g/L sucrose, 36 g/L glucose, 3 g/L KCl, 4 g/L MgCl 2 , pH 5.2) supplemented with 150 µM acetosyringone. The final OD value was adjusted to 0.5. The suspension culture was incubated at 28°C and 200 rpm for 1 hour. The embryogenic calli were immersed in suspension medium for 30 min and then dried on sterile filter paper. The infected calli were placed in cocultivation media (RSM media supplemented with 150 µM acetosyringone, pH 5.2) and incubated in the dark at 27°C for 1, 3, or 5 days. After the cocultivation period, the calli were washed 3 times with 300 mg/L of Timentine in sterile distilled water, dried on sterile filter paper, and then transferred to RSM media supplemented with 50 mg/L hygromycin and 300 mg/L Timentine in the dark at 27°C. After 3–4 weeks of selection, the healthy and proliferated calli were transferred onto shoot regeneration media supplemented with 20 mg/L hygromycin or 300 mg/L Timentine and cultured at 26°C under a 16/8 h light/dark cycle for approximately 4 weeks. Subsequently, adventitious shoots were transferred to rooting media supplemented with 300 mg/L of Timentine (pH 5.2) for root induction. After another 4 weeks, the plantlets with well-developed roots were transplanted into soil to generate seeds at 26°C under a light/dark cycle of 12 h/12 h. PCR analysis and GFP observation of transgenic plants Genomic DNA from leaves was extracted according to the protocol of the TAINGEN Plant Genomic DNA Miniprep Kit (DP305, Tiangen, Beijing). PCR amplification was performed using the vector-specific primers 35S-hpt-F/35S-hpt-R (35S-hpt-F: CGGTCGGCATCTACTCTATT and 35S-hpt-R: AAACCTCCTCGGATTCCATT) to confirm that the transgenic seedlings were positive. The PCR mixture consisted of 50–100 ng of DNA template, 2.5 µl of 2× buffer, 1 µl of each primer and 0.5 µl of Taq DNA polymerase unit. The volume was adjusted to 25 µl with sterile double distilled water. The PCR products were subjected to gel electrophoresis on a 1% (w/v) agarose gel. For GFP observation, the stems and roots of the transgenic plants were viewed and photographed under blue light (450 nm) with a blue light source (LUYOR-3415RG). Statistical analysis All the data are presented as the means ± SDs from three repeated experiments. The transformation rate was calculated as (number of positive transgenic seedlings/number of embryogenic calli) × 100%. Results Optimization of embryogenic callus induction medium To identify the optimal embryogenic callus induction medium for 'Longmi 4', 2,4-D and BAP were tested at four different concentrations using an orthogonal array L16(4 2 ) (Table 1 ). Different hormone concentrations and combinations significantly affected the CIR. Treatment 7 achieved the highest embryogenic callus induction rate of 66.66%, with concentrations of 2.5 mg/L 2,4-D and 0.5 mg/L BAP. The lowest induction rate of 23.35% was observed at concentrations of 3.5 mg/L 2,4-D and 1.0 mg/L BAP. Interestingly, 2.0 mg/L 2,4-D without BAP produced only a 30% induction rate. Two-way ANOVA was carried out, and the results showed that 2,4-D had a highly significant impact on the CIR, while BAP had a significant effect (Table 2 ). The optimal CIM was determined to be 4.33 g L − 1 MS salt, 300 mg L − 1 casein enzymatic hydrolysate, 600 mg L − 1 L-proline, 30 g L − 1 maltose, 3 g L − 1 Phytagel, 2.5 mg L − 1 2,4-D, and 0.5 mg L − 1 BAP at pH 5.8. Optimization of shoot regeneration medium To optimize the cytokinin concentration in SRM media, kinetin and NAA were tested at four different concentrations using an L16(4 2 ) orthogonal array (Table 3 ). Ten embryogenic calluses were placed on each Petri dish (90 mm), and 3 plates were used for each treatment. The regeneration rate of shoot regeneration varied significantly with different treatments (Table 3 ). The highest regeneration rate from treatment 5 (2.5 mg L − 1 2,4-D and 0.5 mg L − 1 BAP) reached 59.55%, while the lowest was 18% in treatment 5. The statistical analysis showed that 2,4-D had a significant effect on the shoot regeneration rate, while NAA was not effective (Table 4 ). The optimal shoot regeneration media were thus determined to be 4.33 g/L MS, 30 g/L sucrose, 3 g/L Phytagel, 2.0 mg/L kinetin, 0.5 mg/L NAA, and 15% coconut milk at pH 5.8. Table 3 Orthogonal experiment results of shoot regeneration Treatments Factors Induction rate(%) NAA(mg/L) Kinetin(mg/L) 1 1(0.0) 1(1.0) 18.00 2 1 2(1.5) 25.00 3 1 3(2.0) 38.46 4 1 4(2.5) 33.33 5 2(0.25) 1 20.00 6 2 2 23.81 7 2 3 45.45 8 2 4 31.25 9 3(0.5) 1 41.67 10 3 2 33.33 11 3 3 59.55 12 3 4 45.45 13 4(1.0) 1 27.78 14 4 2 29.41 15 4 3 41.25 16 4 4 26.31 Table 4 Variance (ANOVA) analysis of the results of the orthogonal experiment Hormones SS DF MS F P NAA 757.179 3 252.393 6.733 0.011 BAP 957.559 3 319.186 8.515 0.005 Residual 337.379 9 37.487 Determination of hygromycin concentration for selection To determine the optimal hygromycin concentration for selecting putative transformants, the callus pieces were cultured on MCI media supplemented with different concentrations of hygromycin (0, 10, 15, 20, 25, 30, 35, 40, 45, and 50 mg/L) (Fig. 1 ). After culturing for 4 weeks, the calli on media supplemented with 45 mg/L or 50 mg/L hygromycin were browned to death, while the calli on media supplemented with no hygromycin continued to proliferate (Fig. 1 A, I and J). From 10 mg/L to 40 mg/L, the calli became brown, but some of the calli survived (Fig. 1 B-H). The survival rate decreased as the concentration increased (Fig. 2 ). Therefore, our results indicate that 45 and 50 mg/L hygromycin are suitable for selecting putative transformants. Determination of cocultivation time Previous studies have indicated that increasing the cocultivation time enhances Agrobacterium transformation efficiency but results in Agrobacterium outgrowth [ 23 – 25 ]. To determine the optimal balance between transformation efficiency and contamination, cocultivation periods of 1, 3, and 5 days were tested. The number of calli that generated hygromycin-resistant shoots was recorded, and the results showed that a cocultivation period of 3 days produced the greatest number of transgenic shoots (Fig. 3 A and 3 B). Compared with the two conditions, 5 days of cocultivation induced more contamination (Fig. 3 C). A greater transformation rate was obtained after 3 days (Fig. 4 ). Genetic transformation Mature 'Longmi 4' seeds were used as explants for callus induction (Fig. 5 A). White and friable embryogenic calli were obtained after culture on MCI media for 4–6 weeks (Fig. 5 B). embryogenic calli were immersed in liquid suspension media for 30 min and then incubated in cocultivation media at 22°C for 3 days in the dark (Fig. 5 C and 5 D). The infected calli were transferred to selection media supplemented with 50 mg/L hygromycin. After 3–4 weeks of selection, the successfully transformed callus appeared white and healthy, while the nontransformed tissue had browned until death (Fig. 5 E). Hygromycin-resistant calli were transferred to shoot regeneration media supplemented with 10 mg/L hygromycin at 26°C under a 16 h/8 h light/night cycle for 4–5 weeks (Fig. 5 F). Subsequently, adventitious shoots were transferred to rooting media for root induction (Fig. 5 G). After 2–3 weeks, the plantlets with well-developed roots were transplanted into the soil, and the seeds were harvested after 6 to 8 weeks (Fig. 5 H). The complete transformation cycle lasted approximately 18 to 25 weeks. Screening and GFP observation of transgenic plants PCR amplification of a 1424 bp fragment was performed to characterize 12 putative transgenic plants. The pRHVcGFP vector plasmid and wild-type genomic DNA were used as positive and negative controls, respectively. As shown in Fig. 6 , 11 lines were confirmed to be positive transgenic plants. In addition, GFP fluorescence was detected in the roots and stems of these transgenic plants (Fig. 7 ). Green fluorescence could not be detected in the leaves of the transgenic plants because of chlorophyl1 accumulation. We performed three rounds of transformation, and the average transformation rate was 21.25% (Table 5 ). Table 5 Orthogonal experiment results of embryogenic callus induction Experiment 1 2 3 Number of infected calli 80 80 80 Number of regeneration calli 38 40 39 Positive plants 13 17 15 Transformation efficiency (%) 16.25 21.25 18.75 Regeneration efficiency(%) 47.5 50 48.75 Discussion Plant intro regeneration is sometimes highly genotype specific. Different regeneration rates were found among different broomcorn millet genotypes [ 19 ]. Some cultivars, such as 'Hongmi' and 'Qingyanghongying', had much greater embryogenic callus induction rates than 'Longmi 4', the elite germplasm and a sequencing cultivar. Therefore, in this study, we used mature 'Longmi 4' seeds as explants and optimized their in vitro regeneration and genetic transformation methods. Optimization of the in vitro regeneration system Several research teams have attempted to construct in vitro regeneration systems for brromcorn millet using different explants, such as mesocotyl, immature inflorescence and mature seeds [ 16 – 19 ]. Mature seeds with high regeneration efficiency have been used for in vitro regeneration of several monocots, such as rice, sorghum and foxtail millet [ 16 , 21 , 23 ]. In this study, we used mature seeds as explants due to their convenience and flexibility. The type and concentration of phytohormones are critical factors affecting the efficiency of embryogenic callus induction in in vitro plant regeneration [ 23 – 25 ]. In rice and foxtail millet, a combination of auxin (2,4-D) and cytokinins (BAP or NAA) was more effective than auxin (2,4-D) alone. In this study, 2,4-D and BAP were tested at four different concentrations using an orthogonal array L16(4 2 ) (Table 1 ). Statistical analysis of this orthogonal experiment showed that 2,4-D had a highly significant impact on the CIR (Table 2 ). We found that a higher concentration of 2,4-D generated a greater induction rate. Shoot regeneration efficiency is a major bottleneck in broomcorn millet. In a recent study of broomcorn millet genetic transformation, the regeneration efficiency was 3.5%-10%, and 3.0 mg/L BAP and 0.2 mg/L 2,4-D were used in the regeneration media[ 20 ]. Kinetin and NAA were used for the induction of rice shoot regeneration, resulting in a 54–77% regeneration frequency [ 12 ]. In our study, the regeneration rate increased to 59.55% when 2.0 mg/L kinetin and 0.5 mg/L NAA were used for shoot induction. Optimization of Agrobacterium -mediated genetic transformation in broomcorn millet Agrobacterium -mediated transformation is widely used in plant genetic transformation due to its high efficiency, effectiveness, simplicity, genetic stability, and low cost [ 9 ]. It is extensively applied in several monocot species, such as rice, maize, sorghum, and foxtail millet [ 12 – 16 , 23 ]. However, genetic information on the transformation of broomcorn millet is still limited. The Agrobacterium -mediated genetic transformation methods should be optimized for broomcorn millet, especially for the sequenced cultivar 'Longmi 4'. Various studies have attempted to increase the efficiency of genetic transformation in major crop species and could be applied in broomcorn millet [ 9 – 12 ]. In this study, we optimized the cocultivation time and hygromycin concentration for selection. The optimal duration of cocultivation is crucial for facilitating T-DNA transfer with the assistance of acetosyringone [ 24 ]. In this study, 3 days of cocultivation was determined to be the optimal cocultivation period, which was consistent with the results in other graminaceous plants [ 25 – 28 ]. The selection of an appropriate screening agent concentration is crucial for successful Agrobacterium -mediated transformation of embryogenic calli. During the transformation process, only a few embryogenic callus tissues can accept and integrate exogenous DNA, making the selection of transgenic callus tissue vital for effectively detecting transgenic components in regenerated plants. Additionally, antibiotic selection is critical for the success rate of transgenic plants. Excessively high concentrations of hygromycin can cause browning and death of embryogenic callus tissues, whereas concentrations that are too low may not achieve effective selection. Different species require varying selection conditions; for example, foxtail millet uses lower hygromycin concentrations (8 mg/L)[ 27 ], while switchgrass requires higher concentrations (75 mg/L)[ 28 ]. We tested various hygromycin concentrations ranging from 10 to 50 mg/L and ultimately selected 45 mg/L based on comparative results. We performed three rounds of transformation, and the average transformation rate was 21.25%. Conclusions In this study, we provide an optimized protocol for in vitro regeneration and genetic transformation of broomcorn millet. Mature 'Longmi 4' seeds were used as explants. We established an efficient in vitro regeneration method by optimizing the type and concentration of phytohormones in the media and obtained a callus induction rate of 66.5% and a shoot regeneration rate of 56.7%. Additionally, the cocultivation time was 3 days, and the optimal hygromcin concentration for putative transgenic callus selection was 45 mg/L. The transgenic efficiency was 21.25%, which is much greater than that reported in previous studies. Our work provides an efficient tool for the characterization of genes related to important traits, as well as a new strategy for broomcorn millet breeding. Abbreviations 2,4-D 2,4-dichlorophenoxyacetic acid BAP 6-benzylaminopurine NAA a-naphthaleneacetic acid MS Murashige and Skoog Medium MCI callus induction medium SRM shoot regeneration medium GFP green fluorescent protein, hpt:hygromycin phosphotransferase Bbm Baby boom Wus2 Wuschel2. Declarations Acknowledgements The authors would like to thank Dr. Shihua Guo, who provided 'Longmi 4' seeds for our experiment. Dr. Guoliang Wang for kindly sharing the binary vector pRHVcGFP. Funding This study was supported by Natural Science Foundation of Inner Mongolia (2021ZD04), The Central Government Guiding Special Funds for the Development of Local Science and Technology (2020ZY0005), Key Research and Development Program of Shanxi Province (2022ZDYF110), Special Project on Crop Germplasm Resources Protection and Utilization of Ministry of Agriculture (19240451), and National Science and Technology Resource Sharing Service Platform Project (NCGRC-2024-27). Availability of data and material All data generated or analysed during this study are included in this manuscript. Authors’ contributions ZLC, JQJ, DML, and LZ contributed to the writing of the paper. ZLC, WMW, XQH, and YCW developed and carried out the experiments. HGW, LLL, LW, and JL assisted in experimental design and data analysis. All authors read and approved the final manuscript. Competing interests The authors declare that they have no competing interests. Consent for publication Not applicable. Ethics approval and consent to participate Not applicable. References Hunt HV, Rudzinski A, Jiang H, Wang R, Thomas MG, Jones MK. Genetic evidence for a western Chinese origin of broomcorn millet ( Panicum miliaceum ). Holocene. 2018;28:1968–78. Rajput SG, Santra DK, Schnable J. Mapping QTLs for morpho-agronomic traits in proso millet ( Panicum miliaceum L.). Mol. Breed. 2016;36–37. Liu MX, Qiao ZJ, Zhang S, Wang YY, Lu P. Response of broomcorn millet ( Panicum miliaceum L.) genotypes from semiarid regions of China to salt stress. Crop J. 2015;3:57–66. Yuan Y, Liu C, Gao Y, et al. Proso millet ( Panicum miliaceum L.): A potential crop to meet demand scenario for sustainable saline agriculture. J Environ Manage. 2021;296:113216. Boukail S, Macharia M, Miculan M, Masoni A, Calamai A, Palchetti E, Dell'Acqua M. Genome wide association study of agronomic and seed traits in a world collection of proso millet ( Panicum miliaceum L ). BMC Plant Biol. 2021;21:330. Kumar A, Tomer V, Kaur A, Kumar V, Gupta K. Millets: A solution to agrarian and nutritional challenges. Agric Food Secur. 2018;7:31. Kumar SR, Sadiq MB, Anal AK. Comparative study of physicochemical and functional properties of pan and microwave cooked underutilized millets (proso and little). LWT. 2020;128:109465. Marti A, Tyl C. Capitalizing on a double crop: Recent advances in proso millet's transition to a food crop. Compr Rev Food Sci Food Saf. 2021;20:819–39. Dai S, Zheng P, Marmey P, Zhang S, Tian W, Chen S, Beachy RN, Fauquet C. Comparative analysis of transgenic rice plants obtained by Agrobacterium -mediated transformation and particle bombardment. Mol Breed. 2001;7:25–33. Singh RK, Prasad M. Advances in Agrobacterium tumefaciens-mediated genetic transformation of graminaceous crops. Protoplasma. 2016;253(3):691–707. Chan MT, Chang HH, Ho SL, Tong WF, Yu SM. Agrobacterium -mediated production of transgenic rice plants expressing a chimeric alpha-amylase promoter/beta-glucuronidase gene. Plant Mol Biol. 1993;22:491–506. Zhang Y, Li J, Gao C. Generation of stable transgenic Rice ( Oryza sativa L.) by Agrobacterium -mediated transformation. Curr Protoc Plant Biol. 2016;1:235–46. Wu C, Sui Y. Efficient and fast production of transgenic rice plants by Agrobacterium -mediated transformation. Methods Mol Biol. 2019;1864:95–103. Lowe K, Wu E, Wang N, Hoerster G, Hastings C, Cho MJ, Scelonge C, Lenderts B, Chamberlin M, Cushatt J, Wang L, Ryan L, Khan T, Chow-Yiu J, Hua W, Yu M, Banh J, Bao Z, Brink K, Igo E, Rudrappa B, Shamseer PM, Bruce W, Newman L, Shen B, Zheng P, Bidney D, Falco C, Register J, Zhao ZY, Xu D, Jones T, Gordon-Kamm W. Morphogenic Regulators Baby boom and Wuschel Improve Monocot Transformation. Plant Cell. 2016;28:1998–2015. Kumar R, Mamrutha HM, Kaur A, Venkatesh K, Sharma D, Singh GP. Optimization of Agrobacterium -mediated transformation in spring bread wheat using mature and immature embryos. Mol Biol Rep. 2019;46:1845–53. Wu E, Zhao ZY. Agrobacterium-Mediated Sorghum Transformation. Methods Mol Biol. 2017;1669:355–64. Rangan T. Morphogenic investigations on tissue cultures of Panicum miliaceum[J]. Z fü Pflanzenphysiologie. 1973;72:456–59. Rangan TS, Vasil LK. Somatic embryogenesis and plant regeneration in tissue cultures of Panicum miliaceum L. and Panicum miliare Lamk. Z Pflanzenphysiol Bd. 1983;109:41–8. Liu Y, Cheng Z, Chen W, Wu C, Chen J, Sui Y. Establishment of genome-editing system and assembly of a near-complete genome in broomcorn millet. J Integr Plant Biol. doi.org/10.1111/jipb.13664 . Bai Y, Liu S, Bai Y, Xu Z, Zhao H, Zhao H, Lai J, Liu Y, Song W. Application of CRISPR/Cas12i.3 for targeted mutagenesis in broomcorn millet (Panicum miliaceum L). J Integr Plant Biol. doi.org/10.1111/jipb.13669 . Sahoo KK, Tripathi AK, Pareek A, Sopory SK, Singla-Pareek SL. An improved protocol for efficient transformation and regeneration of diverse indica rice cultivars. Plant Methods. 2011;7:49–49. He F, Zhang F, Sun W, Ning Y, Wang GL. A Versatile Vector Toolkit for Functional Analysis of Rice Genes. Rice. 2018;11:27. Sood P, Singh RK, Prasad M. An efficient Agrobacterium-mediated genetic transformation method for foxtail millet ( Setaria italica L). Plant Cell Rep. 2020;39:511–25. Priya AM, Pandian SK, Manikandan R. The effect of different antibiotics on the elimination of Agrobacterium and high frequency Agrobacterium -mediated transformation of indica rice ( Oryza sativa L). Czech J Genet Plant Breed. 2012;48:120–30. Zhang Y, Qin C, Liu S, Xu Y, Li Y, Zhang Y, Song Y, Sun M, Fu C, Qin Z, Dai S. Establishment of an efficient Agrobacterium-mediated genetic transformation system in halophyte Puccinellia tenuiflora. Mol Breed. 2021;41:55. Nguyen DQ, Van Eck J, Eamens AL, Grof CPL. Robust and Reproducible Agrobacterium -Mediated Transformation System of the C4 Genetic Model Species Setaria viridis . Front Plant Sci. 2020;11:281. Santos CM, Romeiro D, Silva JP, Basso MF, Molinari HBC, Centeno DC. An improved protocol for efficient transformation and regeneration of Setaria italica . Plant Cell Rep. 2020;39:501–10. Ramamoorthy R, Kumar PP. A simplified protocol for genetic transformation of switchgrass ( Panicum virgatum L). Plant Cell Rep. 2012;31:1923–31. Additional Declarations No competing interests reported. Supplementary Files supplimentaryFigures.rar Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4697063","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":334521066,"identity":"403ae56c-4a7f-4c71-9918-64127c5b7cf6","order_by":0,"name":"Zhaolan Cui","email":"","orcid":"","institution":"Shanxi Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Zhaolan","middleName":"","lastName":"Cui","suffix":""},{"id":334521067,"identity":"d465cca8-9a2f-4333-8783-bc98bcb14991","order_by":1,"name":"Wenmin Wei","email":"","orcid":"","institution":"Shanxi Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Wenmin","middleName":"","lastName":"Wei","suffix":""},{"id":334521068,"identity":"0af2cd0f-e4b7-4263-aeb3-9da95ce90ab7","order_by":2,"name":"Xinqi Han","email":"","orcid":"","institution":"Shanxi Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Xinqi","middleName":"","lastName":"Han","suffix":""},{"id":334521069,"identity":"e33fe215-4687-4dba-9ff9-6e5a677de1c7","order_by":3,"name":"Yuechen Wang","email":"","orcid":"","institution":"Shanxi Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Yuechen","middleName":"","lastName":"Wang","suffix":""},{"id":334521070,"identity":"36ca436e-f152-4599-8e38-771a41d36aff","order_by":4,"name":"Juqing Jia","email":"","orcid":"","institution":"Shanxi Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Juqing","middleName":"","lastName":"Jia","suffix":""},{"id":334521071,"identity":"78d78fae-b613-41a3-9b20-460f067910b4","order_by":5,"name":"Haigang Wang","email":"","orcid":"","institution":"Shanxi Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Haigang","middleName":"","lastName":"Wang","suffix":""},{"id":334521072,"identity":"e48834d5-693c-4709-8bee-38353e72bc04","order_by":6,"name":"Longlong Liu","email":"","orcid":"","institution":"Shanxi Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Longlong","middleName":"","lastName":"Liu","suffix":""},{"id":334521073,"identity":"f43c93d2-84b1-406b-b260-2f3738a71166","order_by":7,"name":"Lun Wang","email":"","orcid":"","institution":"Shanxi Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Lun","middleName":"","lastName":"Wang","suffix":""},{"id":334521074,"identity":"685d47ab-87d8-482d-953b-7ddcf6b902c3","order_by":8,"name":"Jun Li","email":"","orcid":"","institution":"Inner Mongolia University","correspondingAuthor":false,"prefix":"","firstName":"Jun","middleName":"","lastName":"Li","suffix":""},{"id":334521075,"identity":"1ce8b68a-9c4b-4541-a67e-006ad06da310","order_by":9,"name":"Dongming Li","email":"","orcid":"","institution":"Inner Mongolia University","correspondingAuthor":false,"prefix":"","firstName":"Dongming","middleName":"","lastName":"Li","suffix":""},{"id":334521076,"identity":"717058bd-6b63-4c26-baec-367b15156347","order_by":10,"name":"Li Zhang","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA5ElEQVRIie3PsQrCMBCA4QuBTME6XqjoKwSE6uOkCLooOEkHUUGxg4irog/RSVwl0Kni6qiLs4JIR9vNqe0omH+46T64AzCZfjFMRx/HK0qPV+UNixKJZOOzlrxGYWECJDhzR9xmNF/UttP77SWbVGpwPHfCwPIXKpOQXdioVyQyoaF9cQ8VwOgUZBKKyrFRIi9pCC9uxJK/etmEYeedEgRN5n13TvMJx64jHhJlWVMGhQhid2Ana0pMWXJkFPLcX2rrzl7E3khZ1vn5jL1h1fKX2SSN8u9Lc9fTSFxozWQymf62D902Qciy9i0SAAAAAElFTkSuQmCC","orcid":"","institution":"Shanxi Agricultural University","correspondingAuthor":true,"prefix":"","firstName":"Li","middleName":"","lastName":"Zhang","suffix":""}],"badges":[],"createdAt":"2024-07-06 13:51:38","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4697063/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4697063/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":61660578,"identity":"029fe85d-d743-46a4-a788-5de3ea89a338","added_by":"auto","created_at":"2024-08-02 14:39:54","extension":"jpeg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":275382,"visible":true,"origin":"","legend":"\u003cp\u003eCultivation of callus on SRM medium containing different concentrations of hygromycin \u0026nbsp;\u003cstrong\u003ea \u003c/strong\u003eControl, \u003cstrong\u003eb\u003c/strong\u003e 10 mg L\u003csup\u003e-1\u003c/sup\u003e, \u003cstrong\u003ec \u003c/strong\u003e15 mg L\u003csup\u003e-1 \u003c/sup\u003e, \u003cstrong\u003ed\u003c/strong\u003e 20 mg L\u003csup\u003e-1\u003c/sup\u003e, \u003cstrong\u003ee\u003c/strong\u003e 25 mg L\u003csup\u003e-1\u003c/sup\u003e, \u003cstrong\u003ef \u003c/strong\u003e30 mg L\u003csup\u003e-1\u003c/sup\u003e, \u003cstrong\u003eg\u003c/strong\u003e 35 mg L\u003csup\u003e-1\u003c/sup\u003e, \u003cstrong\u003eh \u003c/strong\u003e40 mg L\u003csup\u003e-1\u003c/sup\u003e,\u003cstrong\u003e i \u003c/strong\u003e45 mg L\u003csup\u003e-1\u003c/sup\u003e, \u003cstrong\u003ej \u003c/strong\u003e50 mg L\u003csup\u003e-1\u003c/sup\u003e\u003c/p\u003e","description":"","filename":"Fig.1.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-4697063/v1/f56d83e4309bbbcfb7241b5f.jpeg"},{"id":61660156,"identity":"e13a07ea-b365-47eb-894c-e15fe041d760","added_by":"auto","created_at":"2024-08-02 14:31:54","extension":"jpeg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":25718,"visible":true,"origin":"","legend":"\u003cp\u003eThe survival rates of calli at different concentrations of hygromycin\u003c/p\u003e","description":"","filename":"Fig.2.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-4697063/v1/6f462842d3808c20a81b4523.jpeg"},{"id":61660159,"identity":"c9f70d74-2c17-4b5c-a743-a5853c80b19b","added_by":"auto","created_at":"2024-08-02 14:31:54","extension":"jpeg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":98388,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003eAgrobacterium \u003c/em\u003einfected Calli under different co-cultivation time \u003cstrong\u003ea \u003c/strong\u003eone day, \u003cstrong\u003eb\u003c/strong\u003e three days, \u003cstrong\u003ec\u003c/strong\u003e five days\u003c/p\u003e","description":"","filename":"Fig.3.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-4697063/v1/509d4ca0596a89046a9dc69e.jpeg"},{"id":61660157,"identity":"d4b4ee5e-c84e-4f37-84cf-817014d782b0","added_by":"auto","created_at":"2024-08-02 14:31:54","extension":"jpeg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":16892,"visible":true,"origin":"","legend":"\u003cp\u003eThe transformation rates of infected calli under different co-cultivation time\u003c/p\u003e","description":"","filename":"Fig.4.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-4697063/v1/a4c3f8ef7e2cb08977bad6c3.jpeg"},{"id":61660161,"identity":"423db7f6-a8d2-4609-b248-75ef334f1f35","added_by":"auto","created_at":"2024-08-02 14:31:55","extension":"jpeg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":198227,"visible":true,"origin":"","legend":"\u003cp\u003eFlow chart of \u003cem\u003eAgrobacterium\u003c/em\u003e-mediated genetic transformation in broomcorn millet\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ea\u003c/strong\u003eLongmi 4 seeds were inoculated in induction medium MCI, \u003cstrong\u003eb\u003c/strong\u003e Embryonic callus after 4-6 week, \u003cstrong\u003ec \u003c/strong\u003eEmbryonic callus immersed in \u003cem\u003eAgrobacterium\u003c/em\u003e, \u003cstrong\u003ed \u003c/strong\u003eCo-cultivation of infected embryonic callus, \u003cstrong\u003ee\u003c/strong\u003e After 3-4 weeks of selection, transformed callus was white and healthy, while non-transformed tissue was browned to death, \u003cstrong\u003ef \u003c/strong\u003eRegeneration buds in differentiation medium, \u003cstrong\u003eg\u003c/strong\u003eRegenerated seedlings in rooting medium, \u003cstrong\u003eh\u003c/strong\u003e Positive transgenic plants flowering\u003c/p\u003e","description":"","filename":"Fig.5.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-4697063/v1/743bf201d6efacce523b035c.jpeg"},{"id":61660163,"identity":"f585b2c3-f567-4c56-bf4a-1c7a6d8fa1c7","added_by":"auto","created_at":"2024-08-02 14:31:55","extension":"jpeg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":121626,"visible":true,"origin":"","legend":"\u003cp\u003eGFP fluorescence observation in T0 transgenic plants\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ea \u003c/strong\u003eGFP fluorescence was observed in the root of a transgenic plant, \u003cstrong\u003eb\u003c/strong\u003e the same root was visualized under bright light, \u003cstrong\u003ec\u003c/strong\u003e GFP fluorescence was observed in the stem of a transgenic plant, \u003cstrong\u003ed\u003c/strong\u003e the same stem was visualized under bright light\u003c/p\u003e","description":"","filename":"Fig.6.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-4697063/v1/45c8cfdcc7d6354edab0eae8.jpeg"},{"id":61660579,"identity":"1fbc3d47-5ae4-42c6-bde3-1b91b0221925","added_by":"auto","created_at":"2024-08-02 14:39:55","extension":"jpeg","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":46607,"visible":true,"origin":"","legend":"\u003cp\u003ePCR analysis of the transgenic lines using CaMV35S-hygromycin primers\u003c/p\u003e\n\u003cp\u003eM marker, Line 1 was blank control, Line 2 was plasmid of pRHVcGFP as positive control, Line 3 was genomic DNA of wild type as negative control, Line 4-17 were 12 putative transgenic plants.\u003c/p\u003e","description":"","filename":"Fig.7.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-4697063/v1/48ce377d16c23fbdafc937e9.jpeg"},{"id":61830773,"identity":"d6f59d57-017a-4ae3-b925-38b183b35ed2","added_by":"auto","created_at":"2024-08-06 04:32:45","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1529408,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4697063/v1/a4ead864-19f4-4381-a297-87b565651d25.pdf"},{"id":61660167,"identity":"ad3fe69a-7c77-434a-8ab2-b94f80396f8d","added_by":"auto","created_at":"2024-08-02 14:31:57","extension":"rar","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":124000883,"visible":true,"origin":"","legend":"","description":"","filename":"supplimentaryFigures.rar","url":"https://assets-eu.researchsquare.com/files/rs-4697063/v1/9261fe88d3cdd7ccc035cd98.rar"}],"financialInterests":"No competing interests reported.","formattedTitle":"An optimized protocol for in vitro regeneration and genetic transformation of broomcorn millet","fulltext":[{"header":"Introduction","content":"\u003cp\u003eBroomcorn millet (\u003cem\u003ePanicum miliaceum\u003c/em\u003e L.), or proso millet, which belongs to the Poaceae family, originated from northern China approximately 10 000 years ago [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. It is cultivated in arid and semiarid areas with a high degree of drought and salt tolerance [\u003cspan additionalcitationids=\"CR3\" citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. It also has a short growth cycle, with early-maturing varieties reaching maturity in 60 days [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. In addition, its grains have high nutritional and medicinal value [\u003cspan additionalcitationids=\"CR7\" citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. However, due to the lack of efficient genetic transformation methods for broomcorn millet, the characterization of genes related to these important traits lags behind that of other crop species.\u003c/p\u003e \u003cp\u003e \u003cem\u003eAgrobacterium\u003c/em\u003e-mediated genetic transformation is a natural plant genetic transformation system characterized by low copy numbers and genetic stability of exogenous genes in plants [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. Initially, used for transgenic dicot plants, significant progress has been made over the past two decades in major graminaceous crops such as rice, maize, wheat, and other grasses [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. Rice, as a model monocot plant, has undergone relatively systematic genetic transformation since the first Agrobacterium-mediated transformation in 1993 [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. Researchers have optimized this system, achieving transformation efficiencies of up to 90% [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. Unlike rice, genetic transformation in maize is greatly influenced by the type of callus and genotype, with immature embryos and the maize cultivar A188 being more easily transformed. Adjusting the spatial and temporal expression patterns of the \u003cem\u003eBaby boom\u003c/em\u003e (\u003cem\u003eBbm\u003c/em\u003e) and \u003cem\u003eWuschel2\u003c/em\u003e (\u003cem\u003eWus2\u003c/em\u003e) genes has increased transformation efficiency in several commercial maize varieties, independent of genotype [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. Other graminaceous crop species, including wheat and sorghum, still exhibit relatively low genetic transformation efficiencies. Kumar et al. [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e] generated callus tissue from immature and mature bread wheat embryos, infected them with \u003cem\u003eAgrobacterium\u003c/em\u003e, and successfully cultivated stable transgenic plants, with transformation efficiencies of 14.9% in immature embryos and 9.8% in mature embryos. Similarly, the genetic transformation efficiency of sorghum is strongly influenced by its genotype, with transformation rates ranging from 0.3\u0026ndash;8.3% [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eIn vitro regeneration and genetic transformation of broomcorn millet are still in the early stages. Only a few research teams have attempted to construct in vitro regeneration systems using different explants. In 1973, Rangan et al. [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e] first used the mesocotyl as an explant to culture broomcorn millet in vitro, successfully inducing embryogenic callus but failing to obtain regenerated plants. Later, Rangan and Vasil [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e] induced embryogenic calli using floral primordia from young panicles and successfully obtained complete plants. Recently, Liu used mature embryos from broomcorn millet seeds as explants, transformed them with \u003cem\u003eAgrobacterium\u003c/em\u003e, and successfully established a genetic transformation system [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e, \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. Liu reported significant differences in regeneration ability among different plant genotypes. The average transformation efficiency for 'Longmi 4', which is a widely cultivated genotype and a sequencing cultivar, was 4%. The low efficiency greatly limits the application of advanced technologies such as gene editing in this crop. Therefore, establishing efficient in vitro regeneration and genetic transformation methods for broomcorn millet is essential.\u003c/p\u003e \u003cp\u003eIn this study, we used 'Longmi 4' mature seeds as explants, compared the components of the tissue culture media, optimized the in vitro regeneration system of broomcorn millet, and explored two important factors affecting \u003cem\u003eAgrobacterium\u003c/em\u003e-mediated transformation. The goal was to establish a highly efficient in vitro regeneration and genetic transformation system for broomcorn millet.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003ePlant Materials\u003c/h2\u003e \u003cp\u003eMature seeds of the broomcorn millet cultivar 'Longmi 4' used in this study were obtained from the College of Agriculture, Inner Mongolia Agricultural University.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eEmbryogenic callus induction\u003c/h2\u003e \u003cp\u003e \u003cp\u003eThe dry seeds were carefully dehusked with abrasive paper. Dehusked and healthy seeds were sterilized in 75% (v/v) ethanol for 1 min, followed by 10% sodium hypochlorite for 5 min, after which they were washed with sterilized water five times and subsequently air-dried on sterile filter paper. The sterilized seeds were then inoculated on callus induction medium (MCI) adapted from rice [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. The MCI medium consisted of MS salt containing all vitamins, 300 mg/L casein enzymatic hydrolysate, 600 mg/L L-proline, 30 g/L maltose, and 3 g/L Phytagel. The pH was adjusted to 5.8 with 0.1 M NaOH before autoclaving. To identify the optimal callus induction medium for 'Longmi 4', four different concentrations of 2,4-dichlorophenoxyacetic acid (2,4-D) and 6-benzyla minopurine (BAP) were tested using an orthogonal array L16(4\u003csup\u003e2\u003c/sup\u003e) (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). Twenty seeds were placed on each Petri dish, and 5 plates were used for each treatment. The plates were incubated at 26\u0026deg;C\u0026thinsp;\u0026plusmn;\u0026thinsp;2\u0026deg;C in the dark. Primary calli appeared after 2 weeks, and embryogenic calli were obtained after subculturing for another 2 weeks. The embryogenic callus induction rate was calculated as (number of embryogenic calli/number of seeds) \u0026times; 100%. \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eOrthogonal experiment results of embryogenic callus induction\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eTreatments\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003eFactors\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eInduction rate(%)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003e2,4-D (mg/L)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eBAP (mg/L)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1(2.0)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1(0.0)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e30.00%\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e2(0.25)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e33.35%\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e3(0.5)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e46.65%\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e4(1.0)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e40.30%\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e2(2.5)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e46.65%\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e61.25%\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e66.66%\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e63.35%\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e3(3.0)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e50.00%\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e46.70%\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e56.65%\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e46.70%\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e4(3.5)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e36.65%\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e40.00%\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e56.65%\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e23.35%\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003ePlant regeneration\u003c/h2\u003e \u003cp\u003eThe embryogenic callus was then transferred to shoot regeneration medium (SRM) to induce shoot formation. The SRM consisted of MS salt with vitamins, 2 mg/L kinetin, 0.5 mg/L a-naphthaleneacetic acid (NAA), 30 g/L maltose, and 3 g/L Phytagel, pH 5.8. To optimize the cytokinin concentration in SRM media, kinetin and NAA were tested at four different concentrations using an L16(4\u003csup\u003e2\u003c/sup\u003e) orthogonal array (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). Ten embryogenic calluses were placed on each Petri dish, and 3 plates were used for each treatment. The plates were incubated at 26\u0026deg;C\u0026thinsp;\u0026plusmn;\u0026thinsp;2\u0026deg;C under a 16/8 h light/dark cycle. After 2 weeks, the shoot grew to 1\u0026ndash;2 cm, and the shoot was transferred to rooting media consisting of half-strength MS salt supplemented with 30 g/L sucrose and 3 g/L Phytagel. The regeneration rate was calculated as (number of regenerated plants/number of embryogenic calli) \u0026times; 100%.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eVariance (ANOVA) analysis of the results of the orthogonal experiment results\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"6\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHormones\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSS\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eDF\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eMS\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eP\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e2,4-D\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e0.126\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.042\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e8.498\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.005**\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e6BA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e0.058\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.019\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e3.951\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.047*\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eResidual\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e0.044\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.005\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eBinary vector\u003c/h2\u003e \u003cp\u003eThe binary vector pRHVcGFP was kindly provided by Dr. Wang Guoliang [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. Green fluorescent protein (GFP) was used as the reporter gene under the control of the \u003cem\u003emaize ubiquitin\u003c/em\u003e (\u003cem\u003eZmubi\u003c/em\u003e) promoter, and the \u003cem\u003ehygromycin phosphotransferase\u003c/em\u003e (\u003cem\u003ehpt\u003c/em\u003e) gene was used as the selection marker gene under the control of the cauliflower mosaic virus 35S promoter.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eDetermination of hygromycin concentration\u003c/h2\u003e \u003cp\u003eTo determine the appropriate hygromycin concentration for selecting putative transformants, the calli were cultured in MCI media supplemented with different hygromycin concentrations (0, 10, 15, 20, 25, 30, 35, 40, 45, and 50 mg/L). Ten calli were cultured on a Petri dish plate (90 mm), and each treatment was repeated three times. After 4 weeks of cultivation at 26\u0026deg;C\u0026thinsp;\u0026plusmn;\u0026thinsp;2\u0026deg;C in the dark, the survival rate of the calli was recorded. \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eGenetic transformation\u003c/h2\u003e\u003cp\u003eThe transformation method used in this study was modified from a rice transformation protocol [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. pRHVcGFP was transformed into \u003cem\u003eAgrobacterium tumefaciens\u003c/em\u003e EHA105. Single colonies were scraped from the plate and inoculated into 100 mL of LB liquid media supplemented with 50 mg/L kanamycin and 35 mg/L rifampicin at 28\u0026deg;C and 200 rpm until an OD of 1.0 was reached. The cells were then centrifuged at 5000 \u0026times; g for 10 min and resuspended in 100 ml of inflation medium (MS salt, 68 g/L sucrose, 36 g/L glucose, 3 g/L KCl, 4 g/L MgCl\u003csub\u003e2\u003c/sub\u003e, pH 5.2) supplemented with 150 \u0026micro;M acetosyringone. The final OD value was adjusted to 0.5. The suspension culture was incubated at 28\u0026deg;C and 200 rpm for 1 hour.\u003c/p\u003e \u003cp\u003eThe embryogenic calli were immersed in suspension medium for 30 min and then dried on sterile filter paper. The infected calli were placed in cocultivation media (RSM media supplemented with 150 \u0026micro;M acetosyringone, pH 5.2) and incubated in the dark at 27\u0026deg;C for 1, 3, or 5 days. After the cocultivation period, the calli were washed 3 times with 300 mg/L of Timentine in sterile distilled water, dried on sterile filter paper, and then transferred to RSM media supplemented with 50 mg/L hygromycin and 300 mg/L Timentine in the dark at 27\u0026deg;C. After 3\u0026ndash;4 weeks of selection, the healthy and proliferated calli were transferred onto shoot regeneration media supplemented with 20 mg/L hygromycin or 300 mg/L Timentine and cultured at 26\u0026deg;C under a 16/8 h light/dark cycle for approximately 4 weeks. Subsequently, adventitious shoots were transferred to rooting media supplemented with 300 mg/L of Timentine (pH 5.2) for root induction. After another 4 weeks, the plantlets with well-developed roots were transplanted into soil to generate seeds at 26\u0026deg;C under a light/dark cycle of 12 h/12 h.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003ePCR analysis and GFP observation of transgenic plants\u003c/h2\u003e \u003cp\u003eGenomic DNA from leaves was extracted according to the protocol of the TAINGEN Plant Genomic DNA Miniprep Kit (DP305, Tiangen, Beijing). PCR amplification was performed using the vector-specific primers 35S-hpt-F/35S-hpt-R (35S-hpt-F: CGGTCGGCATCTACTCTATT and 35S-hpt-R: AAACCTCCTCGGATTCCATT) to confirm that the transgenic seedlings were positive. The PCR mixture consisted of 50\u0026ndash;100 ng of DNA template, 2.5 \u0026micro;l of 2\u0026times; buffer, 1 \u0026micro;l of each primer and 0.5 \u0026micro;l of Taq DNA polymerase unit. The volume was adjusted to 25 \u0026micro;l with sterile double distilled water. The PCR products were subjected to gel electrophoresis on a 1% (w/v) agarose gel. For GFP observation, the stems and roots of the transgenic plants were viewed and photographed under blue light (450 nm) with a blue light source (LUYOR-3415RG).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003e \u003cp\u003eAll the data are presented as the means\u0026thinsp;\u0026plusmn;\u0026thinsp;SDs from three repeated experiments. The transformation rate was calculated as (number of positive transgenic seedlings/number of embryogenic calli) \u0026times; 100%.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eOptimization of embryogenic callus induction medium\u003c/h2\u003e \u003cp\u003e To identify the optimal embryogenic callus induction medium for 'Longmi 4', 2,4-D and BAP were tested at four different concentrations using an orthogonal array L16(4\u003csup\u003e2\u003c/sup\u003e) (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). Different hormone concentrations and combinations significantly affected the CIR. Treatment 7 achieved the highest embryogenic callus induction rate of 66.66%, with concentrations of 2.5 mg/L 2,4-D and 0.5 mg/L BAP. The lowest induction rate of 23.35% was observed at concentrations of 3.5 mg/L 2,4-D and 1.0 mg/L BAP. Interestingly, 2.0 mg/L 2,4-D without BAP produced only a 30% induction rate. Two-way ANOVA was carried out, and the results showed that 2,4-D had a highly significant impact on the CIR, while BAP had a significant effect (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). The optimal CIM was determined to be 4.33 g L\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e MS salt, 300 mg L\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e casein enzymatic hydrolysate, 600 mg L\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e L-proline, 30 g L\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e maltose, 3 g L\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e Phytagel, 2.5 mg L\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e 2,4-D, and 0.5 mg L\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e BAP at pH 5.8.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eOptimization of shoot regeneration medium\u003c/h2\u003e \u003cp\u003e To optimize the cytokinin concentration in SRM media, kinetin and NAA were tested at four different concentrations using an L16(4\u003csup\u003e2\u003c/sup\u003e) orthogonal array (Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). Ten embryogenic calluses were placed on each Petri dish (90 mm), and 3 plates were used for each treatment. The regeneration rate of shoot regeneration varied significantly with different treatments (Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). The highest regeneration rate from treatment 5 (2.5 mg L\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e 2,4-D and 0.5 mg L\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e BAP) reached 59.55%, while the lowest was 18% in treatment 5. The statistical analysis showed that 2,4-D had a significant effect on the shoot regeneration rate, while NAA was not effective (Table\u0026nbsp;\u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e4\u003c/span\u003e). The optimal shoot regeneration media were thus determined to be 4.33 g/L MS, 30 g/L sucrose, 3 g/L Phytagel, 2.0 mg/L kinetin, 0.5 mg/L NAA, and 15% coconut milk at pH 5.8.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eOrthogonal experiment results of shoot regeneration\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eTreatments\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003eFactors\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eInduction rate(%)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNAA(mg/L)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eKinetin(mg/L)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1(0.0)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1(1.0)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e18.00\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e2(1.5)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e25.00\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e3(2.0)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e38.46\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e4(2.5)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e33.33\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e2(0.25)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e20.00\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e23.81\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e45.45\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e31.25\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e3(0.5)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e41.67\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e33.33\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e59.55\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e45.45\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e4(1.0)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e27.78\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e29.41\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e41.25\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e26.31\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab4\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 4\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eVariance (ANOVA) analysis of the results of the orthogonal experiment\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"6\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHormones\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSS\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eDF\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eMS\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eP\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNAA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e757.179\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e252.393\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e6.733\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.011\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBAP\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e957.559\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e319.186\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e8.515\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.005\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eResidual\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e337.379\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e37.487\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eDetermination of hygromycin concentration for selection\u003c/h2\u003e \u003cp\u003eTo determine the optimal hygromycin concentration for selecting putative transformants, the callus pieces were cultured on MCI media supplemented with different concentrations of hygromycin (0, 10, 15, 20, 25, 30, 35, 40, 45, and 50 mg/L) (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). After culturing for 4 weeks, the calli on media supplemented with 45 mg/L or 50 mg/L hygromycin were browned to death, while the calli on media supplemented with no hygromycin continued to proliferate (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA, I and J). From 10 mg/L to 40 mg/L, the calli became brown, but some of the calli survived (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB-H). The survival rate decreased as the concentration increased (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). Therefore, our results indicate that 45 and 50 mg/L hygromycin are suitable for selecting putative transformants.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eDetermination of cocultivation time\u003c/h2\u003e\u003cp\u003ePrevious studies have indicated that increasing the cocultivation time enhances \u003cem\u003eAgrobacterium\u003c/em\u003e transformation efficiency but results in \u003cem\u003eAgrobacterium\u003c/em\u003e outgrowth [\u003cspan additionalcitationids=\"CR24\" citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. To determine the optimal balance between transformation efficiency and contamination, cocultivation periods of 1, 3, and 5 days were tested. The number of calli that generated hygromycin-resistant shoots was recorded, and the results showed that a cocultivation period of 3 days produced the greatest number of transgenic shoots (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA and \u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB). Compared with the two conditions, 5 days of cocultivation induced more contamination (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC). A greater transformation rate was obtained after 3 days (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003eGenetic transformation\u003c/h2\u003e \u003cp\u003eMature 'Longmi 4' seeds were used as explants for callus induction (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA). White and friable embryogenic calli were obtained after culture on MCI media for 4\u0026ndash;6 weeks (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB). embryogenic calli were immersed in liquid suspension media for 30 min and then incubated in cocultivation media at 22\u0026deg;C for 3 days in the dark (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC and \u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eD). The infected calli were transferred to selection media supplemented with 50 mg/L hygromycin. After 3\u0026ndash;4 weeks of selection, the successfully transformed callus appeared white and healthy, while the nontransformed tissue had browned until death (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eE). Hygromycin-resistant calli were transferred to shoot regeneration media supplemented with 10 mg/L hygromycin at 26\u0026deg;C under a 16 h/8 h light/night cycle for 4\u0026ndash;5 weeks (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eF). Subsequently, adventitious shoots were transferred to rooting media for root induction (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eG). After 2\u0026ndash;3 weeks, the plantlets with well-developed roots were transplanted into the soil, and the seeds were harvested after 6 to 8 weeks (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eH). The complete transformation cycle lasted approximately 18 to 25 weeks.\u003c/p\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003eScreening and GFP observation of transgenic plants\u003c/h2\u003e \u003cp\u003ePCR amplification of a 1424 bp fragment was performed to characterize 12 putative transgenic plants. The pRHVcGFP vector plasmid and wild-type genomic DNA were used as positive and negative controls, respectively. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e, 11 lines were confirmed to be positive transgenic plants. In addition, GFP fluorescence was detected in the roots and stems of these transgenic plants (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003e). Green fluorescence could not be detected in the leaves of the transgenic plants because of chlorophyl1 accumulation. We performed three rounds of transformation, and the average transformation rate was 21.25% (Table\u0026nbsp;\u003cspan refid=\"Tab5\" class=\"InternalRef\"\u003e5\u003c/span\u003e).\u003c/p\u003e\u003c/p\u003e\u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab5\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 5\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eOrthogonal experiment results of embryogenic callus induction\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eExperiment\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNumber of infected calli\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e80\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e80\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e80\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNumber of regeneration calli\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e38\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e40\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e39\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePositive plants\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e17\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e15\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTransformation efficiency (%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e16.25\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e21.25\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e18.75\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRegeneration efficiency(%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e47.5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e50\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e48.75\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003ePlant intro regeneration is sometimes highly genotype specific. Different regeneration rates were found among different broomcorn millet genotypes [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. Some cultivars, such as 'Hongmi' and 'Qingyanghongying', had much greater embryogenic callus induction rates than 'Longmi 4', the elite germplasm and a sequencing cultivar. Therefore, in this study, we used mature 'Longmi 4' seeds as explants and optimized their in vitro regeneration and genetic transformation methods.\u003c/p\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003eOptimization of the in vitro regeneration system\u003c/h2\u003e \u003cp\u003eSeveral research teams have attempted to construct in vitro regeneration systems for brromcorn millet using different explants, such as mesocotyl, immature inflorescence and mature seeds [\u003cspan additionalcitationids=\"CR17 CR18\" citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. Mature seeds with high regeneration efficiency have been used for in vitro regeneration of several monocots, such as rice, sorghum and foxtail millet [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e, \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e, \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eIn this study, we used mature seeds as explants due to their convenience and flexibility. The type and concentration of phytohormones are critical factors affecting the efficiency of embryogenic callus induction in in vitro plant regeneration [\u003cspan additionalcitationids=\"CR24\" citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. In rice and foxtail millet, a combination of auxin (2,4-D) and cytokinins (BAP or NAA) was more effective than auxin (2,4-D) alone. In this study, 2,4-D and BAP were tested at four different concentrations using an orthogonal array L16(4\u003csup\u003e2\u003c/sup\u003e) (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). Statistical analysis of this orthogonal experiment showed that 2,4-D had a highly significant impact on the CIR (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). We found that a higher concentration of 2,4-D generated a greater induction rate.\u003c/p\u003e \u003cp\u003eShoot regeneration efficiency is a major bottleneck in broomcorn millet. In a recent study of broomcorn millet genetic transformation, the regeneration efficiency was 3.5%-10%, and 3.0 mg/L BAP and 0.2 mg/L 2,4-D were used in the regeneration media[\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. Kinetin and NAA were used for the induction of rice shoot regeneration, resulting in a 54\u0026ndash;77% regeneration frequency [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. In our study, the regeneration rate increased to 59.55% when 2.0 mg/L kinetin and 0.5 mg/L NAA were used for shoot induction.\u003c/p\u003e \u003cp\u003e \u003cb\u003eOptimization of\u003c/b\u003e \u003cb\u003eAgrobacterium\u003c/b\u003e\u003cb\u003e-mediated genetic transformation in broomcorn millet\u003c/b\u003e\u003c/p\u003e \u003cp\u003e \u003cem\u003eAgrobacterium\u003c/em\u003e-mediated transformation is widely used in plant genetic transformation due to its high efficiency, effectiveness, simplicity, genetic stability, and low cost [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. It is extensively applied in several monocot species, such as rice, maize, sorghum, and foxtail millet [\u003cspan additionalcitationids=\"CR13 CR14 CR15\" citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e, \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. However, genetic information on the transformation of broomcorn millet is still limited. The \u003cem\u003eAgrobacterium\u003c/em\u003e-mediated genetic transformation methods should be optimized for broomcorn millet, especially for the sequenced cultivar 'Longmi 4'.\u003c/p\u003e \u003cp\u003eVarious studies have attempted to increase the efficiency of genetic transformation in major crop species and could be applied in broomcorn millet [\u003cspan additionalcitationids=\"CR10 CR11\" citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. In this study, we optimized the cocultivation time and hygromycin concentration for selection. The optimal duration of cocultivation is crucial for facilitating T-DNA transfer with the assistance of acetosyringone [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. In this study, 3 days of cocultivation was determined to be the optimal cocultivation period, which was consistent with the results in other graminaceous plants [\u003cspan additionalcitationids=\"CR26 CR27\" citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe selection of an appropriate screening agent concentration is crucial for successful \u003cem\u003eAgrobacterium\u003c/em\u003e-mediated transformation of embryogenic calli. During the transformation process, only a few embryogenic callus tissues can accept and integrate exogenous DNA, making the selection of transgenic callus tissue vital for effectively detecting transgenic components in regenerated plants. Additionally, antibiotic selection is critical for the success rate of transgenic plants. Excessively high concentrations of hygromycin can cause browning and death of embryogenic callus tissues, whereas concentrations that are too low may not achieve effective selection. Different species require varying selection conditions; for example, foxtail millet uses lower hygromycin concentrations (8 mg/L)[\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e], while switchgrass requires higher concentrations (75 mg/L)[\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. We tested various hygromycin concentrations ranging from 10 to 50 mg/L and ultimately selected 45 mg/L based on comparative results. We performed three rounds of transformation, and the average transformation rate was 21.25%.\u003c/p\u003e \u003c/div\u003e"},{"header":"Conclusions","content":"\u003cp\u003eIn this study, we provide an optimized protocol for in vitro regeneration and genetic transformation of broomcorn millet. Mature 'Longmi 4' seeds were used as explants. We established an efficient in vitro regeneration method by optimizing the type and concentration of phytohormones in the media and obtained a callus induction rate of 66.5% and a shoot regeneration rate of 56.7%. Additionally, the cocultivation time was 3 days, and the optimal hygromcin concentration for putative transgenic callus selection was 45 mg/L. The transgenic efficiency was 21.25%, which is much greater than that reported in previous studies. Our work provides an efficient tool for the characterization of genes related to important traits, as well as a new strategy for broomcorn millet breeding.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cdiv class=\"DefinitionList\"\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e2,4-D\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003e2,4-dichlorophenoxyacetic acid\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eBAP\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003e6-benzylaminopurine\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eNAA\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003ea-naphthaleneacetic acid\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eMS\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eMurashige and Skoog Medium\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eMCI\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003ecallus induction medium\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eSRM\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eshoot regeneration medium\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eGFP\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003egreen fluorescent protein, hpt:hygromycin phosphotransferase\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eBbm\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eBaby boom\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eWus2\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eWuschel2.\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003c/div\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors would like to thank Dr. Shihua Guo, who provided \u0026apos;Longmi 4\u0026apos; seeds for our experiment. Dr. Guoliang Wang for kindly sharing the binary vector\u0026nbsp;pRHVcGFP.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study was\u0026nbsp;supported\u0026nbsp;by Natural Science Foundation of Inner Mongolia\u0026nbsp;(2021ZD04),\u0026nbsp;The Central Government Guiding Special Funds for the Development of Local Science and Technology (2020ZY0005), Key Research and Development Program of Shanxi Province (2022ZDYF110), Special Project on Crop Germplasm Resources Protection and Utilization of Ministry of Agriculture (19240451), and National Science and Technology Resource Sharing Service Platform Project (NCGRC-2024-27).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and material\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll data generated or analysed during this study are included in this manuscript.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors\u0026rsquo; contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eZLC, JQJ, DML, and LZ contributed to the writing of the paper. ZLC, WMW, XQH, and YCW developed and carried out the experiments. HGW, LLL, LW, and JL assisted in experimental design and data analysis. All authors read and approved the final manuscript.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;The authors declare that they have no competing interests.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eHunt HV, Rudzinski A, Jiang H, Wang R, Thomas MG, Jones MK. Genetic evidence for a western Chinese origin of broomcorn millet (\u003cem\u003ePanicum miliaceum\u003c/em\u003e). Holocene. 2018;28:1968\u0026ndash;78.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRajput SG, Santra DK, Schnable J. Mapping QTLs for morpho-agronomic traits in proso millet (\u003cem\u003ePanicum miliaceum\u003c/em\u003e L.). Mol. Breed. 2016;36\u0026ndash;37.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu MX, Qiao ZJ, Zhang S, Wang YY, Lu P. Response of broomcorn millet (\u003cem\u003ePanicum miliaceum\u003c/em\u003e L.) genotypes from semiarid regions of China to salt stress. Crop J. 2015;3:57\u0026ndash;66.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYuan Y, Liu C, Gao Y, et al. Proso millet (\u003cem\u003ePanicum miliaceum\u003c/em\u003e L.): A potential crop to meet demand scenario for sustainable saline agriculture. J Environ Manage. 2021;296:113216.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBoukail S, Macharia M, Miculan M, Masoni A, Calamai A, Palchetti E, Dell'Acqua M. Genome wide association study of agronomic and seed traits in a world collection of proso millet (\u003cem\u003ePanicum miliaceum L\u003c/em\u003e). BMC Plant Biol. 2021;21:330.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKumar A, Tomer V, Kaur A, Kumar V, Gupta K. Millets: A solution to agrarian and nutritional challenges. Agric Food Secur. 2018;7:31.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKumar SR, Sadiq MB, Anal AK. Comparative study of physicochemical and functional properties of pan and microwave cooked underutilized millets (proso and little). LWT. 2020;128:109465.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMarti A, Tyl C. Capitalizing on a double crop: Recent advances in proso millet's transition to a food crop. Compr Rev Food Sci Food Saf. 2021;20:819\u0026ndash;39.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDai S, Zheng P, Marmey P, Zhang S, Tian W, Chen S, Beachy RN, Fauquet C. Comparative analysis of transgenic rice plants obtained by \u003cem\u003eAgrobacterium\u003c/em\u003e-mediated transformation and particle bombardment. Mol Breed. 2001;7:25\u0026ndash;33.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSingh RK, Prasad M. Advances in Agrobacterium tumefaciens-mediated genetic transformation of graminaceous crops. Protoplasma. 2016;253(3):691\u0026ndash;707.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChan MT, Chang HH, Ho SL, Tong WF, Yu SM. \u003cem\u003eAgrobacterium\u003c/em\u003e-mediated production of transgenic rice plants expressing a chimeric alpha-amylase promoter/beta-glucuronidase gene. Plant Mol Biol. 1993;22:491\u0026ndash;506.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang Y, Li J, Gao C. Generation of stable transgenic Rice (\u003cem\u003eOryza sativa\u003c/em\u003e L.) by \u003cem\u003eAgrobacterium\u003c/em\u003e-mediated transformation. Curr Protoc Plant Biol. 2016;1:235\u0026ndash;46.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWu C, Sui Y. Efficient and fast production of transgenic rice plants by \u003cem\u003eAgrobacterium\u003c/em\u003e-mediated transformation. Methods Mol Biol. 2019;1864:95\u0026ndash;103.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLowe K, Wu E, Wang N, Hoerster G, Hastings C, Cho MJ, Scelonge C, Lenderts B, Chamberlin M, Cushatt J, Wang L, Ryan L, Khan T, Chow-Yiu J, Hua W, Yu M, Banh J, Bao Z, Brink K, Igo E, Rudrappa B, Shamseer PM, Bruce W, Newman L, Shen B, Zheng P, Bidney D, Falco C, Register J, Zhao ZY, Xu D, Jones T, Gordon-Kamm W. Morphogenic Regulators Baby boom and Wuschel Improve Monocot Transformation. Plant Cell. 2016;28:1998\u0026ndash;2015.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKumar R, Mamrutha HM, Kaur A, Venkatesh K, Sharma D, Singh GP. Optimization of \u003cem\u003eAgrobacterium\u003c/em\u003e-mediated transformation in spring bread wheat using mature and immature embryos. Mol Biol Rep. 2019;46:1845\u0026ndash;53.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWu E, Zhao ZY. Agrobacterium-Mediated Sorghum Transformation. Methods Mol Biol. 2017;1669:355\u0026ndash;64.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRangan T. Morphogenic investigations on tissue cultures of Panicum miliaceum[J]. Z f\u0026uuml; Pflanzenphysiologie. 1973;72:456\u0026ndash;59.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRangan TS, Vasil LK. Somatic embryogenesis and plant regeneration in tissue cultures of Panicum miliaceum L. and Panicum miliare Lamk. Z Pflanzenphysiol Bd. 1983;109:41\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu Y, Cheng Z, Chen W, Wu C, Chen J, Sui Y. Establishment of genome-editing system and assembly of a near-complete genome in broomcorn millet. J Integr Plant Biol. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003edoi.org/10.1111/jipb.13664\u003c/span\u003e\u003cspan address=\"10.1111/jipb.13664\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBai Y, Liu S, Bai Y, Xu Z, Zhao H, Zhao H, Lai J, Liu Y, Song W. Application of CRISPR/Cas12i.3 for targeted mutagenesis in broomcorn millet \u003cem\u003e(Panicum miliaceum\u003c/em\u003e L). J Integr Plant Biol. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003edoi.org/10.1111/jipb.13669\u003c/span\u003e\u003cspan address=\"10.1111/jipb.13669\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSahoo KK, Tripathi AK, Pareek A, Sopory SK, Singla-Pareek SL. An improved protocol for efficient transformation and regeneration of diverse indica rice cultivars. Plant Methods. 2011;7:49\u0026ndash;49.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHe F, Zhang F, Sun W, Ning Y, Wang GL. A Versatile Vector Toolkit for Functional Analysis of Rice Genes. Rice. 2018;11:27.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSood P, Singh RK, Prasad M. An efficient Agrobacterium-mediated genetic transformation method for foxtail millet (\u003cem\u003eSetaria italica\u003c/em\u003e L). Plant Cell Rep. 2020;39:511\u0026ndash;25.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePriya AM, Pandian SK, Manikandan R. The effect of different antibiotics on the elimination of \u003cem\u003eAgrobacterium\u003c/em\u003e and high frequency \u003cem\u003eAgrobacterium\u003c/em\u003e-mediated transformation of indica rice (\u003cem\u003eOryza sativa\u003c/em\u003e L). Czech J Genet Plant Breed. 2012;48:120\u0026ndash;30.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang Y, Qin C, Liu S, Xu Y, Li Y, Zhang Y, Song Y, Sun M, Fu C, Qin Z, Dai S. Establishment of an efficient Agrobacterium-mediated genetic transformation system in halophyte Puccinellia tenuiflora. Mol Breed. 2021;41:55.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNguyen DQ, Van Eck J, Eamens AL, Grof CPL. Robust and Reproducible \u003cem\u003eAgrobacterium\u003c/em\u003e-Mediated Transformation System of the C4 Genetic Model Species \u003cem\u003eSetaria viridis\u003c/em\u003e. Front Plant Sci. 2020;11:281.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSantos CM, Romeiro D, Silva JP, Basso MF, Molinari HBC, Centeno DC. An improved protocol for efficient transformation and regeneration of \u003cem\u003eSetaria italica\u003c/em\u003e. Plant Cell Rep. 2020;39:501\u0026ndash;10.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRamamoorthy R, Kumar PP. A simplified protocol for genetic transformation of switchgrass (\u003cem\u003ePanicum virgatum\u003c/em\u003e L). Plant Cell Rep. 2012;31:1923\u0026ndash;31.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"","lastPublishedDoi":"10.21203/rs.3.rs-4697063/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4697063/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBackground\u003c/h2\u003e \u003cp\u003eBroomcorn millet has many advantages, such as abiotic stress resistance, a short growth cycle and high nutritional value. However, due to the lack of efficient genetic transformation methods for broomcorn millet, the characterization of genes related to important traits lags behind that of other crop species. Therefore, establishing efficient in vitro regeneration and genetic transformation methods for broomcorn millet is essential.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e \u003cp\u003eIn this study, we used mature seeds from the sequenced cultivar 'Longmi 4' as explants and optimized their in vitro regeneration and genetic transformation methods. The optimal hormone concentrations for embryogenic callus induction medium were 2.5 mg/L 2,4-D and 0.5 mg/L BAP. The optimal hormone concentrations for shoot regeneration media were 2 mg/L kinetin and 0.5 mg/L a-naphthaleneacetic acid. Additionally, the cocultivation time was 3 days, and the optimal hygromcin concentration for putative transgenic callus selection was 45 mg/L. The transgenic efficiency was 21.25% after our modification approach.\u003c/p\u003e\u003ch2\u003eConclusions\u003c/h2\u003e \u003cp\u003eHere, we present a simple and highly efficient \u003cem\u003eAgrobacterium\u003c/em\u003e-mediated genetic transformation protocol for broomcorn millet. Our work provides a tool for the characterization of genes related to important traits, as well as a new strategy for broomcorn millet breeding.\u003c/p\u003e","manuscriptTitle":"An optimized protocol for in vitro regeneration and genetic transformation of broomcorn millet","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-08-02 14:31:50","doi":"10.21203/rs.3.rs-4697063/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"5aa63000-7c45-46a0-a0a9-f1b85bb90af4","owner":[],"postedDate":"August 2nd, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-11-18T04:38:28+00:00","versionOfRecord":[],"versionCreatedAt":"2024-08-02 14:31:50","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4697063","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4697063","identity":"rs-4697063","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2024) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00
unpaywall
last seen: 2026-05-23T02:00:01.238055+00:00
License: CC-BY-4.0