Dissecting allele-specific fungicide resistance mechanisms by heterologous expression of the demethylase inhibitor target gene Cyp51 in a phytopathogen model

12

Fungicide resistance is a major concern both in agriculture and clinical disease 13 control. Whilst several mechanisms of resistance have been elucidated, assigning phenotype to 14 genotype is often difficult and reliant on correlations. 15 Resistance to demethylase inhibitor (DMI) fungicides was recently reported in the economically 16 important filamentous fungal barley (Hordeum vulgare) pathogen Pyrenophora teres f. teres (Ptt) in 17 Australia. The target of DMI fungicides is encoded by the Cyp51 gene family; single allele of Cyp51B 18 and two copies of the Cyp51A gene1. Five Cyp51A alleles (W1-A1, 9193-A1, KO103-A1, W1-A2 and 19 9193-A2) were identified in Ptt with KO103-A1 containing the mutation F489L (F495L) which 20 correlates with resistance to various DMIs.1 21

We replaced the coding region of the native Cyp51B gene of the filamentous fungal 22 Dothideomycete wheat pathogen Parastagonospora nodorum with each of the five Ptt Cyp51A 23 alleles to compare the phenotypic effects of each allele in isolation. The native Cyp51B of P. 24 nodorum could be functionally replaced by Cyp51-A1 but not Cyp51-A2. Transformants carrying 25 KO103-A1 exhibited significantly higher gene expression than 9193-A1 and W1-A1, suggesting the 26 mechanism of gene regulation lies within the coding sequence and is conserved between Ptt and P. 27 .CC-BY-NC 4.0 International licenseperpetuity. It is made available under a preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in The copyright holder for thisthis version posted October 16, 2025. ; https://doi.org/10.1101/2025.10.16.682737doi: bioRxiv preprint 2 nodorum. The EC50 values of the KO103-A1 transformants were significantly higher than any other 1 transformants or wild type isolates for metconazole, prochloraz and tebuconazole but lower for 2 epoxiconazole. 3

This system permits the functional characterisation of fungicide target genes in an 4 isogenic background that mimics the physiological environment of plant pathogens. We suggest the 5 system will prove useful in dissecting the impact of genetic mutations on a spectrum of fungicides 6 and permit the design of fungal strains for screening active ingredients that may control strains 7 resistant to existing fungicides. 8

Fungicide resistance, Pyrenophora teres, Cyp51, demethylase inhibitor, 9 Parastagonospora nodorum, azole 10 11 .CC-BY-NC 4.0 International licenseperpetuity. It is made available under a preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in The copyright holder for thisthis version posted October 16, 2025. ; https://doi.org/10.1101/2025.10.16.682737doi: bioRxiv preprint 3

1 Pyrenophora teres f. teres (Ptt; P. teres Drechsler; anamorph Drechslera teres [Sacc.] Shoem.) is a 2 narrow-host range necrotrophic fungal pathogen responsible for the barley (Hordeum vulgare) 3 disease net form net blotch (NFNB). Net blotch diseases are rapidly increasing in prevalence across 4 nearly all barley growing regions.2 Together with spot form net blotch (SFNB; P. teres f. maculata), 5 these diseases can cause yield losses ranging from 10-40%, and in severe cases, up to 100%.2 No-till 6 farming practices have contributed to the spread of disease in recent decades. In the absence of 7 adequately resistant barley cultivars, fungicides have become the main method of disease control.3 8 Quinone outside inhibitor (QoI), succinate dehydrogenase inhibitor (SDHI) and demethylase inhibitor 9 (DMI) fungicides are widely used on barley crops as seed dressings and foliar treatments to control 10 various diseases.4 DMI fungicides are site specific fungicides that interact with the heme iron of the 11 cytochrome P450 sterol 14 α-demethylase (Cyp51), thus disrupting ergosterol biosynthesis and 12 inhibiting growth.5 These compounds are widely used in both agriculture and medicine to treat 13 fungal pathogens. 14 Although fungicides remain an important and effective means of control, resistance has emerged as 15 a major global challenge in agriculture. In filamentous fungi, five main mechanisms of resistance to 16 fungicides have been reported; target site modification where mutations in the target gene(s) 17 reduce the binding affinity of the fungicide to the enzyme, overexpression of the target gene(s), 18 increased fungicide efflux by overexpression of membrane-bound transporter proteins, 19 detoxification of the fungicide6, and copy number variation in the target gene.7 Resistance in Ptt to 20 SDHI fungicides is widespread in Europe and Australia and poses a major concern8,9. While mutations 21 associated with resistance to QoI fungicides have been detected, field control has not been 22 compromised for all the actives within this fungicide class.3,10,11 Resistance to DMI fungicides was 23 first reported in P. teres (form unknown) isolates from New Zealand,12 though molecular 24 characterization was limited. More recently, Western Australian Ptt isolates were found to harbor 25 both target site mutations and overexpression of the DMI target gene Cyp51.1 26 .CC-BY-NC 4.0 International licenseperpetuity. It is made available under a preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in The copyright holder for thisthis version posted October 16, 2025. ; https://doi.org/10.1101/2025.10.16.682737doi: bioRxiv preprint 4 Cyp51 is encoded by a small gene family in fungi. A single Cyp51B is carried by all ascomycetes, while 1 several species including Aspergillus spp., Fusarium spp., Penicillium digitatum, Rhynchosporium 2 commune, and Ptt carry other paralogs.1,13,14 Ptt carries one copy of Cyp51B and two Cyp51A genes, 3 Cyp51-A1 and Cyp51-A2.1 A survey of Ptt isolates from Western Australia revealed five unique 4 Cyp51A alleles: W1-A1, 9193-A1, KO103-A1, W1-A2 and 9193-A2.1 In species with multiple Cyp51 5 paralogs, target site-mediated DMI resistance is associated with non-synonymous mutations and/or 6 overexpression of the Cyp51A gene.1,15,16 Resistance to DMIs in Ptt was correlated with the mutation 7 F489L (corresponding to F495L in the archetype, A. fumigatus)17 in Cyp51A, which was only found in 8 isolates with the KO103-A1 allele.1 Resistance factors (RFs) of the resistant isolate KO103 varied by 9 fungicide, with RFs about 10 for tebuconazole, metconazole, triticonazole, difenoconazole and 10 prochloraz, and RFs around 1 for epoxiconazole, prothioconazole, propiconazole and triadimenol.1 11 Additionally, all three Cyp51 paralogs, Cyp51-A1, Cyp51-A2 and Cyp51B exhibited an enhanced level 12 of tebuconazole-induced gene expression in KO103 compared to the sensitive strain 9193, despite 13 no promoter changes being found.1 14 Linking a fungicide resistance phenotype to specific genotypic alterations is challenging, especially 15 when using naturally occurring isolates18. An ideal approach is to express individual resistance alleles 16 in an isogenic background. Yeast expression systems have been instrumental in studying the impact 17 of Cyp51 mutations on DMI tolerance.19-21 Recently, DMI ligand binding studies and Cyp51 18 reconstitution assays have been used in conjunction with the expression of individual and pairs of 19 relevant mutations in Candida albicans to determine the effects of those changes on DMI 20 sensitivity.20 Interestingly, amino acid substitutions that resulted in increased tolerance often 21 reduced catalytic activity.20 Also, direct ligand binding studies alone failed to identify small 22 differences between mutant Cyp51 proteins, highlighting the need for a combination of DMI ligand 23 binding and half maximal inhibitory concentration (IC50) studies.20 However, yeast systems have 24 significant drawbacks due to differences in temperature sensitivity compared to plant pathogenic 25 filamentous fungi.22 Cyp51 from the wheat pathogen Zymoseptoria tritici failed to demethylate 26 .CC-BY-NC 4.0 International licenseperpetuity. It is made available under a preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in The copyright holder for thisthis version posted October 16, 2025. ; https://doi.org/10.1101/2025.10.16.682737doi: bioRxiv preprint 5 Cyp51 substrates eburicol or lanosterol at 37°C but catalysis was restored at 22°C, unlike C. 1 albicans.23 To address these limitations, a heterologous expression system was recently developed 2 using the Leotiomycete filamentous fungus Sclerotinia sclerotiorum to test the SDHI target genes 3 SdhB and SdhC from various phytopathogens against several actives from this fungicide group.24 The 4 SdhB and SdhC genes from the phytopathogens Botrytis cinerea, Blumeriella jaapii and Clarireedia 5 jacksonii were introduced into S. sclerotiorum and the radial growth on fungicide-amended media 6 validated previously identified resistance mutations. A laboratory mutant SdhB allele from Monilinia 7 fructicola also conferred resistance to boscalid, suggesting a potential resistance mechanism in M. 8 fructicola.24 9 In this study, we have developed a system to express fungal Cyp51 genes in the model fungal 10 pathogen Parastagonospora nodorum, replacing its sole active Cyp51 gene Cyp51B (SNOG_03702). 11 P. nodorum, the causal agent of septoria nodorum blotch on wheat (Triticum aestivum) is considered 12 an ideal model system for fungicide research as it is a typical filamentous phytopathogen with 13 accessible genomic tools.22,25 We replaced the native Cyp51B gene of P. nodorum with each of the 14 five Ptt Cyp51A alleles to assess the phenotypic impact of each allele in isolation and in the same 15 genomic location. We demonstrate that P. nodorum Cyp51B can be functionally replaced by the Ptt 16 Cyp51A1 alleles but not Cyp51A2. Transformants carrying the KO103-A1 allele exhibited differential 17 resistance to various DMIs. Expression of Cyp51B in transformants carrying the KO103-A1 allele was 18 significantly higher upon treatment with sub-lethal tebuconazole doses than either sensitive allele 19 9193-A1 or W1-A1, suggesting a promoter-independent mechanisms of gene regulation. This work 20 introduces a robust new tool in the study of resistance to DMIs and lays the foundation for 21 expanding functional genomic studies to other fungicide classes and also to those fungal species 22 lacking efficient transformation systems. 23 .CC-BY-NC 4.0 International licenseperpetuity. It is made available under a preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in The copyright holder for thisthis version posted October 16, 2025. ; https://doi.org/10.1101/2025.10.16.682737doi: bioRxiv preprint 6

1 Isolates and Culturing 2 P. nodorum strain SN15 (Table 1) was maintained on V8-PDA agar (150 mL Campbell’s V8 juice L−1, 3 3 g CaCO3 L−1, 10 g Difco PDA L−1 and 15 g agar L−1) under a 12 h photoperiod at 21°C. When required, 4 spores were produced by incubating plates at 21°C in 12 h cycles of darkness and near-UV light 5 (Phillips TL 40W/05).26 P. teres f. teres (Ptt) strains KO103, 9193 and W1 were maintained on V8-6 potato-dextrose agar plates and incubated at room temperature under white light for 5 – 7 days.1 All 7 isolates used are described in Table 1. 8 Construction of the Ptt Cyp51A gene replacement vectors and transformation of P. nodorum 9 SN15 strains with the native Cyp51B gene (SNOG_03702) replaced by each of the five Ptt Cyp51A 10 alleles were generated through genetic transformation with gene replacement vectors constructed 11 using the Gibson assembly® Master Mix (New England Biolabs, Ipswich MA) following the 12 manufacturer’s protocols (Table 1). The gene replacement constructs consist of a 1000 bp flanking 13 region containing the SN15 Cyp51B promoter region, Ptt Cyp51A cDNA from each of the 5 alleles, a 14 TrpC terminator, a GpdA promoter, the hptII gene that confers resistance to hygromycin B and a 15 downstream 1000 bp flanking region containing the SN15 Cyp51B terminator region, all assembled 16 into a pUC18 vector backbone (Figure 1). Ptt Cyp51 alleles were amplified from Ptt isolates 9193, 17 W1 and KO1031 using the PttCYP_F and PttCYP_R primers and the remaining construct was amplified 18 from the construct pUC18::TGH3F5F previously made using the TGH3FpUC5F_F and the 19 TGH3FpUC5F_R primers (Table 2). Briefly, this construct was made by amplifying 1000 bp of the 20 native promoter and terminator regions of the P. nodorum Cyp51B, and GpdA, hptII, and TrpC 21 fragments were all amplified from the pAN7-1 plasmid (Table 2, Figure 1). All PCR was performed 22 using Q5 polymerase (New England Biolabs) under the following conditions: 98°C for 30 s, 25 cycles 23 of 98°C 10 s, 64°C for 30 s, and 72°C for 2 min and 30 s followed by extension of 72°C for 2 min. The 24 P. nodorum strain SN15 was transformed with each construct using PEG-mediated transformation26. 25 Colonies growing through hygromycin overlay were subcultured onto fresh V8-PDA plates containing 26 200 µg ml-1 hygromycin. Presence of the replacement cassette and true gene replacement of the 27 .CC-BY-NC 4.0 International licenseperpetuity. It is made available under a preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in The copyright holder for thisthis version posted October 16, 2025. ; https://doi.org/10.1101/2025.10.16.682737doi: bioRxiv preprint 7 native SN15 Cyp51B gene were confirmed using PCR primers SN15_genomic_F and SN15_genomic_R 1 to ensure absence of shorter native SN15 Cyp51B gene, and both SN15_genomic_F/CYP51_internal 2 and Hyg-internal_F/Hyg_internal_R to confirm correct integration location (Table 2, Figure 1). True 3 gene replacement events containing a single copy of the cassette were identified using qPCR with 4 the primer sets CN_F1, CN_R1 and CN_F2, CN_F2 (Table 2). The sequence of the integrated Cyp51A 5 allele was confirmed by amplification and Sanger sequencing using the PttCYPSeq_F and 6 PttCypSeq_R primers (Table 2, Figure 1). Two isolates containing a single copy integration and one 7 isolate containing an ectopic integration for each Cyp51A allele were retained for further analysis. 8 All transformants used in this study are described in Table 1. 9 Gene expression 10 A final concentration of 1 x 106 spores for each transformant (tebuconazole or ethanol treated 11 control, three replicates per treatment) were grown in 6-well microtitre plates containing 5 ml of 12 Fries2 liquid media,27 and incubated at 22°C and 120 rpm. At 72 h post-inoculation, cultures were 13 spiked with either 2 µL of tebuconazole (final concentration of 3.9 µg mL-1 for Ko103; 0.31 µg mL-1 14 for W1 and 0.25 µg mL-1 for 9193)1 or 2 µL ethanol only (the solvent for tebuconazole) and shaken 15 for an additional 24 h. After 24 h, samples were collected, washed twice with sterile DEPC-treated 16 water and extracted with TRIzol Reagent (ThermoFisher Scientific, Waltham MA).1 RNA was then 17 treated with Turbo™ DNAase (ThermoFisher Scientific) to remove genomic DNA contamination. 18 cDNA was created using the LunaScript RT SuperMix Kit (New England Biolabs), following the 19 manufacturers’ instructions. qPCR was performed using 2X iTaq Universal SYBR Green Supermix 20 (Bio-Rad Laboratories) and PttCYP51A_qPCR_F/PttCYP51A_qPCR_R and 21 PnCYP51B_qPCR_F/PnCYP51B_qPCR_R primers to measure expression of the inserted Ptt Cyp51A 22 gene and the native P. nodorum Cyp51B gene, respectively (Table 2). The qPCR reactions were run 23 on a BioRad CFX96 qPCR machine under the following conditions for all genes: 95°C for 5 min, 40 24 cycles of 95°C for 5 s, and 60°C for 45 s. Melting curve of each primer pairs was analysed after end 25 of the cycle with extension cycle of 65°C to 95°C increment 0.5°C for 5 s. Gene expression of Ptt 26 .CC-BY-NC 4.0 International licenseperpetuity. It is made available under a preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in The copyright holder for thisthis version posted October 16, 2025. ; https://doi.org/10.1101/2025.10.16.682737doi: bioRxiv preprint 8 Cyp51A was normalized to SN15 Act1 (SNOG_01139)28 and relative gene expression calculated using 1 the 2- ∆CT method. Each sample was replicated three times. 2 Growth rate assays 3 For each strain, 5 µL of spores (2 x 105 spores mL-1) were added to each well of a 96-well microtitre 4 plate containing 95 µL of YSS broth. All transformants and controls were replicated four times and 5 the experiment was repeated twice. Optical density of the plate was measured at 405 nm every six 6 hours for seven days using a Synergy HT microplate reader (ThermoFisher Scientific). 7 Fungicide sensitivity assays 8 A 96-well microtitre plate assay was performed and EC50 values calculated for each transformant.29 9 Four technical grade DMI fungicides were used: epoxiconazole, prochloraz, metconazole and 10 tebuconazole (Sigma Aldrich, St. Louis MO). Serial dilutions used for each fungicide were as follows. 11 For epoxiconazole and prochloraz a range of 0, 0.00488, 0.00976, 0.019, 0.039, 0.0781, 0.156, 0.312, 12 0.625, 1.25, 2.5, and 5 µg mL-1 was used, and for metconazole and tebuconazole a range of 0, 0.078, 13 0.156, 0.313, 0.625, 1.25, 2.5, 5, 10, 20, 40, and 80 µg mL-1 was used. 14 Detached leaf assays 15 The first leaf of two-week-old wheat seedlings (var. Wyalkatchem), were cut into 4 cm long pieces 16 and either dipped into water (untreated) or 1.45 µL mL-1 Folicur® 430 SC (Bayer CropScience, active 17 ingredient tebuconazole 430 g L-1) for 10 s. Treated leaves were then transferred to benzimidazole 18 agar (50 mg benzimidazole, 10 g agar, 1 L Milli-Q water) and dried for about 10 minutes before 19 inoculation. 5 µL spores (106 spores mL-1) from each transformant was placed on the leaves to 20 facilitate infection and incubated for 14 days at room temperature under a 12 h photoperiod and 21 then photographed. 22 DNA extraction, whole genome sequencing and data analysis 23 106 spores were incubated in the dark at 22°C, 130 rpm for 7 days. Mycelia were harvested, washed 24 two times with sterile MilliQ water, and freeze dried. High quality genomic DNA was extracted 25 according to Wang, et al.30 Library preparation was performed using the Oxford Nanopore 26 .CC-BY-NC 4.0 International licenseperpetuity. It is made available under a preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in The copyright holder for thisthis version posted October 16, 2025. ; https://doi.org/10.1101/2025.10.16.682737doi: bioRxiv preprint 9 Technologies Ligation Sequencing gDNA Native barcoding Kit SQK-LSK109 for the 1 PnCYP51B::Pt9193A1 and PnCYP51B::PtW1A1 transformants and loaded onto a MinION R9 flow cell 2 (Oxford Nanopore Technologies, Oxford, UK). Library preparation was performed using the Oxford 3 Nanopore Technologies Ligation Sequencing gDNA Native barcoding Kit SQK-NBD114.24 and loaded 4 into MinION flow cell R10.4 for the for PnCYP51B::PtKO103A1 transformants (Oxford Nanopore 5 Technologies, Oxford, UK). Resulting data was base-called using Guppy 6.4.6 (high accuracy) for the 6 PnCYP51B::Pt9193A1 and PnCYP51B::PtW1A1 transformants and Dorado 7.6.8 (super accurate) 7 models for PnCYP51B::PtKO103A1 transformants (Oxford Nanopore Technologies, Oxford, UK). The 8 raw reads were corrected and assembled using canu 2.2 with default parameters 31. To validate 9 single copy integration, the insert used in the replacement construct (5779 bp) was used as a query 10 to search for the insert in the assembled genome using blastn version 2.9.0 32. A genome with single 11 blastn hit with full length construct confirmed a single integration. 12

13 Transformation of Parastagonospora nodorum with Ptt Cyp51A alleles 14 In order to investigate the role of individual variants of Ptt Cyp51A in fungicide resistance, we 15 attempted to replace the native Cyp51B gene in P. nodorum strain SN15 with each of the five 16 Cyp51A alleles found in DMI-resistant and sensitive isolates of Ptt (Figure 1).1 Single copy correctly 17 replaced transformants were obtained for the KO103-A1, 9193-A1 and W1-A1 alleles. In contrast, 18 transformation attempts with 9193-A2 or W1-A2 alleles yielded only hygromycin-resistant colonies 19 with ectopic integration. Seven attempts were made at the transformation of A2 alleles and over 50 20 colonies for each attempt were screened for gene replacement. This strongly suggests the A2 variant 21 cannot functionally complement P. nodorum Cyp51B. 22 For transformants containing KO103-A1, 9193-A1 and W1-A1, two single copy, correctly replaced 23 transformants and one single copy ectopic were selected for further analysis. Since single copy 24 correct replacements were not found for 9193-A2 and W1-A2, one ectopic transformant was 25 .CC-BY-NC 4.0 International licenseperpetuity. It is made available under a preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in The copyright holder for thisthis version posted October 16, 2025. ; https://doi.org/10.1101/2025.10.16.682737doi: bioRxiv preprint 10 selected for each (Table 1). To corroborate qPCR results and confirm the correct gene replacement, 1 we generated whole genome assembles of two PnCYP51B::PtKO103A1 transformants, and one each 2 of PnCYP51B::Pt9193A1 and PnCYP51B::PtW1A1. A BLASTN analysis using the insert sequence as a 3 query returned a single BLAST hit with over 99.98% identity in all transformants tested. Phenotypic 4 characterisation of transformants showed no significant differences in growth rate among the 5 transformants (Figure 2). Although there were some significant differences in sporulation rate, the 6

were variable, and no clear pattern could be deduced (Figure 2). 7 Response of transformants to fungicide treatment 8 To determine the phenotypic impact of each Cyp51 allele, spore suspensions from each 9 transformant were tested against four DMI fungicides to determine the EC50 (Figure 3). 10 Transformants carrying the resistant KO103-A1 allele (F489L) exhibited significantly higher EC50 11 values than all other transformants or wild-type isolates tested for metconazole, prochloraz, and 12 tebuconazole (Figure 3 B-D). In contrast, when tested against epoxiconazole, EC50 values of 13 PnCYP51B::PtKO103A1 transformants were not statistically different from transformants carrying 14 sensitive alleles PnCYP51B::Pt9193A1 or PnCYP51B::PtW1A1 (Figure 3A). Resistance factors for the 15 two PnCYP51B::PtKO103A1 transformants were also significantly lower (0.85, 0.80) for 16 epoxiconazole compared to metconazole (9.53, 8.46), prochloraz (11.46, 13.19) or tebuconazole 17 (14.01, 12.40; Table 3). These phenotypic responses mirrored those found in the original Ptt isolates 18 carrying the different alleles tested in our study.1 19 To further validate these findings in vivo, each transformant was inoculated onto detached wheat 20 leaves either untreated or dipped in a solution of tebuconazole (Figure 4). Visible lesions formed on 21 untreated leaves except for those inoculated with water. Similar lesions to those found on the 22 untreated leaves were present only in PnCYP51B::PtKO103A1 transformants and not present in the 23 PnCYP51B::PtKO103A1 ectopic transformant or in any of the other transformants. Similar to the 24 untreated experiment, the water only control showed no symptoms (Figure 4). 25 .CC-BY-NC 4.0 International licenseperpetuity. It is made available under a preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in The copyright holder for thisthis version posted October 16, 2025. ; https://doi.org/10.1101/2025.10.16.682737doi: bioRxiv preprint 11 Gene expression of Ptt Cyp51A alleles 1 Expression levels of Ptt Cyp51A were measured in each transformant under untreated and 2 tebuconazole-treated conditions (Figure 5A). A significant induction of Cyp51A expression following 3 tebuconazole treatment was observed in the PnCYP51B::PtKO103A1 transformants. Other 4 transformants exhibited a tebuconazole-related increase, but these changes were not statistically 5 significant. No Cyp51A expression was detected in any of the Cyp51-A1 ectopic transformants, nor in 6 the SN15 PEG control or wildtype SN15. Expression was detected in all the ectopic Cyp51-A2 7 transformants but there was no significant difference between control and treated transformants. 8 Expression levels of the endogenous P. nodorum Cyp51B was measured in each transformant as 9 well. No expression was detected in any of the true replacement transformants with the Cyp51A1 10 alleles and no statistically significant differences in expression were found for any other 11 transformant (Figure 5B). 12

13 In this study, we have developed a heterologous expression system using P. nodorum to investigate 14 individual allelic variants of Cyp51, the target gene of DMI fungicides. This system allows the 15 isolation of phenotypic effects attributable to individual genetic changes in a gene of interest from 16 changes that may be caused by genomic background variation. As a proof of concept, we expressed 17 the Cyp51A gene of Ptt, a pathogen currently exhibiting resistance to DMI fungicides in Western 18 Australia.1 P. nodorum is a well-established model for fungicide research22,33,34, offering a complete 19 suite of molecular tools, including reference genome sequences and facile gene replacements 20 techniques.25 21 It is significant that our heterologous system utilises a filamentous fungus rather than a unicellular 22 yeast, providing a more physiologically relevant context for studying fungicide resistance genes in 23 filamentous fungal pathogens. Establishing a direct link between the genotype (allelic variants of 24 Cyp51A) and the resulting phenotype (EC50 values for various fungicides) is important to dissect the 25 mechanisms of resistance. We successfully replaced the sole functional Cyp51B allele in P. nodorum 26 .CC-BY-NC 4.0 International licenseperpetuity. It is made available under a preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in The copyright holder for thisthis version posted October 16, 2025. ; https://doi.org/10.1101/2025.10.16.682737doi: bioRxiv preprint 12 with a distantly related Cyp51A allele from Ptt, despite only 53% amino acid sequence identity 1 (Figure 1, Figure 4). It remains to be seen whether other fungicide target genes such as succinate 2 dehydrogenase (Sdh) subunits B, C and D could be similarly replaced in our system. 3 A recent study using S. sclerotiorum as a heterologous transformation system to test impact in SDHI 4 sensitivity of SdhB and SdhC alleles carrying SDHI-resistance mutations from various 5 phytopathogenic fungi illustrates the utility of such systems.24 However, in that study, the 6 endogenous Sdh genes were not replaced or silenced, and gene expression of the endogenous and 7 introduced Sdh genes was not measured. Thus, it is not known if the introduced alleles exhibited 8 changes in gene expression relative to each other or to the endogenous Sdh gene. Consequently, 9 the observed phenotypes likely reflect the added effects of gene sets, rather than introduced allele 10 in isolation. 11 We found that true replacements of the native P. nodorum Cyp51B with Ptt Cyp51A1 alleles were 12 possible, confirming functional equivalence. This is consistent with a study on Aspergillus fumigatus 13 where knocking out either the Cyp51A or Cyp51B gene did not result in phenotypic differences, 14 suggesting both paralogs could fulfil the same functional role.35-37 However, we could not recover a 15 true replacement using either Ptt Cyp51-A2 alleles. Although gene expression was detected for the 16 A2 alleles (Figure 5), it is possible that the protein products cannot perform the function of the 17 native P. nodorum Cyp51B enzyme. 18 Phenotypic assays revealed that transformants carrying the mutant KO103-A1 allele exhibited RFs 19 similar to those with wild type 9193-A1 and W1-A1 alleles when tested against epoxiconazole 20 (average RF = 0.93), but significantly higher for metconazole, prochloraz and tebuconazole (average 21 RF = 12.18, 11.75 and 18.91, respectively; Figure 3, Table 3). These results are consistent with the 22 phenotypes of the original Ptt strains carrying the KO103-A1 allele where the RFs for epoxiconazole 23 and tebuconazole were 2.0 and 16.4, respectively.1 The EC50 results were confirmed in vivo for 24 .CC-BY-NC 4.0 International licenseperpetuity. It is made available under a preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in The copyright holder for thisthis version posted October 16, 2025. ; https://doi.org/10.1101/2025.10.16.682737doi: bioRxiv preprint 13 tebuconazole using detached leaf assays, which both corroborates the in vivo studies and 1 demonstrates a similar level of pathogenicity of all transformants on leaf tissue (Figure 4). 2 RNAseq analysis revealed that both Cyp51-A1 and Cyp51-A2 alleles in Ptt were expressed and 3 upregulated under tebuconazole induction.1 In our P. nodorum system, all alleles were expressed 4 under the control of the native P. nodorum Cyp51B promoter, eliminating promoter variation as a 5 confounding factor. While Cyp51-A2 alleles were both expressed in ectopic transformants, we 6 cannot confirm translation or protein functionality (Figure 5). There is only one amino acid 7 difference in both 9193-A2 and W1-A2 that differentiates them from the Cyp51-A1 alleles 8 (Supplemental Figure S1). Although it is possible that this amino acid change plays an important role 9 in protein stability or enzyme activity, there may be other factors that resulted in the inability to 10 retrieve correctly replaced transformants. 11 Gene expression analysis of the various transformants showed that only PnCYP51B::PtKO103A1 12 transformants exhibited significant upregulation under tebuconazole induction (Figure 5).1 Gene 13 expression of tebuconazole treated PnCYP51B::PtKO103A1 transformants was also significantly 14 higher than any of the other transformants, regardless of treatment (Figure 5). This agrees with the 15 previous finding that Cyp51A (no distinction between A1 and A2 alleles) was more highly 16 upregulated in the DMI resistant KO103 isolate than the sensitive 9193 isolate.1 This suggests that 17 upregulation of Cyp51-A1 expression is driven by coding sequence variation rather than promoter 18 differences, and that the regulatory mechanism is conserved between P. nodorum and Ptt. Also, 19 there was no significant difference in expression of the endogenous P. nodorum Cyp51B gene in any 20 of the transformants (Figure 5B). This further suggests that the mechanism observed for the 21 overexpression of the KO103-A1 allele in P. nodorum is promoter independent. 22 There is only one SNP that differentiates the KO103-A1 allele from both 9193-A1 and W1-A11, and 23 that is c1467a, which results in the nonsynonymous mutation F489L1 (Supplementary Figure S2). This 24 mutation may affect mRNA stability, as synonymous mutations correlated to changes in gene 25 .CC-BY-NC 4.0 International licenseperpetuity. It is made available under a preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in The copyright holder for thisthis version posted October 16, 2025. ; https://doi.org/10.1101/2025.10.16.682737doi: bioRxiv preprint 14 expression of Cyp51 have been reported in Erysiphe necator.38,39 Alternatively, it is possible that the 1 F489L mutation not only interferes with the access of fungicides to the binding cavity of Cyp51, but 2 also affects the binding of its substrate, which may in turn cause a metabolic feedback loop and 3 increased gene expression, perhaps mediated by the accumulation of toxic sterol shunt products.1 4

5 This study establishes a heterologous expression system for the analysis of fungal Cyp51 allele 6 variants in a cytological and physiological settings that is typical for fungal phytopathogens. The 7 system may also be useful to study filamentous animal pathogens. By isolating individual alleles in an 8 isogenic background, we have used the system to gather insight into the function and regulation of 9 Ptt Cyp51 alleles. Further biochemical and molecular modelling work is needed to fully characterize 10 the impact of specific mutations on both the catalytic function and azole interaction of the allelic 11 variants. The ability to dissect allele-specific effects has proven to be a powerful platform for 12 investigating fungicide resistance and has significant potential for the analysis of other target genes. 13 This study proposes the use of a P. nodorum strain for the fine analysis of the impact of individual 14 mutations affecting DMI sensitivity, with broader implications for understanding resistance in both 15 animal and clinical fungal pathogens. Further studies should address the feasibility of replacing other 16 important fungicide target genes, such as the SDH subunits, allowing the simultaneous analysis of 17 multiple resistance mechanisms. 18

19 The authors would like to thank Dr. Madeleine Tucker for preliminary work on this system. This 20 study was supported by Curtin University and the Grains Research and Development Corporation 21 through research grants CUR00016 and CUR00023. 22 23 .CC-BY-NC 4.0 International licenseperpetuity. It is made available under a preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in The copyright holder for thisthis version posted October 16, 2025. ; https://doi.org/10.1101/2025.10.16.682737doi: bioRxiv preprint 15

1 1 Mair, W. J. et al. Demethylase inhibitor fungicide resistance in Pyrenophora teres f. sp. teres 2 associated with target site modification and inducible overexpression of Cyp51. Front. 3 Microbiol. 7, 1279-1296 (2016). https://doi.org/10.3389/fmicb.2016.01279 4 2 Liu, Z., Ellwood, S. R., Oliver, R. P. & Friesen, T. L. Pyrenophora teres: profile of an 5 increasingly damaging barley pathogen. Mol. Plant Pathol. 12, 1-19 (2011). 6 https://doi.org/10.1111/j.1364-3703.2010.00649.x 7 3 Rehfus, A. et al. Emergence of succinate dehydrogenase inhibitor resistance of Pyrenophora 8 teres in Europe. Pest Manag. Sci. 72, 1977-1988 (2016). https://doi.org/10.1002/ps.4244 9 4 (APVMA), A. P. a. V. M. A. PubCRIS: Public chemical registration information system search, 10 (2016). 11 5 Yoshida, Y. & Aoyama, Y. Interaction of azole antifungal agents with cytochrome P-45014DM 12 purified from Saccharomyces cerevisiae microsomes. Biochemical pharmacology 36, 229-235 13 (1987). 14 6 Lucas, J. A., Hawkins, N. J. & Fraaije, B. A. The evolution of fungicide resistance. Adv. Appl. 15 Microbiol. 90, 29-92 (2015). https://doi.org/10.1016/bs.aambs.2014.09.001 16 7 Jones, L. et al. Adaptive genomic structural variation in the grape powdery mildew pathogen, 17 Erysiphe necator. BMC genomics 15, 1081 (2014). https://doi.org/10.1186/1471-2164-15-18 1081 19 8 Mair, W. J. et al. Emergence of resistance to succinate dehydrogenase inhibitor fungicides in 20 Pyrenophora teres f. teres and P. teres f. maculata in Australia. bioRxiv, 21 2023.2004.2023.537974 (2023). https://doi.org/10.1101/2023.04.23.537974 22 9 Rehfus, A. et al. Emergence of succinate dehydrogenase inhibitor resistance of Pyrenophora 23 teres in Europe. Pest Manag. Sci. 72, 1977-1988 (2016). https://doi.org/10.1002/ps.4244 24 10 Sierotzki, H. et al. Cytochrome b gene sequence and structure of Pyrenophora teres and P. 25 tritici-repentis and implications for QoI resistance. Pest management science 63, 225-233 26 (2007). https://doi.org/10.1002/ps.1330 27 11 Semar, M., Strobel, D., Koch, A., Klappach, K. & Stammler, G. Field efficacy of pyraclostrobin 28 against populations of Pyrenophora teres containing the F129L mutation in the cytochrome 29 b gene. J. Plant. Dis. Prot. 114, 117-119 (2007). 30 12 Sheridan, J. E., Grbavac, N. & Sheridan, M. H. Triadimenol insensitivity in Pyrenophora teres. 31 Transactions of the British Mycological Society 85, 338-341 (1985). 32 https://doi.org/https://doi.org/10.1016/S0007-1536(85)80198-4 33 13 Becher, R., Weihmann, F., Deising, H. B. & Wirsel, S. G. Development of a novel multiplex 34 DNA microarray for Fusarium graminearum and analysis of azole fungicide responses. BMC 35 Genom. 12, 52-69 (2011). https://doi.org/10.1186/1471-2164-12-52 36 14 Hawkins, N. J. et al. Paralog re-emergence: a novel, historically contingent mechanism in the 37 evolution of antimicrobial resistance. Molecular biology and evolution 31, 1793-1802 (2014). 38 https://doi.org/10.1093/molbev/msu134 39 15 Fan, J. et al. Characterization of the sterol 14α-demethylases of Fusarium graminearum 40 identifies a novel genus-specific CYP51 function. New Phytol. 198, 821-835 (2013). 41 https://doi.org/10.1111/nph.12193 42 16 Brunner, P. C., Stefansson, T. S., Fountaine, J., Richina, V. & McDonald, B. A. A Global 43 Analysis of CYP51 Diversity and Azole Sensitivity in Rhynchosporium commune. 44 Phytopathology 106, 355-361 (2016). https://doi.org/10.1094/phyto-07-15-0158-r 45 17 Mair, W. et al. Proposal for a unified nomenclature for target-site mutations associated with 46 resistance to fungicides. Pest management science 72, 1449-1459 (2016). 47 https://doi.org/10.1002/ps.4301 48 18 Oliver, R. P. & Beckerman, J. Fungicides in Practice. (CAB Interational, 2022). 49 19 Cools, H. J. et al. Heterologous expression of mutated eburicol 14alpha-demethylase (CYP51) 50 proteins of Mycosphaerella graminicola to assess effects on azole fungicide sensitivity and 51 .CC-BY-NC 4.0 International licenseperpetuity. It is made available under a preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in The copyright holder for thisthis version posted October 16, 2025. ; https://doi.org/10.1101/2025.10.16.682737doi: bioRxiv preprint 16 intrinsic protein function. Appl. Environ. Microbiol. 76, 2866-2872 (2010). 1 https://doi.org/10.1128/aem.02158-09 2 20 Warrilow, A. G. et al. The Evolution of Azole Resistance in Candida albicans 3 Sterol 14α-Demethylase (CYP51) through Incremental Amino Acid Substitutions. 4 Antimicrobial agents and chemotherapy 63, e02586-02518 (2019). 5 https://doi.org/10.1128/aac.02586-18 6 21 Flowers, S. A., Colón, B., Whaley, S. G., Schuler, M. A. & Rogers, P. D. Contribution of 7 clinically derived mutations in ERG11 to azole resistance in Candida albicans. Antimicrobial 8 agents and chemotherapy 59, 450-460 (2015). https://doi.org/10.1128/aac.03470-14 9 22 Dancer, J., Daniels, A., Cooley, N. & Forster, S. in Septoria on Cereals: A Study of Pathsystems 10 (eds J. A. Lucas, P. Bowyer, & A.M. Anderson) 316-331 (CABI Publishing, 1999). 11 23 Price, C. L. et al. Novel substrate specificity and temperature-sensitive activity of 12 Mycosphaerella graminicola CYP51 supported by the native NADPH cytochrome P450 13 reductase. Appl. Environ. Microbiol. 81, 3379-3386 (2015). 14 https://doi.org/10.1128/aem.03965-14 15 24 Peng, J. et al. A method for the examination of SDHI fungicide resistance mechanisms in 16 phytopathogenic fungi using a heterologous expression system in Sclerotinia sclerotiorum. 17 Phytopathology 0, 0 (2020). https://doi.org/10.1094/phyto-09-20-0421-r 18 25 Oliver, R. P., Friesen, T. L., Faris, J. D. & Solomon, P. S. Stagonospora nodorum: from 19 pathology to genomics and host resistance. Annu. Rev. Phytopathol. 50, 23-43 (2012). 20 https://doi.org/10.1146/annurev-phyto-081211-173019 21 26 Solomon, P. S., Tan, K. C., Sanchez, P., Cooper, R. M. & Oliver, R. P. The disruption of a 22 Galpha subunit sheds new light on the pathogenicity of Stagonospora nodorum on wheat. 23 Mol. Plant-Microbe Interact. 17, 456-466 (2004). 24 https://doi.org/10.1094/mpmi.2004.17.5.456 25 27 Fries, N. Über die bedeutung von wuchsstoffen für das wachstum verschiedener Pilze. 26 Symboo. Botan. Upsalienses 3, 188 (1938). 27 28 Tan, K. C. et al. A signaling-regulated, short-chain dehydrogenase of Stagonospora nodorum 28 regulates asexual development. Eukaryotic Cell 7, 1916-1929 (2008). 29 https://doi.org/10.1128/ec.00237-08 30 29 John, E. et al. Dissecting the role of histidine kinase and HOG1 mitogen-activated protein 31 kinase signalling in stress tolerance and pathogenicity of Parastagonospora nodorum on 32 wheat. Microbiology 162, 1023-1036 (2016). https://doi.org/10.1099/mic.0.000280 33 30 Wang, C., Milgate, A. W., Solomon, P. S. & McDonald, M. C. The identification of a 34 transposon affecting the asexual reproduction of the wheat pathogen Zymoseptoria tritici. 35 Mol. Plant Pathol. 22, 800-816 (2021). https://doi.org/https://doi.org/10.1111/mpp.13064 36 31 Koren, S. et al. Canu: scalable and accurate long-read assembly via adaptive k-mer weighting 37 and repeat separation. Genome Res. 27, 722-736 (2017). 38 https://doi.org/10.1101/gr.215087.116 39 32 Altschul, S. F., Gish, W., Miller, W., Myers, E. W. & Lipman, D. J. Basic local alignment search 40 tool. J. Mol. Biol. 215, 403-410 (1990). https://doi.org/10.1016/s0022-2836(05)80360-2 41 33 Li, W. et al. Malayamycin, a new streptomycete antifungal compound, specifically inhibits 42 sporulation of Stagonospora nodorum (Berk) Castell and Germano, the cause of wheat 43 glume blotch disease. Pest Manag. Sci. 64, 1294-1302 (2008). 44 https://doi.org/10.1002/ps.1632 45 34 Cooley, R. N., van Gorcom, R. F. M., van den Hondel, C. A. M. J. J. & Caten, C. E. Isolation of a 46 benomyl-resistant allele of the β-tubulin gene from Septoria nodorum and its use as a 47 dominant selectable marker. J. Gen. Microbiol. 137, 2085-2091 (1991). 48 35 Mellado, E. et al. Targeted gene disruption of the 14-alpha sterol demethylase (cyp51A) in 49 Aspergillus fumigatus and its role in azole drug susceptibility. Antimicrob. Agents Chemother. 50 49, 2536-2538 (2005). https://doi.org/10.1128/aac.49.6.2536-2538.2005 51 .CC-BY-NC 4.0 International licenseperpetuity. It is made available under a preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in The copyright holder for thisthis version posted October 16, 2025. ; https://doi.org/10.1101/2025.10.16.682737doi: bioRxiv preprint 17 36 Martel, C. M. et al. Complementation of a Saccharomyces cerevisiae ERG11/CYP51 (sterol 1 14alpha-demethylase) doxycycline-regulated mutant and screening of the azole sensitivity of 2 Aspergillus fumigatus isoenzymes CYP51A and CYP51B. Antimicrob Agents Chemother 54, 3 4920-4923 (2010). https://doi.org/10.1128/aac.00349-10 4 37 Garcia-Effron, G. et al. Differences in interactions between azole drugs related to 5 modifications in the 14-alpha sterol demethylase gene (cyp51A) of Aspergillus fumigatus. 6 Antimicrob. Agents Chemother. 49, 2119-2121 (2005). 7 https://doi.org/10.1128/aac.49.5.2119-2121.2005 8 38 Rallos, L. E. E. & Baudoin, A. B. Co-occurrence of two allelic variants of CYP51 in Erysiphe 9 necator and their correlation with over-expression for DMI resistance. PLoS One 11, 10 e0148025 (2016). https://doi.org/10.1371/journal.pone.0148025 11 39 Frenkel, O., Cadle-Davidson, L., Wilcox, W. F. & Milgroom, M. G. Mechanisms of resistance to 12 an azole fungicide in the grapevine powdery mildew fungus, Erysiphe necator. 13 Phytopathology 105, 370-377 (2015). https://doi.org/10.1094/phyto-07-14-0202-r 14 15 .CC-BY-NC 4.0 International licenseperpetuity. It is made available under a preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in The copyright holder for thisthis version posted October 16, 2025. ; https://doi.org/10.1101/2025.10.16.682737doi: bioRxiv preprint 18 Figure Captions 1 Figure 1. Diagram of construct used for replacement of Parastagonospora nodorum Cyp51B with 2 Cyp51A allelic variants from Pyrenophora teres f. teres. Primer codes correspond to primers found 3 in Table 2. 4 5 .CC-BY-NC 4.0 International licenseperpetuity. It is made available under a preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in The copyright holder for thisthis version posted October 16, 2025. ; https://doi.org/10.1101/2025.10.16.682737doi: bioRxiv preprint 19 Figure 2. Growth parameters of transformants. A – Average doubling time and B – amount of 1 spores produced for each transformant. N = 4 biological replicates. Strains listed in Table 1. 2 3 4 .CC-BY-NC 4.0 International licenseperpetuity. It is made available under a preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in The copyright holder for thisthis version posted October 16, 2025. ; https://doi.org/10.1101/2025.10.16.682737doi: bioRxiv preprint 20 Figure 3. EC50 values for all transformants treated with A – epoxiconazole, B – metconazole, C – 1 prochloraz and D – tebuconazole. N = 3 biological replicates per transformant. Letters signify 2 statistical significance p < 0.05 (Tukey). Strains listed in Table 1. 3 4 5 .CC-BY-NC 4.0 International licenseperpetuity. It is made available under a preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in The copyright holder for thisthis version posted October 16, 2025. ; https://doi.org/10.1101/2025.10.16.682737doi: bioRxiv preprint 21 Figure 4. Detached leaf assays of spore suspensions of each transformant on wheat (Triticum 1 aestivum, var. Wyalkatchem). Leaves either dipped in Folicur® (430 g L⁻¹ tebuconazole) or water 2 (untreated). Photos taken at 14 days past inoculation. 3 4 5 .CC-BY-NC 4.0 International licenseperpetuity. It is made available under a preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in The copyright holder for thisthis version posted October 16, 2025. ; https://doi.org/10.1101/2025.10.16.682737doi: bioRxiv preprint 22 Figure 5. Gene expression analysis of A – Cyp51A from Pyrenophora teres f. teres and B – the 1 endogenous Cyp51B from Parastagonospora nodorum by qPCR of each transformant either grown 2 in media supplemented with ethanol only (0) or with an EC50 relevant to the respective alleles. 3 Mean relative gene expression calculated by 2-ΔCT normalized to Actin. Asterisks signify statistical 4 significance p < 0.05 (Tukey) 5 6 .CC-BY-NC 4.0 International licenseperpetuity. It is made available under a preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in The copyright holder for thisthis version posted October 16, 2025. ; https://doi.org/10.1101/2025.10.16.682737doi: bioRxiv preprint 23 Tables 1 Table 1: Strains used in this study. 2 Strain Description Source SN15 Wild type Parastagonospora nodorum DPIRDa SN15 PEG Wild type P. nodorum put through transformation process with no DNA This study PnCyp51B::PtKO103A1 P. nodorum SN15 Cyp51B replaced with Ptt Cyp51 Ko103A1 allele This study PnCyp51B::Pt9193A1 P. nodorum SN15 Cyp51B replaced with Ptt Cyp51 9193A1 allele This study PnCyp51B::PtW1A1 P. nodorum SN15 Cyp51B replaced with Ptt Cyp51 W1A1 allele This study PnCyp51B::Pt9193A2E P. nodorum SN15 with ectopic integration of Ptt Cyp51 9193A2 allele This study PnCyp51B::PtW1A2E P. nodorum SN15 with ectopic integration of Ptt Cyp51 W1A2 allele This study PnCyp51B::PtKO103A1E P. nodorum SN15 with ectopic integration of Ptt Cyp51 Ko103A1 allele This study PnCyp51B::Pt9193A1E P. nodorum SN15 with ectopic integration of Ptt Cyp51 9193A1 allele This study PnCyp51B::PtW1A1E P. nodorum SN15 with ectopic integration of Ptt Cyp51 W1A1 allele This study a Department of Primary Industries and Regional Development, Western Australia 3 4 .CC-BY-NC 4.0 International licenseperpetuity. It is made available under a preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in The copyright holder for thisthis version posted October 16, 2025. ; https://doi.org/10.1101/2025.10.16.682737doi: bioRxiv preprint 24 Table 2: Primers used in this study. 1 Primer Name Code Description Sequence PttCYP_F Amplification of Cyp51A from Ptt for Gibson assembly tcgatctctgttcaagaATGCTCTCCCTCCTCTTCCTCC PttCYP_R Amplification of Cyp51A from Ptt for Gibson assembly gaatctttttattgtcagtTTACCGCCTCTCCCAGCAAATC TGH3FpUC5F_F Amplification of TEF/G3P/HYG/3'Flank/pUC18/5'Flank for Gibson assembly ACTGACAATAAAAAGATTCTTGTTTTC TGH3FpUC5F_R Amplification of TEF/G3P/HYG/3'Flank/pUC18/5'Flank for Gibson assembly TCTTGAACAGAGATCGAACGAAGG Flank_F F1 Amplification of 5’flank to 3’flank region used for transformation GGGACTCTGTTGGCGATCC Flank_R F2 Amplification of 5’flank to 3’flank region used for transformation CCCCAACACATCCACAACCTCA CYP51_internal I1 Amplification of region spanning P. nodorum genomic DNA and construct to verify correct insertion location GAATCTTTTTATTGTCAGTTTACCGCCTCTCCCAGCAAATC Hyg_internal_F I2F Amplification of region spanning P. nodorum genomic DNA and construct to verify correct insertion location CTGTGTAGAAGTACTCGCCG Hyg_internal_R I2R Amplification of region spanning P. nodorum genomic DNA and construct to verify correct insertion location AGAAGATTCTGCCACCAGGC SN15_genomic_F G1 Amplification of region spanning P. nodorum genomic DNA and construct to verify correct insert size and location CGAGAATTCAAATCACCGAAGATACA SN15_genomic_R G2 Amplification of region spanning P. nodorum genomic DNA and construct to verify correct insert size and location GTGCCCCTCAGATTATCATAA PttCypSeq_F S1 Sequence verification of Ptt Cyp51A fragment after transformation CCTACAACATTGTGGTCACGCTTC PttCypSeq_R S2 Sequence verification of Ptt Cyp51A fragment after transformation CATCTGGGCAGATGATGTCGAGG PnCYP51B_qPCR_F Forward primer for RT-qPCR of native PnCyp51B TCCCACTCTCTTCAGGGTAAG PnCYP51B_qPCR_R Reverse primer for RT-qPCR of native PnCyp51B CATGAAGTTGACGGGAGAGAAG PttCYP51A_qPCR_F Forward primer for RT-qPCR of Cyp51A CGTGTACGACTGTCCCAATT PttCYP51A_qPCR_R Reverse primer for RT-qPCR of Cyp51A TGCTCAATCAGTCGTACGTG PnActin_qPCR_F Forward primer for qPCR of Actin from P. nodorum AGTCGAAGCGTGGTATCCT PnActin_qPCR_R Reverse primer for qPCR of Actin from P. nodorum ACTTGGGGTTGATGGGAG CN_F1 Forward primer 1 for copy number qPCR of Cyp51A alleles CGAAGGAGAATGTGAAGCCA CN_R1 Reverse primer 1 for copy number qPCR of Cyp51A alleles CGCTCTACCTACTTCGGAGA CN_F2 Forward primer 2 for copy number qPCR of Cyp51A alleles GGTTGACGGCAATTTCGATG CN_R2 Reverse primer 2 for copy number qPCR of Cyp51A alleles TCCACTATCGGCGAGTACTT 2 3 .CC-BY-NC 4.0 International licenseperpetuity. It is made available under a preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in The copyright holder for thisthis version posted October 16, 2025. ; https://doi.org/10.1101/2025.10.16.682737doi: bioRxiv preprint 25 Table 3: EC50 and resistance factor values of each transformant treated with epoxiconazole, 1 metconazole, prochloraz and tebuconazole. EC50 values ± standard error of the mean. 2 Epoxiconazole Metconazole Prochloraz Tebuconazole Transformant EC50 RF EC50 RF EC50 RF EC50 RF PnCyp51B::PtKO103A1-1 1.16±0.03 0.85 9.63±1.56 9.53 2.98±0.10 11.46 24.94±1.19 14.01 PnCyp51B::PtKO103A1-2 1.09±0.17 0.80 8.54±2.25 8.46 3.43±0.33 13.19 22.07±4.05 12.40 PnCyp51B::PtKO103A1E 0.06±0.03 0.04 0.13±0.03 0.13 0.10±0.03 0.38 0.37±0.04 0.21 PnCyp51B::Pt9193A1-1 1.80±0.09 1.23±0.27 0.42±0.01 2.98±0.33 PnCyp51B::Pt9193A1-2 1.44±0.17 0.83±0.37 0.28±0.02 2.26±0.30 PnCyp51B::Pt9193A1E 0.07±0.01 0.13±0.03 0.06±0.05 0.17±0.01 PnCyp51B::PtW1A1-1 1.18±0.23 1.12±0.30 0.26±0.05 1.72±.029 PnCyp51B::PtW1A1-2 1.08±0.09 0.84±0.04 0.15±0.02 1.28±0.26 PnCyp51B::PtW1A1E 0.60±0.04 0.65±0.06 0.17±0.06 0.98±0.18 PnCyp51B::Pt9193A2E 0.06±0.01 0.04±0.01 0.01±0.00 0.15±0.01 PnCyp51B::PtW1A2E 0.04±0.01 0.04±0.01 0.04±0.01 0.13±0.02 SN15 PEG 0.06±0.01 0.11±0.05 0.04±0.00 0.21±0.05 SN15 0.05±0.00 0.12±0.04 0.03±0.01 0.22±0.04 3 4 .CC-BY-NC 4.0 International licenseperpetuity. It is made available under a preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in The copyright holder for thisthis version posted October 16, 2025. ; https://doi.org/10.1101/2025.10.16.682737doi: bioRxiv preprint 26 Supplementary Information 1 Supplementary Figures 2 Supplementary Figure S1. Amino acid alignment of 5 Pyrenophora teres f. teres allelic variants of 3 Cyp51A. Amino acid variations are shaded in grey or white. 4 5 6 .CC-BY-NC 4.0 International licenseperpetuity. It is made available under a preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in The copyright holder for thisthis version posted October 16, 2025. ; https://doi.org/10.1101/2025.10.16.682737doi: bioRxiv preprint 27 Supplementary Figure S2. Nucleic acid alignment of Pyrenophora teres f. teres Cyp51-A1 alleles. 1 Nucleic acid differences are shaded in grey or white. 2 3 .CC-BY-NC 4.0 International licenseperpetuity. It is made available under a preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in The copyright holder for thisthis version posted October 16, 2025. ; https://doi.org/10.1101/2025.10.16.682737doi: bioRxiv preprint