Probiotic Intervention Alleviates Helicobacter pylori-induced Intestinal Inflammation by Sustaining Intestinal Homeostasis

preprint OA: closed CC-BY-4.0
📄 Open PDF Full text JSON View at publisher
Full text 162,065 characters · extracted from preprint-html · click to expand
Probiotic Intervention Alleviates Helicobacter pylori-induced Intestinal Inflammation by Sustaining Intestinal Homeostasis | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Probiotic Intervention Alleviates Helicobacter pylori-induced Intestinal Inflammation by Sustaining Intestinal Homeostasis Shiying Wu, Fangtong Wei, Yongqiang Chen, Ziqi Chen, Yuenuo Luo, and 5 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-5351640/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 13 Feb, 2025 Read the published version in Probiotics and Antimicrobial Proteins → Version 1 posted 9 You are reading this latest preprint version Abstract Helicobacter pylori ( H. pylori ) infection poses significant risks for gastric cancer and intestinal inflammation, yet effective prevention strategies for intestinal inflammation remain elusive. Here, we aimed to investigate the protective effects and underlying mechanisms of Lactiplantibacillus plantarum ZJ316 ( L. plantarum ZJ316) in a mouse model of H. pylori -induced intestinal inflammation. Our results demonstrated that treatment with L. plantarum ZJ316 effectively reduced tissue damage and upregulated expression of tight junction proteins such as Zonula occludens-1 (ZO-1), Occludin, and Claudin-1, while decreased pro-inflammatory cytokines interleukin-1β (IL-1β), interferon γ (IFN-γ), and tumor necrosis factor α (TNF-α). Additionally, intaking L. plantarum ZJ316 reduced relative abundance of pathogenic bacteria Staphylococcus and Desulfovibrio by 69%, and 42%, respectively, while enhancing beneficial bacteria including Ligilactobacillus , Akkermansia , and Lactobacillus associated with short-chain fatty acids (SCFAs) synthesis, by 88%, 85%, and 16%, respectively. Gas chromatography–mass spectrometry (GC-MS) analysis confirmed L. plantarum ZJ316 reversed H. pylori -induced declines in SCFA levels. In vitro, L. plantarum ZJ316 inhibited the IκBα/NF-κB pathway, thereby reducing TNF-α and IL-8 production in HT-29 cells following H. pylori infection. These findings collectively suggest that L. plantarum ZJ316 ameliorates H. pylori -induced intestinal inflammation by enhancing gut barrier function, improving flora structure, increasing SCFA levels, and mitigating inflammation through NF-κB pathway inhibition, offering promise for therapeutic development. Lactiplantibacillus plantarum ZJ316 Helicobacter pylori Intestinal inflammation Gut microbiota Short-chain fatty acids NF-κB signaling pathway Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 1. Introduction Helicobacter pylori ( H. pylori ) infection presents a persistent and substantial global public health concern, affecting a significant proportion of the world's population [ 35 ] . This bacterial infection is widely recognized as a pivotal risk factor contributing to the development of gastric cancer [ 20 ] . Effective eradication of H. pylori has emerged as a crucial and manageable approach to preventing gastric malignancies. Upon infection, H. pylori triggers a series of immune responses, notably activating NF-κB signaling, which plays pivotal roles in the pathogenesis of H. pylori -related diseases [ 32 , 43 ] . Furthermore, H. pylori induces inflammation within the gastric epithelium through various virulence factors, including cytotoxin-associated protein A (CagA), vacuolating cytotoxin A (VacA), and lipopolysaccharide (LPS) [ 25 , 43 ] . This persistent inflammatory milieu is acknowledged as a major contributor to tumor initiation and progression. Although H. pylori infection primarily affects the stomach, mounting evidence has implicated H. pylori infection in the pathogenesis of extra gastric diseases, such as intestinal inflammation, colorectal carcinogenesis, and asthma, through deregulating immune homeostasis and disrupting composition and function of the gut microbiota [ 16 , 18 ] . Intestinal inflammation, characterized by immune-mediated responses within the intestinal mucosa, is a multifactorial process associated with tissue damage, alterations in barrier integrity and microbiota composition, a decrease in short-chain fatty acid (SCFA), as well as disturbances in immune response regulation [ 13 , 51 ] . Impairment of the epithelial barrier represents a key pathological mechanism underlying intestinal inflammation, leading to increased permeability and dysregulated immune responses [ 31 , 49 ] . Presently, the primary pharmaceutical treatments for intestinal inflammation comprise anti-inflammatory drugs, immunosuppressants, antibiotics, and anti-diarrheal drugs. However, these treatments often provide only partial symptom relief and are associated with notable side effects [ 41 ] . Particularly in the process of eradicating H. pylori with antibiotic treatment, dysbiosis of the host's gut microbiota can occur and prove difficult to restore [ 24 , 52 ] . Thus, the development of effective treatment strategies with minimal side effects is imperative for addressing intestinal inflammation. Consuming probiotics holds promise for reinstating gut microbiota equilibrium, bolstering intestinal mucosal barrier integrity, and mitigating gastrointestinal infections [ 6 , 50 ] . Numerous investigations have underscored the comparable efficacy of probiotics to conventional pharmacotherapy in managing intestinal inflammation [ 6 ] . Their indispensable role in modulating inflammatory responses has been extensively delineated across various in vitro and ex vivo models, and clinical trials. Notably, in a clinical investigation, administration of a probiotic blend comprising four Bifidobacterium strains elicited a notable reduction in key proinflammatory cytokines, including calprotectin, IFN-γ, IL-12p70, and IL-4, coupled with an elevation in IL-22 levels in the fecal matter of preterm infants [ 48 ] . The gut constitutes a rich and diverse ecosystem harboring hundreds of bacterial species collectively known as the gut microbiota, playing a pivotal role in human well-being [ 23 ] . Recent research has emphasized the significant link between gut microbiota dysbiosis and the development of intestinal inflammation. Utilizing next-generation sequencing (NGS) techniques and preclinical models, researchers have indicated a correlation between reduced variety and abundance of gut microbiota and increased susceptibility to intestinal inflammation [ 26 ] . Probiotic supplementation may provide a promising approach to restoring gut microbiota balance. For instance, Yu et al . revealed that supplementation with Lactiplantibacillus plantarum L15 elevated the abundance of Lactobacillus , Turicibacter , Bacteroides , and Butyricicoccus , thereby alleviating dextran sulfate sodium-induced colitis in mice [ 68 ] . The gut microbiota is known to yield a spectrum of metabolites, encompassing SCFAs, polyphenolic compounds, and amino acid derivatives. Notably, SCFAs, comprising acetate, propionate, and butyrate, are enzymatically synthesized via the fermentation of dietary fiber by anaerobic bacteria, prominently Firmicutes and Bacteroidetes [ 15 ] . These SCFAs exert pivotal regulatory functions in bolstering gut homeostasis, modulating inflammatory cascades, preserving intestinal epithelial barrier integrity, and tumorigenesis [ 42 , 58 ] . Consequently, alterations in gut microbial composition precipitated shifts in SCFAs, thus contributing to the pathogenesis of intestinal inflammation, diabetes, colorectal carcinoma, and cardiovascular maladies [ 36 , 44 ] . Numerous studies have indicated that H. pylori infection elicits a systemic immunoregulatory effect and disrupts the typical acidic gastric environment, resulting in changes to the gastric and gut microbiota as well as levels of SCFAs [ 3 , 25 ] . It has been documented that H. pylori -positive patients demonstrate enriched Prevotellaceae abundance and reduced levels of beneficial SCFAs producers such as Pseudofavonifractor , Alistipes , and Fusicatenibacter compared to negative controls [ 65 ] [ 12 ] . Additionally, several studies suggest that H. pylori infection diminishes short-chain fatty acid production, potentially elucidating the link between H. pylori exposure and extra gastric diseases [ 40 ] . However, limited information exists regarding the mechanisms by which L. plantarum strains alleviate H. pylori -induced intestinal inflammation. Our previous investigation unveiled that L. plantarum ZJ316, characterized by favorable gastrointestinal transit tolerance, adhesion properties, and the ability to reduce pro-inflammatory responses, effectively alleviated H. pylori -induced gastritis in mice [ 62 , 73 ] . Therefore, the present investigation aims to elucidate the protective effects of L. plantarum ZJ316 on H. pylori -induced intestinal inflammation both in vitro and in vivo . The findings of this research may lay the groundwork for exploring potential probiotic combinations and hold considerable implications for future investigations into safe and effective preventive and therapeutic strategies for H. pylori -induced intestinal inflammation. 2. Materials and Methods 2.1. Bacteria strains and cell culture Lactobacillus plantarum ZJ316 (CCTCC M 208077) was isolated and preserved in our laboratory. Cultivation of the strain was carried out anaerobically at 37°C for 24 h in MRS broth (Hopebio, Qingdao, China). The H. pylori strain ZJC03 (CCTCC M20211218) was sourced from individuals diagnosed with gastritis and gastric cancer at Zhejiang University College of Medicine, and was cultured at 37°C for 72 h on Brucella agar fortified with 7% defibrinated sheep blood under microaerobic conditions. Human colonic adenocarcinoma cell line HT-29 was procured from Wuhan Benyuan Biotechnology Co., Ltd. (Wuhan, China). These cells were cultured in RPMI 1640 medium fortified with 20% fetal bovine serum in a humidified atmosphere containing 5% CO 2 at 37°C. The cells were pretreated with L. plantarum ZJ316 (1 × 10 8 CFU /mL) for 2 h, subsequently supplemented with H. pylori (1 × 10 8 CFU /mL) for 2 h. 2.2. Animals and Experimental Design. Six-week-old specific-pathogen-free (SPF) female C57BL/6J mice were procured from SIPPR/BK Lab Animal Co., Ltd. (Shanghai, China). The animals underwent acclimatization and were housed within the Experimental Animal Department of the Shanghai Public Health Clinical Center under standardized laboratory conditions. They were provided ad libitum availability of pelleted food and water. Animal procedures were sanctioned by the Institutional Animal Care and Use Committee of the Shanghai Public Health Clinical Center under protocol number 2022-A037-01. The mice were randomly allocated into three groups (n = 8 per group), and following one week of acclimatization, the experimental protocols were performed as follows: • Control group: Mice were administered 400 µL of sterile saline orally every other day for a duration of 5 weeks. • Hp group: Mice received 400 µL of sterile saline orally for 3 weeks prior to infection. • ZJ316 + Hp group: Mice were orally administered a suspension of L. plantarum ZJ316 (1 × 10 9 CFU/mL) for 3 weeks. Subsequently, mice in the Hp and ZJ316 + Hp groups were administered orally with 400 µL of H. pylori (1 × 10 9 CFU/mL) every alternate day for a duration of 14 days (Fig. 1 A). After the experiment, fresh feces and blood samples were collected and the mice were euthanized. Gastric mucosa was utilized to extract DNA for the detection of H. pylori through quantitative real-time PCR, with the following specific primers: (F: 5-CGCTAAGAGATCAGCCTATGTCC-3; R: 5-CCGTGTCTCAGTTCCAGTGTGT-3). 2.3. Histology and Immunohistochemistry The intestinal tissue was fixed in a 4% paraformaldehyde buffer at ambient temperature for 36 h. Tissues were paraffin-embedded, sectioned at 5 µm thickness, and stained with hematoxylin and eosin (H&E). Histological scoring was conducted as follows: The scoring criteria includes epithelial damage, inflammatory cell infiltration, crypt architecture, and tissue integrity, each graded from 0 to 3 based on the extent of damage, with 0 representing absence of damage, 1 for minor damage, 2 for moderate injury, and 3 for significant impairment. It covers aspects such as epithelial edema and vacuolation, erosions/disruptive lesions, the extent and depth of inflammatory cell infiltration, the percentage of crypt loss, mucosal and submucosal thickening, as well as ulceration and necrosis. For immunohistochemical staining, sections were incubated in blocking solution at ambient temperature away from light for 30 minutes [ 69 ] . Subsequently, the primary antibody Phospho-NF-κB p65 (3033S, 1:200; Cell Signaling Technology) was applied and left to incubate for 1 h at ambient temperature. Sections underwent three PBS washes before incubation with a secondary enzyme-linked goat anti-rabbit IgG polymer for 30 minutes. Subsequently, sections were inspected under a light microscope (NIKON Eclipse Ci, Japan). 2.4. 16S rDNA Gene Sequencing The gut microbiota was analyzed by sequencing the V3-V4 region of the 16S rDNA gene with QIIME pipeline. DADA2 was utilized to infer Paired-end reads, which were then associated with sample IDs and clustered into amplicon sequence variants (ASVs) with 100% similarity using the SILVA 138/16S database. Alpha and Beta diversity were analyzed. [ 66 ] Differences in taxa, clades, and ASVs underwent analysis via linear discriminant analysis effect size (LEfSe) method (LDA > 4.0). 2.5. Measurement of fecal SCFAs The SCFA levels in fecal samples were quantified using gas chromatography–mass spectrometry. Fecal samples were homogenized with liquid nitrogen and mixed with 1300 µl of ethanol solution. After extraction via ultrasonication for 40 minutes, the samples were centrifuged. The resulting supernatant was then passed through a 0.22 µm needle filter and subjected to direct GC-MS analysis [ 25 ] . GC analysis was performed with a capillary column with helium as the carrier gas at a flow rate of 1.0 mL/min. The injection port temperature was set at 250°C with no split flow. The heating program started at 50°C for 2 minutes, then ramped up to 120°C at 15°C/min, followed by a gradual increase to 170°C at 5°C/min, and finally held at 240°C for 3 minutes [ 25 ] . 2.6. Reverse transcription‑quantitative polymerase chain reaction (RT-qPCR) Conventional RT-qPCR analyses were performed using primers listed in Table 1 , with GAPDH employed as a reference gene for evaluating target gene transcription levels. RT-qPCR was conducted utilizing commercial kits (RR820A, Takara) and the ABI StepOne Plus system. mRNA levels were quantified using the 2 −ΔΔCq method. Table 1 Sequences of the primers. Gene Forward (5'-3') Reverse (5'-3') GAPDH GTCTCCTCTGACTTCAACAGCG ACCACCCTGTTGCTGTAGCCAA Human IL-6 AGACAGCCACTCACCTCTTCAG TTCTGCCAGTGCCTCTTTGCTG Human IL-8 AGTCCTTGTTCCACTGTGCCTTGG TGCTTCCACATGTCCTCACAACATC Human TNF-α CTCTTCTGCCTGCTGCACTTTG ATGGGCTACAGGCTTGTCACTC Human ZO-1 GTCCAGAATCTCGGAAAAGTGCC CTTTCAGCGCACCATACCAACC Human Cludin-1 GTCTTTGACTCCTTGCTGAATCTG CACCTCATCGTCTTCCAAGCAC Human Occludin ATGGCAAAGTGAATGACAAGCGG CTGTAACGAGGCTGCCTGAAGT Mouse IL-1β TCAAATCTCGCAGCAGCACATC CGTCACACACCAGCAGGTTATC Mouse INF-γ CTCAAGTGGCATAGATGTGGAAG TGACCTCAAACTTGGCAATACTC Mouse TNF-α GGTGCCTATGTCTCAGCCTCTT GCCATAGAACTGATGAGAGGGAG Mouse ZO-1 GTTGGTACGGTGCCCTGAAAGA GCTGACAGGTAGGACAGACGAT Mouse Claudin-1 GGACTGTGGATGTCCTGCGTTT GCCAATTACCATCAAGGCTCGG Mouse Occludain TGGCAAGCGATCATACCCAGAG CTGCCTGAAGTCATCCACACTC 2.7. Western blotting Cellular lysates underwent SDS-PAGE separation and transfer to a PVDF membrane (ISEQ00010, MilliporeSigma). Following blocking with 5% skim milk for 1 h, the membrane was then subjected to overnight incubation at 4°C with the primary antibody, followed by probing with secondary antibodies (anti-mouse IgG: Bio X Cell, anti-Rabbit IgG (H + L): Invitrogen). Band intensities on the Western blot were visualized using an enhanced chemiluminescence assay kit (BMU102-CN, Abbkine). The primary antibodies were employed as indicated: Phospho-NF-κB p65 (3033S, 1:1000), IκBα (4814S, 1:1200), NF-κB p65 (8242S, 1:1000), α-tubulin (2144S, 1:1000) (Cell Signaling Technology). 2.8. Statistical analysis Analysis of statistics was performed utilizing GraphPad Prism 9.5 software. Significance was assessed by one-way analysis of variance (ANOVA). 3. Results 3.1. L. plantarum ZJ316 mitigated H. pylori -induced intestinal inflammation in mice An H. pylori -induced murine model was established, with the experimental timeline depicted in Fig. 1 A. The colonization of H. pylori in the gastric tissues of mice was evaluated using quantitative PCR, revealing a substantial quantity of H. pylori in the Hp group, whereas treatment with L. plantarum ZJ316 significantly diminished its levels ( Fig. 1 B ) . Given that H. pylori infection is associated with intestinal inflammation, we subsequently assessed the severity of this inflammation, primarily employing H&E staining and analysis of inflammatory factor expression. As depicted in Fig. 1 C, intestinal tissues from the H. pylori group exhibited hallmark signs of inflammation, including epithelial disruption and substantial infiltration of inflammatory cells (black arrow). Conversely, preemptive administration of L. plantarum ZJ316 effectively mitigated tissue damage, resulting in mucosal tissue stratification and a notable decrease in inflammatory cell infiltration. Moreover, treatment with L. plantarum ZJ316 significantly reduced the pathological scores of H. pylori -induced tissue damage in mice ( Fig. 1 C ) . Furthermore, we assessed immune responses and observed that H. pylori colonization markedly upregulated mRNA levels of IL-1β, IFN-γ, and TNF-α, whereas supplementation with L. plantarum ZJ316 significantly attenuated pro-inflammatory cytokine concentrations ( Fig. 1 D-F ) . The barrier function serves as a crucial indicator of tissue damage and inflammatory response. Our findings revealed substantial downregulation of mRNA levels of tight junction proteins (TJs), including ZO-1, Occludin, and Claudin-1, in the H. pylori group, as anticipated. Conversely, TJs levels gradually increased in the L. plantarum ZJ316 treatment group ( Fig. 1 G-I ) . These results underscored the efficacy of L. plantarum ZJ316 supplementation in ameliorating H. pylori -induced intestinal inflammation in mice. 3.2. L. plantarum ZJ316 modulated gut microbiota composition in H. pylori- infected mice To investigate the interplay between H. pylori -induced intestinal inflammation and gut microbiota, we performed 16S rRNA gene sequencing on the intestinal contents of mice. Illustrated in Fig. 2 A, among the 1475 operational taxonomic units (OTUs) identified, 468 were found to overlap across all experimental groups, with 298 and 310 distinct bacteria noted in the Hp and Hp + ZJ316 groups, respectively. Further elucidating the impact of L. plantarum ZJ316 treatment on mouse gut bacterial diversity, we utilized Alpha Diversity Analysis and Principal Coordinate Analysis (PCoA) to visually compare compositional structures, species richness, and evenness among samples. In comparison to the control group, the ACE, Shannon, and Chao1 indices significantly decreased in the H. pylori model group, indicative of reduced microbiota diversity induced by H. pylori . Conversely, L. plantarum ZJ316 treatment led to an elevation in these three indices, with a notable difference (p < 0.05) ( Fig. 2 B-D ) . While H. pylori infection led to an increase in the Simpson index and a decrease in the Pielou index, no significant differences were detected between the Hp and Hp + ZJ316 groups ( Fig. 2 E, F ) . Distinct separations were observed in PCoA among the Control, Hp, and Hp + ZJ316 groups based on the Weighted Bray-Curtis distance matrix ( Fig. 2 G ) , suggesting significant changes in species composition induced by H. pylori and substantial modulation in gut microbiota composition following L. plantarum ZJ316 administration. These findings underscored the considerable influence of H. pylori infection on gut microbiota composition. Additionally, treatment with L. plantarum ZJ316 enhanced bacterial diversity and richness compared to the Hp group. To further examine the alterations in gut microbiota composition among the groups, we conducted taxonomic analysis. The predominant species at the phylum level is depicted in Figure. 3A . Firmicutes, Bacteroidota, Actinobacteriota, and Verrucomicrobiota emerged as the dominant phyla. Notably, in the L. plantarum ZJ316 treatment group, the relative abundances of Firmicutes (49.98%), Bacteroidota (37.08%), and Actinobacteria (2.90%) were elevated compared to the Hp group, resembling levels observed in the control group (Control group: 53.944%, 36.00%, and 3.34%, respectively). This suggests that L. plantarum ZJ316 may reshape the gut microbiota structure in mice infected with H. pylori . Moreover, the Firmicutes/Bacteroidota (F/B) ratio in the L. plantarum ZJ316 group was significantly higher than that in the H. pylori group ( Fig. 3 B ) . At the genus level ( Fig. 3 C ) , reductions in beneficial bacterium Ligilactobacillus , Akkermansia , and Lactobacillus were noted in the H. pylori group compared to the control group, while pathogenic microbiota Staphylococcus and Desulfovibrio exhibited higher abundance. Notably, treatment with L. plantarum ZJ316 reversed the disrupted abundances of Ligilactobacillus , Akkermansia , Staphylococcus , and Desulfovibrio induced by H. pylori , particularly for Ligilactobacillus (p 4) ( Fig. 4 ) . The composition of gut bacterial communities in the preventive groups is depicted in Fig. 4 A. Characteristic bacteria in the Hp group included Jeotgalicoccus and Halomonas , whereas the L. plantarum ZJ316 treatment group exhibited Alloprevotella , Anaerotruncus , and Romboutsia ( Fig. 4 B ) . Additionally, ternary phase analysis was conducted on the top 10 microflora at the genus level, revealing that L. plantarum ZJ316 increased potential beneficial bacteria abundances, notably Ligilactobacillus and Akkermansia ( Fig. 4 C ) . 3.3. Correlation analysis of gut microbiota with SCFAs. SCFAs are crucial metabolites produced by the intestinal flora. In our study, we utilized GC-MS technology to quantify SCFA levels in fecal contents. As depicted in Fig. 5 A-F, H. pylori induction led to a significant reduction in valeric acid, propionic acid, caproic acid, isobutyric acid, and butyric acid contents in the fecal contents. Following intervention with L. plantarum ZJ316, the concentrations of valeric acid, propionic acid, acetic acid, caproic acid, isobutyric acid, and butyric acid significantly increased (p < 0.05), rising from 0.033, 0.280, 1.425, 0.008, 0.033, and 0.244 mg/g in the Hp group to 0.084, 0.493, 2.214, 0.027, 0.058, and 0.491 mg/g in the Hp + ZJ316 group, respectively. These results implied that H. pylori infection altered the content of certain SCFAs, which could be restored with L. plantarum ZJ316 treatment. Based upon the preceding findings, we conducted further analysis to investigate the potential correlation between predominant gut microbiota species (top 16 in abundance at the genus level) and SCFAs using Spearman analysis. As depicted in Fig. 5 G, Turicibacter and Mucispirillum exhibited inverse relationships with acetic acid, whereas Lactobacillus and Ligilactobacillus showed positive correlations with butyric acid and isobutyric acid, respectively. Additionally, Jeotgalicoccus displayed negative associations with valeric acid and acetic acid. These findings indicated that an increased abundance of Ligilactobacillus and Lactobacillus may contribute to SCFAs production. Moreover, our findings indicated that changes in gut microbiota composition may influence SCFA levels in stool. Thus, the protective effects of L. plantarum ZJ316 against H. pylori -induced intestinal inflammation may be attributed to its modulation of gut microbiota and SCFA metabolites. 3.4. L. plantarum ZJ316 alleviated H. pylori -induced inflammation in vitro In our experimental findings, H. pylori infection was observed to disrupt intestinal barrier function, resulting in alterations in inflammatory responses and microbiota structure. However, supplementation with L. plantarum ZJ316 demonstrated the ability to restore these aforementioned disruptions. Building upon these observations, we proceeded to validate the expression of inflammatory pathway proteins associated with barrier function and gut microbiota using RT-qPCR as well as western blot assays in HT-29 cells. The results revealed that H. pylori infection led to decreased mRNA levels of ZO-1, Claudin-1, and MUC2, whereas pretreatment with L. plantarum ZJ316 dramatically increased the mRNA levels of tight junction proteins ( Fig. 6 A-C ) . Concurrently, H. pylori infection elicited elevated expression levels of IL-8, IL-6, and TNF-α compared to the control group, while supplementation with L. plantarum ZJ316 notably attenuated the expression of these genes ( Fig. 6 D-F ) . NF-κB serves as a pivotal transcription factor involved in the inflammatory response. [ 21 , 28 ] H. pylori infection is known to activate NF-κB signaling. Consistent with this, western blot analysis revealed that H. pylori infection enhanced p65 phosphorylation and degradation of IκBα, whereas treatment with L. plantarum ZJ316 notably reduced p65 phosphorylation and degradation of IκBα (p < 0.001) ( Fig. 6 G-I ) . Immunohistochemical staining of phosphorylated NF-κB in intestinal tissues further supported these findings, showing that supplementation with L. plantarum ZJ316 effectively downregulated p65 phosphorylation, consistent with our in vitro results ( Fig. 6 J ) . These findings collectively provided evidence that L. plantarum ZJ316 can mitigate H. pylori -induced activation of the NF-κB pathway, thereby modulating immune function and alleviating gut inflammation. 4. Discussion H. pylori infection poses a globally significant concern due to its link with the onset of gastric carcinoma and peptic ulcers, with the infection often persisting lifelong if not eradicated [ 29 , 38 ] . Despite primarily colonizing the stomach, chronic H. pylori infection has been linked to a range of extra gastric diseases [ 11 ] . Epidemiological evidence suggests a correlation between H. pylori infection and an escalated susceptibility and severity of intestinal inflammation [ 8 ] . Utilizing antibiotics to eliminate H. pylori or resorting to anti-inflammatory medications or antibiotics for intestinal inflammation treatment can lead to adverse effects such as gut dysbiosis [ 57 , 70 ] . Hence, there is a pressing need to investigate innovative treatment approaches. Lactic acid bacteria, recognized as safe food microorganisms, hold immense promise for therapeutic applications. However, the potential protective mechanisms of lactic acid bacteria against H. pylori -induced intestinal inflammation have not been experimentally validated. In the work, we utilized H. pylori -infected mice as surrogate models for human intestinal inflammation and observed a reduction in intestinal inflammation following pretreatment with L. plantarum ZJ316. Notably, this protective effect is characterized by enhanced intestinal barrier function, mitigation of intestinal inflammation, improved microbiota structure, and elevated levels of SCFAs. Chronic inflammation and tissue damage are pivotal in the pathogenesis of gastritis, intestinal inflammation, and colorectal cancer induced by H. pylori infection [ 18 , 47 ] . Previous studies have demonstrated elevated levels of pro-inflammatory cytokines (TNF-α, IFN-γ, and IL-1β) in gastric and intestinal tissues upon H. pylori exposure, which can be mitigated by certain Lactobacillus species, known for their anti-inflammatory properties [ 47 , 55 , 68 ] . Our findings corroborated these observations, showing significantly higher levels of TNF-α, IFN-γ, and IL-1β in the Hp group compared to controls, which were notably attenuated by L. plantarum ZJ316 administration. Interestingly, while IFN-γ levels were markedly elevated in H. pylori -induced intestinal inflammation, they exhibited a reverse trend in H. pylori -induced inflammatory bowel disease (IBD), consistent with previous reports of an inverse association between H. pylori infection and IBD risk [ 2 ] . Mechanistically, H. pylori colonization appeared to modulate colonic immune responses by altering Th17 and Treg cell populations and cytokine profiles, as well as promoting M2 macrophage infiltration, with a role for CagA in M2 polarization [ 71 ] . Additionally, Li et al. , have suggested that H. pylori may alleviate DSS-induced IBD by increasing CD19 + IL-10 + Breg cell percentages [ 33 ] . The multifaceted nature of these observations underscored the complexity of H. pylori pathogenesis, with strain specificity and various infecting parameters likely contributing to the observed outcomes. Furthermore, while epidemiological studies have linked H. pylori infection to extra gastric diseases, the underlying mechanisms remain elusive and warrant further investigation. A well-functioning gut barrier is vital for gut health, preventing increased permeability, severe inflammation, and oxidative stress [ 39 ] . TJs are integral to gut barrier integrity, with ZO-1, Occludin, and Claudin-1 being key components. In our study, L. plantarum ZJ316 treatment significantly upregulated mRNA levels of ZO-1, Occludin, and Claudin-1 in intestinal tissues compared to H. pylori stimulation, aligning with the effects seen with various natural compounds, such as conjugated Carnosol and Phenolics from Dendrobium officinale [ 61 , 64 ] . Prior research has demonstrated the potential of micro integral membrane proteins from L. plantarum CGMCC 1258 to repair tight junction damage by boosting the expression of JAM-1, occludin, and claudin-1 [ 67 ] . These findings suggest that L. plantarum ZJ316 enhanced the gut barrier and mitigated H. pylori -induced intestinal inflammation. The gastrointestinal microbiota is essential for regulating the host’s immune, digestive, and neural functions, and the production of physiologically active substances [ 22 , 27 ] . While fewer studies have focused on the impact of H. pylori infection on the gut microbiome in human patients compared to the gastric microbiome, alterations in gut microbiota induced by H. pylori have been associated with various gastrointestinal and systemic diseases [ 10 ] . Few researchers reported consistent or higher alpha diversity in the fecal microbiome of H. pylori -infected patients versus the controls [ 4 , 12 , 14 ] . This finding contrasts with the lower alpha diversity observed in the gastric microbiota of H. pylori -positive individuals compared to H. pylori -negative individuals [ 45 ] . Our study revealed a decrease in alpha diversity indices with H. pylori infection, while administration of L. plantarum ZJ316 modulated H. pylori -induced dysbiosis in bacterial composition and diversity. These results may differ from previous observations, suggesting the need for further research on this topic. Reports have linked H. pylori -induced dysbiosis of gut microbiota with gut-related diseases, such as intestinal inflammation and CRC [ 47 ] . Significant alterations were observed in the intestinal microbiota of mice infected with H. pylori , characterized by a decrease in Firmicutes and an increase in Proteobacteria at the phylum level. Changes in the gut microbial communities, such as decreased Firmicutes to Bacteroidetes ratio and increased Proteobacteria abundance, have been associated with obesity and metabolic syndrome [ 4 , 5 ] . However, treatment with L. plantarum ZJ316 effectively reversed these changes induced by H. pylori , enhancing Firmicutes abundance and the Firmicutes to Bacteroidetes ratio while decreasing Proteobacteria abundance. Moreover, Chen et al. , reported an elevation in the Firmicutes to Bacteroidetes ratio following H. pylori eradication with quadruple therapy supplemented by Clostridium butyricum treatment [ 4 ] . Antibiotics are increasingly recognized as potentially harmful to intestinal microbiota, with studies reporting that H. pylori eradication with bismuth quadruple therapy reduced alpha-diversity and relative abundances of Bacteroidetes and Actinobacteria but increased that of Proteobacteria in intestinal microbiota [ 8 ] . These discrepancies may be partially explained by differences in eradication regimens. Probiotics treatment also induced significant taxonomic shifts at the genus level. H. pylori infection boosted pathogenic bacteria like Desulfovibrio and Staphylococcus , while also elevating beneficial commensals such as Akkermansia , Alloprevotella , and Ligilactobacillus . Desulfovibrio , known for its production of lipopolysaccharide and hydrogen sulfide, contributed to intestinal barrier damage and liver injury [ 7 , 54 , 72 ] , whereas Akkermansia bolstered intestinal barrier function and immune response, inversely associated with inflammatory bowel disease [ 37 , 60 ] Ligilactobacillus encompasses species adapted to vertebrate hosts, and fermented food, with its antioxidant, antibacterial, and anti-inflammatory properties, benefited host health [ 9 ] . In comparison to the Hp group, administration of L. plantarum ZJ316 increased the relative abundance of Akkermansia and Ligilactobacillus , renowned for SCFAs production, possibly explaining the reduced intestinal damage and inflammation observed in pretreated mice compared to the Hp group. Curiously, our examination of fecal samples did not detect H. pylori , aligning with the results of Kienesberger et al ., who similarly did not detect H. pylori in murine feces through qPCR or high-throughput sequencing following a six-month infection period [ 30 ] . SCFAs are metabolic byproducts derived from the fermentation of undigested dietary carbohydrates and proteins by intestinal microbiota [ 19 ] . Previous studies have reported significant decreases in SCFA levels, including valeric acid, propionic acid, caproic acid, isobutyric acid, butyric acid, and acetic acid, in mice infected with H. pylori [ 25 , 69 ] . Consistently, our findings indicated reductions in fecal SCFA levels in the H. pylori -infected group, while pretreatment with L. plantarum ZJ316 reversed these changes, suggesting alterations in intestinal flora structure. Additionally, L. plantarum ZJ316 supplementation correlated with an increased abundance of Akkermansia , Ligilactobacillus , and Lactobacillus , which were positively associated with SCFAs. Notably, higher levels of butyric acid have been inversely linked to colitis development [ 63 ] . Conversely, the putatively harmful bacterium Desulfovibrio exhibited negative correlations with SCFA levels, aligning with findings by Qu et al [ 46 ] . Overall, our results provided insights into the interplay between H. pyl ori eradication, gut microbiota composition, and SCFAs alterations. H. pylori infection triggers inflammation and disrupts cell tight junctions, which are crucial factors contributing to related diseases. In the research, upon H. pylori infection, there was a decrease in ZO-1, Claudin-1, and MUC2 mRNA levels, leading to intestinal barrier dysfunction [ 59 ] . Claudin-1 plays a role in tight junction regulation, while ZO-1 is associated with epithelial integrity [ 53 ] . Supplementation with L. plantarum ZJ316 was correlated with increased expression of tight junction proteins, indicating significant protective effects of probiotics. Intestinal epithelial barrier disruption can result in inflammation [ 56 ] . TLR4 serves as a key molecule in initiating inflammation during H. pylori infection, activating the MyD88-dependent pathway and NF-κB pathway, leading to the overexpression of inflammatory cytokines [ 1 ] . In this study, H. pylori stimulation led to elevated expression of TNF-α, IL-6, IL-8, and p-p65, which were significantly downregulated upon supplementation with L. plantarum ZJ316. Furthermore, in vivo experiments confirmed that L. plantarum ZJ316 reduced p-p65 protein expression, as detected by IHC. The nuclear translocation of p65 upon H. pylori infection has been demonstrated in numerous studies, and the anti-inflammatory activity of natural compounds often involves a decrease in p65 nuclear translocation [ 17 , 34 ] . These results implied that L. plantarum ZJ316 improves H. pylori -induced intestinal inflammation and preserves gut barrier function by modulating the gut microbiota, inhibiting the NF-κB pathway, and reducing the levels of proinflammatory cytokines. 5. Conclusions In conclusion, our study revealed that supplementation with L. plantarum ZJ316 effectively mitigates H. pylori -induced intestinal inflammation by suppressing inflammation and elevating the abundance of beneficial bacteria, including Ligilactobacillus and Akkermansia , along with enhancing SCFAs levels. These findings enhanced our comprehension of the protective mechanism of L. plantarum ZJ316 against gastrointestinal diseases, underscoring its therapeutic promise for H. pylori -induced intestinal inflammation. This research provides valuable data supporting the exploration and development of natural molecule substances and prevention strategies for gastrointestinal diseases in the future. Declarations Acknowledgments This work was supported by the Zhejiang Gongshang University Provincial Colleges and Universities Basic Research Expenses (QRK23006), Zhejiang Provincial Natural Science Foundation of China (LY22C200012), General Scientific Research Project of Zhejiang Education Department (Y202352915), National Natural Science Foundation of China (NSFC) Project (32001667) and Key Project of Zhejiang Gongshang University "Digital+" Discipline Construction (No. SZJ2022A006). Ethics Statement Animal procedures were sanctioned by the Institutional Animal Care and Use Committee of the Shanghai Public Health Clinical Center under protocol number 2022-A037-01. CRediT authorship contribution statement Shiying Wu: Conceptualization, Investigation, Resources, Writing – original draft, Funding acquisition. Fangtong Wei: Investigation, Visualization, Writing – original draft. Yongqiang Chen: Investigation, Methodology. Ziqi Chen: Data curation. Yuenuo Luo: Investigation, Methodology. Jiayi Fan: Data curation. Yang Xu: Investigation, Methodology. Mingyang Hu: Investigation. Ping Li: Investigation, Resources. Qing Gu: Writing – review & editing, Funding acquisition, Supervision. Declaration of interests The authors declare that they have no conflict of interest. Data availability The original contributions described in the research are available within the article materials, and additional questions can be addressed to the corresponding author. References S. Brandt, T. Kwok, R. Hartig, et al. NF-kappaB activation and potentiation of proinflammatory responses by the Helicobacter pylori CagA protein. Proc Natl Acad Sci U S A , 102 (26), (2005) 9300-9305. https://doi.org/10.1073/pnas.0409873102 N. Castaño-Rodríguez, N. O. Kaakoush, W. S. Lee, et al. Dual role of Helicobacter and Campylobacter species in IBD: a systematic review and meta-analysis. Gut , 66 (2), (2017) 235-249. https://doi.org/10.1136/gutjnl-2015-310545 C. C. Chen, J. M. Liou, Y. C. Lee, et al. The interplay between Helicobacter pylori and gastrointestinal microbiota. Gut Microbes , 13 (1), (2021) 1-22. https://doi.org/10.1080/19490976.2021.1909459 L. Chen, W. Xu, A. Lee, et al. The impact of Helicobacter pylori infection, eradication therapy and probiotic supplementation on gut microenvironment homeostasis: An open-label, randomized clinical trial. EBioMedicine , 35 , (2018) 87-96. https://doi.org/10.1016/j.ebiom.2018.08.028 D. Compare, A. Rocco, M. Sanduzzi Zamparelli, et al. The Gut Bacteria-Driven Obesity Development. Dig Dis , 34 (3), (2016) 221-229. https://doi.org/10.1159/000443356 F. Cristofori, V. N. Dargenio, C. Dargenio, et al. Anti-Inflammatory and Immunomodulatory Effects of Probiotics in Gut Inflammation: A Door to the Body. Front Immunol , 12 , (2021) 578386. https://doi.org/10.3389/fimmu.2021.578386 C. Du, S. Quan, X. Nan, et al. Effects of oral milk extracellular vesicles on the gut microbiome and serum metabolome in mice. Food Funct , 12 (21), (2021) 10938-10949. https://doi.org/10.1039/d1fo02255e V. Engelsberger, M. Gerhard, & R. Mejías-Luque. Effects of Helicobacter pylori infection on intestinal microbiota, immunity and colorectal cancer risk. Front Cell Infect Microbiol , 14 , (2024) 1339750. https://doi.org/10.3389/fcimb.2024.1339750 Y. Fei, S. Zhang, S. Han, et al. The Role of Dihydroresveratrol in Enhancing the Synergistic Effect of Ligilactobacillus salivarius Li01 and Resveratrol in Ameliorating Colitis in Mice. Research (Wash D C) , 2022 , (2022) 9863845. https://doi.org/10.34133/2022/9863845 Q. Feng, W. D. Chen, & Y. D. Wang. Gut Microbiota: An Integral Moderator in Health and Disease. Front Microbiol , 9 , (2018) 151. https://doi.org/10.3389/fmicb.2018.00151 F. Franceschi, M. Covino, & C. Roubaud Baudron. Review: Helicobacter pylori and extragastric diseases. Helicobacter , 24 Suppl 1 , (2019) e12636. https://doi.org/10.1111/hel.12636 F. Frost, T. Kacprowski, M. Rühlemann, et al. Helicobacter pylori infection associates with fecal microbiota composition and diversity. Sci Rep , 9 (1), (2019) 20100. https://doi.org/10.1038/s41598-019-56631-4 J. Gao, K. Xu, H. Liu, et al. Impact of the gut microbiota on intestinal immunity mediated by tryptophan metabolism. Frontiers in cellular and infection microbiology , 8 , (2018) 13. J. J. Gao, Y. Zhang, M. Gerhard, et al. Association Between Gut Microbiota and Helicobacter pylori -Related Gastric Lesions in a High-Risk Population of Gastric Cancer. Front Cell Infect Microbiol , 8 , (2018) 202. https://doi.org/10.3389/fcimb.2018.00202 M. G. Gareau, P. M. Sherman, & W. A. Walker. Probiotics and the gut microbiota in intestinal health and disease. Nat Rev Gastroenterol Hepatol , 7 (9), (2010) 503-514. https://doi.org/10.1038/nrgastro.2010.117 A. G. Gravina, R. M. Zagari, C. De Musis, et al. Helicobacter pylori and extragastric diseases: A review. World journal of gastroenterology , 24 (29), (2018) 3204. T. Guo, Q. Lin, X. Li, et al. Octacosanol Attenuates Inflammation in Both RAW264.7 Macrophages and a Mouse Model of Colitis. J Agric Food Chem , 65 (18), (2017) 3647-3658. https://doi.org/10.1021/acs.jafc.6b05465 Y. Guo, C. Xu, R. Gong, et al. Exosomal CagA from Helicobacter pylori aggravates intestinal epithelium barrier dysfunction in chronic colitis by facilitating Claudin-2 expression. Gut Pathog , 14 (1), (2022) 13. https://doi.org/10.1186/s13099-022-00486-0 H. M. Hamer, D. Jonkers, K. Venema, et al. Review article: the role of butyrate on colonic function. Aliment Pharmacol Ther , 27 (2), (2008) 104-119. https://doi.org/10.1111/j.1365-2036.2007.03562.x M. Hatakeyama. Helicobacter pylori CagA and gastric cancer: a paradigm for hit-and-run carcinogenesis. Cell host & microbe , 15 (3), (2014) 306-316. B. Hoesel, & J. A. Schmid. The complexity of NF-κB signaling in inflammation and cancer. Mol Cancer , 12 , (2013) 86. https://doi.org/10.1186/1476-4598-12-86 H. D. Holscher. Dietary fiber and prebiotics and the gastrointestinal microbiota. Gut Microbes , 8 (2), (2017) 172-184. https://doi.org/10.1080/19490976.2017.1290756 L. V. Hooper, D. R. Littman, & A. J. Macpherson. Interactions between the microbiota and the immune system. Science , 336 (6086), (2012) 1268-1273. https://doi.org/10.1126/science.1223490 P. I. Hsu, C. Y. Pan, J. Y. Kao, et al. Helicobacter pylori eradication with bismuth quadruple therapy leads to dysbiosis of gut microbiota with an increased relative abundance of Proteobacteria and decreased relative abundances of Bacteroidetes and Actinobacteria. Helicobacter , 23 (4), (2018) e12498. https://doi.org/10.1111/hel.12498 Y. Huang, Y. Ding, H. Xu, et al. Effects of sodium butyrate supplementation on inflammation, gut microbiota, and short-chain fatty acids in Helicobacter pylori -infected mice. Helicobacter , 26 (2), (2021) e12785. https://doi.org/10.1111/hel.12785 D. Jakubczyk, K. Leszczyńska, & S. Górska. The Effectiveness of Probiotics in the Treatment of Inflammatory Bowel Disease (IBD)-A Critical Review. Nutrients , 12 (7), (2020). https://doi.org/10.3390/nu12071973 S. M. Jandhyala, R. Talukdar, C. Subramanyam, et al. Role of the normal gut microbiota. World J Gastroenterol , 21 (29), (2015) 8787-8803. https://doi.org/10.3748/wjg.v21.i29.8787 A. Kauppinen, T. Suuronen, J. Ojala, et al. Antagonistic crosstalk between NF-κB and SIRT1 in the regulation of inflammation and metabolic disorders. Cell Signal , 25 (10), (2013) 1939-1948. https://doi.org/10.1016/j.cellsig.2013.06.007 S. Kayali, M. Manfredi, F. Gaiani, et al. Helicobacter pylori , transmission routes and recurrence of infection: state of the art. Acta Biomed , 89 (8-s), (2018) 72-76. https://doi.org/10.23750/abm.v89i8-S.7947 S. Kienesberger, L. M. Cox, A. Livanos, et al. Gastric Helicobacter pylori Infection Affects Local and Distant Microbial Populations and Host Responses. Cell Rep , 14 (6), (2016) 1395-1407. https://doi.org/10.1016/j.celrep.2016.01.017 R. Koumangoye, S. Omer, M. H. Kabeer, et al. Novel Human NKCC1 Mutations Cause Defects in Goblet Cell Mucus Secretion and Chronic Inflammation. Cell Mol Gastroenterol Hepatol , 9 (2), (2020) 239-255. https://doi.org/10.1016/j.jcmgh.2019.10.006 M. H. Lee, J. Y. Yang, Y. Cho, et al. Inhibitory Effects of Menadione on Helicobacter pylori Growth and Helicobacter pylori -Induced Inflammation via NF-κB Inhibition. Int J Mol Sci , 20 (5), (2019). https://doi.org/10.3390/ijms20051169 X. Li, J. Tan, F. Zhang, et al. H.pylori Infection Alleviates Acute and Chronic Colitis with the Expansion of Regulatory B Cells in Mice. Inflammation , 42 (5), (2019) 1611-1621. https://doi.org/10.1007/s10753-019-01022-0 Y. Lin, S. Wang, Z. Yang, et al. Bilirubin alleviates alum-induced peritonitis through inactivation of NLRP3 inflammasome. Biomed Pharmacother , 116 , (2019) 108973. https://doi.org/10.1016/j.biopha.2019.108973 J. M. Liou, P. Malfertheiner, Y. C. Lee, et al. Screening and eradication of Helicobacter pylori for gastric cancer prevention: the Taipei global consensus. Gut , 69 (12), (2020) 2093-2112. https://doi.org/10.1136/gutjnl-2020-322368 P. Liu, Y. Wang, G. Yang, et al. The role of short-chain fatty acids in intestinal barrier function, inflammation, oxidative stress, and colonic carcinogenesis. Pharmacol Res , 165 , (2021) 105420. https://doi.org/10.1016/j.phrs.2021.105420 I. G. Macchione, L. R. Lopetuso, G. Ianiro, et al. Akkermansia muciniphila : key player in metabolic and gastrointestinal disorders. Eur Rev Med Pharmacol Sci , 23 (18), (2019) 8075-8083. https://doi.org/10.26355/eurrev_201909_19024 P. Malfertheiner, M. C. Camargo, E. El-Omar, et al. Helicobacter pylori infection. Nat Rev Dis Primers , 9 (1), (2023) 19. https://doi.org/10.1038/s41572-023-00431-8 E. C. Martens, M. Neumann, & M. S. Desai. Interactions of commensal and pathogenic microorganisms with the intestinal mucosal barrier. Nat Rev Microbiol , 16 (8), (2018) 457-470. https://doi.org/10.1038/s41579-018-0036-x G. M. Martín-Núñez, I. Cornejo-Pareja, L. Coin-Aragüez, et al. H. pylori eradication with antibiotic treatment causes changes in glucose homeostasis related to modifications in the gut microbiota. PLoS One , 14 (3), (2019) e0213548. https://doi.org/10.1371/journal.pone.0213548 K. Matsuoka, E. Saito, T. Fujii, et al. Tacrolimus for the Treatment of Ulcerative Colitis. Intest Res , 13 (3), (2015) 219-226. https://doi.org/10.5217/ir.2015.13.3.219 S. M. McNabney, & T. M. Henagan. Short Chain Fatty Acids in the Colon and Peripheral Tissues: A Focus on Butyrate, Colon Cancer, Obesity and Insulin Resistance. Nutrients , 9 (12), (2017). https://doi.org/10.3390/nu9121348 R. Mejías-Luque, J. Zöller, F. Anderl, et al. Lymphotoxin β receptor signalling executes Helicobacter pylori -driven gastric inflammation in a T4SS-dependent manner. Gut , 66 (8), (2017) 1369-1381. https://doi.org/10.1136/gutjnl-2015-310783 J. Miyamoto, M. Kasubuchi, A. Nakajima, et al. The role of short-chain fatty acid on blood pressure regulation. Curr Opin Nephrol Hypertens , 25 (5), (2016) 379-383. https://doi.org/10.1097/mnh.0000000000000246 N. Ndegwa, A. Ploner, A. F. Andersson, et al. Gastric Microbiota in a Low- Helicobacter pylori Prevalence General Population and Their Associations With Gastric Lesions. Clin Transl Gastroenterol , 11 (7), (2020) e00191. https://doi.org/10.14309/ctg.0000000000000191 W. Qu, X. Yuan, J. Zhao, et al. Dietary advanced glycation end products modify gut microbial composition and partially increase colon permeability in rats. Mol Nutr Food Res , 61 (10), (2017). https://doi.org/10.1002/mnfr.201700118 A. Ralser, A. Dietl, S. Jarosch, et al. Helicobacter pylori promotes colorectal carcinogenesis by deregulating intestinal immunity and inducing a mucus-degrading microbiota signature. Gut , 72 (7), (2023) 1258-1270. https://doi.org/10.1136/gutjnl-2022-328075 J. Samara, S. Moossavi, B. Alshaikh, et al. Supplementation with a probiotic mixture accelerates gut microbiome maturation and reduces intestinal inflammation in extremely preterm infants. Cell Host Microbe , 30 (5), (2022) 696-711.e695. https://doi.org/10.1016/j.chom.2022.04.005 E. E. Schneeberger, & R. D. Lynch. The tight junction: a multifunctional complex. Am J Physiol Cell Physiol , 286 (6), (2004) C1213-1228. https://doi.org/10.1152/ajpcell.00558.2003 Z. H. Shen, C. X. Zhu, Y. S. Quan, et al. Relationship between intestinal microbiota and ulcerative colitis: Mechanisms and clinical application of probiotics and fecal microbiota transplantation. World J Gastroenterol , 24 (1), (2018) 5-14. https://doi.org/10.3748/wjg.v24.i1.5 S. Shim, H. S. Jang, H. W. Myung, et al. Rebamipide ameliorates radiation-induced intestinal injury in a mouse model. Toxicol Appl Pharmacol , 329 , (2017) 40-47. https://doi.org/10.1016/j.taap.2017.05.012 S. Sitkin, L. Lazebnik, E. Avalueva, et al. Gastrointestinal microbiome and Helicobacter pylori : Eradicate, leave it as it is, or take a personalized benefit-risk approach? World J Gastroenterol , 28 (7), (2022) 766-774. https://doi.org/10.3748/wjg.v28.i7.766 G. Song, D. Liu, X. Geng, et al. Bone marrow-derived mesenchymal stem cells alleviate severe acute pancreatitis-induced multiple-organ injury in rats via suppression of autophagy. Exp Cell Res , 385 (2), (2019) 111674. https://doi.org/10.1016/j.yexcr.2019.111674 B. G. J. Surewaard, A. Thanabalasuriar, Z. Zeng, et al. α-Toxin Induces Platelet Aggregation and Liver Injury during Staphylococcus aureus Sepsis. Cell Host Microbe , 24 (2), (2018) 271-284.e273. https://doi.org/10.1016/j.chom.2018.06.017 T. T. D. Thuy, P. Y. Kuo, S. M. Lin, et al. Anti- Helicobacter pylori activity of potential probiotic Lactiplantibacillus pentosus SLC13. BMC Microbiol , 22 (1), (2022) 277. https://doi.org/10.1186/s12866-022-02701-z M. K. Tulic, M. Vivinus-Nébot, A. Rekima, et al. Presence of commensal house dust mite allergen in human gastrointestinal tract: a potential contributor to intestinal barrier dysfunction. Gut , 65 (5), (2016) 757-766. https://doi.org/10.1136/gutjnl-2015-310523 C. Ubeda, Y. Taur, R. R. Jenq, et al. Vancomycin-resistant Enterococcus domination of intestinal microbiota is enabled by antibiotic treatment in mice and precedes bloodstream invasion in humans. J Clin Invest , 120 (12), (2010) 4332-4341. https://doi.org/10.1172/jci43918 M. A. Vinolo, H. G. Rodrigues, R. T. Nachbar, et al. Regulation of inflammation by short chain fatty acids. Nutrients , 3 (10), (2011) 858-876. https://doi.org/10.3390/nu3100858 J. Wang, C. Zhang, C. Guo, et al. Chitosan Ameliorates DSS-Induced Ulcerative Colitis Mice by Enhancing Intestinal Barrier Function and Improving Microflora. Int J Mol Sci , 20 (22), (2019). https://doi.org/10.3390/ijms20225751 L. Wang, L. Tang, Y. Feng, et al. A purified membrane protein from Akkermansia muciniphila or the pasteurised bacterium blunts colitis associated tumourigenesis by modulation of CD8(+) T cells in mice. Gut , 69 (11), (2020) 1988-1997. https://doi.org/10.1136/gutjnl-2019-320105 P. Wang, M. Cai, K. Yang, et al. Phenolics from Dendrobium officinale Leaf Ameliorate Dextran Sulfate Sodium-Induced Chronic Colitis by Regulating Gut Microbiota and Intestinal Barrier. J Agric Food Chem , 71 (44), (2023) 16630-16646. https://doi.org/10.1021/acs.jafc.3c05339 S. Wu, Y. Xu, Z. Chen, et al. Lactiplantibacillus plantarum ZJ316 Reduces Helicobacter pylori Adhesion and Inflammation by Inhibiting the Expression of Adhesin and Urease Genes. Mol Nutr Food Res , 67 (18), (2023) e2300241. https://doi.org/10.1002/mnfr.202300241 S. Y. Xu, J. J. Aweya, N. Li, et al. Microbial catabolism of Porphyra haitanensis polysaccharides by human gut microbiota. Food Chem , 289 , (2019) 177-186. https://doi.org/10.1016/j.foodchem.2019.03.050 X. Xu, G. Zhang, K. Peng, et al. Carnosol Maintains Intestinal Barrier Function and Mucosal Immune Homeostasis in DSS-Induced Colitis. Front Nutr , 9 , (2022) 894307. https://doi.org/10.3389/fnut.2022.894307 Q. Yang, J. Ouyang, F. Sun, et al. Short-Chain Fatty Acids: A Soldier Fighting Against Inflammation and Protecting From Tumorigenesis in People With Diabetes. Front Immunol , 11 , (2020) 590685. https://doi.org/10.3389/fimmu.2020.590685 Y. Yang, A. Li, J. Qiu, et al. Responses of the intestinal microbiota to exposure of okadaic acid in marine medaka Oryzias melastigma. J Hazard Mater , 465 , (2024) 133087. https://doi.org/10.1016/j.jhazmat.2023.133087 M. Yin, X. Yan, W. Weng, et al. Micro Integral Membrane Protein (MIMP), a Newly Discovered Anti-Inflammatory Protein of Lactobacillus Plantarum , Enhances the Gut Barrier and Modulates Microbiota and Inflammatory Cytokines. Cell Physiol Biochem , 45 (2), (2018) 474-490. https://doi.org/10.1159/000487027 P. Yu, C. Ke, J. Guo, et al. Lactobacillus plantarum L15 Alleviates Colitis by Inhibiting LPS-Mediated NF-κB Activation and Ameliorates DSS-Induced Gut Microbiota Dysbiosis. Front Immunol , 11 , (2020) 575173. https://doi.org/10.3389/fimmu.2020.575173 X. Yu, J. Ou, L. Wang, et al. Gut microbiota modulate CD8(+) T cell immunity in gastric cancer through Butyrate/GPR109A/HOPX. Gut Microbes , 16 (1), (2024) 2307542. https://doi.org/10.1080/19490976.2024.2307542 A. Zarrinpar, A. Chaix, Z. Z. Xu, et al. Antibiotic-induced microbiome depletion alters metabolic homeostasis by affecting gut signaling and colonic metabolism. Nat Commun , 9 (1), (2018) 2872. https://doi.org/10.1038/s41467-018-05336-9 H. Zhang, Y. Dai, Y. Liu, et al. Helicobacter pylori Colonization Protects Against Chronic Experimental Colitis by Regulating Th17/Treg Balance. Inflamm Bowel Dis , 24 (7), (2018) 1481-1492. https://doi.org/10.1093/ibd/izy107 Q. Zhang, C. Qiu, W. Jiang, et al. The impact of dioctyl phthalate exposure on multiple organ systems and gut microbiota in mice. Heliyon , 9 (12), (2023) e22677. https://doi.org/10.1016/j.heliyon.2023.e22677 Q. Zhou, B. Xue, R. Gu, et al. Lactobacillus plantarum ZJ316 Attenuates Helicobacter pylori -Induced Gastritis in C57BL/6 Mice. J Agric Food Chem , 69 (23), (2021) 6510-6523. https://doi.org/10.1021/acs.jafc.1c01070 Additional Declarations No competing interests reported. Supplementary Files GraphicalAbstract.docx Cite Share Download PDF Status: Published Journal Publication published 13 Feb, 2025 Read the published version in Probiotics and Antimicrobial Proteins → Version 1 posted Editorial decision: Revision requested 18 Jan, 2025 Reviews received at journal 17 Jan, 2025 Reviews received at journal 13 Jan, 2025 Reviewers agreed at journal 07 Jan, 2025 Reviewers agreed at journal 02 Jan, 2025 Reviewers invited by journal 09 Dec, 2024 Editor assigned by journal 05 Nov, 2024 Submission checks completed at journal 05 Nov, 2024 First submitted to journal 29 Oct, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-5351640","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":374187905,"identity":"423c7c06-5a79-4118-a056-ef4114714e5f","order_by":0,"name":"Shiying Wu","email":"","orcid":"","institution":"Zhejiang Gongshang University","correspondingAuthor":false,"prefix":"","firstName":"Shiying","middleName":"","lastName":"Wu","suffix":""},{"id":374187908,"identity":"e7f6b9d8-adce-4b37-a52f-7c3c14717035","order_by":1,"name":"Fangtong Wei","email":"","orcid":"","institution":"Zhejiang Gongshang University","correspondingAuthor":false,"prefix":"","firstName":"Fangtong","middleName":"","lastName":"Wei","suffix":""},{"id":374187909,"identity":"99b4ef72-8e67-4ee8-8878-d9deb61b5f89","order_by":2,"name":"Yongqiang Chen","email":"","orcid":"","institution":"Zhejiang Gongshang University","correspondingAuthor":false,"prefix":"","firstName":"Yongqiang","middleName":"","lastName":"Chen","suffix":""},{"id":374187912,"identity":"22b66b99-cc5a-4b21-9ef2-7058ad476e41","order_by":3,"name":"Ziqi Chen","email":"","orcid":"","institution":"Zhejiang Gongshang University","correspondingAuthor":false,"prefix":"","firstName":"Ziqi","middleName":"","lastName":"Chen","suffix":""},{"id":374187914,"identity":"70678636-22a2-417f-ac6b-4b4e34ca3f75","order_by":4,"name":"Yuenuo Luo","email":"","orcid":"","institution":"Zhejiang Gongshang University","correspondingAuthor":false,"prefix":"","firstName":"Yuenuo","middleName":"","lastName":"Luo","suffix":""},{"id":374187915,"identity":"95cf8d32-3715-4f99-916a-c06fe370cbf6","order_by":5,"name":"Jiayi Fan","email":"","orcid":"","institution":"Zhejiang Gongshang University","correspondingAuthor":false,"prefix":"","firstName":"Jiayi","middleName":"","lastName":"Fan","suffix":""},{"id":374187916,"identity":"b9b00381-0db9-454c-8a80-c77353115f81","order_by":6,"name":"Yang Xu","email":"","orcid":"","institution":"Zhejiang Gongshang University","correspondingAuthor":false,"prefix":"","firstName":"Yang","middleName":"","lastName":"Xu","suffix":""},{"id":374187919,"identity":"967c5980-ec17-4802-9a70-e2c328c8b12a","order_by":7,"name":"Mingyang Hu","email":"","orcid":"","institution":"Zhejiang Gongshang University","correspondingAuthor":false,"prefix":"","firstName":"Mingyang","middleName":"","lastName":"Hu","suffix":""},{"id":374187921,"identity":"2e6bd652-139b-497a-9c90-f5f0577292a3","order_by":8,"name":"Ping Li","email":"","orcid":"","institution":"Zhejiang Gongshang University","correspondingAuthor":false,"prefix":"","firstName":"Ping","middleName":"","lastName":"Li","suffix":""},{"id":374187922,"identity":"111c1e37-e9bd-4207-8727-4dcb8841c43b","order_by":9,"name":"Qing Gu","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA+klEQVRIiWNgGAWjYJCCAwwMNjxs7M3HwDw2duK0pMnx8xxLY2BIAGphJs6iw8aSM3LMwFoYCGmRj0jeeLjgF3PihgM53x58/LFNno+ZgfHDxxzcWgxvpBUcntnHBtRydrvhjITbhm3MDMySM7fh0TIjx+Awbw9P4oaDvdukeRJuMwK1sDHzEtYikbjhMM8zkBZ7glrkJYBaeH4YGEu28bCBtCQS1GLA86zgMG9DAjCQ2cwkZ6TdTm5jZmzG6xf59uTNn3n+/Odhk3/8TOKDzW3b+e3NBz98xGfLAQYDBsY2FDHGBtzqQbY0ALUw/MGrZhSMglEwCkY6AAAJ9FK6jNAXCgAAAABJRU5ErkJggg==","orcid":"","institution":"Zhejiang Gongshang University","correspondingAuthor":true,"prefix":"","firstName":"Qing","middleName":"","lastName":"Gu","suffix":""}],"badges":[],"createdAt":"2024-10-29 06:38:25","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-5351640/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-5351640/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1007/s12602-025-10474-w","type":"published","date":"2025-02-13T15:57:42+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":69214294,"identity":"49b89d1b-ec32-4074-94a7-4f6bc5c8b817","added_by":"auto","created_at":"2024-11-18 06:06:07","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":4685324,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003eL. plantarum\u003c/em\u003e ZJ316 ameliorated intestinal inflammation and repaired intestinal barrier function in \u003cem\u003eH. pylori\u003c/em\u003e infected mice.\u003csub\u003e \u003c/sub\u003e(A) The experimental schedule. (B) The number of \u003cem\u003eH. pylori\u003c/em\u003e in gastric mucosa. (C) H\u0026amp;E staining and pathological scores. (D-I) The relative mRNA levels of IL-1β, IFN-γ, TNF-α, ZO-1, Occludin, and Claudin-1 of intestinal tissues. All bar graphs depict mean ± SD. *\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05; **\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01; ***\u003cem\u003ep \u0026lt;\u003c/em\u003e 0.001. \u003cem\u003en \u003c/em\u003e= 5.\u003c/p\u003e","description":"","filename":"Figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-5351640/v1/7e623418bfa1bd2fc54f9918.png"},{"id":69214296,"identity":"f7e882ff-7608-465c-9020-a0273332651b","added_by":"auto","created_at":"2024-11-18 06:06:07","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":1727706,"visible":true,"origin":"","legend":"\u003cp\u003eThe effect of \u003cem\u003eL. plantarum\u003c/em\u003eZJ316 on microbiota diversity in \u003cem\u003eH. pylori\u003c/em\u003einfected mice. (A) Venn diagram. (B-F) The diversity analysis by AEC, Shannon, Chao1, Simpson, and Pielou. (G) The β-diversity analysis. All bar graphs depictas mean ± SD. *\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05; **\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01; ***\u003cem\u003ep \u0026lt;\u003c/em\u003e 0.001. \u003cem\u003en \u003c/em\u003e= 5.\u003c/p\u003e","description":"","filename":"Figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-5351640/v1/7138ec99bf889420e51f3fac.png"},{"id":69215459,"identity":"d14f9348-e35e-42f8-af0c-9d7a23e1a31f","added_by":"auto","created_at":"2024-11-18 06:22:13","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":1322383,"visible":true,"origin":"","legend":"\u003cp\u003eRegulatory effect of \u003cem\u003eL. plantarum\u003c/em\u003e ZJ316 on the gut microbiota composition in in mice infected with \u003cem\u003eH. pylori\u003c/em\u003e. (A, C) Relative abundance composition of gut microbiota at phylum and genus levels. (B) Firmicutes/Bacteroidota (F/B) ratio. (D-F) Quantitative analysis of\u003cem\u003e Akkermansia\u003c/em\u003e, \u003cem\u003eLigilactobacillus\u003c/em\u003e, \u003cem\u003eStaphylococcus\u003c/em\u003e, and \u003cem\u003eDesulfovibrio\u003c/em\u003e. All bar graphs depict as mean ± SD. *\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05; **\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01; ***\u003cem\u003ep \u0026lt;\u003c/em\u003e 0.001. \u003cem\u003en \u003c/em\u003e= 5.\u003c/p\u003e","description":"","filename":"Figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-5351640/v1/b2f3ff89b9aa34c53f3e027d.png"},{"id":69215349,"identity":"05e992cd-fbcb-455f-be85-fb4a0cc2f305","added_by":"auto","created_at":"2024-11-18 06:14:07","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":2583788,"visible":true,"origin":"","legend":"\u003cp\u003eVariations in intestinal bacterial taxa among the groups. (A) Evolutionary branching diagram for LEfse analysis (LDA \u0026gt; 4). (B) LEfSe analysis. (C) Ternary phase analysis (top 10 genus level). All bar graphs depict mean ± SD. *\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05; **\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01; ***\u003cem\u003ep \u0026lt;\u003c/em\u003e 0.001. \u003cem\u003en \u003c/em\u003e= 5.\u003c/p\u003e","description":"","filename":"Figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-5351640/v1/583b16c2ebe613878e4a9337.png"},{"id":69215348,"identity":"a2a254e1-ad66-4daf-8528-371242e98dec","added_by":"auto","created_at":"2024-11-18 06:14:07","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":1255956,"visible":true,"origin":"","legend":"\u003cp\u003eImpact of \u003cem\u003eL. plantarum \u003c/em\u003eZJ316 treatment on SCFA levels in \u003cem\u003eH. pylori\u003c/em\u003e-infected mice. (A-F) Levels of valeric acid, propionic acid, acetic acid, caproic acid, isobutyric acid, and butyric acid, respectively. (G) Heatmap depicting the association between gut microbiomes at the genus level and SCFAs. All bar graphs depict mean ± SD. *\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05; **\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01; ***\u003cem\u003ep \u0026lt;\u003c/em\u003e 0.001. \u003cem\u003en \u003c/em\u003e= 5.\u003c/p\u003e","description":"","filename":"Figure5.png","url":"https://assets-eu.researchsquare.com/files/rs-5351640/v1/eea46e0c5c7525780e00fa3f.png"},{"id":69214300,"identity":"70efeeda-4ee5-4697-9b98-0c2dc41a73cb","added_by":"auto","created_at":"2024-11-18 06:06:07","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":4822957,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003eL. plantarum\u003c/em\u003e ZJ316 attenuates \u003cem\u003eH. pylori\u003c/em\u003e-induced inflammation in HT-29 Cells. (A-F) The relative mRNA levels of ZO-1, Claudin-1, MUC2, IL-8, IL-6, and TNF-α. (G-I) The protein expression levels of p-p65, p65 and IκBα. (J) Immunohistochemical staining of phosphorylated NF-κB in intestinal tissues. All bar graphs depict mean ± SD. *\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05; **\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01; ***\u003cem\u003ep \u0026lt;\u003c/em\u003e 0.001.\u003c/p\u003e","description":"","filename":"Figure6.png","url":"https://assets-eu.researchsquare.com/files/rs-5351640/v1/7b6d2ab1303c7368d899f423.png"},{"id":76487553,"identity":"e12b3e17-15e7-4a56-ba7e-3bae02e4926f","added_by":"auto","created_at":"2025-02-17 16:09:01","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":17372402,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-5351640/v1/e59e0bc5-e1b4-418b-9b8f-2fb022f0136c.pdf"},{"id":69214298,"identity":"e6c69e85-64b2-4466-937f-61bd9476f5a4","added_by":"auto","created_at":"2024-11-18 06:06:07","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":546366,"visible":true,"origin":"","legend":"","description":"","filename":"GraphicalAbstract.docx","url":"https://assets-eu.researchsquare.com/files/rs-5351640/v1/ae9989436a79e994361537f0.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Probiotic Intervention Alleviates Helicobacter pylori-induced Intestinal Inflammation by Sustaining Intestinal Homeostasis","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003e \u003cem\u003eHelicobacter pylori\u003c/em\u003e (\u003cem\u003eH. pylori\u003c/em\u003e) infection presents a persistent and substantial global public health concern, affecting a significant proportion of the world's population \u003csup\u003e[\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]\u003c/sup\u003e. This bacterial infection is widely recognized as a pivotal risk factor contributing to the development of gastric cancer \u003csup\u003e[\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]\u003c/sup\u003e. Effective eradication of \u003cem\u003eH. pylori\u003c/em\u003e has emerged as a crucial and manageable approach to preventing gastric malignancies. Upon infection, \u003cem\u003eH. pylori\u003c/em\u003e triggers a series of immune responses, notably activating NF-κB signaling, which plays pivotal roles in the pathogenesis of \u003cem\u003eH. pylori\u003c/em\u003e-related diseases \u003csup\u003e[\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e, \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e]\u003c/sup\u003e. Furthermore, \u003cem\u003eH. pylori\u003c/em\u003e induces inflammation within the gastric epithelium through various virulence factors, including cytotoxin-associated protein A (CagA), vacuolating cytotoxin A (VacA), and lipopolysaccharide (LPS) \u003csup\u003e[\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e, \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e]\u003c/sup\u003e. This persistent inflammatory milieu is acknowledged as a major contributor to tumor initiation and progression.\u003c/p\u003e \u003cp\u003eAlthough \u003cem\u003eH. pylori\u003c/em\u003e infection primarily affects the stomach, mounting evidence has implicated \u003cem\u003eH. pylori\u003c/em\u003e infection in the pathogenesis of extra gastric diseases, such as intestinal inflammation, colorectal carcinogenesis, and asthma, through deregulating immune homeostasis and disrupting composition and function of the gut microbiota \u003csup\u003e[\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e, \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]\u003c/sup\u003e. Intestinal inflammation, characterized by immune-mediated responses within the intestinal mucosa, is a multifactorial process associated with tissue damage, alterations in barrier integrity and microbiota composition, a decrease in short-chain fatty acid (SCFA), as well as disturbances in immune response regulation \u003csup\u003e[\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e, \u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e]\u003c/sup\u003e. Impairment of the epithelial barrier represents a key pathological mechanism underlying intestinal inflammation, leading to increased permeability and dysregulated immune responses \u003csup\u003e[\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e, \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e]\u003c/sup\u003e. Presently, the primary pharmaceutical treatments for intestinal inflammation comprise anti-inflammatory drugs, immunosuppressants, antibiotics, and anti-diarrheal drugs. However, these treatments often provide only partial symptom relief and are associated with notable side effects \u003csup\u003e[\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e]\u003c/sup\u003e. Particularly in the process of eradicating \u003cem\u003eH. pylori\u003c/em\u003e with antibiotic treatment, dysbiosis of the host's gut microbiota can occur and prove difficult to restore \u003csup\u003e[\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e, \u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e]\u003c/sup\u003e. Thus, the development of effective treatment strategies with minimal side effects is imperative for addressing intestinal inflammation.\u003c/p\u003e \u003cp\u003eConsuming probiotics holds promise for reinstating gut microbiota equilibrium, bolstering intestinal mucosal barrier integrity, and mitigating gastrointestinal infections \u003csup\u003e[\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e, \u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e]\u003c/sup\u003e. Numerous investigations have underscored the comparable efficacy of probiotics to conventional pharmacotherapy in managing intestinal inflammation \u003csup\u003e[\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]\u003c/sup\u003e. Their indispensable role in modulating inflammatory responses has been extensively delineated across various \u003cem\u003ein vitro\u003c/em\u003e and \u003cem\u003eex vivo\u003c/em\u003e models, and clinical trials. Notably, in a clinical investigation, administration of a probiotic blend comprising four \u003cem\u003eBifidobacterium\u003c/em\u003e strains elicited a notable reduction in key proinflammatory cytokines, including calprotectin, IFN-γ, IL-12p70, and IL-4, coupled with an elevation in IL-22 levels in the fecal matter of preterm infants \u003csup\u003e[\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e]\u003c/sup\u003e. The gut constitutes a rich and diverse ecosystem harboring hundreds of bacterial species collectively known as the gut microbiota, playing a pivotal role in human well-being \u003csup\u003e[\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]\u003c/sup\u003e. Recent research has emphasized the significant link between gut microbiota dysbiosis and the development of intestinal inflammation. Utilizing next-generation sequencing (NGS) techniques and preclinical models, researchers have indicated a correlation between reduced variety and abundance of gut microbiota and increased susceptibility to intestinal inflammation \u003csup\u003e[\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]\u003c/sup\u003e. Probiotic supplementation may provide a promising approach to restoring gut microbiota balance. For instance, Yu \u003cem\u003eet al\u003c/em\u003e. revealed that supplementation with \u003cem\u003eLactiplantibacillus plantarum\u003c/em\u003e L15 elevated the abundance of \u003cem\u003eLactobacillus\u003c/em\u003e, \u003cem\u003eTuricibacter\u003c/em\u003e, \u003cem\u003eBacteroides\u003c/em\u003e, and \u003cem\u003eButyricicoccus\u003c/em\u003e, thereby alleviating dextran sulfate sodium-induced colitis in mice \u003csup\u003e[\u003cspan citationid=\"CR68\" class=\"CitationRef\"\u003e68\u003c/span\u003e]\u003c/sup\u003e. The gut microbiota is known to yield a spectrum of metabolites, encompassing SCFAs, polyphenolic compounds, and amino acid derivatives. Notably, SCFAs, comprising acetate, propionate, and butyrate, are enzymatically synthesized via the fermentation of dietary fiber by anaerobic bacteria, prominently Firmicutes and Bacteroidetes \u003csup\u003e[\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]\u003c/sup\u003e. These SCFAs exert pivotal regulatory functions in bolstering gut homeostasis, modulating inflammatory cascades, preserving intestinal epithelial barrier integrity, and tumorigenesis \u003csup\u003e[\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e, \u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e58\u003c/span\u003e]\u003c/sup\u003e. Consequently, alterations in gut microbial composition precipitated shifts in SCFAs, thus contributing to the pathogenesis of intestinal inflammation, diabetes, colorectal carcinoma, and cardiovascular maladies \u003csup\u003e[\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e, \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e]\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eNumerous studies have indicated that \u003cem\u003eH. pylori\u003c/em\u003e infection elicits a systemic immunoregulatory effect and disrupts the typical acidic gastric environment, resulting in changes to the gastric and gut microbiota as well as levels of SCFAs \u003csup\u003e[\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]\u003c/sup\u003e. It has been documented that \u003cem\u003eH. pylori\u003c/em\u003e-positive patients demonstrate enriched \u003cem\u003ePrevotellaceae\u003c/em\u003e abundance and reduced levels of beneficial SCFAs producers such as \u003cem\u003ePseudofavonifractor\u003c/em\u003e, \u003cem\u003eAlistipes\u003c/em\u003e, and \u003cem\u003eFusicatenibacter\u003c/em\u003e compared to negative controls \u003csup\u003e[\u003cspan citationid=\"CR65\" class=\"CitationRef\"\u003e65\u003c/span\u003e] [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]\u003c/sup\u003e. Additionally, several studies suggest that \u003cem\u003eH. pylori\u003c/em\u003e infection diminishes short-chain fatty acid production, potentially elucidating the link between \u003cem\u003eH. pylori\u003c/em\u003e exposure and extra gastric diseases \u003csup\u003e[\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e]\u003c/sup\u003e. However, limited information exists regarding the mechanisms by which \u003cem\u003eL. plantarum\u003c/em\u003e strains alleviate \u003cem\u003eH. pylori\u003c/em\u003e-induced intestinal inflammation. Our previous investigation unveiled that \u003cem\u003eL. plantarum\u003c/em\u003e ZJ316, characterized by favorable gastrointestinal transit tolerance, adhesion properties, and the ability to reduce pro-inflammatory responses, effectively alleviated \u003cem\u003eH. pylori\u003c/em\u003e-induced gastritis in mice \u003csup\u003e[\u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e62\u003c/span\u003e, \u003cspan citationid=\"CR73\" class=\"CitationRef\"\u003e73\u003c/span\u003e]\u003c/sup\u003e. Therefore, the present investigation aims to elucidate the protective effects of \u003cem\u003eL. plantarum\u003c/em\u003e ZJ316 on \u003cem\u003eH. pylori\u003c/em\u003e-induced intestinal inflammation both \u003cem\u003ein vitro\u003c/em\u003e and \u003cem\u003ein vivo\u003c/em\u003e. The findings of this research may lay the groundwork for exploring potential probiotic combinations and hold considerable implications for future investigations into safe and effective preventive and therapeutic strategies for \u003cem\u003eH. pylori\u003c/em\u003e-induced intestinal inflammation.\u003c/p\u003e"},{"header":"2. Materials and Methods","content":"\u003cdiv id=\"Sec3\"\u003e\n \u003ch2\u003e2.1. Bacteria strains and cell culture\u003c/h2\u003e\n \u003cp\u003e\u003cem\u003eLactobacillus plantarum\u003c/em\u003e ZJ316 (CCTCC M 208077) was isolated and preserved in our laboratory. Cultivation of the strain was carried out anaerobically at 37\u0026deg;C for 24 h in MRS broth (Hopebio, Qingdao, China). The \u003cem\u003eH. pylori\u003c/em\u003e strain ZJC03 (CCTCC M20211218) was sourced from individuals diagnosed with gastritis and gastric cancer at Zhejiang University College of Medicine, and was cultured at 37\u0026deg;C for 72 h on Brucella agar fortified with 7% defibrinated sheep blood under microaerobic conditions.\u003c/p\u003e\n \u003cp\u003eHuman colonic adenocarcinoma cell line HT-29 was procured from Wuhan Benyuan Biotechnology Co., Ltd. (Wuhan, China). These cells were cultured in RPMI 1640 medium fortified with 20% fetal bovine serum in a humidified atmosphere containing 5% CO\u003csub\u003e2\u003c/sub\u003e at 37\u0026deg;C. The cells were pretreated with \u003cem\u003eL. plantarum\u003c/em\u003e ZJ316 (1 \u0026times; 10\u003csup\u003e8\u003c/sup\u003e CFU /mL) for 2 h, subsequently supplemented with \u003cem\u003eH. pylori\u003c/em\u003e (1 \u0026times; 10\u003csup\u003e8\u003c/sup\u003e CFU /mL) for 2 h.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec4\"\u003e\n \u003ch2\u003e2.2. Animals and Experimental Design.\u003c/h2\u003e\n \u003cp\u003eSix-week-old specific-pathogen-free (SPF) female C57BL/6J mice were procured from SIPPR/BK Lab Animal Co., Ltd. (Shanghai, China). The animals underwent acclimatization and were housed within the Experimental Animal Department of the Shanghai Public Health Clinical Center under standardized laboratory conditions. They were provided ad libitum availability of pelleted food and water. Animal procedures were sanctioned by the Institutional Animal Care and Use Committee of the Shanghai Public Health Clinical Center under protocol number 2022-A037-01. The mice were randomly allocated into three groups (n\u0026thinsp;=\u0026thinsp;8 per group), and following one week of acclimatization, the experimental protocols were performed as follows:\u003c/p\u003e\n \u003cp\u003e\u0026bull; Control group: Mice were administered 400 \u0026micro;L of sterile saline orally every other day for a duration of 5 weeks.\u003c/p\u003e\n \u003cp\u003e\u0026bull; Hp group: Mice received 400 \u0026micro;L of sterile saline orally for 3 weeks prior to infection.\u003c/p\u003e\n \u003cp\u003e\u0026bull; ZJ316\u0026thinsp;+\u0026thinsp;Hp group: Mice were orally administered a suspension of \u003cem\u003eL. plantarum\u003c/em\u003e ZJ316 (1 \u0026times; 10\u003csup\u003e9\u003c/sup\u003e CFU/mL) for 3 weeks.\u003c/p\u003e\n \u003cp\u003eSubsequently, mice in the Hp and ZJ316\u0026thinsp;+\u0026thinsp;Hp groups were administered orally with 400 \u0026micro;L of \u003cem\u003eH. pylori\u003c/em\u003e (1 \u0026times; 10\u003csup\u003e9\u003c/sup\u003e CFU/mL) every alternate day for a duration of 14 days (Fig.\u0026nbsp;\u003cspan\u003e1\u003c/span\u003eA). After the experiment, fresh feces and blood samples were collected and the mice were euthanized. Gastric mucosa was utilized to extract DNA for the detection of \u003cem\u003eH. pylori\u003c/em\u003e through quantitative real-time PCR, with the following specific primers: (F: 5-CGCTAAGAGATCAGCCTATGTCC-3; R: 5-CCGTGTCTCAGTTCCAGTGTGT-3).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec5\"\u003e\n \u003ch2\u003e2.3. Histology and Immunohistochemistry\u003c/h2\u003e\n \u003cp\u003eThe intestinal tissue was fixed in a 4% paraformaldehyde buffer at ambient temperature for 36 h. Tissues were paraffin-embedded, sectioned at 5 \u0026micro;m thickness, and stained with hematoxylin and eosin (H\u0026amp;E). Histological scoring was conducted as follows: The scoring criteria includes epithelial damage, inflammatory cell infiltration, crypt architecture, and tissue integrity, each graded from 0 to 3 based on the extent of damage, with 0 representing absence of damage, 1 for minor damage, 2 for moderate injury, and 3 for significant impairment. It covers aspects such as epithelial edema and vacuolation, erosions/disruptive lesions, the extent and depth of inflammatory cell infiltration, the percentage of crypt loss, mucosal and submucosal thickening, as well as ulceration and necrosis.\u003c/p\u003e\n \u003cp\u003eFor immunohistochemical staining, sections were incubated in blocking solution at ambient temperature away from light for 30 minutes \u003csup\u003e[\u003cspan\u003e69\u003c/span\u003e]\u003c/sup\u003e. Subsequently, the primary antibody Phospho-NF-\u0026kappa;B p65 (3033S, 1:200; Cell Signaling Technology) was applied and left to incubate for 1 h at ambient temperature. Sections underwent three PBS washes before incubation with a secondary enzyme-linked goat anti-rabbit IgG polymer for 30 minutes. Subsequently, sections were inspected under a light microscope (NIKON Eclipse Ci, Japan).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec6\"\u003e\n \u003ch2\u003e2.4. 16S rDNA Gene Sequencing\u003c/h2\u003e\n \u003cp\u003eThe gut microbiota was analyzed by sequencing the V3-V4 region of the 16S rDNA gene with QIIME pipeline. DADA2 was utilized to infer Paired-end reads, which were then associated with sample IDs and clustered into amplicon sequence variants (ASVs) with 100% similarity using the SILVA 138/16S database. Alpha and Beta diversity were analyzed.\u003csup\u003e[\u003cspan\u003e66\u003c/span\u003e]\u003c/sup\u003e Differences in taxa, clades, and ASVs underwent analysis via linear discriminant analysis effect size (LEfSe) method (LDA\u0026thinsp;\u0026gt;\u0026thinsp;4.0).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec7\"\u003e\n \u003ch2\u003e2.5. Measurement of fecal SCFAs\u003c/h2\u003e\n \u003cp\u003eThe SCFA levels in fecal samples were quantified using gas chromatography\u0026ndash;mass spectrometry. Fecal samples were homogenized with liquid nitrogen and mixed with 1300 \u0026micro;l of ethanol solution. After extraction via ultrasonication for 40 minutes, the samples were centrifuged. The resulting supernatant was then passed through a 0.22 \u0026micro;m needle filter and subjected to direct GC-MS analysis \u003csup\u003e[\u003cspan\u003e25\u003c/span\u003e]\u003c/sup\u003e. GC analysis was performed with a capillary column with helium as the carrier gas at a flow rate of 1.0 mL/min. The injection port temperature was set at 250\u0026deg;C with no split flow. The heating program started at 50\u0026deg;C for 2 minutes, then ramped up to 120\u0026deg;C at 15\u0026deg;C/min, followed by a gradual increase to 170\u0026deg;C at 5\u0026deg;C/min, and finally held at 240\u0026deg;C for 3 minutes \u003csup\u003e[\u003cspan\u003e25\u003c/span\u003e]\u003c/sup\u003e.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec8\"\u003e\n \u003ch2\u003e2.6. Reverse transcription‑quantitative polymerase chain reaction (RT-qPCR)\u003c/h2\u003e\n \u003cp\u003eConventional RT-qPCR analyses were performed using primers listed in Table\u0026nbsp;\u003cspan\u003e1\u003c/span\u003e, with GAPDH employed as a reference gene for evaluating target gene transcription levels. RT-qPCR was conducted utilizing commercial kits (RR820A, Takara) and the ABI StepOne Plus system. mRNA levels were quantified using the 2\u003csup\u003e\u0026minus;\u0026Delta;\u0026Delta;Cq\u003c/sup\u003e method.\u003c/p\u003e\n \u003cdiv\u003e\n \u003ctable id=\"Tab1\" border=\"1\"\u003e\n \u003ccaption language=\"En\"\u003e\n \u003cdiv\u003eTable 1\u003c/div\u003e\n \u003cdiv\u003e\n \u003cp\u003eSequences of the primers.\u003c/p\u003e\n \u003c/div\u003e\n \u003c/caption\u003e\n \u003ccolgroup cols=\"3\"\u003e\u003c/colgroup\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eGene\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eForward (5\u0026apos;-3\u0026apos;)\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eReverse (5\u0026apos;-3\u0026apos;)\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eGAPDH\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGTCTCCTCTGACTTCAACAGCG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eACCACCCTGTTGCTGTAGCCAA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eHuman IL-6\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eAGACAGCCACTCACCTCTTCAG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTTCTGCCAGTGCCTCTTTGCTG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eHuman IL-8\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eAGTCCTTGTTCCACTGTGCCTTGG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTGCTTCCACATGTCCTCACAACATC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eHuman TNF-\u0026alpha;\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCTCTTCTGCCTGCTGCACTTTG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eATGGGCTACAGGCTTGTCACTC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eHuman ZO-1\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGTCCAGAATCTCGGAAAAGTGCC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCTTTCAGCGCACCATACCAACC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eHuman Cludin-1\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGTCTTTGACTCCTTGCTGAATCTG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCACCTCATCGTCTTCCAAGCAC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eHuman Occludin\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eATGGCAAAGTGAATGACAAGCGG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCTGTAACGAGGCTGCCTGAAGT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eMouse IL-1\u0026beta;\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTCAAATCTCGCAGCAGCACATC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCGTCACACACCAGCAGGTTATC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eMouse INF-\u0026gamma;\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCTCAAGTGGCATAGATGTGGAAG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTGACCTCAAACTTGGCAATACTC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eMouse TNF-\u0026alpha;\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGGTGCCTATGTCTCAGCCTCTT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGCCATAGAACTGATGAGAGGGAG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eMouse ZO-1\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGTTGGTACGGTGCCCTGAAAGA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGCTGACAGGTAGGACAGACGAT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eMouse Claudin-1\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGGACTGTGGATGTCCTGCGTTT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGCCAATTACCATCAAGGCTCGG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eMouse Occludain\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTGGCAAGCGATCATACCCAGAG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCTGCCTGAAGTCATCCACACTC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n \u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec9\"\u003e\n \u003ch2\u003e2.7. Western blotting\u003c/h2\u003e\n \u003cp\u003eCellular lysates underwent SDS-PAGE separation and transfer to a PVDF membrane (ISEQ00010, MilliporeSigma). Following blocking with 5% skim milk for 1 h, the membrane was then subjected to overnight incubation at 4\u0026deg;C with the primary antibody, followed by probing with secondary antibodies (anti-mouse IgG: Bio X Cell, anti-Rabbit IgG (H\u0026thinsp;+\u0026thinsp;L): Invitrogen). Band intensities on the Western blot were visualized using an enhanced chemiluminescence assay kit (BMU102-CN, Abbkine). The primary antibodies were employed as indicated: Phospho-NF-\u0026kappa;B p65 (3033S, 1:1000), I\u0026kappa;B\u0026alpha; (4814S, 1:1200), NF-\u0026kappa;B p65 (8242S, 1:1000), \u0026alpha;-tubulin (2144S, 1:1000) (Cell Signaling Technology).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec10\"\u003e\n \u003ch2\u003e2.8. Statistical analysis\u003c/h2\u003e\n \u003cp\u003eAnalysis of statistics was performed utilizing GraphPad Prism 9.5 software. Significance was assessed by one-way analysis of variance (ANOVA).\u003c/p\u003e\n\u003c/div\u003e"},{"header":"3. Results","content":"\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003e3.1. \u003cem\u003eL. plantarum\u003c/em\u003e ZJ316 mitigated \u003cem\u003eH. pylori\u003c/em\u003e-induced intestinal inflammation in mice\u003c/h2\u003e \u003cp\u003eAn \u003cem\u003eH. pylori\u003c/em\u003e-induced murine model was established, with the experimental timeline depicted in Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e1\u003c/span\u003eA. The colonization of \u003cem\u003eH. pylori\u003c/em\u003e in the gastric tissues of mice was evaluated using quantitative PCR, revealing a substantial quantity of \u003cem\u003eH. pylori\u003c/em\u003e in the Hp group, whereas treatment with \u003cem\u003eL. plantarum\u003c/em\u003e ZJ316 significantly diminished its levels \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e1\u003c/span\u003eB\u003cb\u003e)\u003c/b\u003e. Given that \u003cem\u003eH. pylori\u003c/em\u003e infection is associated with intestinal inflammation, we subsequently assessed the severity of this inflammation, primarily employing H\u0026amp;E staining and analysis of inflammatory factor expression. As depicted in Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e1\u003c/span\u003eC, intestinal tissues from the \u003cem\u003eH. pylori\u003c/em\u003e group exhibited hallmark signs of inflammation, including epithelial disruption and substantial infiltration of inflammatory cells (black arrow). Conversely, preemptive administration of \u003cem\u003eL. plantarum\u003c/em\u003e ZJ316 effectively mitigated tissue damage, resulting in mucosal tissue stratification and a notable decrease in inflammatory cell infiltration. Moreover, treatment with \u003cem\u003eL. plantarum\u003c/em\u003e ZJ316 significantly reduced the pathological scores of \u003cem\u003eH. pylori\u003c/em\u003e-induced tissue damage in mice \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e1\u003c/span\u003eC\u003cb\u003e)\u003c/b\u003e. Furthermore, we assessed immune responses and observed that \u003cem\u003eH. pylori\u003c/em\u003e colonization markedly upregulated mRNA levels of IL-1β, IFN-γ, and TNF-α, whereas supplementation with \u003cem\u003eL. plantarum\u003c/em\u003e ZJ316 significantly attenuated pro-inflammatory cytokine concentrations \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e1\u003c/span\u003eD-F\u003cb\u003e)\u003c/b\u003e.\u003c/p\u003e \u003cp\u003eThe barrier function serves as a crucial indicator of tissue damage and inflammatory response. Our findings revealed substantial downregulation of mRNA levels of tight junction proteins (TJs), including ZO-1, Occludin, and Claudin-1, in the \u003cem\u003eH. pylori\u003c/em\u003e group, as anticipated. Conversely, TJs levels gradually increased in the \u003cem\u003eL. plantarum\u003c/em\u003e ZJ316 treatment group \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e1\u003c/span\u003eG-I\u003cb\u003e)\u003c/b\u003e. These results underscored the efficacy of \u003cem\u003eL. plantarum\u003c/em\u003e ZJ316 supplementation in ameliorating \u003cem\u003eH. pylori\u003c/em\u003e-induced intestinal inflammation in mice.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003e3.2. \u003cem\u003eL. plantarum\u003c/em\u003e ZJ316 modulated gut microbiota composition in \u003cem\u003eH. pylori-\u003c/em\u003einfected mice\u003c/h2\u003e \u003cp\u003eTo investigate the interplay between \u003cem\u003eH. pylori\u003c/em\u003e-induced intestinal inflammation and gut microbiota, we performed 16S rRNA gene sequencing on the intestinal contents of mice. Illustrated in Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e2\u003c/span\u003eA, among the 1475 operational taxonomic units (OTUs) identified, 468 were found to overlap across all experimental groups, with 298 and 310 distinct bacteria noted in the Hp and Hp\u0026thinsp;+\u0026thinsp;ZJ316 groups, respectively. Further elucidating the impact of \u003cem\u003eL. plantarum\u003c/em\u003e ZJ316 treatment on mouse gut bacterial diversity, we utilized Alpha Diversity Analysis and Principal Coordinate Analysis (PCoA) to visually compare compositional structures, species richness, and evenness among samples. In comparison to the control group, the ACE, Shannon, and Chao1 indices significantly decreased in the \u003cem\u003eH. pylori\u003c/em\u003e model group, indicative of reduced microbiota diversity induced by \u003cem\u003eH. pylori\u003c/em\u003e. Conversely, \u003cem\u003eL. plantarum\u003c/em\u003e ZJ316 treatment led to an elevation in these three indices, with a notable difference (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05) \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e2\u003c/span\u003eB-D\u003cb\u003e)\u003c/b\u003e. While \u003cem\u003eH. pylori\u003c/em\u003e infection led to an increase in the Simpson index and a decrease in the Pielou index, no significant differences were detected between the Hp and Hp\u0026thinsp;+\u0026thinsp;ZJ316 groups \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e2\u003c/span\u003eE, F\u003cb\u003e)\u003c/b\u003e. Distinct separations were observed in PCoA among the Control, Hp, and Hp\u0026thinsp;+\u0026thinsp;ZJ316 groups based on the Weighted Bray-Curtis distance matrix \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e2\u003c/span\u003eG\u003cb\u003e)\u003c/b\u003e, suggesting significant changes in species composition induced by \u003cem\u003eH. pylori\u003c/em\u003e and substantial modulation in gut microbiota composition following \u003cem\u003eL. plantarum\u003c/em\u003e ZJ316 administration. These findings underscored the considerable influence of \u003cem\u003eH. pylori\u003c/em\u003e infection on gut microbiota composition. Additionally, treatment with \u003cem\u003eL. plantarum\u003c/em\u003e ZJ316 enhanced bacterial diversity and richness compared to the Hp group.\u003c/p\u003e \u003cp\u003eTo further examine the alterations in gut microbiota composition among the groups, we conducted taxonomic analysis. The predominant species at the phylum level is depicted in \u003cb\u003eFigure. 3A\u003c/b\u003e. Firmicutes, Bacteroidota, Actinobacteriota, and Verrucomicrobiota emerged as the dominant phyla. Notably, in the \u003cem\u003eL. plantarum\u003c/em\u003e ZJ316 treatment group, the relative abundances of Firmicutes (49.98%), Bacteroidota (37.08%), and Actinobacteria (2.90%) were elevated compared to the Hp group, resembling levels observed in the control group (Control group: 53.944%, 36.00%, and 3.34%, respectively). This suggests that \u003cem\u003eL. plantarum\u003c/em\u003e ZJ316 may reshape the gut microbiota structure in mice infected with \u003cem\u003eH. pylori\u003c/em\u003e. Moreover, the Firmicutes/Bacteroidota (F/B) ratio in the \u003cem\u003eL. plantarum\u003c/em\u003e ZJ316 group was significantly higher than that in the \u003cem\u003eH. pylori\u003c/em\u003e group \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e3\u003c/span\u003eB\u003cb\u003e)\u003c/b\u003e. At the genus level \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e3\u003c/span\u003eC\u003cb\u003e)\u003c/b\u003e, reductions in beneficial bacterium \u003cem\u003eLigilactobacillus\u003c/em\u003e, \u003cem\u003eAkkermansia\u003c/em\u003e, and \u003cem\u003eLactobacillus\u003c/em\u003e were noted in the \u003cem\u003eH. pylori\u003c/em\u003e group compared to the control group, while pathogenic microbiota \u003cem\u003eStaphylococcus\u003c/em\u003e and \u003cem\u003eDesulfovibrio\u003c/em\u003e exhibited higher abundance. Notably, treatment with \u003cem\u003eL. plantarum\u003c/em\u003e ZJ316 reversed the disrupted abundances of \u003cem\u003eLigilactobacillus\u003c/em\u003e, \u003cem\u003eAkkermansia\u003c/em\u003e, \u003cem\u003eStaphylococcus\u003c/em\u003e, and \u003cem\u003eDesulfovibrio\u003c/em\u003e induced by \u003cem\u003eH. pylori\u003c/em\u003e, particularly for \u003cem\u003eLigilactobacillus\u003c/em\u003e (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001) (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e3\u003c/span\u003eC-G).\u003c/p\u003e \u003cp\u003eTo discern the key taxa contributing to differences between the Hp and Hp\u0026thinsp;+\u0026thinsp;ZJ316 groups, we employed the LEfSe method at the genus level (LDA\u0026thinsp;\u0026gt;\u0026thinsp;4) \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e4\u003c/span\u003e\u003cb\u003e)\u003c/b\u003e. The composition of gut bacterial communities in the preventive groups is depicted in Fig.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e4\u003c/span\u003eA. Characteristic bacteria in the Hp group included \u003cem\u003eJeotgalicoccus\u003c/em\u003e and \u003cem\u003eHalomonas\u003c/em\u003e, whereas the \u003cem\u003eL. plantarum\u003c/em\u003e ZJ316 treatment group exhibited \u003cem\u003eAlloprevotella\u003c/em\u003e, \u003cem\u003eAnaerotruncus\u003c/em\u003e, and \u003cem\u003eRomboutsia\u003c/em\u003e \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e4\u003c/span\u003eB\u003cb\u003e)\u003c/b\u003e. Additionally, ternary phase analysis was conducted on the top 10 microflora at the genus level, revealing that \u003cem\u003eL. plantarum\u003c/em\u003e ZJ316 increased potential beneficial bacteria abundances, notably \u003cem\u003eLigilactobacillus\u003c/em\u003e and \u003cem\u003eAkkermansia\u003c/em\u003e \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e4\u003c/span\u003eC\u003cb\u003e)\u003c/b\u003e.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003e3.3. Correlation analysis of gut microbiota with SCFAs.\u003c/h2\u003e \u003cp\u003eSCFAs are crucial metabolites produced by the intestinal flora. In our study, we utilized GC-MS technology to quantify SCFA levels in fecal contents. As depicted in Fig.\u0026nbsp;\u003cspan refid=\"Fig11\" class=\"InternalRef\"\u003e5\u003c/span\u003eA-F, H. \u003cem\u003epylori\u003c/em\u003e induction led to a significant reduction in valeric acid, propionic acid, caproic acid, isobutyric acid, and butyric acid contents in the fecal contents. Following intervention with \u003cem\u003eL. plantarum\u003c/em\u003e ZJ316, the concentrations of valeric acid, propionic acid, acetic acid, caproic acid, isobutyric acid, and butyric acid significantly increased (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05), rising from 0.033, 0.280, 1.425, 0.008, 0.033, and 0.244 mg/g in the Hp group to 0.084, 0.493, 2.214, 0.027, 0.058, and 0.491 mg/g in the Hp\u0026thinsp;+\u0026thinsp;ZJ316 group, respectively. These results implied that \u003cem\u003eH. pylori\u003c/em\u003e infection altered the content of certain SCFAs, which could be restored with \u003cem\u003eL. plantarum\u003c/em\u003e ZJ316 treatment.\u003c/p\u003e \u003cp\u003eBased upon the preceding findings, we conducted further analysis to investigate the potential correlation between predominant gut microbiota species (top 16 in abundance at the genus level) and SCFAs using Spearman analysis. As depicted in Fig.\u0026nbsp;\u003cspan refid=\"Fig11\" class=\"InternalRef\"\u003e5\u003c/span\u003eG, \u003cem\u003eTuricibacter\u003c/em\u003e and \u003cem\u003eMucispirillum\u003c/em\u003e exhibited inverse relationships with acetic acid, whereas \u003cem\u003eLactobacillus\u003c/em\u003e and \u003cem\u003eLigilactobacillus\u003c/em\u003e showed positive correlations with butyric acid and isobutyric acid, respectively. Additionally, \u003cem\u003eJeotgalicoccus\u003c/em\u003e displayed negative associations with valeric acid and acetic acid. These findings indicated that an increased abundance of \u003cem\u003eLigilactobacillus\u003c/em\u003e and \u003cem\u003eLactobacillus\u003c/em\u003e may contribute to SCFAs production. Moreover, our findings indicated that changes in gut microbiota composition may influence SCFA levels in stool. Thus, the protective effects of \u003cem\u003eL. plantarum\u003c/em\u003e ZJ316 against \u003cem\u003eH. pylori\u003c/em\u003e-induced intestinal inflammation may be attributed to its modulation of gut microbiota and SCFA metabolites.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003e3.4. \u003cem\u003eL. plantarum\u003c/em\u003e ZJ316 alleviated \u003cem\u003eH. pylori\u003c/em\u003e-induced inflammation in vitro\u003c/h2\u003e \u003cp\u003eIn our experimental findings, \u003cem\u003eH. pylori\u003c/em\u003e infection was observed to disrupt intestinal barrier function, resulting in alterations in inflammatory responses and microbiota structure. However, supplementation with \u003cem\u003eL. plantarum\u003c/em\u003e ZJ316 demonstrated the ability to restore these aforementioned disruptions. Building upon these observations, we proceeded to validate the expression of inflammatory pathway proteins associated with barrier function and gut microbiota using RT-qPCR as well as western blot assays in HT-29 cells. The results revealed that \u003cem\u003eH. pylori\u003c/em\u003e infection led to decreased mRNA levels of ZO-1, Claudin-1, and MUC2, whereas pretreatment with \u003cem\u003eL. plantarum\u003c/em\u003e ZJ316 dramatically increased the mRNA levels of tight junction proteins \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig12\" class=\"InternalRef\"\u003e6\u003c/span\u003eA-C\u003cb\u003e)\u003c/b\u003e. Concurrently, \u003cem\u003eH. pylori\u003c/em\u003e infection elicited elevated expression levels of IL-8, IL-6, and TNF-α compared to the control group, while supplementation with \u003cem\u003eL. plantarum\u003c/em\u003e ZJ316 notably attenuated the expression of these genes \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig12\" class=\"InternalRef\"\u003e6\u003c/span\u003eD-F\u003cb\u003e)\u003c/b\u003e.\u003c/p\u003e \u003cp\u003eNF-κB serves as a pivotal transcription factor involved in the inflammatory response. \u003csup\u003e[\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e, \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]\u003c/sup\u003e \u003cem\u003eH. pylori\u003c/em\u003e infection is known to activate NF-κB signaling. Consistent with this, western blot analysis revealed that \u003cem\u003eH. pylori\u003c/em\u003e infection enhanced p65 phosphorylation and degradation of IκBα, whereas treatment with \u003cem\u003eL. plantarum\u003c/em\u003e ZJ316 notably reduced p65 phosphorylation and degradation of IκBα (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001) \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig12\" class=\"InternalRef\"\u003e6\u003c/span\u003eG-I\u003cb\u003e)\u003c/b\u003e. Immunohistochemical staining of phosphorylated NF-κB in intestinal tissues further supported these findings, showing that supplementation with \u003cem\u003eL. plantarum\u003c/em\u003e ZJ316 effectively downregulated p65 phosphorylation, consistent with our \u003cem\u003ein vitro\u003c/em\u003e results \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig12\" class=\"InternalRef\"\u003e6\u003c/span\u003eJ\u003cb\u003e)\u003c/b\u003e. These findings collectively provided evidence that \u003cem\u003eL. plantarum\u003c/em\u003e ZJ316 can mitigate \u003cem\u003eH. pylori\u003c/em\u003e-induced activation of the NF-κB pathway, thereby modulating immune function and alleviating gut inflammation.\u003c/p\u003e \u003c/div\u003e"},{"header":"4. Discussion","content":"\u003cp\u003e \u003cem\u003eH. pylori\u003c/em\u003e infection poses a globally significant concern due to its link with the onset of gastric carcinoma and peptic ulcers, with the infection often persisting lifelong if not eradicated \u003csup\u003e[\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e, \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e]\u003c/sup\u003e. Despite primarily colonizing the stomach, chronic \u003cem\u003eH. pylori\u003c/em\u003e infection has been linked to a range of extra gastric diseases \u003csup\u003e[\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]\u003c/sup\u003e. Epidemiological evidence suggests a correlation between \u003cem\u003eH. pylori\u003c/em\u003e infection and an escalated susceptibility and severity of intestinal inflammation \u003csup\u003e[\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]\u003c/sup\u003e. Utilizing antibiotics to eliminate \u003cem\u003eH. pylori\u003c/em\u003e or resorting to anti-inflammatory medications or antibiotics for intestinal inflammation treatment can lead to adverse effects such as gut dysbiosis \u003csup\u003e[\u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e57\u003c/span\u003e, \u003cspan citationid=\"CR70\" class=\"CitationRef\"\u003e70\u003c/span\u003e]\u003c/sup\u003e. Hence, there is a pressing need to investigate innovative treatment approaches. Lactic acid bacteria, recognized as safe food microorganisms, hold immense promise for therapeutic applications. However, the potential protective mechanisms of lactic acid bacteria against \u003cem\u003eH. pylori\u003c/em\u003e-induced intestinal inflammation have not been experimentally validated. In the work, we utilized \u003cem\u003eH. pylori\u003c/em\u003e-infected mice as surrogate models for human intestinal inflammation and observed a reduction in intestinal inflammation following pretreatment with \u003cem\u003eL. plantarum\u003c/em\u003e ZJ316. Notably, this protective effect is characterized by enhanced intestinal barrier function, mitigation of intestinal inflammation, improved microbiota structure, and elevated levels of SCFAs.\u003c/p\u003e \u003cp\u003eChronic inflammation and tissue damage are pivotal in the pathogenesis of gastritis, intestinal inflammation, and colorectal cancer induced by \u003cem\u003eH. pylori\u003c/em\u003e infection \u003csup\u003e[\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e, \u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e]\u003c/sup\u003e. Previous studies have demonstrated elevated levels of pro-inflammatory cytokines (TNF-α, IFN-γ, and IL-1β) in gastric and intestinal tissues upon \u003cem\u003eH. pylori\u003c/em\u003e exposure, which can be mitigated by certain \u003cem\u003eLactobacillus\u003c/em\u003e species, known for their anti-inflammatory properties \u003csup\u003e[\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e, \u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e55\u003c/span\u003e, \u003cspan citationid=\"CR68\" class=\"CitationRef\"\u003e68\u003c/span\u003e]\u003c/sup\u003e. Our findings corroborated these observations, showing significantly higher levels of TNF-α, IFN-γ, and IL-1β in the Hp group compared to controls, which were notably attenuated by \u003cem\u003eL. plantarum\u003c/em\u003e ZJ316 administration. Interestingly, while IFN-γ levels were markedly elevated in \u003cem\u003eH. pylori\u003c/em\u003e-induced intestinal inflammation, they exhibited a reverse trend in \u003cem\u003eH. pylori\u003c/em\u003e-induced inflammatory bowel disease (IBD), consistent with previous reports of an inverse association between \u003cem\u003eH. pylori\u003c/em\u003e infection and IBD risk \u003csup\u003e[\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]\u003c/sup\u003e. Mechanistically, \u003cem\u003eH. pylori\u003c/em\u003e colonization appeared to modulate colonic immune responses by altering Th17 and Treg cell populations and cytokine profiles, as well as promoting M2 macrophage infiltration, with a role for CagA in M2 polarization \u003csup\u003e[\u003cspan citationid=\"CR71\" class=\"CitationRef\"\u003e71\u003c/span\u003e]\u003c/sup\u003e. Additionally, Li \u003cem\u003eet al.\u003c/em\u003e, have suggested that \u003cem\u003eH. pylori\u003c/em\u003e may alleviate DSS-induced IBD by increasing CD19\u003csup\u003e+\u003c/sup\u003e IL-10\u003csup\u003e+\u003c/sup\u003e Breg cell percentages \u003csup\u003e[\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]\u003c/sup\u003e. The multifaceted nature of these observations underscored the complexity of \u003cem\u003eH. pylori\u003c/em\u003e pathogenesis, with strain specificity and various infecting parameters likely contributing to the observed outcomes. Furthermore, while epidemiological studies have linked \u003cem\u003eH. pylori\u003c/em\u003e infection to extra gastric diseases, the underlying mechanisms remain elusive and warrant further investigation.\u003c/p\u003e \u003cp\u003eA well-functioning gut barrier is vital for gut health, preventing increased permeability, severe inflammation, and oxidative stress \u003csup\u003e[\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e]\u003c/sup\u003e. TJs are integral to gut barrier integrity, with ZO-1, Occludin, and Claudin-1 being key components. In our study, \u003cem\u003eL. plantarum\u003c/em\u003e ZJ316 treatment significantly upregulated mRNA levels of ZO-1, Occludin, and Claudin-1 in intestinal tissues compared to \u003cem\u003eH. pylori\u003c/em\u003e stimulation, aligning with the effects seen with various natural compounds, such as conjugated Carnosol and Phenolics from Dendrobium officinale \u003csup\u003e[\u003cspan citationid=\"CR61\" class=\"CitationRef\"\u003e61\u003c/span\u003e, \u003cspan citationid=\"CR64\" class=\"CitationRef\"\u003e64\u003c/span\u003e]\u003c/sup\u003e. Prior research has demonstrated the potential of micro integral membrane proteins from \u003cem\u003eL. plantarum\u003c/em\u003e CGMCC 1258 to repair tight junction damage by boosting the expression of JAM-1, occludin, and claudin-1 \u003csup\u003e[\u003cspan citationid=\"CR67\" class=\"CitationRef\"\u003e67\u003c/span\u003e]\u003c/sup\u003e. These findings suggest that \u003cem\u003eL. plantarum\u003c/em\u003e ZJ316 enhanced the gut barrier and mitigated \u003cem\u003eH. pylori\u003c/em\u003e-induced intestinal inflammation.\u003c/p\u003e \u003cp\u003eThe gastrointestinal microbiota is essential for regulating the host\u0026rsquo;s immune, digestive, and neural functions, and the production of physiologically active substances \u003csup\u003e[\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e, \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]\u003c/sup\u003e. While fewer studies have focused on the impact of \u003cem\u003eH. pylori\u003c/em\u003e infection on the gut microbiome in human patients compared to the gastric microbiome, alterations in gut microbiota induced by \u003cem\u003eH. pylori\u003c/em\u003e have been associated with various gastrointestinal and systemic diseases \u003csup\u003e[\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]\u003c/sup\u003e. Few researchers reported consistent or higher alpha diversity in the fecal microbiome of \u003cem\u003eH. pylori\u003c/em\u003e-infected patients versus the controls \u003csup\u003e[\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e, \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]\u003c/sup\u003e. This finding contrasts with the lower alpha diversity observed in the gastric microbiota of \u003cem\u003eH. pylori\u003c/em\u003e-positive individuals compared to \u003cem\u003eH. pylori\u003c/em\u003e-negative individuals \u003csup\u003e[\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e]\u003c/sup\u003e. Our study revealed a decrease in alpha diversity indices with \u003cem\u003eH. pylori\u003c/em\u003e infection, while administration of \u003cem\u003eL. plantarum\u003c/em\u003e ZJ316 modulated \u003cem\u003eH. pylori\u003c/em\u003e-induced dysbiosis in bacterial composition and diversity. These results may differ from previous observations, suggesting the need for further research on this topic. Reports have linked \u003cem\u003eH. pylori\u003c/em\u003e-induced dysbiosis of gut microbiota with gut-related diseases, such as intestinal inflammation and CRC \u003csup\u003e[\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e]\u003c/sup\u003e. Significant alterations were observed in the intestinal microbiota of mice infected with \u003cem\u003eH. pylori\u003c/em\u003e, characterized by a decrease in Firmicutes and an increase in Proteobacteria at the phylum level. Changes in the gut microbial communities, such as decreased Firmicutes to Bacteroidetes ratio and increased Proteobacteria abundance, have been associated with obesity and metabolic syndrome \u003csup\u003e[\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e, \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]\u003c/sup\u003e. However, treatment with \u003cem\u003eL. plantarum\u003c/em\u003e ZJ316 effectively reversed these changes induced by \u003cem\u003eH. pylori\u003c/em\u003e, enhancing Firmicutes abundance and the Firmicutes to Bacteroidetes ratio while decreasing Proteobacteria abundance. Moreover, Chen \u003cem\u003eet al.\u003c/em\u003e, reported an elevation in the Firmicutes to Bacteroidetes ratio following \u003cem\u003eH. pylori\u003c/em\u003e eradication with quadruple therapy supplemented by \u003cem\u003eClostridium butyricum\u003c/em\u003e treatment \u003csup\u003e[\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]\u003c/sup\u003e. Antibiotics are increasingly recognized as potentially harmful to intestinal microbiota, with studies reporting that \u003cem\u003eH. pylori\u003c/em\u003e eradication with bismuth quadruple therapy reduced alpha-diversity and relative abundances of Bacteroidetes and Actinobacteria but increased that of Proteobacteria in intestinal microbiota \u003csup\u003e[\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]\u003c/sup\u003e. These discrepancies may be partially explained by differences in eradication regimens.\u003c/p\u003e \u003cp\u003eProbiotics treatment also induced significant taxonomic shifts at the genus level. \u003cem\u003eH. pylori\u003c/em\u003e infection boosted pathogenic bacteria like \u003cem\u003eDesulfovibrio\u003c/em\u003e and \u003cem\u003eStaphylococcus\u003c/em\u003e, while also elevating beneficial commensals such as \u003cem\u003eAkkermansia\u003c/em\u003e, \u003cem\u003eAlloprevotella\u003c/em\u003e, and \u003cem\u003eLigilactobacillus\u003c/em\u003e. \u003cem\u003eDesulfovibrio\u003c/em\u003e, known for its production of lipopolysaccharide and hydrogen sulfide, contributed to intestinal barrier damage and liver injury \u003csup\u003e[\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e, \u003cspan citationid=\"CR72\" class=\"CitationRef\"\u003e72\u003c/span\u003e]\u003c/sup\u003e, whereas \u003cem\u003eAkkermansia\u003c/em\u003e bolstered intestinal barrier function and immune response, inversely associated with inflammatory bowel disease \u003csup\u003e[\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e, \u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e60\u003c/span\u003e]\u003c/sup\u003e \u003cem\u003eLigilactobacillus\u003c/em\u003e encompasses species adapted to vertebrate hosts, and fermented food, with its antioxidant, antibacterial, and anti-inflammatory properties, benefited host health \u003csup\u003e[\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]\u003c/sup\u003e. In comparison to the Hp group, administration of \u003cem\u003eL. plantarum\u003c/em\u003e ZJ316 increased the relative abundance of \u003cem\u003eAkkermansia\u003c/em\u003e and \u003cem\u003eLigilactobacillus\u003c/em\u003e, renowned for SCFAs production, possibly explaining the reduced intestinal damage and inflammation observed in pretreated mice compared to the Hp group. Curiously, our examination of fecal samples did not detect \u003cem\u003eH. pylori\u003c/em\u003e, aligning with the results of Kienesberger \u003cem\u003eet al\u003c/em\u003e., who similarly did not detect \u003cem\u003eH. pylori\u003c/em\u003e in murine feces through qPCR or high-throughput sequencing following a six-month infection period \u003csup\u003e[\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]\u003c/sup\u003e. SCFAs are metabolic byproducts derived from the fermentation of undigested dietary carbohydrates and proteins by intestinal microbiota \u003csup\u003e[\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]\u003c/sup\u003e. Previous studies have reported significant decreases in SCFA levels, including valeric acid, propionic acid, caproic acid, isobutyric acid, butyric acid, and acetic acid, in mice infected with \u003cem\u003eH. pylori\u003c/em\u003e \u003csup\u003e[\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e, \u003cspan citationid=\"CR69\" class=\"CitationRef\"\u003e69\u003c/span\u003e]\u003c/sup\u003e. Consistently, our findings indicated reductions in fecal SCFA levels in the \u003cem\u003eH. pylori\u003c/em\u003e-infected group, while pretreatment with \u003cem\u003eL. plantarum\u003c/em\u003e ZJ316 reversed these changes, suggesting alterations in intestinal flora structure. Additionally, \u003cem\u003eL. plantarum\u003c/em\u003e ZJ316 supplementation correlated with an increased abundance of \u003cem\u003eAkkermansia\u003c/em\u003e, \u003cem\u003eLigilactobacillus\u003c/em\u003e, and \u003cem\u003eLactobacillus\u003c/em\u003e, which were positively associated with SCFAs. Notably, higher levels of butyric acid have been inversely linked to colitis development \u003csup\u003e[\u003cspan citationid=\"CR63\" class=\"CitationRef\"\u003e63\u003c/span\u003e]\u003c/sup\u003e. Conversely, the putatively harmful bacterium \u003cem\u003eDesulfovibrio\u003c/em\u003e exhibited negative correlations with SCFA levels, aligning with findings by Qu \u003cem\u003eet al\u003c/em\u003e \u003csup\u003e[\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e]\u003c/sup\u003e. Overall, our results provided insights into the interplay between \u003cem\u003eH.\u003c/em\u003e pyl\u003cem\u003eori\u003c/em\u003e eradication, gut microbiota composition, and SCFAs alterations.\u003c/p\u003e \u003cp\u003e \u003cem\u003eH. pylori\u003c/em\u003e infection triggers inflammation and disrupts cell tight junctions, which are crucial factors contributing to related diseases. In the research, upon \u003cem\u003eH. pylori\u003c/em\u003e infection, there was a decrease in ZO-1, Claudin-1, and MUC2 mRNA levels, leading to intestinal barrier dysfunction \u003csup\u003e[\u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e59\u003c/span\u003e]\u003c/sup\u003e. Claudin-1 plays a role in tight junction regulation, while ZO-1 is associated with epithelial integrity \u003csup\u003e[\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e]\u003c/sup\u003e. Supplementation with \u003cem\u003eL. plantarum\u003c/em\u003e ZJ316 was correlated with increased expression of tight junction proteins, indicating significant protective effects of probiotics. Intestinal epithelial barrier disruption can result in inflammation \u003csup\u003e[\u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e]\u003c/sup\u003e. TLR4 serves as a key molecule in initiating inflammation during \u003cem\u003eH. pylori\u003c/em\u003e infection, activating the MyD88-dependent pathway and NF-κB pathway, leading to the overexpression of inflammatory cytokines \u003csup\u003e[\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]\u003c/sup\u003e. In this study, \u003cem\u003eH. pylori\u003c/em\u003e stimulation led to elevated expression of TNF-α, IL-6, IL-8, and p-p65, which were significantly downregulated upon supplementation with \u003cem\u003eL. plantarum\u003c/em\u003e ZJ316. Furthermore, \u003cem\u003ein vivo\u003c/em\u003e experiments confirmed that \u003cem\u003eL. plantarum\u003c/em\u003e ZJ316 reduced p-p65 protein expression, as detected by IHC. The nuclear translocation of p65 upon \u003cem\u003eH. pylori\u003c/em\u003e infection has been demonstrated in numerous studies, and the anti-inflammatory activity of natural compounds often involves a decrease in p65 nuclear translocation \u003csup\u003e[\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e, \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]\u003c/sup\u003e. These results implied that \u003cem\u003eL. plantarum\u003c/em\u003e ZJ316 improves \u003cem\u003eH. pylori\u003c/em\u003e-induced intestinal inflammation and preserves gut barrier function by modulating the gut microbiota, inhibiting the NF-κB pathway, and reducing the levels of proinflammatory cytokines.\u003c/p\u003e"},{"header":"5. Conclusions","content":"\u003cp\u003eIn conclusion, our study revealed that supplementation with \u003cem\u003eL. plantarum\u003c/em\u003e ZJ316 effectively mitigates \u003cem\u003eH. pylori\u003c/em\u003e-induced intestinal inflammation by suppressing inflammation and elevating the abundance of beneficial bacteria, including \u003cem\u003eLigilactobacillus\u003c/em\u003e and \u003cem\u003eAkkermansia\u003c/em\u003e, along with enhancing SCFAs levels. These findings enhanced our comprehension of the protective mechanism of \u003cem\u003eL. plantarum\u003c/em\u003e ZJ316 against gastrointestinal diseases, underscoring its therapeutic promise for \u003cem\u003eH. pylori\u003c/em\u003e-induced intestinal inflammation. This research provides valuable data supporting the exploration and development of natural molecule substances and prevention strategies for gastrointestinal diseases in the future.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003eAcknowledgments\u003c/p\u003e\n\u003cp\u003eThis work was supported by the Zhejiang Gongshang University Provincial Colleges and Universities Basic Research Expenses (QRK23006), Zhejiang Provincial Natural Science Foundation of China (LY22C200012), General Scientific Research Project of Zhejiang Education Department (Y202352915), National Natural Science Foundation of China (NSFC) Project (32001667) and Key Project of Zhejiang Gongshang University \u0026quot;Digital+\u0026quot; Discipline Construction (No. SZJ2022A006).\u003c/p\u003e\n\u003cp\u003eEthics Statement\u003c/p\u003e\n\u003cp\u003eAnimal procedures were sanctioned by the Institutional Animal Care and Use Committee of the Shanghai Public Health Clinical Center under protocol number 2022-A037-01.\u003c/p\u003e\n\u003cp\u003eCRediT authorship contribution statement\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eShiying Wu:\u003c/strong\u003e Conceptualization, Investigation, Resources, Writing \u0026ndash; original draft,\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eFunding acquisition. \u003cstrong\u003eFangtong Wei:\u0026nbsp;\u003c/strong\u003eInvestigation, Visualization, Writing \u0026ndash; original draft. \u003cstrong\u003eYongqiang Chen:\u003c/strong\u003e Investigation, Methodology. \u003cstrong\u003eZiqi Chen:\u003c/strong\u003e Data curation.\u0026nbsp;\u003cstrong\u003eYuenuo Luo:\u003c/strong\u003e Investigation, Methodology. \u003cstrong\u003eJiayi Fan:\u003c/strong\u003e Data curation.\u003cstrong\u003e\u0026nbsp;Yang Xu:\u003c/strong\u003e Investigation, Methodology.\u003cstrong\u003e\u0026nbsp;Mingyang Hu:\u003c/strong\u003e Investigation.\u0026nbsp;\u003cstrong\u003ePing Li:\u003c/strong\u003e Investigation, Resources. \u003cstrong\u003eQing Gu:\u0026nbsp;\u003c/strong\u003eWriting \u0026ndash; review \u0026amp; editing, Funding acquisition, Supervision.\u003c/p\u003e\n\u003cp\u003eDeclaration of interests\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no conflict of interest.\u003c/p\u003e\n\u003cp\u003eData availability\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe original contributions described in the research are available within the article materials, and additional questions can be addressed to the corresponding author.\u0026nbsp;\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eS. Brandt, T. Kwok, R. Hartig, et al. NF-kappaB activation and potentiation of proinflammatory responses by the \u003cem\u003eHelicobacter pylori\u003c/em\u003e CagA protein. \u003cem\u003eProc Natl Acad Sci U S A\u003c/em\u003e,\u003cem\u003e 102\u003c/em\u003e(26), (2005) 9300-9305. https://doi.org/10.1073/pnas.0409873102\u003c/li\u003e\n\u003cli\u003eN. Casta\u0026ntilde;o-Rodr\u0026iacute;guez, N. O. Kaakoush, W. S. Lee, et al. Dual role of \u003cem\u003eHelicobacter\u003c/em\u003e and \u003cem\u003eCampylobacter\u003c/em\u003e species in IBD: a systematic review and meta-analysis. \u003cem\u003eGut\u003c/em\u003e,\u003cem\u003e 66\u003c/em\u003e(2), (2017) 235-249. https://doi.org/10.1136/gutjnl-2015-310545\u003c/li\u003e\n\u003cli\u003eC. C. Chen, J. M. Liou, Y. C. Lee, et al. The interplay between \u003cem\u003eHelicobacter pylori\u003c/em\u003e and gastrointestinal microbiota. \u003cem\u003eGut Microbes\u003c/em\u003e,\u003cem\u003e 13\u003c/em\u003e(1), (2021) 1-22. https://doi.org/10.1080/19490976.2021.1909459\u003c/li\u003e\n\u003cli\u003eL. Chen, W. Xu, A. Lee, et al. The impact of \u003cem\u003eHelicobacter pylori\u003c/em\u003e infection, eradication therapy and probiotic supplementation on gut microenvironment homeostasis: An open-label, randomized clinical trial. \u003cem\u003eEBioMedicine\u003c/em\u003e,\u003cem\u003e 35\u003c/em\u003e, (2018) 87-96. https://doi.org/10.1016/j.ebiom.2018.08.028\u003c/li\u003e\n\u003cli\u003eD. Compare, A. Rocco, M. Sanduzzi Zamparelli, et al. The Gut Bacteria-Driven Obesity Development. \u003cem\u003eDig Dis\u003c/em\u003e,\u003cem\u003e 34\u003c/em\u003e(3), (2016) 221-229. https://doi.org/10.1159/000443356\u003c/li\u003e\n\u003cli\u003eF. Cristofori, V. N. Dargenio, C. Dargenio, et al. Anti-Inflammatory and Immunomodulatory Effects of Probiotics in Gut Inflammation: A Door to the Body. \u003cem\u003eFront Immunol\u003c/em\u003e,\u003cem\u003e 12\u003c/em\u003e, (2021) 578386. https://doi.org/10.3389/fimmu.2021.578386\u003c/li\u003e\n\u003cli\u003eC. Du, S. Quan, X. Nan, et al. Effects of oral milk extracellular vesicles on the gut microbiome and serum metabolome in mice. \u003cem\u003eFood Funct\u003c/em\u003e,\u003cem\u003e 12\u003c/em\u003e(21), (2021) 10938-10949. https://doi.org/10.1039/d1fo02255e\u003c/li\u003e\n\u003cli\u003eV. Engelsberger, M. Gerhard, \u0026amp; R. Mej\u0026iacute;as-Luque. Effects of \u003cem\u003eHelicobacter pylori\u003c/em\u003e infection on intestinal microbiota, immunity and colorectal cancer risk. \u003cem\u003eFront Cell Infect Microbiol\u003c/em\u003e,\u003cem\u003e 14\u003c/em\u003e, (2024) 1339750. https://doi.org/10.3389/fcimb.2024.1339750\u003c/li\u003e\n\u003cli\u003eY. Fei, S. Zhang, S. Han, et al. The Role of Dihydroresveratrol in Enhancing the Synergistic Effect of \u003cem\u003eLigilactobacillus salivarius\u003c/em\u003e Li01 and Resveratrol in Ameliorating Colitis in Mice. \u003cem\u003eResearch (Wash D C)\u003c/em\u003e,\u003cem\u003e 2022\u003c/em\u003e, (2022) 9863845. https://doi.org/10.34133/2022/9863845\u003c/li\u003e\n\u003cli\u003eQ. Feng, W. D. Chen, \u0026amp; Y. D. Wang. Gut Microbiota: An Integral Moderator in Health and Disease. \u003cem\u003eFront Microbiol\u003c/em\u003e,\u003cem\u003e 9\u003c/em\u003e, (2018) 151. https://doi.org/10.3389/fmicb.2018.00151\u003c/li\u003e\n\u003cli\u003eF. Franceschi, M. Covino, \u0026amp; C. Roubaud Baudron. Review: \u003cem\u003eHelicobacter pylori\u003c/em\u003e and extragastric diseases. \u003cem\u003eHelicobacter\u003c/em\u003e,\u003cem\u003e 24 Suppl 1\u003c/em\u003e, (2019) e12636. https://doi.org/10.1111/hel.12636\u003c/li\u003e\n\u003cli\u003eF. Frost, T. Kacprowski, M. R\u0026uuml;hlemann, et al. \u003cem\u003eHelicobacter pylori\u003c/em\u003e infection associates with fecal microbiota composition and diversity. \u003cem\u003eSci Rep\u003c/em\u003e,\u003cem\u003e 9\u003c/em\u003e(1), (2019) 20100. https://doi.org/10.1038/s41598-019-56631-4\u003c/li\u003e\n\u003cli\u003eJ. Gao, K. Xu, H. Liu, et al. Impact of the gut microbiota on intestinal immunity mediated by tryptophan metabolism. \u003cem\u003eFrontiers in cellular and infection microbiology\u003c/em\u003e,\u003cem\u003e 8\u003c/em\u003e, (2018) 13. \u003c/li\u003e\n\u003cli\u003eJ. J. Gao, Y. Zhang, M. Gerhard, et al. Association Between Gut Microbiota and \u003cem\u003eHelicobacter pylori\u003c/em\u003e-Related Gastric Lesions in a High-Risk Population of Gastric Cancer. \u003cem\u003eFront Cell Infect Microbiol\u003c/em\u003e,\u003cem\u003e 8\u003c/em\u003e, (2018) 202. https://doi.org/10.3389/fcimb.2018.00202\u003c/li\u003e\n\u003cli\u003eM. G. Gareau, P. M. Sherman, \u0026amp; W. A. Walker. Probiotics and the gut microbiota in intestinal health and disease. \u003cem\u003eNat Rev Gastroenterol Hepatol\u003c/em\u003e,\u003cem\u003e 7\u003c/em\u003e(9), (2010) 503-514. https://doi.org/10.1038/nrgastro.2010.117\u003c/li\u003e\n\u003cli\u003eA. G. Gravina, R. M. Zagari, C. De Musis, et al. \u003cem\u003eHelicobacter pylori\u003c/em\u003e and extragastric diseases: A review. \u003cem\u003eWorld journal of gastroenterology\u003c/em\u003e,\u003cem\u003e 24\u003c/em\u003e(29), (2018) 3204. \u003c/li\u003e\n\u003cli\u003eT. Guo, Q. Lin, X. Li, et al. Octacosanol Attenuates Inflammation in Both RAW264.7 Macrophages and a Mouse Model of Colitis. \u003cem\u003eJ Agric Food Chem\u003c/em\u003e,\u003cem\u003e 65\u003c/em\u003e(18), (2017) 3647-3658. https://doi.org/10.1021/acs.jafc.6b05465\u003c/li\u003e\n\u003cli\u003eY. Guo, C. Xu, R. Gong, et al. Exosomal CagA from \u003cem\u003eHelicobacter pylori\u003c/em\u003e aggravates intestinal epithelium barrier dysfunction in chronic colitis by facilitating Claudin-2 expression. \u003cem\u003eGut Pathog\u003c/em\u003e,\u003cem\u003e 14\u003c/em\u003e(1), (2022) 13. https://doi.org/10.1186/s13099-022-00486-0\u003c/li\u003e\n\u003cli\u003eH. M. Hamer, D. Jonkers, K. Venema, et al. Review article: the role of butyrate on colonic function. \u003cem\u003eAliment Pharmacol Ther\u003c/em\u003e,\u003cem\u003e 27\u003c/em\u003e(2), (2008) 104-119. https://doi.org/10.1111/j.1365-2036.2007.03562.x\u003c/li\u003e\n\u003cli\u003eM. Hatakeyama. \u003cem\u003eHelicobacter pylori\u003c/em\u003e CagA and gastric cancer: a paradigm for hit-and-run carcinogenesis. \u003cem\u003eCell host \u0026amp; microbe\u003c/em\u003e,\u003cem\u003e 15\u003c/em\u003e(3), (2014) 306-316. \u003c/li\u003e\n\u003cli\u003eB. Hoesel, \u0026amp; J. A. Schmid. The complexity of NF-\u0026kappa;B signaling in inflammation and cancer. \u003cem\u003eMol Cancer\u003c/em\u003e,\u003cem\u003e 12\u003c/em\u003e, (2013) 86. https://doi.org/10.1186/1476-4598-12-86\u003c/li\u003e\n\u003cli\u003eH. D. Holscher. Dietary fiber and prebiotics and the gastrointestinal microbiota. \u003cem\u003eGut Microbes\u003c/em\u003e,\u003cem\u003e 8\u003c/em\u003e(2), (2017) 172-184. https://doi.org/10.1080/19490976.2017.1290756\u003c/li\u003e\n\u003cli\u003eL. V. Hooper, D. R. Littman, \u0026amp; A. J. Macpherson. Interactions between the microbiota and the immune system. \u003cem\u003eScience\u003c/em\u003e,\u003cem\u003e 336\u003c/em\u003e(6086), (2012) 1268-1273. https://doi.org/10.1126/science.1223490\u003c/li\u003e\n\u003cli\u003eP. I. Hsu, C. Y. Pan, J. Y. Kao, et al. \u003cem\u003eHelicobacter pylori\u003c/em\u003e eradication with bismuth quadruple therapy leads to dysbiosis of gut microbiota with an increased relative abundance of \u003cem\u003eProteobacteria\u003c/em\u003e and decreased relative abundances of \u003cem\u003eBacteroidetes\u003c/em\u003e and Actinobacteria. \u003cem\u003eHelicobacter\u003c/em\u003e,\u003cem\u003e 23\u003c/em\u003e(4), (2018) e12498. https://doi.org/10.1111/hel.12498\u003c/li\u003e\n\u003cli\u003eY. Huang, Y. Ding, H. Xu, et al. Effects of sodium butyrate supplementation on inflammation, gut microbiota, and short-chain fatty acids in \u003cem\u003eHelicobacter pylori\u003c/em\u003e-infected mice. \u003cem\u003eHelicobacter\u003c/em\u003e,\u003cem\u003e 26\u003c/em\u003e(2), (2021) e12785. https://doi.org/10.1111/hel.12785\u003c/li\u003e\n\u003cli\u003eD. Jakubczyk, K. Leszczyńska, \u0026amp; S. G\u0026oacute;rska. The Effectiveness of Probiotics in the Treatment of Inflammatory Bowel Disease (IBD)-A Critical Review. \u003cem\u003eNutrients\u003c/em\u003e,\u003cem\u003e 12\u003c/em\u003e(7), (2020). https://doi.org/10.3390/nu12071973\u003c/li\u003e\n\u003cli\u003eS. M. Jandhyala, R. Talukdar, C. Subramanyam, et al. Role of the normal gut microbiota. \u003cem\u003eWorld J Gastroenterol\u003c/em\u003e,\u003cem\u003e 21\u003c/em\u003e(29), (2015) 8787-8803. https://doi.org/10.3748/wjg.v21.i29.8787\u003c/li\u003e\n\u003cli\u003eA. Kauppinen, T. Suuronen, J. Ojala, et al. Antagonistic crosstalk between NF-\u0026kappa;B and SIRT1 in the regulation of inflammation and metabolic disorders. \u003cem\u003eCell Signal\u003c/em\u003e,\u003cem\u003e 25\u003c/em\u003e(10), (2013) 1939-1948. https://doi.org/10.1016/j.cellsig.2013.06.007\u003c/li\u003e\n\u003cli\u003eS. Kayali, M. Manfredi, F. Gaiani, et al. \u003cem\u003eHelicobacter pylori\u003c/em\u003e, transmission routes and recurrence of infection: state of the art. \u003cem\u003eActa Biomed\u003c/em\u003e,\u003cem\u003e 89\u003c/em\u003e(8-s), (2018) 72-76. https://doi.org/10.23750/abm.v89i8-S.7947\u003c/li\u003e\n\u003cli\u003eS. Kienesberger, L. M. Cox, A. Livanos, et al. Gastric \u003cem\u003eHelicobacter pylori\u003c/em\u003e Infection Affects Local and Distant Microbial Populations and Host Responses. \u003cem\u003eCell Rep\u003c/em\u003e,\u003cem\u003e 14\u003c/em\u003e(6), (2016) 1395-1407. https://doi.org/10.1016/j.celrep.2016.01.017\u003c/li\u003e\n\u003cli\u003eR. Koumangoye, S. Omer, M. H. Kabeer, et al. Novel Human NKCC1 Mutations Cause Defects in Goblet Cell Mucus Secretion and Chronic Inflammation. \u003cem\u003eCell Mol Gastroenterol Hepatol\u003c/em\u003e,\u003cem\u003e 9\u003c/em\u003e(2), (2020) 239-255. https://doi.org/10.1016/j.jcmgh.2019.10.006\u003c/li\u003e\n\u003cli\u003eM. H. Lee, J. Y. Yang, Y. Cho, et al. Inhibitory Effects of Menadione on \u003cem\u003eHelicobacter pylori\u003c/em\u003e Growth and \u003cem\u003eHelicobacter pylori\u003c/em\u003e-Induced Inflammation via NF-\u0026kappa;B Inhibition. \u003cem\u003eInt J Mol Sci\u003c/em\u003e,\u003cem\u003e 20\u003c/em\u003e(5), (2019). https://doi.org/10.3390/ijms20051169\u003c/li\u003e\n\u003cli\u003eX. Li, J. Tan, F. Zhang, et al. H.pylori Infection Alleviates Acute and Chronic Colitis with the Expansion of Regulatory B Cells in Mice. \u003cem\u003eInflammation\u003c/em\u003e,\u003cem\u003e 42\u003c/em\u003e(5), (2019) 1611-1621. https://doi.org/10.1007/s10753-019-01022-0\u003c/li\u003e\n\u003cli\u003eY. Lin, S. Wang, Z. Yang, et al. Bilirubin alleviates alum-induced peritonitis through inactivation of NLRP3 inflammasome. \u003cem\u003eBiomed Pharmacother\u003c/em\u003e,\u003cem\u003e 116\u003c/em\u003e, (2019) 108973. https://doi.org/10.1016/j.biopha.2019.108973\u003c/li\u003e\n\u003cli\u003eJ. M. Liou, P. Malfertheiner, Y. C. Lee, et al. Screening and eradication of \u003cem\u003eHelicobacter pylori\u003c/em\u003e for gastric cancer prevention: the Taipei global consensus. \u003cem\u003eGut\u003c/em\u003e,\u003cem\u003e 69\u003c/em\u003e(12), (2020) 2093-2112. https://doi.org/10.1136/gutjnl-2020-322368\u003c/li\u003e\n\u003cli\u003eP. Liu, Y. Wang, G. Yang, et al. The role of short-chain fatty acids in intestinal barrier function, inflammation, oxidative stress, and colonic carcinogenesis. \u003cem\u003ePharmacol Res\u003c/em\u003e,\u003cem\u003e 165\u003c/em\u003e, (2021) 105420. https://doi.org/10.1016/j.phrs.2021.105420\u003c/li\u003e\n\u003cli\u003eI. G. Macchione, L. R. Lopetuso, G. Ianiro, et al. \u003cem\u003eAkkermansia muciniphila\u003c/em\u003e: key player in metabolic and gastrointestinal disorders. \u003cem\u003eEur Rev Med Pharmacol Sci\u003c/em\u003e,\u003cem\u003e 23\u003c/em\u003e(18), (2019) 8075-8083. https://doi.org/10.26355/eurrev_201909_19024\u003c/li\u003e\n\u003cli\u003eP. Malfertheiner, M. C. Camargo, E. El-Omar, et al. \u003cem\u003eHelicobacter pylori\u003c/em\u003e infection. \u003cem\u003eNat Rev Dis Primers\u003c/em\u003e,\u003cem\u003e 9\u003c/em\u003e(1), (2023) 19. https://doi.org/10.1038/s41572-023-00431-8\u003c/li\u003e\n\u003cli\u003eE. C. Martens, M. Neumann, \u0026amp; M. S. Desai. Interactions of commensal and pathogenic microorganisms with the intestinal mucosal barrier. \u003cem\u003eNat Rev Microbiol\u003c/em\u003e,\u003cem\u003e 16\u003c/em\u003e(8), (2018) 457-470. https://doi.org/10.1038/s41579-018-0036-x\u003c/li\u003e\n\u003cli\u003eG. M. Mart\u0026iacute;n-N\u0026uacute;\u0026ntilde;ez, I. Cornejo-Pareja, L. Coin-Arag\u0026uuml;ez, et al. \u003cem\u003eH. pylori \u003c/em\u003eeradication with antibiotic treatment causes changes in glucose homeostasis related to modifications in the gut microbiota. \u003cem\u003ePLoS One\u003c/em\u003e,\u003cem\u003e 14\u003c/em\u003e(3), (2019) e0213548. https://doi.org/10.1371/journal.pone.0213548\u003c/li\u003e\n\u003cli\u003eK. Matsuoka, E. Saito, T. Fujii, et al. Tacrolimus for the Treatment of Ulcerative Colitis. \u003cem\u003eIntest Res\u003c/em\u003e,\u003cem\u003e 13\u003c/em\u003e(3), (2015) 219-226. https://doi.org/10.5217/ir.2015.13.3.219\u003c/li\u003e\n\u003cli\u003eS. M. McNabney, \u0026amp; T. M. Henagan. Short Chain Fatty Acids in the Colon and Peripheral Tissues: A Focus on Butyrate, Colon Cancer, Obesity and Insulin Resistance. \u003cem\u003eNutrients\u003c/em\u003e,\u003cem\u003e 9\u003c/em\u003e(12), (2017). https://doi.org/10.3390/nu9121348\u003c/li\u003e\n\u003cli\u003eR. Mej\u0026iacute;as-Luque, J. Z\u0026ouml;ller, F. Anderl, et al. Lymphotoxin \u0026beta; receptor signalling executes \u003cem\u003eHelicobacter pylori\u003c/em\u003e-driven gastric inflammation in a T4SS-dependent manner. \u003cem\u003eGut\u003c/em\u003e,\u003cem\u003e 66\u003c/em\u003e(8), (2017) 1369-1381. https://doi.org/10.1136/gutjnl-2015-310783\u003c/li\u003e\n\u003cli\u003eJ. Miyamoto, M. Kasubuchi, A. Nakajima, et al. The role of short-chain fatty acid on blood pressure regulation. \u003cem\u003eCurr Opin Nephrol Hypertens\u003c/em\u003e,\u003cem\u003e 25\u003c/em\u003e(5), (2016) 379-383. https://doi.org/10.1097/mnh.0000000000000246\u003c/li\u003e\n\u003cli\u003eN. Ndegwa, A. Ploner, A. F. Andersson, et al. Gastric Microbiota in a Low-\u003cem\u003eHelicobacter pylori\u003c/em\u003e Prevalence General Population and Their Associations With Gastric Lesions. \u003cem\u003eClin Transl Gastroenterol\u003c/em\u003e,\u003cem\u003e 11\u003c/em\u003e(7), (2020) e00191. https://doi.org/10.14309/ctg.0000000000000191\u003c/li\u003e\n\u003cli\u003eW. Qu, X. Yuan, J. Zhao, et al. Dietary advanced glycation end products modify gut microbial composition and partially increase colon permeability in rats. \u003cem\u003eMol Nutr Food Res\u003c/em\u003e,\u003cem\u003e 61\u003c/em\u003e(10), (2017). https://doi.org/10.1002/mnfr.201700118\u003c/li\u003e\n\u003cli\u003eA. Ralser, A. Dietl, S. Jarosch, et al. \u003cem\u003eHelicobacter pylori\u003c/em\u003e promotes colorectal carcinogenesis by deregulating intestinal immunity and inducing a mucus-degrading microbiota signature. \u003cem\u003eGut\u003c/em\u003e,\u003cem\u003e 72\u003c/em\u003e(7), (2023) 1258-1270. https://doi.org/10.1136/gutjnl-2022-328075\u003c/li\u003e\n\u003cli\u003eJ. Samara, S. Moossavi, B. Alshaikh, et al. Supplementation with a probiotic mixture accelerates gut microbiome maturation and reduces intestinal inflammation in extremely preterm infants. \u003cem\u003eCell Host Microbe\u003c/em\u003e,\u003cem\u003e 30\u003c/em\u003e(5), (2022) 696-711.e695. https://doi.org/10.1016/j.chom.2022.04.005\u003c/li\u003e\n\u003cli\u003eE. E. Schneeberger, \u0026amp; R. D. Lynch. The tight junction: a multifunctional complex. \u003cem\u003eAm J Physiol Cell Physiol\u003c/em\u003e,\u003cem\u003e 286\u003c/em\u003e(6), (2004) C1213-1228. https://doi.org/10.1152/ajpcell.00558.2003\u003c/li\u003e\n\u003cli\u003eZ. H. Shen, C. X. Zhu, Y. S. Quan, et al. Relationship between intestinal microbiota and ulcerative colitis: Mechanisms and clinical application of probiotics and fecal microbiota transplantation. \u003cem\u003eWorld J Gastroenterol\u003c/em\u003e,\u003cem\u003e 24\u003c/em\u003e(1), (2018) 5-14. https://doi.org/10.3748/wjg.v24.i1.5\u003c/li\u003e\n\u003cli\u003eS. Shim, H. S. Jang, H. W. Myung, et al. Rebamipide ameliorates radiation-induced intestinal injury in a mouse model. \u003cem\u003eToxicol Appl Pharmacol\u003c/em\u003e,\u003cem\u003e 329\u003c/em\u003e, (2017) 40-47. https://doi.org/10.1016/j.taap.2017.05.012\u003c/li\u003e\n\u003cli\u003eS. Sitkin, L. Lazebnik, E. Avalueva, et al. Gastrointestinal microbiome and \u003cem\u003eHelicobacter pylori\u003c/em\u003e: Eradicate, leave it as it is, or take a personalized benefit-risk approach? \u003cem\u003eWorld J Gastroenterol\u003c/em\u003e,\u003cem\u003e 28\u003c/em\u003e(7), (2022) 766-774. https://doi.org/10.3748/wjg.v28.i7.766\u003c/li\u003e\n\u003cli\u003eG. Song, D. Liu, X. Geng, et al. Bone marrow-derived mesenchymal stem cells alleviate severe acute pancreatitis-induced multiple-organ injury in rats via suppression of autophagy. \u003cem\u003eExp Cell Res\u003c/em\u003e,\u003cem\u003e 385\u003c/em\u003e(2), (2019) 111674. https://doi.org/10.1016/j.yexcr.2019.111674\u003c/li\u003e\n\u003cli\u003eB. G. J. Surewaard, A. Thanabalasuriar, Z. Zeng, et al. \u0026alpha;-Toxin Induces Platelet Aggregation and Liver Injury during \u003cem\u003eStaphylococcus aureus\u003c/em\u003e Sepsis. \u003cem\u003eCell Host Microbe\u003c/em\u003e,\u003cem\u003e 24\u003c/em\u003e(2), (2018) 271-284.e273. https://doi.org/10.1016/j.chom.2018.06.017\u003c/li\u003e\n\u003cli\u003eT. T. D. Thuy, P. Y. Kuo, S. M. Lin, et al. Anti-\u003cem\u003eHelicobacter pylori\u003c/em\u003e activity of potential probiotic \u003cem\u003eLactiplantibacillus pentosus\u003c/em\u003e SLC13. \u003cem\u003eBMC Microbiol\u003c/em\u003e,\u003cem\u003e 22\u003c/em\u003e(1), (2022) 277. https://doi.org/10.1186/s12866-022-02701-z\u003c/li\u003e\n\u003cli\u003eM. K. Tulic, M. Vivinus-N\u0026eacute;bot, A. Rekima, et al. Presence of commensal house dust mite allergen in human gastrointestinal tract: a potential contributor to intestinal barrier dysfunction. \u003cem\u003eGut\u003c/em\u003e,\u003cem\u003e 65\u003c/em\u003e(5), (2016) 757-766. https://doi.org/10.1136/gutjnl-2015-310523\u003c/li\u003e\n\u003cli\u003eC. Ubeda, Y. Taur, R. R. Jenq, et al. Vancomycin-resistant Enterococcus domination of intestinal microbiota is enabled by antibiotic treatment in mice and precedes bloodstream invasion in humans. \u003cem\u003eJ Clin Invest\u003c/em\u003e,\u003cem\u003e 120\u003c/em\u003e(12), (2010) 4332-4341. https://doi.org/10.1172/jci43918\u003c/li\u003e\n\u003cli\u003eM. A. Vinolo, H. G. Rodrigues, R. T. Nachbar, et al. Regulation of inflammation by short chain fatty acids. \u003cem\u003eNutrients\u003c/em\u003e,\u003cem\u003e 3\u003c/em\u003e(10), (2011) 858-876. https://doi.org/10.3390/nu3100858\u003c/li\u003e\n\u003cli\u003eJ. Wang, C. Zhang, C. Guo, et al. Chitosan Ameliorates DSS-Induced Ulcerative Colitis Mice by Enhancing Intestinal Barrier Function and Improving Microflora. \u003cem\u003eInt J Mol Sci\u003c/em\u003e,\u003cem\u003e 20\u003c/em\u003e(22), (2019). https://doi.org/10.3390/ijms20225751\u003c/li\u003e\n\u003cli\u003eL. Wang, L. Tang, Y. Feng, et al. A purified membrane protein from \u003cem\u003eAkkermansia muciniphila\u003c/em\u003e or the \u003cem\u003epasteurised bacterium\u003c/em\u003e blunts colitis associated tumourigenesis by modulation of CD8(+) T cells in mice. \u003cem\u003eGut\u003c/em\u003e,\u003cem\u003e 69\u003c/em\u003e(11), (2020) 1988-1997. https://doi.org/10.1136/gutjnl-2019-320105\u003c/li\u003e\n\u003cli\u003eP. Wang, M. Cai, K. Yang, et al. Phenolics from Dendrobium officinale Leaf Ameliorate Dextran Sulfate Sodium-Induced Chronic Colitis by Regulating Gut Microbiota and Intestinal Barrier. \u003cem\u003eJ Agric Food Chem\u003c/em\u003e,\u003cem\u003e 71\u003c/em\u003e(44), (2023) 16630-16646. https://doi.org/10.1021/acs.jafc.3c05339\u003c/li\u003e\n\u003cli\u003eS. Wu, Y. Xu, Z. Chen, et al. \u003cem\u003eLactiplantibacillus plantarum\u003c/em\u003e ZJ316 Reduces \u003cem\u003eHelicobacter pylori\u003c/em\u003e Adhesion and Inflammation by Inhibiting the Expression of Adhesin and Urease Genes. \u003cem\u003eMol Nutr Food Res\u003c/em\u003e,\u003cem\u003e 67\u003c/em\u003e(18), (2023) e2300241. https://doi.org/10.1002/mnfr.202300241\u003c/li\u003e\n\u003cli\u003eS. Y. Xu, J. J. Aweya, N. Li, et al. Microbial catabolism of Porphyra haitanensis polysaccharides by human gut microbiota. \u003cem\u003eFood Chem\u003c/em\u003e,\u003cem\u003e 289\u003c/em\u003e, (2019) 177-186. https://doi.org/10.1016/j.foodchem.2019.03.050\u003c/li\u003e\n\u003cli\u003eX. Xu, G. Zhang, K. Peng, et al. Carnosol Maintains Intestinal Barrier Function and Mucosal Immune Homeostasis in DSS-Induced Colitis. \u003cem\u003eFront Nutr\u003c/em\u003e,\u003cem\u003e 9\u003c/em\u003e, (2022) 894307. https://doi.org/10.3389/fnut.2022.894307\u003c/li\u003e\n\u003cli\u003eQ. Yang, J. Ouyang, F. Sun, et al. Short-Chain Fatty Acids: A Soldier Fighting Against Inflammation and Protecting From Tumorigenesis in People With Diabetes. \u003cem\u003eFront Immunol\u003c/em\u003e,\u003cem\u003e 11\u003c/em\u003e, (2020) 590685. https://doi.org/10.3389/fimmu.2020.590685\u003c/li\u003e\n\u003cli\u003eY. Yang, A. Li, J. Qiu, et al. Responses of the intestinal microbiota to exposure of okadaic acid in marine medaka Oryzias melastigma. \u003cem\u003eJ Hazard Mater\u003c/em\u003e,\u003cem\u003e 465\u003c/em\u003e, (2024) 133087. https://doi.org/10.1016/j.jhazmat.2023.133087\u003c/li\u003e\n\u003cli\u003eM. Yin, X. Yan, W. Weng, et al. Micro Integral Membrane Protein (MIMP), a Newly Discovered Anti-Inflammatory Protein of \u003cem\u003eLactobacillus Plantarum\u003c/em\u003e, Enhances the Gut Barrier and Modulates Microbiota and Inflammatory Cytokines. \u003cem\u003eCell Physiol Biochem\u003c/em\u003e,\u003cem\u003e 45\u003c/em\u003e(2), (2018) 474-490. https://doi.org/10.1159/000487027\u003c/li\u003e\n\u003cli\u003eP. Yu, C. Ke, J. Guo, et al. \u003cem\u003eLactobacillus plantarum\u003c/em\u003e L15 Alleviates Colitis by Inhibiting LPS-Mediated NF-\u0026kappa;B Activation and Ameliorates DSS-Induced Gut Microbiota Dysbiosis. \u003cem\u003eFront Immunol\u003c/em\u003e,\u003cem\u003e 11\u003c/em\u003e, (2020) 575173. https://doi.org/10.3389/fimmu.2020.575173\u003c/li\u003e\n\u003cli\u003eX. Yu, J. Ou, L. Wang, et al. Gut microbiota modulate CD8(+) T cell immunity in gastric cancer through Butyrate/GPR109A/HOPX. \u003cem\u003eGut Microbes\u003c/em\u003e,\u003cem\u003e 16\u003c/em\u003e(1), (2024) 2307542. https://doi.org/10.1080/19490976.2024.2307542\u003c/li\u003e\n\u003cli\u003eA. Zarrinpar, A. Chaix, Z. Z. Xu, et al. Antibiotic-induced microbiome depletion alters metabolic homeostasis by affecting gut signaling and colonic metabolism. \u003cem\u003eNat Commun\u003c/em\u003e,\u003cem\u003e 9\u003c/em\u003e(1), (2018) 2872. https://doi.org/10.1038/s41467-018-05336-9\u003c/li\u003e\n\u003cli\u003eH. Zhang, Y. Dai, Y. Liu, et al. \u003cem\u003eHelicobacter pylori\u003c/em\u003e Colonization Protects Against Chronic Experimental Colitis by Regulating Th17/Treg Balance. \u003cem\u003eInflamm Bowel Dis\u003c/em\u003e,\u003cem\u003e 24\u003c/em\u003e(7), (2018) 1481-1492. https://doi.org/10.1093/ibd/izy107\u003c/li\u003e\n\u003cli\u003eQ. Zhang, C. Qiu, W. Jiang, et al. The impact of dioctyl phthalate exposure on multiple organ systems and gut microbiota in mice. \u003cem\u003eHeliyon\u003c/em\u003e,\u003cem\u003e 9\u003c/em\u003e(12), (2023) e22677. https://doi.org/10.1016/j.heliyon.2023.e22677\u003c/li\u003e\n\u003cli\u003eQ. Zhou, B. Xue, R. Gu, et al. \u003cem\u003eLactobacillus plantarum\u003c/em\u003e ZJ316 Attenuates \u003cem\u003eHelicobacter pylori\u003c/em\u003e-Induced Gastritis in C57BL/6 Mice. \u003cem\u003eJ Agric Food Chem\u003c/em\u003e,\u003cem\u003e 69\u003c/em\u003e(23), (2021) 6510-6523. https://doi.org/10.1021/acs.jafc.1c01070\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"probiotics-and-antimicrobial-proteins","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"paap","sideBox":"Learn more about [Probiotics and Antimicrobial Proteins](http://link.springer.com/journal/12601)","snPcode":"12602","submissionUrl":"https://submission.nature.com/new-submission/12602/3","title":"Probiotics and Antimicrobial Proteins","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"Lactiplantibacillus plantarum ZJ316, Helicobacter pylori, Intestinal inflammation, Gut microbiota, Short-chain fatty acids, NF-κB signaling pathway","lastPublishedDoi":"10.21203/rs.3.rs-5351640/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-5351640/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e \u003cem\u003eHelicobacter pylori\u003c/em\u003e (\u003cem\u003eH. pylori\u003c/em\u003e) infection poses significant risks for gastric cancer and intestinal inflammation, yet effective prevention strategies for intestinal inflammation remain elusive. Here, we aimed to investigate the protective effects and underlying mechanisms of \u003cem\u003eLactiplantibacillus plantarum\u003c/em\u003e ZJ316 (\u003cem\u003eL. plantarum\u003c/em\u003e ZJ316) in a mouse model of \u003cem\u003eH. pylori\u003c/em\u003e-induced intestinal inflammation. Our results demonstrated that treatment with \u003cem\u003eL. plantarum\u003c/em\u003e ZJ316 effectively reduced tissue damage and upregulated expression of tight junction proteins such as Zonula occludens-1 (ZO-1), Occludin, and Claudin-1, while decreased pro-inflammatory cytokines interleukin-1β (IL-1β), interferon γ (IFN-γ), and tumor necrosis factor α (TNF-α). Additionally, intaking \u003cem\u003eL. plantarum\u003c/em\u003e ZJ316 reduced relative abundance of pathogenic bacteria \u003cem\u003eStaphylococcus\u003c/em\u003e and \u003cem\u003eDesulfovibrio\u003c/em\u003e by 69%, and 42%, respectively, while enhancing beneficial bacteria including \u003cem\u003eLigilactobacillus\u003c/em\u003e, \u003cem\u003eAkkermansia\u003c/em\u003e, and \u003cem\u003eLactobacillus\u003c/em\u003e associated with short-chain fatty acids (SCFAs) synthesis, by 88%, 85%, and 16%, respectively. Gas chromatography\u0026ndash;mass spectrometry (GC-MS) analysis confirmed \u003cem\u003eL. plantarum\u003c/em\u003e ZJ316 reversed \u003cem\u003eH. pylori\u003c/em\u003e-induced declines in SCFA levels. In vitro, \u003cem\u003eL. plantarum\u003c/em\u003e ZJ316 inhibited the IκBα/NF-κB pathway, thereby reducing TNF-α and IL-8 production in HT-29 cells following \u003cem\u003eH. pylori\u003c/em\u003e infection. These findings collectively suggest that \u003cem\u003eL. plantarum\u003c/em\u003e ZJ316 ameliorates \u003cem\u003eH. pylori\u003c/em\u003e-induced intestinal inflammation by enhancing gut barrier function, improving flora structure, increasing SCFA levels, and mitigating inflammation through NF-κB pathway inhibition, offering promise for therapeutic development.\u003c/p\u003e","manuscriptTitle":"Probiotic Intervention Alleviates Helicobacter pylori-induced Intestinal Inflammation by Sustaining Intestinal Homeostasis","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-11-18 06:06:02","doi":"10.21203/rs.3.rs-5351640/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2025-01-18T17:32:54+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-01-18T04:23:00+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-01-14T04:08:08+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"141049625961225435575556963862034266584","date":"2025-01-07T08:35:06+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"153815802517473790447347392152418832989","date":"2025-01-02T08:53:29+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2024-12-09T18:14:51+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-11-05T06:16:33+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2024-11-05T06:16:26+00:00","index":"","fulltext":""},{"type":"submitted","content":"Probiotics and Antimicrobial Proteins","date":"2024-10-29T06:33:24+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"probiotics-and-antimicrobial-proteins","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"paap","sideBox":"Learn more about [Probiotics and Antimicrobial Proteins](http://link.springer.com/journal/12601)","snPcode":"12602","submissionUrl":"https://submission.nature.com/new-submission/12602/3","title":"Probiotics and Antimicrobial Proteins","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"57f5ad49-8f03-4181-b48e-8bcf64ef742f","owner":[],"postedDate":"November 18th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2025-02-17T16:02:46+00:00","versionOfRecord":{"articleIdentity":"rs-5351640","link":"https://doi.org/10.1007/s12602-025-10474-w","journal":{"identity":"probiotics-and-antimicrobial-proteins","isVorOnly":false,"title":"Probiotics and Antimicrobial Proteins"},"publishedOn":"2025-02-13 15:57:42","publishedOnDateReadable":"February 13th, 2025"},"versionCreatedAt":"2024-11-18 06:06:02","video":"","vorDoi":"10.1007/s12602-025-10474-w","vorDoiUrl":"https://doi.org/10.1007/s12602-025-10474-w","workflowStages":[]},"version":"v1","identity":"rs-5351640","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-5351640","identity":"rs-5351640","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2024) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00
unpaywall
last seen: 2026-05-23T02:00:01.238055+00:00
License: CC-BY-4.0